>Feature sequence001 4522 965 gene locus_tag LOCUS_00010 gene recC 4522 965 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF44 protein_id gnl|my_center|LOCUS_00010 5530 6129 gene locus_tag LOCUS_00020 5530 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6141 8000 gene locus_tag LOCUS_00030 gene pcoA 6141 8000 CDS product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925242.1 protein_id gnl|my_center|LOCUS_00030 8063 8791 gene locus_tag LOCUS_00040 8063 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8950 9348 gene locus_tag LOCUS_00050 8950 9348 CDS product copper-resistance exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530770.1 protein_id gnl|my_center|LOCUS_00050 9326 10324 gene locus_tag LOCUS_00060 9326 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12400 10394 gene locus_tag LOCUS_00070 12400 10394 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072203.1 protein_id gnl|my_center|LOCUS_00070 13170 12397 gene locus_tag LOCUS_00080 13170 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 14322 13411 gene locus_tag LOCUS_00090 14322 13411 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072205.1 protein_id gnl|my_center|LOCUS_00090 15184 14417 gene locus_tag LOCUS_00100 15184 14417 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 protein_id gnl|my_center|LOCUS_00100 17427 15433 gene locus_tag LOCUS_00110 gene sltY 17427 15433 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072113.1 protein_id gnl|my_center|LOCUS_00110 19350 17809 gene locus_tag LOCUS_00120 gene rmuC 19350 17809 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 protein_id gnl|my_center|LOCUS_00120 19601 20623 gene locus_tag LOCUS_00130 gene yedY 19601 20623 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD9 protein_id gnl|my_center|LOCUS_00130 20688 21320 gene locus_tag LOCUS_00140 gene yedZ 20688 21320 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD8 protein_id gnl|my_center|LOCUS_00140 21976 21653 gene locus_tag LOCUS_00150 21976 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072521.1 protein_id gnl|my_center|LOCUS_00150 22668 24494 gene locus_tag LOCUS_00160 gene asmA 22668 24494 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 protein_id gnl|my_center|LOCUS_00160 24494 25087 gene locus_tag LOCUS_00170 24494 25087 CDS product proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072518.1 protein_id gnl|my_center|LOCUS_00170 26698 25151 gene locus_tag LOCUS_00180 26698 25151 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_00180 27594 26785 gene locus_tag LOCUS_00190 gene gloB 27594 26785 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE27 protein_id gnl|my_center|LOCUS_00190 27768 28508 gene locus_tag LOCUS_00200 27768 28508 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 protein_id gnl|my_center|LOCUS_00200 28519 29415 gene locus_tag LOCUS_00210 28519 29415 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072514.1 protein_id gnl|my_center|LOCUS_00210 29819 29430 gene locus_tag LOCUS_00220 gene rnhA 29819 29430 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE30 protein_id gnl|my_center|LOCUS_00220 29962 30690 gene locus_tag LOCUS_00230 gene dnaQ 29962 30690 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072512.1 protein_id gnl|my_center|LOCUS_00230 30876 32165 gene locus_tag LOCUS_00240 30876 32165 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072511.1 protein_id gnl|my_center|LOCUS_00240 32297 32373 gene locus_tag LOCUS_t00010 32297 32373 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 32443 32519 gene locus_tag LOCUS_t00020 32443 32519 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 35460 33013 gene locus_tag LOCUS_00250 gene fadE2 35460 33013 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072493.1 protein_id gnl|my_center|LOCUS_00250 35708 36487 gene locus_tag LOCUS_00260 35708 36487 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072492.1 protein_id gnl|my_center|LOCUS_00260 37294 36536 gene locus_tag LOCUS_00270 37294 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072491.1 protein_id gnl|my_center|LOCUS_00270 37652 37431 gene locus_tag LOCUS_00280 37652 37431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 39694 37973 gene locus_tag LOCUS_00290 39694 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39877 40368 gene locus_tag LOCUS_00300 gene def3 39877 40368 CDS product peptide deformylase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE60 protein_id gnl|my_center|LOCUS_00300 41750 40365 gene locus_tag LOCUS_00310 41750 40365 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106224.1 protein_id gnl|my_center|LOCUS_00310 41928 42476 gene locus_tag LOCUS_00320 41928 42476 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990418.1 protein_id gnl|my_center|LOCUS_00320 43185 42505 gene locus_tag LOCUS_00330 gene yqfA 43185 42505 CDS product channel protein hemolysin III family subfamily YqfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 protein_id gnl|my_center|LOCUS_00330 43409 43912 gene locus_tag LOCUS_00340 43409 43912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 43937 44161 gene locus_tag LOCUS_00350 43937 44161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 44751 46727 gene locus_tag LOCUS_00360 gene thiC 44751 46727 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EED7 protein_id gnl|my_center|LOCUS_00360 46732 48309 gene locus_tag LOCUS_00370 gene thiDE 46732 48309 CDS product bifunctional hydroxy-(phospho)methylpyrimidine kinase/thiamine-phosphate pyrophosphorylase ThiDE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072420.1 protein_id gnl|my_center|LOCUS_00370 48296 49114 gene locus_tag LOCUS_00380 gene thiF 48296 49114 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072419.1 protein_id gnl|my_center|LOCUS_00380 49111 49353 gene locus_tag LOCUS_00390 gene thiS 49111 49353 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704416.1 protein_id gnl|my_center|LOCUS_00390 49355 50125 gene locus_tag LOCUS_00400 gene thiG 49355 50125 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE1 protein_id gnl|my_center|LOCUS_00400 50144 51259 gene locus_tag LOCUS_00410 gene thiH 50144 51259 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072416.1 protein_id gnl|my_center|LOCUS_00410 51337 51594 gene locus_tag LOCUS_00420 51337 51594 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072415.1 protein_id gnl|my_center|LOCUS_00420 >Feature sequence002 11 1366 gene locus_tag LOCUS_00430 gene gor 11 1366 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074290.1 protein_id gnl|my_center|LOCUS_00430 1579 2070 gene locus_tag LOCUS_00440 1579 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2183 3139 gene locus_tag LOCUS_00450 2183 3139 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8F7 protein_id gnl|my_center|LOCUS_00450 4198 3557 gene locus_tag LOCUS_00460 4198 3557 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_00460 5457 4279 gene locus_tag LOCUS_00470 5457 4279 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074297.1 protein_id gnl|my_center|LOCUS_00470 5888 7246 gene locus_tag LOCUS_00480 gene menF 5888 7246 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074299.1 protein_id gnl|my_center|LOCUS_00480 7470 8126 gene locus_tag LOCUS_00490 7470 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 protein_id gnl|my_center|LOCUS_00490 10833 8716 gene locus_tag LOCUS_00500 10833 8716 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 protein_id gnl|my_center|LOCUS_00500 12217 10835 gene locus_tag LOCUS_00510 12217 10835 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_00510 12489 13301 gene locus_tag LOCUS_00520 gene tupA 12489 13301 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074305.1 protein_id gnl|my_center|LOCUS_00520 13396 14103 gene locus_tag LOCUS_00530 gene tupB 13396 14103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074306.1 protein_id gnl|my_center|LOCUS_00530 14107 14826 gene locus_tag LOCUS_00540 gene tupC 14107 14826 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 protein_id gnl|my_center|LOCUS_00540 14810 15418 gene locus_tag LOCUS_00550 gene mobA 14810 15418 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 protein_id gnl|my_center|LOCUS_00550 15415 17214 gene locus_tag LOCUS_00560 gene mobB/moeA 15415 17214 CDS product bifunctional molybdopterin-guanine dinucleotide biosynthesis protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074309.1 protein_id gnl|my_center|LOCUS_00560 17282 17437 gene locus_tag LOCUS_00570 17282 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 17517 18005 gene locus_tag LOCUS_00580 gene mutM 17517 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074311.1 protein_id gnl|my_center|LOCUS_00580 18050 18865 gene locus_tag LOCUS_00590 gene mutM 18050 18865 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D9 protein_id gnl|my_center|LOCUS_00590 20512 19019 gene locus_tag LOCUS_00600 20512 19019 CDS product outer membrane protein in capsule/EPS biosynthesis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 protein_id gnl|my_center|LOCUS_00600 20999 20520 gene locus_tag LOCUS_00610 gene coaD 20999 20520 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_00610 22432 21002 gene locus_tag LOCUS_00620 gene hldE 22432 21002 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ2 protein_id gnl|my_center|LOCUS_00620 22905 23825 gene locus_tag LOCUS_00630 22905 23825 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44011 protein_id gnl|my_center|LOCUS_00630 23862 24848 gene locus_tag LOCUS_00640 gene hldD 23862 24848 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV3 protein_id gnl|my_center|LOCUS_00640 25918 24905 gene locus_tag LOCUS_00650 25918 24905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 26327 27844 gene locus_tag LOCUS_00660 gene asnB 26327 27844 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964098.1 protein_id gnl|my_center|LOCUS_00660 27841 28254 gene locus_tag LOCUS_00670 27841 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 28508 29623 gene locus_tag LOCUS_00680 28508 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 30822 29749 gene locus_tag LOCUS_00690 30822 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 32053 31001 gene locus_tag LOCUS_00700 gene waaC 32053 31001 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_00700 32238 32783 gene locus_tag LOCUS_00710 32238 32783 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009344923.1 protein_id gnl|my_center|LOCUS_00710 32786 33859 gene locus_tag LOCUS_00720 32786 33859 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP17 protein_id gnl|my_center|LOCUS_00720 33856 34722 gene locus_tag LOCUS_00730 gene rfbD 33856 34722 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_00730 34805 35587 gene locus_tag LOCUS_00740 gene kdkA 34805 35587 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I7 protein_id gnl|my_center|LOCUS_00740 37112 35826 gene locus_tag LOCUS_00750 gene kdtA 37112 35826 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074267.1 protein_id gnl|my_center|LOCUS_00750 37406 38062 gene locus_tag LOCUS_00760 37406 38062 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence003 178 843 gene locus_tag LOCUS_00770 gene minC 178 843 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE14 protein_id gnl|my_center|LOCUS_00770 872 1681 gene locus_tag LOCUS_00780 gene minD 872 1681 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE13 protein_id gnl|my_center|LOCUS_00780 1684 1941 gene locus_tag LOCUS_00790 gene minE 1684 1941 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE12 protein_id gnl|my_center|LOCUS_00790 3147 2029 gene locus_tag LOCUS_00800 gene rnd 3147 2029 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE10 protein_id gnl|my_center|LOCUS_00800 4896 3223 gene locus_tag LOCUS_00810 gene fadD 4896 3223 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 protein_id gnl|my_center|LOCUS_00810 5966 5082 gene locus_tag LOCUS_00820 5966 5082 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072531.1 protein_id gnl|my_center|LOCUS_00820 6858 6040 gene locus_tag LOCUS_00830 6858 6040 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_00830 7741 7034 gene locus_tag LOCUS_00840 7741 7034 CDS product membrane zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 protein_id gnl|my_center|LOCUS_00840 8117 7734 gene locus_tag LOCUS_00850 8117 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 8921 8202 gene locus_tag LOCUS_00860 gene yeaZ 8921 8202 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 protein_id gnl|my_center|LOCUS_00860 9816 9088 gene locus_tag LOCUS_00870 9816 9088 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_00870 11001 9829 gene locus_tag LOCUS_00880 11001 9829 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_00880 12516 11074 gene locus_tag LOCUS_00890 12516 11074 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_00890 13981 12602 gene locus_tag LOCUS_00900 13981 12602 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_00900 15585 14128 gene locus_tag LOCUS_00910 15585 14128 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_00910 16768 15791 gene locus_tag LOCUS_00920 16768 15791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 protein_id gnl|my_center|LOCUS_00920 16701 16955 gene locus_tag LOCUS_00930 16701 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17199 17543 gene locus_tag LOCUS_00940 17199 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 18961 17633 gene locus_tag LOCUS_00950 18961 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 19553 18954 gene locus_tag LOCUS_00960 gene cheB2 19553 18954 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_00960 20379 19546 gene locus_tag LOCUS_00970 gene cheR 20379 19546 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_00970 25477 20402 gene locus_tag LOCUS_00980 25477 20402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 27664 25739 gene locus_tag LOCUS_00990 27664 25739 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072146.1 protein_id gnl|my_center|LOCUS_00990 28210 29109 gene locus_tag LOCUS_01000 gene hisG 28210 29109 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB0 protein_id gnl|my_center|LOCUS_01000 29118 30422 gene locus_tag LOCUS_01010 gene hisD 29118 30422 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB1 protein_id gnl|my_center|LOCUS_01010 30419 31513 gene locus_tag LOCUS_01020 gene hisC 30419 31513 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB2 protein_id gnl|my_center|LOCUS_01020 31611 32678 gene locus_tag LOCUS_01030 gene hisB 31611 32678 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB3 protein_id gnl|my_center|LOCUS_01030 32675 33394 gene locus_tag LOCUS_01040 gene hisH 32675 33394 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB4 protein_id gnl|my_center|LOCUS_01040 33391 34194 gene locus_tag LOCUS_01050 gene hisA 33391 34194 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB5 protein_id gnl|my_center|LOCUS_01050 34184 34957 gene locus_tag LOCUS_01060 gene hisF 34184 34957 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX42 protein_id gnl|my_center|LOCUS_01060 35050 35685 gene locus_tag LOCUS_01070 gene hisI 35050 35685 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB6 protein_id gnl|my_center|LOCUS_01070 35980 36609 gene locus_tag LOCUS_01080 35980 36609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence004 1513 86 gene locus_tag LOCUS_01090 1513 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873771.1 protein_id gnl|my_center|LOCUS_01090 3971 1518 gene locus_tag LOCUS_01100 3971 1518 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705552.1 protein_id gnl|my_center|LOCUS_01100 6174 3979 gene locus_tag LOCUS_01110 6174 3979 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705554.1 protein_id gnl|my_center|LOCUS_01110 6325 6852 gene locus_tag LOCUS_01120 6325 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_01120 6849 7211 gene locus_tag LOCUS_01130 6849 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_01130 7228 11187 gene locus_tag LOCUS_01140 7228 11187 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_01140 12438 11365 gene locus_tag LOCUS_01150 12438 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 15461 12597 gene locus_tag LOCUS_01160 15461 12597 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265674.1 protein_id gnl|my_center|LOCUS_01160 16005 16880 gene locus_tag LOCUS_01170 16005 16880 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_01170 17787 16963 gene locus_tag LOCUS_01180 17787 16963 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157438.1 protein_id gnl|my_center|LOCUS_01180 18924 17938 gene locus_tag LOCUS_01190 gene idhA 18924 17938 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919173.1 protein_id gnl|my_center|LOCUS_01190 19320 21236 gene locus_tag LOCUS_01200 gene iolC 19320 21236 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 protein_id gnl|my_center|LOCUS_01200 21250 23109 gene locus_tag LOCUS_01210 gene iolD 21250 23109 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919176.1 protein_id gnl|my_center|LOCUS_01210 23125 24024 gene locus_tag LOCUS_01220 gene iolE 23125 24024 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_01220 24090 25592 gene locus_tag LOCUS_01230 gene mmsA-1 24090 25592 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_01230 25908 26090 gene locus_tag LOCUS_01240 25908 26090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 29029 26369 gene locus_tag LOCUS_01250 29029 26369 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649004.1 protein_id gnl|my_center|LOCUS_01250 31034 29112 gene locus_tag LOCUS_01260 31034 29112 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 protein_id gnl|my_center|LOCUS_01260 32296 31208 gene locus_tag LOCUS_01270 32296 31208 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722978.1 protein_id gnl|my_center|LOCUS_01270 32648 32334 gene locus_tag LOCUS_01280 gene frwB 32648 32334 CDS product PTS system fructose-like EIIB component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69818 protein_id gnl|my_center|LOCUS_01280 33901 32714 gene locus_tag LOCUS_01290 33901 32714 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR20 protein_id gnl|my_center|LOCUS_01290 >Feature sequence005 <1 1053 gene locus_tag LOCUS_01300 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005680409.1:peptidase M75 1201 2823 gene locus_tag LOCUS_01310 1201 2823 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842701.1 protein_id gnl|my_center|LOCUS_01310 3102 3629 gene locus_tag LOCUS_01320 gene hemG 3102 3629 CDS product oxygen-independent protoporphyrinogen oxidase HemG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 protein_id gnl|my_center|LOCUS_01320 3669 4202 gene locus_tag LOCUS_01330 3669 4202 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073508.1 protein_id gnl|my_center|LOCUS_01330 4911 4264 gene locus_tag LOCUS_01340 4911 4264 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073507.1 protein_id gnl|my_center|LOCUS_01340 5691 7325 gene locus_tag LOCUS_01350 5691 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7450 7896 gene locus_tag LOCUS_01360 7450 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 9185 8217 gene locus_tag LOCUS_01370 9185 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 9436 10533 gene locus_tag LOCUS_01380 9436 10533 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071380.1 protein_id gnl|my_center|LOCUS_01380 10809 11960 gene locus_tag LOCUS_01390 10809 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477374.1 protein_id gnl|my_center|LOCUS_01390 12192 13064 gene locus_tag LOCUS_01400 12192 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071385.1 protein_id gnl|my_center|LOCUS_01400 13379 13591 gene locus_tag LOCUS_01410 13379 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 13804 14292 gene locus_tag LOCUS_01420 13804 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14331 14795 gene locus_tag LOCUS_01430 14331 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 15797 14850 gene locus_tag LOCUS_01440 gene pagO 15797 14850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_01440 16483 16274 gene locus_tag LOCUS_01450 gene arfA 16483 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073782.1 protein_id gnl|my_center|LOCUS_01450 16995 16816 gene locus_tag LOCUS_01460 16995 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 17522 19132 gene locus_tag LOCUS_01470 17522 19132 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_01470 19275 19637 gene locus_tag LOCUS_01480 19275 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 19781 19632 gene locus_tag LOCUS_01490 19781 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 20934 20338 gene locus_tag LOCUS_01500 20934 20338 CDS product cyclic nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071750.1 protein_id gnl|my_center|LOCUS_01500 21272 22450 gene locus_tag LOCUS_01510 21272 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881437.1 protein_id gnl|my_center|LOCUS_01510 23391 22687 gene locus_tag LOCUS_01520 gene hutC 23391 22687 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263318.1 protein_id gnl|my_center|LOCUS_01520 23840 26515 gene locus_tag LOCUS_01530 23840 26515 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 protein_id gnl|my_center|LOCUS_01530 26723 27466 gene locus_tag LOCUS_01540 26723 27466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 27466 29322 gene locus_tag LOCUS_01550 27466 29322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 30715 30921 gene locus_tag LOCUS_01560 30715 30921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence006 103 573 gene locus_tag LOCUS_01570 gene holC 103 573 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073281.1 protein_id gnl|my_center|LOCUS_01570 589 3504 gene locus_tag LOCUS_01580 gene valS 589 3504 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS5 protein_id gnl|my_center|LOCUS_01580 4787 3624 gene locus_tag LOCUS_01590 gene pflA 4787 3624 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_01590 6595 4862 gene locus_tag LOCUS_01600 6595 4862 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671333.1 protein_id gnl|my_center|LOCUS_01600 6980 6765 gene locus_tag LOCUS_01610 6980 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 7037 7849 gene locus_tag LOCUS_01620 7037 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01620 7827 8435 gene locus_tag LOCUS_01630 7827 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 8555 11521 gene locus_tag LOCUS_01640 8555 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481876.1 protein_id gnl|my_center|LOCUS_01640 11903 13438 gene locus_tag LOCUS_01650 11903 13438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_01650 14454 13744 gene locus_tag LOCUS_01660 14454 13744 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_01660 15099 14458 gene locus_tag LOCUS_01670 gene azrR 15099 14458 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073404.1 protein_id gnl|my_center|LOCUS_01670 15593 16018 gene locus_tag LOCUS_01680 15593 16018 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_01680 16358 16110 gene locus_tag LOCUS_01690 16358 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 17115 16729 gene locus_tag LOCUS_01700 17115 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 17331 17125 gene locus_tag LOCUS_01710 17331 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 17651 17325 gene locus_tag LOCUS_01720 gene arsR 17651 17325 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 protein_id gnl|my_center|LOCUS_01720 17823 18299 gene locus_tag LOCUS_01730 17823 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073407.1 protein_id gnl|my_center|LOCUS_01730 18841 18329 gene locus_tag LOCUS_01740 18841 18329 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707675.1 protein_id gnl|my_center|LOCUS_01740 20061 18943 gene locus_tag LOCUS_01750 20061 18943 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_01750 22306 20063 gene locus_tag LOCUS_01760 22306 20063 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 protein_id gnl|my_center|LOCUS_01760 23549 22374 gene locus_tag LOCUS_01770 23549 22374 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_01770 23714 24553 gene locus_tag LOCUS_01780 23714 24553 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085861.1 protein_id gnl|my_center|LOCUS_01780 24775 25656 gene locus_tag LOCUS_01790 gene mipA 24775 25656 CDS product outer membrane MltA-interaction protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_01790 25662 26084 gene locus_tag LOCUS_01800 25662 26084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 26084 26797 gene locus_tag LOCUS_01810 gene rstA 26084 26797 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 protein_id gnl|my_center|LOCUS_01810 26837 28117 gene locus_tag LOCUS_01820 gene rstB 26837 28117 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073413.1 protein_id gnl|my_center|LOCUS_01820 28439 28128 gene locus_tag LOCUS_01830 28439 28128 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073414.1 protein_id gnl|my_center|LOCUS_01830 28622 29161 gene locus_tag LOCUS_01840 28622 29161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073415.1 protein_id gnl|my_center|LOCUS_01840 30427 29291 gene locus_tag LOCUS_01850 gene yiaV 30427 29291 CDS product MFP transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 protein_id gnl|my_center|LOCUS_01850 30818 30429 gene locus_tag LOCUS_01860 30818 30429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706438.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence007 664 2046 gene locus_tag LOCUS_01870 gene glmU 664 2046 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C2 protein_id gnl|my_center|LOCUS_01870 2309 4468 gene locus_tag LOCUS_01880 2309 4468 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074327.1 protein_id gnl|my_center|LOCUS_01880 4672 5442 gene locus_tag LOCUS_01890 gene glmR 4672 5442 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074326.1 protein_id gnl|my_center|LOCUS_01890 5486 7315 gene locus_tag LOCUS_01900 gene glmS 5486 7315 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX33 protein_id gnl|my_center|LOCUS_01900 9420 8035 gene locus_tag LOCUS_01910 gene manB 9420 8035 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 protein_id gnl|my_center|LOCUS_01910 9604 12366 gene locus_tag LOCUS_01920 9604 12366 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919015.1 protein_id gnl|my_center|LOCUS_01920 12455 13660 gene locus_tag LOCUS_01930 gene manA 12455 13660 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI72 protein_id gnl|my_center|LOCUS_01930 15058 13745 gene locus_tag LOCUS_01940 15058 13745 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_01940 15394 15191 gene locus_tag LOCUS_01950 15394 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 16860 15751 gene locus_tag LOCUS_01960 gene mtlK 16860 15751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210202.1 protein_id gnl|my_center|LOCUS_01960 17933 16878 gene locus_tag LOCUS_01970 17933 16878 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210200.1 protein_id gnl|my_center|LOCUS_01970 18237 19544 gene locus_tag LOCUS_01980 18237 19544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210193.1 protein_id gnl|my_center|LOCUS_01980 19546 20826 gene locus_tag LOCUS_01990 19546 20826 CDS product solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210199.1 protein_id gnl|my_center|LOCUS_01990 20814 21704 gene locus_tag LOCUS_02000 20814 21704 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210198.1 protein_id gnl|my_center|LOCUS_02000 21705 22538 gene locus_tag LOCUS_02010 21705 22538 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210197.1 protein_id gnl|my_center|LOCUS_02010 22548 24152 gene locus_tag LOCUS_02020 22548 24152 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989597.1 protein_id gnl|my_center|LOCUS_02020 24168 25235 gene locus_tag LOCUS_02030 24168 25235 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_02030 25286 26206 gene locus_tag LOCUS_02040 25286 26206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213840.1 protein_id gnl|my_center|LOCUS_02040 26255 26500 gene locus_tag LOCUS_02050 26255 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 26980 26678 gene locus_tag LOCUS_02060 26980 26678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 27328 27086 gene locus_tag LOCUS_02070 27328 27086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 28446 27541 gene locus_tag LOCUS_02080 gene menB 28446 27541 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C7 protein_id gnl|my_center|LOCUS_02080 28895 28578 gene locus_tag LOCUS_02090 28895 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 29019 30449 gene locus_tag LOCUS_02100 gene ccoG 29019 30449 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence008 266 511 gene locus_tag LOCUS_02110 266 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 1000 566 gene locus_tag LOCUS_02120 1000 566 CDS product periplasmic L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_02120 1097 1666 gene locus_tag LOCUS_02130 1097 1666 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_02130 2336 1707 gene locus_tag LOCUS_02140 2336 1707 CDS product type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464499.1 protein_id gnl|my_center|LOCUS_02140 3732 2986 gene locus_tag LOCUS_02150 3732 2986 CDS product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477718.1 protein_id gnl|my_center|LOCUS_02150 4079 3735 gene locus_tag LOCUS_02160 4079 3735 CDS product EscI/YscI/HrpB family type III secretion system inner rod protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464519.1 protein_id gnl|my_center|LOCUS_02160 4701 4090 gene locus_tag LOCUS_02170 4701 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5048 4701 gene locus_tag LOCUS_02180 5048 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 5328 5059 gene locus_tag LOCUS_02190 5328 5059 CDS product EscF/YscF/HrpA family type III secretion system needle major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464566.1 protein_id gnl|my_center|LOCUS_02190 5575 5351 gene locus_tag LOCUS_02200 5575 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6848 5520 gene locus_tag LOCUS_02210 6848 5520 CDS product EscD/YscD/HrpQ family type III secretion system inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477850.1 protein_id gnl|my_center|LOCUS_02210 8702 6858 gene locus_tag LOCUS_02220 8702 6858 CDS product EscC/YscC/HrcC family type III secretion system outer membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105906.1 protein_id gnl|my_center|LOCUS_02220 9142 8702 gene locus_tag LOCUS_02230 9142 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10089 9139 gene locus_tag LOCUS_02240 10089 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 11028 10168 gene locus_tag LOCUS_02250 11028 10168 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464548.1 protein_id gnl|my_center|LOCUS_02250 12475 12023 gene locus_tag LOCUS_02260 12475 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12649 13101 gene locus_tag LOCUS_02270 12649 13101 CDS product exoenzyme S synthesis protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464682.1 protein_id gnl|my_center|LOCUS_02270 13104 13391 gene locus_tag LOCUS_02280 13104 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15225 14209 gene locus_tag LOCUS_02290 15225 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 16512 15235 gene locus_tag LOCUS_02300 16512 15235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 16997 16512 gene locus_tag LOCUS_02310 gene pcrH 16997 16512 CDS product CesD/SycD/LcrH family type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113548.1 protein_id gnl|my_center|LOCUS_02310 17965 17006 gene locus_tag LOCUS_02320 17965 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 18286 17981 gene locus_tag LOCUS_02330 18286 17981 CDS product type III secretion protein LcrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464408.1 protein_id gnl|my_center|LOCUS_02330 18786 18373 gene locus_tag LOCUS_02340 18786 18373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 20897 18783 gene locus_tag LOCUS_02350 20897 18783 CDS product EscV/YscV/HrcV family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105897.1 protein_id gnl|my_center|LOCUS_02350 21259 20894 gene locus_tag LOCUS_02360 21259 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 21638 21261 gene locus_tag LOCUS_02370 gene yscX 21638 21261 CDS product Yop proteins translocation protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU78 protein_id gnl|my_center|LOCUS_02370 22006 21635 gene locus_tag LOCUS_02380 22006 21635 CDS product type III secretion chaperone SycN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477854.1 protein_id gnl|my_center|LOCUS_02380 22271 21993 gene locus_tag LOCUS_02390 22271 21993 CDS product SepL/TyeA/HrpJ family type III secretion system gatekeeper inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464474.1 protein_id gnl|my_center|LOCUS_02390 23149 22277 gene locus_tag LOCUS_02400 23149 22277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464652.1 protein_id gnl|my_center|LOCUS_02400 24048 23626 gene locus_tag LOCUS_02410 24048 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 26112 24061 gene locus_tag LOCUS_02420 26112 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 26362 27708 gene locus_tag LOCUS_02430 26362 27708 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477722.1 protein_id gnl|my_center|LOCUS_02430 27705 28178 gene locus_tag LOCUS_02440 27705 28178 CDS product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464592.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence009 59 421 gene locus_tag LOCUS_02450 59 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 421 1890 gene locus_tag LOCUS_02460 gene crnA 421 1890 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_02460 1914 3842 gene locus_tag LOCUS_02470 1914 3842 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_02470 4364 4996 gene locus_tag LOCUS_02480 4364 4996 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072669.1 protein_id gnl|my_center|LOCUS_02480 5216 5698 gene locus_tag LOCUS_02490 5216 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5993 6349 gene locus_tag LOCUS_02500 gene hinT 5993 6349 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072667.1 protein_id gnl|my_center|LOCUS_02500 6519 6908 gene locus_tag LOCUS_02510 6519 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072664.1 protein_id gnl|my_center|LOCUS_02510 7313 9433 gene locus_tag LOCUS_02520 7313 9433 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_02520 9553 9813 gene locus_tag LOCUS_02530 gene ykoF 9553 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_02530 9917 10558 gene locus_tag LOCUS_02540 gene pnuT 9917 10558 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_02540 10638 11654 gene locus_tag LOCUS_02550 gene thiK 10638 11654 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072657.1 protein_id gnl|my_center|LOCUS_02550 11769 12380 gene locus_tag LOCUS_02560 11769 12380 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_02560 12535 13083 gene locus_tag LOCUS_02570 gene ydjA 12535 13083 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072654.1 protein_id gnl|my_center|LOCUS_02570 13236 13727 gene locus_tag LOCUS_02580 13236 13727 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072653.1 protein_id gnl|my_center|LOCUS_02580 14139 14462 gene locus_tag LOCUS_02590 14139 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072766.1 protein_id gnl|my_center|LOCUS_02590 14600 14989 gene locus_tag LOCUS_02600 14600 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 15314 16000 gene locus_tag LOCUS_02610 15314 16000 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_02610 15990 17039 gene locus_tag LOCUS_02620 15990 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 17036 18235 gene locus_tag LOCUS_02630 17036 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 18232 19440 gene locus_tag LOCUS_02640 18232 19440 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_02640 19520 20776 gene locus_tag LOCUS_02650 19520 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140776.1 protein_id gnl|my_center|LOCUS_02650 21151 22188 gene locus_tag LOCUS_02660 21151 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489206.1 protein_id gnl|my_center|LOCUS_02660 23890 22331 gene locus_tag LOCUS_02670 23890 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 24489 25307 gene locus_tag LOCUS_02680 gene iolB 24489 25307 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_02680 25369 27891 gene locus_tag LOCUS_02690 25369 27891 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185153.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence010 515 3 gene locus_tag LOCUS_02700 gene creA 515 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072222.1 protein_id gnl|my_center|LOCUS_02700 1897 512 gene locus_tag LOCUS_02710 gene yegD 1897 512 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_02710 2631 2095 gene locus_tag LOCUS_02720 2631 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2819 4219 gene locus_tag LOCUS_02730 2819 4219 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_02730 4219 5022 gene locus_tag LOCUS_02740 4219 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_02740 6112 5126 gene locus_tag LOCUS_02750 6112 5126 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_02750 6364 7026 gene locus_tag LOCUS_02760 6364 7026 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_02760 7078 7305 gene locus_tag LOCUS_02770 7078 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7778 9013 gene locus_tag LOCUS_02780 7778 9013 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072290.1 protein_id gnl|my_center|LOCUS_02780 9481 11202 gene locus_tag LOCUS_02790 gene ilvI 9481 11202 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EET7 protein_id gnl|my_center|LOCUS_02790 11202 11696 gene locus_tag LOCUS_02800 gene ilvH 11202 11696 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072288.1 protein_id gnl|my_center|LOCUS_02800 12322 11882 gene locus_tag LOCUS_02810 gene ibpA 12322 11882 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_02810 14343 12631 gene locus_tag LOCUS_02820 gene ushA 14343 12631 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072087.1 protein_id gnl|my_center|LOCUS_02820 15117 14929 gene locus_tag LOCUS_02830 15117 14929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 15704 15033 gene locus_tag LOCUS_02840 15704 15033 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_02840 15907 16917 gene locus_tag LOCUS_02850 15907 16917 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482408.1 protein_id gnl|my_center|LOCUS_02850 17166 16948 gene locus_tag LOCUS_02860 17166 16948 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072085.1 protein_id gnl|my_center|LOCUS_02860 17768 17286 gene locus_tag LOCUS_02870 17768 17286 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_02870 19169 17982 gene locus_tag LOCUS_02880 19169 17982 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072082.1 protein_id gnl|my_center|LOCUS_02880 19434 19793 gene locus_tag LOCUS_02890 19434 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072081.1 protein_id gnl|my_center|LOCUS_02890 19884 20552 gene locus_tag LOCUS_02900 19884 20552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072080.1 protein_id gnl|my_center|LOCUS_02900 21518 20565 gene locus_tag LOCUS_02910 gene cheV 21518 20565 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072079.1 protein_id gnl|my_center|LOCUS_02910 22139 22312 gene locus_tag LOCUS_02920 22139 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072074.1 protein_id gnl|my_center|LOCUS_02920 23523 22603 gene locus_tag LOCUS_02930 23523 22603 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072070.1 protein_id gnl|my_center|LOCUS_02930 23734 24141 gene locus_tag LOCUS_02940 23734 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072069.1 protein_id gnl|my_center|LOCUS_02940 24938 24207 gene locus_tag LOCUS_02950 24938 24207 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_02950 25168 25398 gene locus_tag LOCUS_02960 25168 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 25856 25500 gene locus_tag LOCUS_02970 25856 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072064.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence011 49 1017 gene locus_tag LOCUS_02980 gene wzz 49 1017 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_02980 1739 2884 gene locus_tag LOCUS_02990 gene glf 1739 2884 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973473.1 protein_id gnl|my_center|LOCUS_02990 2974 4200 gene locus_tag LOCUS_03000 2974 4200 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_03000 4197 5381 gene locus_tag LOCUS_03010 4197 5381 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639967.1 protein_id gnl|my_center|LOCUS_03010 5390 6931 gene locus_tag LOCUS_03020 5390 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6921 7736 gene locus_tag LOCUS_03030 6921 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 7733 8845 gene locus_tag LOCUS_03040 7733 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8842 10119 gene locus_tag LOCUS_03050 8842 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107916.1 protein_id gnl|my_center|LOCUS_03050 10116 11207 gene locus_tag LOCUS_03060 10116 11207 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107723.1 protein_id gnl|my_center|LOCUS_03060 11223 12506 gene locus_tag LOCUS_03070 11223 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 12555 13370 gene locus_tag LOCUS_03080 12555 13370 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837622.1 protein_id gnl|my_center|LOCUS_03080 13740 14654 gene locus_tag LOCUS_03090 13740 14654 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261051.1 protein_id gnl|my_center|LOCUS_03090 14664 15218 gene locus_tag LOCUS_03100 14664 15218 CDS product undecaprenyl-phosphate beta-N-acetyl-D-fucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 protein_id gnl|my_center|LOCUS_03100 15255 16421 gene locus_tag LOCUS_03110 15255 16421 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_03110 16436 17440 gene locus_tag LOCUS_03120 16436 17440 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481622.1 protein_id gnl|my_center|LOCUS_03120 17985 19928 gene locus_tag LOCUS_03130 gene wbfY 17985 19928 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_03130 19972 20895 gene locus_tag LOCUS_03140 gene galU 19972 20895 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44878 protein_id gnl|my_center|LOCUS_03140 22115 23311 gene locus_tag LOCUS_03150 22115 23311 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03150 23283 24341 gene locus_tag LOCUS_03160 23283 24341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence012 2603 2157 gene locus_tag LOCUS_03170 2603 2157 CDS product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_03170 3254 2736 gene locus_tag LOCUS_03180 3254 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074167.1 protein_id gnl|my_center|LOCUS_03180 3435 4151 gene locus_tag LOCUS_03190 3435 4151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074166.1 protein_id gnl|my_center|LOCUS_03190 4208 5626 gene locus_tag LOCUS_03200 4208 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074165.1 protein_id gnl|my_center|LOCUS_03200 5838 7100 gene locus_tag LOCUS_03210 5838 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_03210 7507 7139 gene locus_tag LOCUS_03220 7507 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074164.1 protein_id gnl|my_center|LOCUS_03220 8670 7684 gene locus_tag LOCUS_03230 8670 7684 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074162.1 protein_id gnl|my_center|LOCUS_03230 8778 9980 gene locus_tag LOCUS_03240 8778 9980 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074161.1 protein_id gnl|my_center|LOCUS_03240 11210 10215 gene locus_tag LOCUS_03250 11210 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 11589 12140 gene locus_tag LOCUS_03260 11589 12140 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 protein_id gnl|my_center|LOCUS_03260 12091 12294 gene locus_tag LOCUS_03270 12091 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 12545 12952 gene locus_tag LOCUS_03280 12545 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13026 13388 gene locus_tag LOCUS_03290 13026 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 13926 15254 gene locus_tag LOCUS_03300 13926 15254 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_03300 15251 16696 gene locus_tag LOCUS_03310 15251 16696 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_03310 17453 16989 gene locus_tag LOCUS_03320 gene trmL 17453 16989 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8X2 protein_id gnl|my_center|LOCUS_03320 17969 19303 gene locus_tag LOCUS_03330 17969 19303 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489150.1 protein_id gnl|my_center|LOCUS_03330 19318 20292 gene locus_tag LOCUS_03340 19318 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 20313 20483 gene locus_tag LOCUS_03350 20313 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 20452 20823 gene locus_tag LOCUS_03360 20452 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 20820 21032 gene locus_tag LOCUS_03370 20820 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 22539 21109 gene locus_tag LOCUS_03380 gene cpxA 22539 21109 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 protein_id gnl|my_center|LOCUS_03380 23210 22527 gene locus_tag LOCUS_03390 gene cpxR 23210 22527 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_03390 23458 23946 gene locus_tag LOCUS_03400 gene cpxP 23458 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074104.1 protein_id gnl|my_center|LOCUS_03400 24222 24031 gene locus_tag LOCUS_03410 24222 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 24176 24925 gene locus_tag LOCUS_03420 gene fieF 24176 24925 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence013 1687 1385 gene locus_tag LOCUS_03430 gene nuoK 1687 1385 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVE8 protein_id gnl|my_center|LOCUS_03430 2328 1684 gene locus_tag LOCUS_03440 2328 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2840 2325 gene locus_tag LOCUS_03450 gene nuoI 2840 2325 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J4 protein_id gnl|my_center|LOCUS_03450 3808 2855 gene locus_tag LOCUS_03460 gene nuoH 3808 2855 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ61 protein_id gnl|my_center|LOCUS_03460 6794 3795 gene locus_tag LOCUS_03470 gene nuoG 6794 3795 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1Y5 protein_id gnl|my_center|LOCUS_03470 8149 6794 gene locus_tag LOCUS_03480 8149 6794 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789507.1 protein_id gnl|my_center|LOCUS_03480 8874 8146 gene locus_tag LOCUS_03490 8874 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10673 8883 gene locus_tag LOCUS_03500 gene nuoC 10673 8883 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ1 protein_id gnl|my_center|LOCUS_03500 11332 10676 gene locus_tag LOCUS_03510 gene nuoB 11332 10676 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ8 protein_id gnl|my_center|LOCUS_03510 11703 11332 gene locus_tag LOCUS_03520 gene nuoA 11703 11332 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI29 protein_id gnl|my_center|LOCUS_03520 12273 11842 gene locus_tag LOCUS_03530 12273 11842 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_03530 13791 12823 gene locus_tag LOCUS_03540 gene cysK 13791 12823 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED64 protein_id gnl|my_center|LOCUS_03540 14136 15284 gene locus_tag LOCUS_03550 14136 15284 CDS product RDD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072811.1 protein_id gnl|my_center|LOCUS_03550 16024 15548 gene locus_tag LOCUS_03560 16024 15548 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_03560 16857 16153 gene locus_tag LOCUS_03570 16857 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 18105 16888 gene locus_tag LOCUS_03580 18105 16888 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 protein_id gnl|my_center|LOCUS_03580 20040 18346 gene locus_tag LOCUS_03590 gene betA 20040 18346 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H53 protein_id gnl|my_center|LOCUS_03590 21513 20050 gene locus_tag LOCUS_03600 gene betB 21513 20050 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H52 protein_id gnl|my_center|LOCUS_03600 22094 21504 gene locus_tag LOCUS_03610 gene betI 22094 21504 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62CH6 protein_id gnl|my_center|LOCUS_03610 22723 22583 gene locus_tag LOCUS_03620 22723 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence014 540 130 gene locus_tag LOCUS_03630 gene fliS 540 130 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB0 protein_id gnl|my_center|LOCUS_03630 867 547 gene locus_tag LOCUS_03640 867 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2286 925 gene locus_tag LOCUS_03650 gene fliD 2286 925 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_03650 2745 2359 gene locus_tag LOCUS_03660 gene flaG 2745 2359 CDS product flagella locus protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 protein_id gnl|my_center|LOCUS_03660 4305 2935 gene locus_tag LOCUS_03670 gene fliC 4305 2935 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 protein_id gnl|my_center|LOCUS_03670 5721 4507 gene locus_tag LOCUS_03680 gene flgL 5721 4507 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 protein_id gnl|my_center|LOCUS_03680 7646 5733 gene locus_tag LOCUS_03690 gene flgK 7646 5733 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_03690 8697 7759 gene locus_tag LOCUS_03700 gene flgJ 8697 7759 CDS product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073125.1 protein_id gnl|my_center|LOCUS_03700 10067 8976 gene locus_tag LOCUS_03710 gene flgI 10067 8976 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA2 protein_id gnl|my_center|LOCUS_03710 10761 10108 gene locus_tag LOCUS_03720 gene flgH 10761 10108 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA1 protein_id gnl|my_center|LOCUS_03720 11593 10805 gene locus_tag LOCUS_03730 gene flgG 11593 10805 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA0 protein_id gnl|my_center|LOCUS_03730 12347 11604 gene locus_tag LOCUS_03740 gene flgF 12347 11604 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC99 protein_id gnl|my_center|LOCUS_03740 14077 12716 gene locus_tag LOCUS_03750 gene flgE 14077 12716 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 protein_id gnl|my_center|LOCUS_03750 15617 14253 gene locus_tag LOCUS_03760 gene flgE 15617 14253 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 protein_id gnl|my_center|LOCUS_03760 16477 15668 gene locus_tag LOCUS_03770 gene flgD 16477 15668 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC96 protein_id gnl|my_center|LOCUS_03770 16907 16491 gene locus_tag LOCUS_03780 gene flgC 16907 16491 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC95 protein_id gnl|my_center|LOCUS_03780 17308 16910 gene locus_tag LOCUS_03790 gene flgB 17308 16910 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC94 protein_id gnl|my_center|LOCUS_03790 18476 17643 gene locus_tag LOCUS_03800 gene cheR 18476 17643 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073134.1 protein_id gnl|my_center|LOCUS_03800 19536 18616 gene locus_tag LOCUS_03810 gene cheV 19536 18616 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_03810 19757 20461 gene locus_tag LOCUS_03820 gene flgA 19757 20461 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC91 protein_id gnl|my_center|LOCUS_03820 20545 20865 gene locus_tag LOCUS_03830 gene flgM 20545 20865 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073137.1 protein_id gnl|my_center|LOCUS_03830 20873 21298 gene locus_tag LOCUS_03840 gene flgN 20873 21298 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073138.1 protein_id gnl|my_center|LOCUS_03840 22160 21714 gene locus_tag LOCUS_03850 gene flgP 22160 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_03850 22786 22157 gene locus_tag LOCUS_03860 gene flgO 22786 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073140.1 protein_id gnl|my_center|LOCUS_03860 23322 24482 gene locus_tag LOCUS_03870 gene flgT 23322 24482 CDS product flagella assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073141.1 protein_id gnl|my_center|LOCUS_03870 24592 24667 gene locus_tag LOCUS_t00030 24592 24667 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 597 2231 gene locus_tag LOCUS_03880 gene yidC 597 2231 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT6 protein_id gnl|my_center|LOCUS_03880 2356 3717 gene locus_tag LOCUS_03890 gene mnmE 2356 3717 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX52 protein_id gnl|my_center|LOCUS_03890 6968 4389 gene locus_tag LOCUS_03900 6968 4389 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_03900 7333 12423 gene locus_tag LOCUS_03910 7333 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 12420 13271 gene locus_tag LOCUS_03920 12420 13271 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_03920 13344 16358 gene locus_tag LOCUS_03930 13344 16358 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_03930 16358 17209 gene locus_tag LOCUS_03940 16358 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_03940 17915 18214 gene locus_tag LOCUS_03950 17915 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 18204 19493 gene locus_tag LOCUS_03960 18204 19493 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_03960 20344 19742 gene locus_tag LOCUS_03970 gene fic 20344 19742 CDS product cell filamentation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_03970 20853 20341 gene locus_tag LOCUS_03980 20853 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 21601 21371 gene locus_tag LOCUS_03990 21601 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence016 583 1710 gene locus_tag LOCUS_04000 583 1710 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 protein_id gnl|my_center|LOCUS_04000 2750 1833 gene locus_tag LOCUS_04010 2750 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4669 2849 gene locus_tag LOCUS_04020 4669 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_04020 6758 4809 gene locus_tag LOCUS_04030 gene kefB 6758 4809 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_04030 6942 7823 gene locus_tag LOCUS_04040 6942 7823 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071801.1 protein_id gnl|my_center|LOCUS_04040 9303 7894 gene locus_tag LOCUS_04050 gene tilS 9303 7894 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGF9 protein_id gnl|my_center|LOCUS_04050 12778 9305 gene locus_tag LOCUS_04060 gene dnaE 12778 9305 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG0 protein_id gnl|my_center|LOCUS_04060 13554 12898 gene locus_tag LOCUS_04070 gene rnhB 13554 12898 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG1 protein_id gnl|my_center|LOCUS_04070 14724 13597 gene locus_tag LOCUS_04080 gene lpxB 14724 13597 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG2 protein_id gnl|my_center|LOCUS_04080 15584 14817 gene locus_tag LOCUS_04090 gene lpxA 15584 14817 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG3 protein_id gnl|my_center|LOCUS_04090 16039 15581 gene locus_tag LOCUS_04100 gene fabZ 16039 15581 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_04100 17093 16068 gene locus_tag LOCUS_04110 gene lpxD 17093 16068 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG5 protein_id gnl|my_center|LOCUS_04110 17616 17113 gene locus_tag LOCUS_04120 gene skp 17616 17113 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071793.1 protein_id gnl|my_center|LOCUS_04120 20172 17689 gene locus_tag LOCUS_04130 gene bamA 20172 17689 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG7 protein_id gnl|my_center|LOCUS_04130 21571 20204 gene locus_tag LOCUS_04140 gene rseP 21571 20204 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG8 protein_id gnl|my_center|LOCUS_04140 22777 21590 gene locus_tag LOCUS_04150 gene dxr 22777 21590 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG9 protein_id gnl|my_center|LOCUS_04150 23639 22782 gene locus_tag LOCUS_04160 gene cdsA 23639 22782 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH0 protein_id gnl|my_center|LOCUS_04160 >Feature sequence017 2380 1130 gene locus_tag LOCUS_04170 2380 1130 CDS product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 protein_id gnl|my_center|LOCUS_04170 2608 3261 gene locus_tag LOCUS_04180 2608 3261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082516.1 protein_id gnl|my_center|LOCUS_04180 4469 3387 gene locus_tag LOCUS_04190 4469 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 7483 4589 gene locus_tag LOCUS_04200 gene gcvP 7483 4589 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I05 protein_id gnl|my_center|LOCUS_04200 7886 7500 gene locus_tag LOCUS_04210 gene gcvH 7886 7500 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I04 protein_id gnl|my_center|LOCUS_04210 9286 7991 gene locus_tag LOCUS_04220 gene glyA2 9286 7991 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I03 protein_id gnl|my_center|LOCUS_04220 9971 9351 gene locus_tag LOCUS_04230 9971 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 10269 10898 gene locus_tag LOCUS_04240 10269 10898 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 protein_id gnl|my_center|LOCUS_04240 11460 12848 gene locus_tag LOCUS_04250 11460 12848 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_04250 12921 14048 gene locus_tag LOCUS_04260 12921 14048 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I01 protein_id gnl|my_center|LOCUS_04260 14139 15392 gene locus_tag LOCUS_04270 gene dadA 14139 15392 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTV1 protein_id gnl|my_center|LOCUS_04270 16428 15643 gene locus_tag LOCUS_04280 16428 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 16764 16552 gene locus_tag LOCUS_04290 16764 16552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 18137 17157 gene locus_tag LOCUS_04300 18137 17157 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 protein_id gnl|my_center|LOCUS_04300 18327 18869 gene locus_tag LOCUS_04310 18327 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 22286 19563 gene locus_tag LOCUS_04320 22286 19563 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919015.1 protein_id gnl|my_center|LOCUS_04320 23072 22827 gene locus_tag LOCUS_04330 23072 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence018 2748 538 gene locus_tag LOCUS_04340 gene polB 2748 538 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ4 protein_id gnl|my_center|LOCUS_04340 3165 5177 gene locus_tag LOCUS_04350 gene dinG 3165 5177 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 protein_id gnl|my_center|LOCUS_04350 5187 5960 gene locus_tag LOCUS_04360 5187 5960 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ6 protein_id gnl|my_center|LOCUS_04360 5963 6637 gene locus_tag LOCUS_04370 5963 6637 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071938.1 protein_id gnl|my_center|LOCUS_04370 6647 7345 gene locus_tag LOCUS_04380 6647 7345 CDS product UPF0319 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ8 protein_id gnl|my_center|LOCUS_04380 7580 7852 gene locus_tag LOCUS_04390 gene comFB 7580 7852 CDS product competence protein ComFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071935.1 protein_id gnl|my_center|LOCUS_04390 8585 8268 gene locus_tag LOCUS_04400 gene comE 8585 8268 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261493.1 protein_id gnl|my_center|LOCUS_04400 8706 9005 gene locus_tag LOCUS_04410 8706 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 8986 9159 gene locus_tag LOCUS_04420 8986 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10462 9284 gene locus_tag LOCUS_04430 gene mdeA 10462 9284 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_04430 11784 10612 gene locus_tag LOCUS_04440 11784 10612 CDS product UPF0283 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG03 protein_id gnl|my_center|LOCUS_04440 13261 11807 gene locus_tag LOCUS_04450 gene ycjX 13261 11807 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071931.1 protein_id gnl|my_center|LOCUS_04450 13705 13310 gene locus_tag LOCUS_04460 gene pspC 13705 13310 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_04460 14070 13843 gene locus_tag LOCUS_04470 gene pspB 14070 13843 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_04470 14776 14093 gene locus_tag LOCUS_04480 gene pspA 14776 14093 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_04480 14954 16024 gene locus_tag LOCUS_04490 gene pspF 14954 16024 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_04490 16110 17747 gene locus_tag LOCUS_04500 gene sapA 16110 17747 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071926.1 protein_id gnl|my_center|LOCUS_04500 17747 18778 gene locus_tag LOCUS_04510 gene sapB 17747 18778 CDS product antimicrobial peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071925.1 protein_id gnl|my_center|LOCUS_04510 18765 19655 gene locus_tag LOCUS_04520 gene sapC 18765 19655 CDS product antimicrobial peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071924.1 protein_id gnl|my_center|LOCUS_04520 19671 20684 gene locus_tag LOCUS_04530 gene sapD 19671 20684 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071923.1 protein_id gnl|my_center|LOCUS_04530 20659 21471 gene locus_tag LOCUS_04540 gene sapF 20659 21471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 protein_id gnl|my_center|LOCUS_04540 21653 22855 gene locus_tag LOCUS_04550 gene fabV 21653 22855 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG14 protein_id gnl|my_center|LOCUS_04550 >Feature sequence019 661 2277 gene locus_tag LOCUS_04560 661 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2811 3485 gene locus_tag LOCUS_04570 gene yiaD 2811 3485 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_04570 5015 3654 gene locus_tag LOCUS_04580 5015 3654 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_04580 5395 5120 gene locus_tag LOCUS_04590 gene ptsO 5395 5120 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_04590 6236 5388 gene locus_tag LOCUS_04600 6236 5388 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE2 protein_id gnl|my_center|LOCUS_04600 6676 6233 gene locus_tag LOCUS_04610 gene ptsN 6676 6233 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073701.1 protein_id gnl|my_center|LOCUS_04610 6966 6679 gene locus_tag LOCUS_04620 gene yhbH 6966 6679 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 protein_id gnl|my_center|LOCUS_04620 8659 7181 gene locus_tag LOCUS_04630 gene rpoN 8659 7181 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE5 protein_id gnl|my_center|LOCUS_04630 9542 8811 gene locus_tag LOCUS_04640 gene lptB 9542 8811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_04640 10414 9539 gene locus_tag LOCUS_04650 10414 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11085 10528 gene locus_tag LOCUS_04660 gene lptC 11085 10528 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE8 protein_id gnl|my_center|LOCUS_04660 11639 11082 gene locus_tag LOCUS_04670 gene kdsC 11639 11082 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_04670 12618 11641 gene locus_tag LOCUS_04680 gene kdsD 12618 11641 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAF0 protein_id gnl|my_center|LOCUS_04680 13631 12672 gene locus_tag LOCUS_04690 gene yrbG 13631 12672 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_04690 13813 14631 gene locus_tag LOCUS_04700 gene mlaF 13813 14631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_04700 14690 15472 gene locus_tag LOCUS_04710 gene mlaE 14690 15472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073692.1 protein_id gnl|my_center|LOCUS_04710 15528 15992 gene locus_tag LOCUS_04720 gene mlaD 15528 15992 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 protein_id gnl|my_center|LOCUS_04720 16079 16741 gene locus_tag LOCUS_04730 gene mlaC 16079 16741 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 protein_id gnl|my_center|LOCUS_04730 16742 17044 gene locus_tag LOCUS_04740 gene mlaB 16742 17044 CDS product ABC phospholipid uptake (salvage) system anti-anti-sigma factor MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073689.1 protein_id gnl|my_center|LOCUS_04740 17049 17336 gene locus_tag LOCUS_04750 gene yrbA 17049 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 protein_id gnl|my_center|LOCUS_04750 17350 18609 gene locus_tag LOCUS_04760 gene murA 17350 18609 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAF7 protein_id gnl|my_center|LOCUS_04760 19852 18770 gene locus_tag LOCUS_04770 gene degS 19852 18770 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073685.1 protein_id gnl|my_center|LOCUS_04770 21372 20020 gene locus_tag LOCUS_04780 gene degQ 21372 20020 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 protein_id gnl|my_center|LOCUS_04780 21888 21514 gene locus_tag LOCUS_04790 21888 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 21992 23098 gene locus_tag LOCUS_04800 gene zapE 21992 23098 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence020 <1 700 gene locus_tag LOCUS_04810 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIS9:phospho-2-dehydro-3-deoxyheptonate aldolase 1021 845 gene locus_tag LOCUS_04820 1021 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071061.1 protein_id gnl|my_center|LOCUS_04820 1436 3205 gene locus_tag LOCUS_04830 gene atmA 1436 3205 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_04830 3380 3643 gene locus_tag LOCUS_04840 3380 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071059.1 protein_id gnl|my_center|LOCUS_04840 3896 3693 gene locus_tag LOCUS_04850 3896 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071058.1 protein_id gnl|my_center|LOCUS_04850 4494 4069 gene locus_tag LOCUS_04860 4494 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4763 4966 gene locus_tag LOCUS_04870 4763 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5025 5774 gene locus_tag LOCUS_04880 gene fpr 5025 5774 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071054.1 protein_id gnl|my_center|LOCUS_04880 6139 7146 gene locus_tag LOCUS_04890 gene fbpA 6139 7146 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071051.1 protein_id gnl|my_center|LOCUS_04890 7299 8930 gene locus_tag LOCUS_04900 gene fbpB 7299 8930 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071050.1 protein_id gnl|my_center|LOCUS_04900 8996 10024 gene locus_tag LOCUS_04910 gene fbpC 8996 10024 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071049.1 protein_id gnl|my_center|LOCUS_04910 10159 11097 gene locus_tag LOCUS_04920 10159 11097 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 protein_id gnl|my_center|LOCUS_04920 12690 11362 gene locus_tag LOCUS_04930 12690 11362 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_04930 12892 14001 gene locus_tag LOCUS_04940 12892 14001 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_04940 15147 14290 gene locus_tag LOCUS_04950 15147 14290 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 protein_id gnl|my_center|LOCUS_04950 17430 15358 gene locus_tag LOCUS_04960 gene pepO 17430 15358 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_04960 17692 18195 gene locus_tag LOCUS_04970 17692 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482653.1 protein_id gnl|my_center|LOCUS_04970 18393 18274 gene locus_tag LOCUS_04980 18393 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 19226 20728 gene locus_tag LOCUS_04990 19226 20728 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_04990 21374 21096 gene locus_tag LOCUS_05000 21374 21096 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 protein_id gnl|my_center|LOCUS_05000 22551 21517 gene locus_tag LOCUS_05010 gene pyrC 22551 21517 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence021 2968 1466 gene locus_tag LOCUS_05020 gene rng 2968 1466 CDS product ribonuclease G Rng inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073798.1 protein_id gnl|my_center|LOCUS_05020 3621 3025 gene locus_tag LOCUS_05030 3621 3025 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA14 protein_id gnl|my_center|LOCUS_05030 4117 3623 gene locus_tag LOCUS_05040 gene mreD 4117 3623 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA13 protein_id gnl|my_center|LOCUS_05040 5022 4114 gene locus_tag LOCUS_05050 gene mreC 5022 4114 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073801.1 protein_id gnl|my_center|LOCUS_05050 5052 5204 gene locus_tag LOCUS_05060 5052 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6203 5154 gene locus_tag LOCUS_05070 gene mreB 6203 5154 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_05070 10930 6482 gene locus_tag LOCUS_05080 10930 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11423 10923 gene locus_tag LOCUS_05090 gene mshP 11423 10923 CDS product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073803.1 protein_id gnl|my_center|LOCUS_05090 12240 11413 gene locus_tag LOCUS_05100 gene mshO 12240 11413 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_05100 12910 12326 gene locus_tag LOCUS_05110 gene mshD 12910 12326 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_05110 13355 12900 gene locus_tag LOCUS_05120 13355 12900 CDS product MSHA biogenesis protein MshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704372.1 protein_id gnl|my_center|LOCUS_05120 13952 13422 gene locus_tag LOCUS_05130 13952 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 14550 14029 gene locus_tag LOCUS_05140 14550 14029 CDS product MSHA pilin protein MshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883247.1 protein_id gnl|my_center|LOCUS_05140 15126 14581 gene locus_tag LOCUS_05150 15126 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 15869 15252 gene locus_tag LOCUS_05160 gene mshB 15869 15252 CDS product MSHA biogenesis protein MshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073808.1 protein_id gnl|my_center|LOCUS_05160 16522 16007 gene locus_tag LOCUS_05170 16522 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 17830 16616 gene locus_tag LOCUS_05180 gene mshG 17830 16616 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_05180 19658 17913 gene locus_tag LOCUS_05190 gene mshE 19658 17913 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_05190 20260 19655 gene locus_tag LOCUS_05200 20260 19655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 20514 20759 gene locus_tag LOCUS_05210 20514 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 21753 20845 gene locus_tag LOCUS_05220 gene mshM 21753 20845 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_05220 <22763 21757 gene locus_tag LOCUS_05230 <22763 21757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073814.1:pilus (MSHA type) biogenesis protein MshL >Feature sequence022 2204 3313 gene locus_tag LOCUS_05240 2204 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701837.1 protein_id gnl|my_center|LOCUS_05240 3306 5072 gene locus_tag LOCUS_05250 3306 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701838.1 protein_id gnl|my_center|LOCUS_05250 5074 7089 gene locus_tag LOCUS_05260 5074 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 protein_id gnl|my_center|LOCUS_05260 7089 7460 gene locus_tag LOCUS_05270 7089 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 8729 7608 gene locus_tag LOCUS_05280 8729 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9259 8726 gene locus_tag LOCUS_05290 9259 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 10502 9291 gene locus_tag LOCUS_05300 10502 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 10890 10633 gene locus_tag LOCUS_05310 10890 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 11480 11130 gene locus_tag LOCUS_05320 11480 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 16770 11470 gene locus_tag LOCUS_05330 16770 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 18085 16736 gene locus_tag LOCUS_05340 18085 16736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 19683 18088 gene locus_tag LOCUS_05350 19683 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 21342 20602 gene locus_tag LOCUS_05360 gene fabG 21342 20602 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315093.1 protein_id gnl|my_center|LOCUS_05360 21983 21363 gene locus_tag LOCUS_05370 gene gst-1 21983 21363 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence023 <1 969 gene locus_tag LOCUS_05380 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBQ3:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 1097 3301 gene locus_tag LOCUS_05390 gene relA 1097 3301 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 protein_id gnl|my_center|LOCUS_05390 3375 4172 gene locus_tag LOCUS_05400 3375 4172 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073298.1 protein_id gnl|my_center|LOCUS_05400 4287 5924 gene locus_tag LOCUS_05410 gene pyrG 4287 5924 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ9 protein_id gnl|my_center|LOCUS_05410 6055 7347 gene locus_tag LOCUS_05420 gene eno 6055 7347 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR0 protein_id gnl|my_center|LOCUS_05420 7503 7793 gene locus_tag LOCUS_05430 gene ftsB 7503 7793 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_05430 7830 8540 gene locus_tag LOCUS_05440 gene ispD 7830 8540 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR2 protein_id gnl|my_center|LOCUS_05440 8628 9113 gene locus_tag LOCUS_05450 gene ispF 8628 9113 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_05450 9162 10235 gene locus_tag LOCUS_05460 gene truD 9162 10235 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR4 protein_id gnl|my_center|LOCUS_05460 10345 11094 gene locus_tag LOCUS_05470 gene surE 10345 11094 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR5 protein_id gnl|my_center|LOCUS_05470 11091 11726 gene locus_tag LOCUS_05480 gene pcm 11091 11726 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR6 protein_id gnl|my_center|LOCUS_05480 11939 12742 gene locus_tag LOCUS_05490 gene nlpD 11939 12742 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073289.1 protein_id gnl|my_center|LOCUS_05490 12825 13796 gene locus_tag LOCUS_05500 gene rpoS 12825 13796 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR8 protein_id gnl|my_center|LOCUS_05500 16811 14244 gene locus_tag LOCUS_05510 gene mutS 16811 14244 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR9 protein_id gnl|my_center|LOCUS_05510 17164 18222 gene locus_tag LOCUS_05520 gene recA 17164 18222 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS0 protein_id gnl|my_center|LOCUS_05520 18621 21245 gene locus_tag LOCUS_05530 gene alaS 18621 21245 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS1 protein_id gnl|my_center|LOCUS_05530 21857 22054 gene locus_tag LOCUS_05540 gene csrA 21857 22054 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS3 protein_id gnl|my_center|LOCUS_05540 22326 22417 gene locus_tag LOCUS_t00040 22326 22417 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22439 22515 gene locus_tag LOCUS_t00050 22439 22515 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 1977 268 gene locus_tag LOCUS_05550 gene proS 1977 268 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECI8 protein_id gnl|my_center|LOCUS_05550 2379 2828 gene locus_tag LOCUS_05560 2379 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3272 4201 gene locus_tag LOCUS_05570 3272 4201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_05570 5246 4488 gene locus_tag LOCUS_05580 gene yaeB 5246 4488 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073040.1 protein_id gnl|my_center|LOCUS_05580 5671 5285 gene locus_tag LOCUS_05590 gene rcsF 5671 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073039.1 protein_id gnl|my_center|LOCUS_05590 7204 5840 gene locus_tag LOCUS_05600 7204 5840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_05600 10275 7201 gene locus_tag LOCUS_05610 10275 7201 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_05610 10834 10442 gene locus_tag LOCUS_05620 10834 10442 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECJ6 protein_id gnl|my_center|LOCUS_05620 11142 11891 gene locus_tag LOCUS_05630 gene etfB 11142 11891 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073035.1 protein_id gnl|my_center|LOCUS_05630 11891 12814 gene locus_tag LOCUS_05640 gene etfA 11891 12814 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 protein_id gnl|my_center|LOCUS_05640 13006 12809 gene locus_tag LOCUS_05650 13006 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 13313 14881 gene locus_tag LOCUS_05660 13313 14881 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_05660 15090 15668 gene locus_tag LOCUS_05670 gene tdk 15090 15668 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECK0 protein_id gnl|my_center|LOCUS_05670 16670 16014 gene locus_tag LOCUS_05680 gene liuG 16670 16014 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_05680 17406 16687 gene locus_tag LOCUS_05690 gene liuF 17406 16687 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 protein_id gnl|my_center|LOCUS_05690 18568 17675 gene locus_tag LOCUS_05700 gene liuE 18568 17675 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 protein_id gnl|my_center|LOCUS_05700 20726 18612 gene locus_tag LOCUS_05710 gene liuD 20726 18612 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072001.1 protein_id gnl|my_center|LOCUS_05710 21565 20726 gene locus_tag LOCUS_05720 gene liuC 21565 20726 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence025 455 3580 gene locus_tag LOCUS_05730 455 3580 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479247.1 protein_id gnl|my_center|LOCUS_05730 3728 5773 gene locus_tag LOCUS_05740 3728 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6697 6062 gene locus_tag LOCUS_05750 6697 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 6873 6712 gene locus_tag LOCUS_05760 6873 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 7962 10286 gene locus_tag LOCUS_05770 7962 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 10395 12767 gene locus_tag LOCUS_05780 gene glgB 10395 12767 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU7 protein_id gnl|my_center|LOCUS_05780 12754 14892 gene locus_tag LOCUS_05790 gene glgX 12754 14892 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU6 protein_id gnl|my_center|LOCUS_05790 14882 17398 gene locus_tag LOCUS_05800 gene glgP 14882 17398 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU5 protein_id gnl|my_center|LOCUS_05800 17500 18768 gene locus_tag LOCUS_05810 gene glgC 17500 18768 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_05810 18835 20652 gene locus_tag LOCUS_05820 gene glgA 18835 20652 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_05820 21208 20729 gene locus_tag LOCUS_05830 21208 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence026 2846 2283 gene locus_tag LOCUS_05840 2846 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3055 2843 gene locus_tag LOCUS_05850 3055 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3288 3052 gene locus_tag LOCUS_05860 3288 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3522 3289 gene locus_tag LOCUS_05870 3522 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 4027 3602 gene locus_tag LOCUS_05880 4027 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4323 4060 gene locus_tag LOCUS_05890 4323 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4875 4333 gene locus_tag LOCUS_05900 4875 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097411.1 protein_id gnl|my_center|LOCUS_05900 5164 4922 gene locus_tag LOCUS_05910 5164 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5236 6240 gene locus_tag LOCUS_05920 5236 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6256 6960 gene locus_tag LOCUS_05930 6256 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7020 7298 gene locus_tag LOCUS_05940 7020 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 8925 7522 gene locus_tag LOCUS_05950 8925 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 10480 9923 gene locus_tag LOCUS_05960 gene cobU 10480 9923 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_05960 11303 10473 gene locus_tag LOCUS_05970 gene btuF 11303 10473 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_05970 11836 11300 gene locus_tag LOCUS_05980 gene cobU 11836 11300 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_05980 12847 11837 gene locus_tag LOCUS_05990 gene btuC 12847 11837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_05990 13601 12834 gene locus_tag LOCUS_06000 gene btuD 13601 12834 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_06000 15442 13709 gene locus_tag LOCUS_06010 gene btuB 15442 13709 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVI9 protein_id gnl|my_center|LOCUS_06010 17185 16061 gene locus_tag LOCUS_06020 17185 16061 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721584.1 protein_id gnl|my_center|LOCUS_06020 18004 17456 gene locus_tag LOCUS_06030 gene pduT 18004 17456 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816702.1 protein_id gnl|my_center|LOCUS_06030 19389 18007 gene locus_tag LOCUS_06040 gene pduS 19389 18007 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816701.1 protein_id gnl|my_center|LOCUS_06040 20061 19405 gene locus_tag LOCUS_06050 gene eutL 20061 19405 CDS product microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423987.1 protein_id gnl|my_center|LOCUS_06050 <20721 20077 gene locus_tag LOCUS_06060 <20721 20077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z4U3:ethanolamine ammonia-lyase light chain >Feature sequence027 835 446 gene locus_tag LOCUS_06070 835 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2272 962 gene locus_tag LOCUS_06080 2272 962 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_06080 2572 3450 gene locus_tag LOCUS_06090 2572 3450 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_06090 3499 7029 gene locus_tag LOCUS_06100 3499 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7111 8613 gene locus_tag LOCUS_06110 7111 8613 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_06110 10244 8778 gene locus_tag LOCUS_06120 10244 8778 CDS product outer membrane protein in capsule/EPS biosynthesis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 protein_id gnl|my_center|LOCUS_06120 10819 11709 gene locus_tag LOCUS_06130 gene hexA 10819 11709 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071808.1 protein_id gnl|my_center|LOCUS_06130 11833 12576 gene locus_tag LOCUS_06140 11833 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071809.1 protein_id gnl|my_center|LOCUS_06140 12639 13316 gene locus_tag LOCUS_06150 12639 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071810.1 protein_id gnl|my_center|LOCUS_06150 13820 13401 gene locus_tag LOCUS_06160 13820 13401 CDS product DUF583 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071813.1 protein_id gnl|my_center|LOCUS_06160 14439 13954 gene locus_tag LOCUS_06170 gene napF 14439 13954 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 protein_id gnl|my_center|LOCUS_06170 15529 14516 gene locus_tag LOCUS_06180 gene galE 15529 14516 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_06180 16449 15526 gene locus_tag LOCUS_06190 gene galU 16449 15526 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD9 protein_id gnl|my_center|LOCUS_06190 16819 17616 gene locus_tag LOCUS_06200 gene phhA 16819 17616 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 protein_id gnl|my_center|LOCUS_06200 17690 18028 gene locus_tag LOCUS_06210 17690 18028 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_06210 18185 19789 gene locus_tag LOCUS_06220 gene tyrR 18185 19789 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071819.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence028 162 1517 gene locus_tag LOCUS_06230 gene argW 162 1517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 protein_id gnl|my_center|LOCUS_06230 1721 2137 gene locus_tag LOCUS_06240 1721 2137 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_06240 3555 2179 gene locus_tag LOCUS_06250 3555 2179 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071463.1 protein_id gnl|my_center|LOCUS_06250 4943 3642 gene locus_tag LOCUS_06260 4943 3642 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 protein_id gnl|my_center|LOCUS_06260 5217 5591 gene locus_tag LOCUS_06270 5217 5591 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHJ4 protein_id gnl|my_center|LOCUS_06270 5995 5639 gene locus_tag LOCUS_06280 5995 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 8272 6461 gene locus_tag LOCUS_06290 8272 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8719 9354 gene locus_tag LOCUS_06300 8719 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 11504 10131 gene locus_tag LOCUS_06310 gene radA 11504 10131 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_06310 11829 14243 gene locus_tag LOCUS_06320 11829 14243 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 protein_id gnl|my_center|LOCUS_06320 15177 14248 gene locus_tag LOCUS_06330 15177 14248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071452.1 protein_id gnl|my_center|LOCUS_06330 16390 15410 gene locus_tag LOCUS_06340 gene serB 16390 15410 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071451.1 protein_id gnl|my_center|LOCUS_06340 16523 17113 gene locus_tag LOCUS_06350 16523 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 18132 17422 gene locus_tag LOCUS_06360 gene deoD2 18132 17422 CDS product purine nucleoside phosphorylase DeoD-type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK0 protein_id gnl|my_center|LOCUS_06360 19488 18271 gene locus_tag LOCUS_06370 gene deoB 19488 18271 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK2 protein_id gnl|my_center|LOCUS_06370 <20095 19511 gene locus_tag LOCUS_06380 <20095 19511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHK3:thymidine phosphorylase >Feature sequence029 1369 1560 gene locus_tag LOCUS_06390 1369 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1996 1634 gene locus_tag LOCUS_06400 1996 1634 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_06400 4132 2156 gene locus_tag LOCUS_06410 4132 2156 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606001.1 protein_id gnl|my_center|LOCUS_06410 5546 4836 gene locus_tag LOCUS_06420 gene phoU 5546 4836 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG81 protein_id gnl|my_center|LOCUS_06420 6450 5632 gene locus_tag LOCUS_06430 gene pstB1 6450 5632 CDS product phosphate import ATP-binding protein PstB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG82 protein_id gnl|my_center|LOCUS_06430 8242 6590 gene locus_tag LOCUS_06440 gene pstA 8242 6590 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG83 protein_id gnl|my_center|LOCUS_06440 10773 8518 gene locus_tag LOCUS_06450 gene pstC 10773 8518 CDS product ABC high affinity phosphate uptake system permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_06450 10944 11444 gene locus_tag LOCUS_06460 10944 11444 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071861.1 protein_id gnl|my_center|LOCUS_06460 11713 12528 gene locus_tag LOCUS_06470 11713 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071859.1 protein_id gnl|my_center|LOCUS_06470 12886 15039 gene locus_tag LOCUS_06480 12886 15039 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_06480 15514 16341 gene locus_tag LOCUS_06490 15514 16341 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704485.1 protein_id gnl|my_center|LOCUS_06490 16367 17335 gene locus_tag LOCUS_06500 16367 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 17903 17433 gene locus_tag LOCUS_06510 17903 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071858.1 protein_id gnl|my_center|LOCUS_06510 18423 18238 gene locus_tag LOCUS_06520 18423 18238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 18524 18835 gene locus_tag LOCUS_06530 18524 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 18953 19519 gene locus_tag LOCUS_06540 18953 19519 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_06540 19780 19616 gene locus_tag LOCUS_06550 19780 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence030 685 1278 gene locus_tag LOCUS_06560 gene rsmD 685 1278 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S4 protein_id gnl|my_center|LOCUS_06560 1318 1680 gene locus_tag LOCUS_06570 1318 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2517 1954 gene locus_tag LOCUS_06580 gene cymA 2517 1954 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S0 protein_id gnl|my_center|LOCUS_06580 3608 4039 gene locus_tag LOCUS_06590 3608 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4276 4716 gene locus_tag LOCUS_06600 4276 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074192.1 protein_id gnl|my_center|LOCUS_06600 5084 5299 gene locus_tag LOCUS_06610 5084 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5322 6845 gene locus_tag LOCUS_06620 5322 6845 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074442.1 protein_id gnl|my_center|LOCUS_06620 7095 10226 gene locus_tag LOCUS_06630 7095 10226 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074441.1 protein_id gnl|my_center|LOCUS_06630 12360 11137 gene locus_tag LOCUS_06640 12360 11137 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263714.1 protein_id gnl|my_center|LOCUS_06640 12694 12353 gene locus_tag LOCUS_06650 12694 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263713.1 protein_id gnl|my_center|LOCUS_06650 12936 13946 gene locus_tag LOCUS_06660 12936 13946 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263711.1 protein_id gnl|my_center|LOCUS_06660 14606 13953 gene locus_tag LOCUS_06670 14606 13953 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_06670 15949 14693 gene locus_tag LOCUS_06680 gene mtr 15949 14693 CDS product high affinity tryptophan transporter Mtr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074198.1 protein_id gnl|my_center|LOCUS_06680 18372 15949 gene locus_tag LOCUS_06690 gene plsB 18372 15949 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q9 protein_id gnl|my_center|LOCUS_06690 >Feature sequence031 331 1947 gene locus_tag LOCUS_06700 331 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_06700 3101 6091 gene locus_tag LOCUS_06710 3101 6091 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070964.1 protein_id gnl|my_center|LOCUS_06710 6204 6938 gene locus_tag LOCUS_06720 6204 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7157 7348 gene locus_tag LOCUS_06730 7157 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8996 7404 gene locus_tag LOCUS_06740 8996 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880602.1 protein_id gnl|my_center|LOCUS_06740 9999 12071 gene locus_tag LOCUS_06750 9999 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_06750 12068 12796 gene locus_tag LOCUS_06760 12068 12796 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 protein_id gnl|my_center|LOCUS_06760 12796 14244 gene locus_tag LOCUS_06770 12796 14244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055826.1 protein_id gnl|my_center|LOCUS_06770 14247 17681 gene locus_tag LOCUS_06780 14247 17681 CDS product superfamily II DNA/RNA helicase and SNF2 family-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707160.1 protein_id gnl|my_center|LOCUS_06780 17778 18770 gene locus_tag LOCUS_06790 17778 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 18770 19396 gene locus_tag LOCUS_06800 18770 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 19407 19625 gene locus_tag LOCUS_06810 19407 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence032 2674 461 gene locus_tag LOCUS_06820 2674 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2571 2864 gene locus_tag LOCUS_06830 2571 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3091 4407 gene locus_tag LOCUS_06840 gene gltP 3091 4407 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_06840 6185 4539 gene locus_tag LOCUS_06850 6185 4539 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073402.1 protein_id gnl|my_center|LOCUS_06850 7834 6530 gene locus_tag LOCUS_06860 gene gsk 7834 6530 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072104.1 protein_id gnl|my_center|LOCUS_06860 9041 8046 gene locus_tag LOCUS_06870 gene hemH1 9041 8046 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_06870 9811 9167 gene locus_tag LOCUS_06880 gene adk 9811 9167 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF5 protein_id gnl|my_center|LOCUS_06880 10841 9996 gene locus_tag LOCUS_06890 10841 9996 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072101.1 protein_id gnl|my_center|LOCUS_06890 12920 11004 gene locus_tag LOCUS_06900 gene htpG 12920 11004 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF7 protein_id gnl|my_center|LOCUS_06900 13740 13141 gene locus_tag LOCUS_06910 gene recR 13740 13141 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF8 protein_id gnl|my_center|LOCUS_06910 14088 13759 gene locus_tag LOCUS_06920 14088 13759 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MQ3 protein_id gnl|my_center|LOCUS_06920 16866 14173 gene locus_tag LOCUS_06930 gene dnaX 16866 14173 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072097.1 protein_id gnl|my_center|LOCUS_06930 17665 17120 gene locus_tag LOCUS_06940 gene apt 17665 17120 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG1 protein_id gnl|my_center|LOCUS_06940 18241 17873 gene locus_tag LOCUS_06950 18241 17873 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG2 protein_id gnl|my_center|LOCUS_06950 19461 18718 gene locus_tag LOCUS_06960 19461 18718 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence033 250 1119 gene locus_tag LOCUS_06970 250 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1228 3687 gene locus_tag LOCUS_06980 1228 3687 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921290.1 protein_id gnl|my_center|LOCUS_06980 3814 5478 gene locus_tag LOCUS_06990 3814 5478 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_06990 5541 6743 gene locus_tag LOCUS_07000 5541 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 6885 7673 gene locus_tag LOCUS_07010 gene lgt 6885 7673 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A337 protein_id gnl|my_center|LOCUS_07010 8064 9182 gene locus_tag LOCUS_07020 8064 9182 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477948.1 protein_id gnl|my_center|LOCUS_07020 10232 9216 gene locus_tag LOCUS_07030 10232 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 10627 10352 gene locus_tag LOCUS_07040 10627 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 10904 11626 gene locus_tag LOCUS_07050 10904 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 13945 11702 gene locus_tag LOCUS_07060 13945 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_07060 14214 14068 gene locus_tag LOCUS_07070 14214 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 15496 14357 gene locus_tag LOCUS_07080 15496 14357 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073533.1 protein_id gnl|my_center|LOCUS_07080 17267 15606 gene locus_tag LOCUS_07090 17267 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 18703 17264 gene locus_tag LOCUS_07100 18703 17264 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073532.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence034 2049 541 gene locus_tag LOCUS_07110 gene csgA 2049 541 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_07110 2500 2063 gene locus_tag LOCUS_07120 gene csgB 2500 2063 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071156.1 protein_id gnl|my_center|LOCUS_07120 2981 5491 gene locus_tag LOCUS_07130 2981 5491 CDS product collagenolytic serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071157.1 protein_id gnl|my_center|LOCUS_07130 6137 5598 gene locus_tag LOCUS_07140 6137 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9210 6199 gene locus_tag LOCUS_07150 9210 6199 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070964.1 protein_id gnl|my_center|LOCUS_07150 9641 10684 gene locus_tag LOCUS_07160 9641 10684 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070965.1 protein_id gnl|my_center|LOCUS_07160 10876 11313 gene locus_tag LOCUS_07170 10876 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071011.1 protein_id gnl|my_center|LOCUS_07170 12432 11398 gene locus_tag LOCUS_07180 gene galM 12432 11398 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY4 protein_id gnl|my_center|LOCUS_07180 13681 12515 gene locus_tag LOCUS_07190 gene galK 13681 12515 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY3 protein_id gnl|my_center|LOCUS_07190 16033 14408 gene locus_tag LOCUS_07200 16033 14408 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_07200 18021 16156 gene locus_tag LOCUS_07210 gene dsbD 18021 16156 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY1 protein_id gnl|my_center|LOCUS_07210 18406 18083 gene locus_tag LOCUS_07220 gene cutA 18406 18083 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence035 2873 516 gene locus_tag LOCUS_07230 2873 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3105 3794 gene locus_tag LOCUS_07240 3105 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3817 4377 gene locus_tag LOCUS_07250 3817 4377 CDS product thiol:disulfide interchange protein tlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269072.1 protein_id gnl|my_center|LOCUS_07250 4513 5427 gene locus_tag LOCUS_07260 4513 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5507 5689 gene locus_tag LOCUS_07270 5507 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 6253 5987 gene locus_tag LOCUS_07280 6253 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 6493 7113 gene locus_tag LOCUS_07290 6493 7113 CDS product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 protein_id gnl|my_center|LOCUS_07290 7277 7798 gene locus_tag LOCUS_07300 7277 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 9617 8094 gene locus_tag LOCUS_07310 9617 8094 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052610.1 protein_id gnl|my_center|LOCUS_07310 10081 10476 gene locus_tag LOCUS_07320 10081 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10720 11559 gene locus_tag LOCUS_07330 10720 11559 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496764.1 protein_id gnl|my_center|LOCUS_07330 13322 11598 gene locus_tag LOCUS_07340 gene recJ 13322 11598 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071232.1 protein_id gnl|my_center|LOCUS_07340 14261 13524 gene locus_tag LOCUS_07350 gene dsbC 14261 13524 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_07350 15339 14422 gene locus_tag LOCUS_07360 gene xerD 15339 14422 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ8 protein_id gnl|my_center|LOCUS_07360 16771 15440 gene locus_tag LOCUS_07370 gene brnQ 16771 15440 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI94 protein_id gnl|my_center|LOCUS_07370 17265 17996 gene locus_tag LOCUS_07380 17265 17996 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI95 protein_id gnl|my_center|LOCUS_07380 >Feature sequence036 862 53 gene locus_tag LOCUS_07390 862 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1888 1016 gene locus_tag LOCUS_07400 gene ilvY 1888 1016 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074007.1 protein_id gnl|my_center|LOCUS_07400 2076 3557 gene locus_tag LOCUS_07410 gene ilvC 2076 3557 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_07410 4001 5719 gene locus_tag LOCUS_07420 gene ilvG 4001 5719 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D7 protein_id gnl|my_center|LOCUS_07420 5858 6085 gene locus_tag LOCUS_07430 gene ilvM 5858 6085 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074003.1 protein_id gnl|my_center|LOCUS_07430 6189 7112 gene locus_tag LOCUS_07440 6189 7112 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807980.1 protein_id gnl|my_center|LOCUS_07440 7333 9183 gene locus_tag LOCUS_07450 gene ilvD 7333 9183 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D9 protein_id gnl|my_center|LOCUS_07450 9185 10735 gene locus_tag LOCUS_07460 gene ilvA 9185 10735 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9E0 protein_id gnl|my_center|LOCUS_07460 11114 12256 gene locus_tag LOCUS_07470 gene agxT 11114 12256 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_07470 14274 12340 gene locus_tag LOCUS_07480 14274 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14567 14334 gene locus_tag LOCUS_07490 14567 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 15094 14564 gene locus_tag LOCUS_07500 15094 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 16877 15459 gene locus_tag LOCUS_07510 gene creD 16877 15459 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073993.1 protein_id gnl|my_center|LOCUS_07510 17067 17906 gene locus_tag LOCUS_07520 17067 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 18239 17979 gene locus_tag LOCUS_07530 18239 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073988.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence037 39 124 gene locus_tag LOCUS_t00060 39 124 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2537 393 gene locus_tag LOCUS_07540 2537 393 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_07540 2777 4165 gene locus_tag LOCUS_07550 2777 4165 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072172.1 protein_id gnl|my_center|LOCUS_07550 4337 4822 gene locus_tag LOCUS_07560 4337 4822 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072173.1 protein_id gnl|my_center|LOCUS_07560 4968 5255 gene locus_tag LOCUS_07570 gene rplY 4968 5255 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF74 protein_id gnl|my_center|LOCUS_07570 6847 5318 gene locus_tag LOCUS_07580 6847 5318 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072795.1 protein_id gnl|my_center|LOCUS_07580 8125 6857 gene locus_tag LOCUS_07590 8125 6857 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59352 protein_id gnl|my_center|LOCUS_07590 10163 8178 gene locus_tag LOCUS_07600 gene prkA 10163 8178 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072793.1 protein_id gnl|my_center|LOCUS_07600 10954 10373 gene locus_tag LOCUS_07610 gene sodB 10954 10373 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED83 protein_id gnl|my_center|LOCUS_07610 11160 11513 gene locus_tag LOCUS_07620 gene grxD 11160 11513 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED84 protein_id gnl|my_center|LOCUS_07620 12826 11594 gene locus_tag LOCUS_07630 gene uraA 12826 11594 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 protein_id gnl|my_center|LOCUS_07630 13024 14130 gene locus_tag LOCUS_07640 13024 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072790.1 protein_id gnl|my_center|LOCUS_07640 14207 14917 gene locus_tag LOCUS_07650 gene hda 14207 14917 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 protein_id gnl|my_center|LOCUS_07650 16973 14997 gene locus_tag LOCUS_07660 16973 14997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072788.1 protein_id gnl|my_center|LOCUS_07660 17756 17385 gene locus_tag LOCUS_07670 17756 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072787.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence038 1457 156 gene locus_tag LOCUS_07680 gene dcuA 1457 156 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E297 protein_id gnl|my_center|LOCUS_07680 1858 4689 gene locus_tag LOCUS_07690 gene exeS 1858 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071959.1 protein_id gnl|my_center|LOCUS_07690 5159 4839 gene locus_tag LOCUS_07700 5159 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_07700 5374 5189 gene locus_tag LOCUS_07710 5374 5189 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072131.1 protein_id gnl|my_center|LOCUS_07710 9099 5647 gene locus_tag LOCUS_07720 9099 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 9644 9336 gene locus_tag LOCUS_07730 9644 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10622 9774 gene locus_tag LOCUS_07740 10622 9774 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_07740 11010 12806 gene locus_tag LOCUS_07750 11010 12806 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072705.1 protein_id gnl|my_center|LOCUS_07750 12948 13217 gene locus_tag LOCUS_07760 12948 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 14024 13392 gene locus_tag LOCUS_07770 14024 13392 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_07770 14529 14666 gene locus_tag LOCUS_07780 14529 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 14717 15124 gene locus_tag LOCUS_07790 14717 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 15284 16210 gene locus_tag LOCUS_07800 15284 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 <17886 16266 gene locus_tag LOCUS_07810 <17886 16266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073394.1:2',3'-cyclic-nucleotide 2'-phosphodiesterase >Feature sequence039 <1 828 gene locus_tag LOCUS_07820 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072927.1:bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase 937 2181 gene locus_tag LOCUS_07830 gene trpB 937 2181 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV0 protein_id gnl|my_center|LOCUS_07830 2168 2986 gene locus_tag LOCUS_07840 gene trpA 2168 2986 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECU9 protein_id gnl|my_center|LOCUS_07840 5209 3113 gene locus_tag LOCUS_07850 5209 3113 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109778.1 protein_id gnl|my_center|LOCUS_07850 5548 6099 gene locus_tag LOCUS_07860 5548 6099 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59365 protein_id gnl|my_center|LOCUS_07860 6172 6471 gene locus_tag LOCUS_07870 gene yciL 6172 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_07870 6491 7297 gene locus_tag LOCUS_07880 gene xth 6491 7297 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072940.1 protein_id gnl|my_center|LOCUS_07880 9593 7407 gene locus_tag LOCUS_07890 9593 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 9768 10232 gene locus_tag LOCUS_07900 9768 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 10225 10827 gene locus_tag LOCUS_07910 10225 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_07910 11150 12880 gene locus_tag LOCUS_07920 gene fadD2 11150 12880 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_07920 13980 12889 gene locus_tag LOCUS_07930 13980 12889 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_07930 14090 16108 gene locus_tag LOCUS_07940 gene fadH 14090 16108 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104734.1 protein_id gnl|my_center|LOCUS_07940 17383 16157 gene locus_tag LOCUS_07950 17383 16157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence040 61 137 gene locus_tag LOCUS_t00070 61 137 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1224 622 gene locus_tag LOCUS_07960 1224 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070751.1 protein_id gnl|my_center|LOCUS_07960 1382 1564 gene locus_tag LOCUS_07970 1382 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1792 1607 gene locus_tag LOCUS_07980 1792 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4568 2772 gene locus_tag LOCUS_07990 4568 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5657 4947 gene locus_tag LOCUS_08000 5657 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 7597 5708 gene locus_tag LOCUS_08010 7597 5708 CDS product HsdS polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105648.1 protein_id gnl|my_center|LOCUS_08010 9084 7597 gene locus_tag LOCUS_08020 9084 7597 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_08020 9336 9740 gene locus_tag LOCUS_08030 9336 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480554.1 protein_id gnl|my_center|LOCUS_08030 10094 9945 gene locus_tag LOCUS_08040 10094 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480562.1 protein_id gnl|my_center|LOCUS_08040 10175 10519 gene locus_tag LOCUS_08050 10175 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 13009 10541 gene locus_tag LOCUS_08060 13009 10541 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_08060 14377 13628 gene locus_tag LOCUS_08070 14377 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 15674 14367 gene locus_tag LOCUS_08080 15674 14367 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 protein_id gnl|my_center|LOCUS_08080 15673 15849 gene locus_tag LOCUS_08090 15673 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 16505 16086 gene locus_tag LOCUS_08100 16505 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence041 132 399 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtgcggcagtgaac 1108 530 gene locus_tag LOCUS_08110 1108 530 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 protein_id gnl|my_center|LOCUS_08110 2139 1117 gene locus_tag LOCUS_08120 2139 1117 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 protein_id gnl|my_center|LOCUS_08120 3105 2155 gene locus_tag LOCUS_08130 3105 2155 CDS product CRISPR type I-F system protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 protein_id gnl|my_center|LOCUS_08130 4361 3102 gene locus_tag LOCUS_08140 4361 3102 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_08140 7714 4355 gene locus_tag LOCUS_08150 7714 4355 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_08150 9118 8102 gene locus_tag LOCUS_08160 9118 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_08160 10036 9209 gene locus_tag LOCUS_08170 10036 9209 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_08170 10248 11475 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtgcggcagtgaac 11830 12333 gene locus_tag LOCUS_08180 11830 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12988 12530 gene locus_tag LOCUS_08190 gene pyrI 12988 12530 CDS product aspartate carbamoyltransferase regulatory chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG1 protein_id gnl|my_center|LOCUS_08190 13920 12985 gene locus_tag LOCUS_08200 gene pyrB 13920 12985 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG0 protein_id gnl|my_center|LOCUS_08200 14846 14457 gene locus_tag LOCUS_08210 14846 14457 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 protein_id gnl|my_center|LOCUS_08210 15360 14938 gene locus_tag LOCUS_08220 15360 14938 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263218.1 protein_id gnl|my_center|LOCUS_08220 15668 15510 gene locus_tag LOCUS_08230 15668 15510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 15752 16762 gene locus_tag LOCUS_08240 15752 16762 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105758.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence042 2 928 gene locus_tag LOCUS_08250 gene yhcC 2 928 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071535.1 protein_id gnl|my_center|LOCUS_08250 1102 1467 gene locus_tag LOCUS_08260 gene hptA 1102 1467 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071536.1 protein_id gnl|my_center|LOCUS_08260 2104 2934 gene locus_tag LOCUS_08270 gene oxyR 2104 2934 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 protein_id gnl|my_center|LOCUS_08270 4065 2986 gene locus_tag LOCUS_08280 gene cyaC 4065 2986 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071538.1 protein_id gnl|my_center|LOCUS_08280 4850 4218 gene locus_tag LOCUS_08290 gene mutH 4850 4218 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH99 protein_id gnl|my_center|LOCUS_08290 5595 6131 gene locus_tag LOCUS_08300 gene rppH 5595 6131 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH98 protein_id gnl|my_center|LOCUS_08300 6190 8415 gene locus_tag LOCUS_08310 gene ptsP 6190 8415 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071541.1 protein_id gnl|my_center|LOCUS_08310 8534 9337 gene locus_tag LOCUS_08320 8534 9337 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH96 protein_id gnl|my_center|LOCUS_08320 9438 10289 gene locus_tag LOCUS_08330 gene thyA 9438 10289 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66108 protein_id gnl|my_center|LOCUS_08330 10613 11794 gene locus_tag LOCUS_08340 gene nhaA 10613 11794 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH93 protein_id gnl|my_center|LOCUS_08340 11823 12206 gene locus_tag LOCUS_08350 11823 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071546.1 protein_id gnl|my_center|LOCUS_08350 12259 13170 gene locus_tag LOCUS_08360 gene nhaR 12259 13170 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071547.1 protein_id gnl|my_center|LOCUS_08360 13389 13589 gene locus_tag LOCUS_08370 13389 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH90 protein_id gnl|my_center|LOCUS_08370 15649 14036 gene locus_tag LOCUS_08380 gene nadB 15649 14036 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH88 protein_id gnl|my_center|LOCUS_08380 15850 16428 gene locus_tag LOCUS_08390 gene rpoE 15850 16428 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence043 1008 184 gene locus_tag LOCUS_08400 gene rlpA 1008 184 CDS product septal ring lipoprotein RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_08400 2075 1071 gene locus_tag LOCUS_08410 gene mltB 2075 1071 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071397.1 protein_id gnl|my_center|LOCUS_08410 3342 2236 gene locus_tag LOCUS_08420 gene mrdB 3342 2236 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_08420 5171 3339 gene locus_tag LOCUS_08430 gene mrdA 5171 3339 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071399.1 protein_id gnl|my_center|LOCUS_08430 5740 5270 gene locus_tag LOCUS_08440 gene rlmH 5740 5270 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP8 protein_id gnl|my_center|LOCUS_08440 6069 5740 gene locus_tag LOCUS_08450 gene rsfS 6069 5740 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP7 protein_id gnl|my_center|LOCUS_08450 6809 6174 gene locus_tag LOCUS_08460 gene nadD 6809 6174 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX46 protein_id gnl|my_center|LOCUS_08460 7857 6817 gene locus_tag LOCUS_08470 gene holA 7857 6817 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 protein_id gnl|my_center|LOCUS_08470 8419 7925 gene locus_tag LOCUS_08480 gene lptE 8419 7925 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP5 protein_id gnl|my_center|LOCUS_08480 11042 8451 gene locus_tag LOCUS_08490 gene leuS 11042 8451 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP4 protein_id gnl|my_center|LOCUS_08490 11162 11662 gene locus_tag LOCUS_08500 11162 11662 CDS product DUF1451 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071406.1 protein_id gnl|my_center|LOCUS_08500 12127 13995 gene locus_tag LOCUS_08510 12127 13995 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233308.2 protein_id gnl|my_center|LOCUS_08510 15649 14105 gene locus_tag LOCUS_08520 gene lnt 15649 14105 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP1 protein_id gnl|my_center|LOCUS_08520 16574 15699 gene locus_tag LOCUS_08530 gene corC 16574 15699 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence044 210 713 gene locus_tag LOCUS_08540 gene s4P 210 713 CDS product queD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072465.1 protein_id gnl|my_center|LOCUS_08540 891 1178 gene locus_tag LOCUS_08550 891 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072464.1 protein_id gnl|my_center|LOCUS_08550 1292 3493 gene locus_tag LOCUS_08560 1292 3493 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072463.1 protein_id gnl|my_center|LOCUS_08560 3896 3540 gene locus_tag LOCUS_08570 3896 3540 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59192 protein_id gnl|my_center|LOCUS_08570 4518 4006 gene locus_tag LOCUS_08580 4518 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072461.1 protein_id gnl|my_center|LOCUS_08580 6635 4797 gene locus_tag LOCUS_08590 6635 4797 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_08590 6831 7469 gene locus_tag LOCUS_08600 gene psrA 6831 7469 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072458.1 protein_id gnl|my_center|LOCUS_08600 7501 9777 gene locus_tag LOCUS_08610 gene fadE1 7501 9777 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072457.1 protein_id gnl|my_center|LOCUS_08610 11724 10285 gene locus_tag LOCUS_08620 gene pykA 11724 10285 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE96 protein_id gnl|my_center|LOCUS_08620 12764 11910 gene locus_tag LOCUS_08630 gene hexR 12764 11910 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 protein_id gnl|my_center|LOCUS_08630 13073 14545 gene locus_tag LOCUS_08640 gene zwf 13073 14545 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE98 protein_id gnl|my_center|LOCUS_08640 14558 15256 gene locus_tag LOCUS_08650 gene pgl 14558 15256 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence045 <1 538 gene locus_tag LOCUS_08660 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJ68:GTPase HflX 579 1721 gene locus_tag LOCUS_08670 gene hflK 579 1721 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070936.1 protein_id gnl|my_center|LOCUS_08670 1724 2602 gene locus_tag LOCUS_08680 gene hflC 1724 2602 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ66 protein_id gnl|my_center|LOCUS_08680 2927 3517 gene locus_tag LOCUS_08690 gene petA 2927 3517 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ64 protein_id gnl|my_center|LOCUS_08690 3517 4731 gene locus_tag LOCUS_08700 gene petB 3517 4731 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ63 protein_id gnl|my_center|LOCUS_08700 4731 5453 gene locus_tag LOCUS_08710 gene petC 4731 5453 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_08710 5560 6189 gene locus_tag LOCUS_08720 gene sspA 5560 6189 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_08720 6189 6707 gene locus_tag LOCUS_08730 gene sspB 6189 6707 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070942.1 protein_id gnl|my_center|LOCUS_08730 6812 7402 gene locus_tag LOCUS_08740 gene pabA 6812 7402 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070943.1 protein_id gnl|my_center|LOCUS_08740 7542 10031 gene locus_tag LOCUS_08750 7542 10031 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_08750 10240 11382 gene locus_tag LOCUS_08760 10240 11382 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070945.1 protein_id gnl|my_center|LOCUS_08760 11833 13050 gene locus_tag LOCUS_08770 gene argD 11833 13050 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59320 protein_id gnl|my_center|LOCUS_08770 13146 14219 gene locus_tag LOCUS_08780 gene astA 13146 14219 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ55 protein_id gnl|my_center|LOCUS_08780 14229 15689 gene locus_tag LOCUS_08790 gene astD 14229 15689 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ54 protein_id gnl|my_center|LOCUS_08790 >Feature sequence046 1606 392 gene locus_tag LOCUS_08800 1606 392 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074053.1 protein_id gnl|my_center|LOCUS_08800 2514 1867 gene locus_tag LOCUS_08810 2514 1867 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_08810 2788 2567 gene locus_tag LOCUS_08820 2788 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_08820 2891 3907 gene locus_tag LOCUS_08830 2891 3907 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E985 protein_id gnl|my_center|LOCUS_08830 3904 4848 gene locus_tag LOCUS_08840 3904 4848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074049.1 protein_id gnl|my_center|LOCUS_08840 4853 5425 gene locus_tag LOCUS_08850 4853 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074048.1 protein_id gnl|my_center|LOCUS_08850 5489 5683 gene locus_tag LOCUS_08860 5489 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6407 5814 gene locus_tag LOCUS_08870 6407 5814 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_08870 7696 6461 gene locus_tag LOCUS_08880 gene fabF 7696 6461 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_08880 8430 7696 gene locus_tag LOCUS_08890 gene fabG 8430 7696 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_08890 8927 8427 gene locus_tag LOCUS_08900 8927 8427 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074035.1 protein_id gnl|my_center|LOCUS_08900 10138 8927 gene locus_tag LOCUS_08910 10138 8927 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_08910 10854 10192 gene locus_tag LOCUS_08920 10854 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074033.1 protein_id gnl|my_center|LOCUS_08920 12133 10868 gene locus_tag LOCUS_08930 12133 10868 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_08930 14526 12130 gene locus_tag LOCUS_08940 14526 12130 CDS product MMPL family efflux pump permease component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074031.1 protein_id gnl|my_center|LOCUS_08940 15329 14523 gene locus_tag LOCUS_08950 15329 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074030.1 protein_id gnl|my_center|LOCUS_08950 15853 15326 gene locus_tag LOCUS_08960 15853 15326 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence047 1875 697 gene locus_tag LOCUS_08970 1875 697 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_08970 2444 2806 gene locus_tag LOCUS_08980 2444 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071674.1 protein_id gnl|my_center|LOCUS_08980 3035 3259 gene locus_tag LOCUS_08990 3035 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071673.1 protein_id gnl|my_center|LOCUS_08990 5083 4073 gene locus_tag LOCUS_09000 gene ybjU 5083 4073 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073208.1 protein_id gnl|my_center|LOCUS_09000 5454 6086 gene locus_tag LOCUS_09010 5454 6086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073212.1 protein_id gnl|my_center|LOCUS_09010 6986 6144 gene locus_tag LOCUS_09020 gene mscS 6986 6144 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_09020 7714 7142 gene locus_tag LOCUS_09030 7714 7142 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073209.1 protein_id gnl|my_center|LOCUS_09030 8856 8296 gene locus_tag LOCUS_09040 8856 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_09040 9050 9367 gene locus_tag LOCUS_09050 9050 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073214.1 protein_id gnl|my_center|LOCUS_09050 9599 9928 gene locus_tag LOCUS_09060 gene yciH 9599 9928 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073215.1 protein_id gnl|my_center|LOCUS_09060 9998 10558 gene locus_tag LOCUS_09070 9998 10558 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ9 protein_id gnl|my_center|LOCUS_09070 10604 11026 gene locus_tag LOCUS_09080 10604 11026 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ8 protein_id gnl|my_center|LOCUS_09080 12205 11093 gene locus_tag LOCUS_09090 gene pilU 12205 11093 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 protein_id gnl|my_center|LOCUS_09090 13188 12229 gene locus_tag LOCUS_09100 gene pilT 13188 12229 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_09100 13270 14004 gene locus_tag LOCUS_09110 gene yggS 13270 14004 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 protein_id gnl|my_center|LOCUS_09110 14137 14955 gene locus_tag LOCUS_09120 gene proC 14137 14955 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ1 protein_id gnl|my_center|LOCUS_09120 15031 15579 gene locus_tag LOCUS_09130 gene yggT 15031 15579 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_09130 15583 15921 gene locus_tag LOCUS_09140 15583 15921 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBY9 protein_id gnl|my_center|LOCUS_09140 >Feature sequence048 522 872 gene locus_tag LOCUS_09150 522 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3132 910 gene locus_tag LOCUS_09160 gene plpD 3132 910 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070786.1 protein_id gnl|my_center|LOCUS_09160 7668 3247 gene locus_tag LOCUS_09170 7668 3247 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070785.1 protein_id gnl|my_center|LOCUS_09170 12304 7925 gene locus_tag LOCUS_09180 12304 7925 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070785.1 protein_id gnl|my_center|LOCUS_09180 14032 12602 gene locus_tag LOCUS_09190 gene lpdA 14032 12602 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN7 protein_id gnl|my_center|LOCUS_09190 16069 14192 gene locus_tag LOCUS_09200 16069 14192 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LU3 protein_id gnl|my_center|LOCUS_09200 >Feature sequence049 1351 320 gene locus_tag LOCUS_09210 1351 320 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263714.1 protein_id gnl|my_center|LOCUS_09210 1659 1348 gene locus_tag LOCUS_09220 1659 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3209 1932 gene locus_tag LOCUS_09230 gene pepB 3209 1932 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071165.1 protein_id gnl|my_center|LOCUS_09230 3334 4050 gene locus_tag LOCUS_09240 gene sfsA 3334 4050 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG4 protein_id gnl|my_center|LOCUS_09240 4210 4653 gene locus_tag LOCUS_09250 gene dksA 4210 4653 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG5 protein_id gnl|my_center|LOCUS_09250 4792 5664 gene locus_tag LOCUS_09260 gene gluQ 4792 5664 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG6 protein_id gnl|my_center|LOCUS_09260 5889 7244 gene locus_tag LOCUS_09270 gene pcnB 5889 7244 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG7 protein_id gnl|my_center|LOCUS_09270 7244 7735 gene locus_tag LOCUS_09280 gene folK 7244 7735 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071161.1 protein_id gnl|my_center|LOCUS_09280 7821 8615 gene locus_tag LOCUS_09290 gene panB 7821 8615 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_09290 8767 9612 gene locus_tag LOCUS_09300 gene panC 8767 9612 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH0 protein_id gnl|my_center|LOCUS_09300 9698 10081 gene locus_tag LOCUS_09310 9698 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10908 10132 gene locus_tag LOCUS_09320 10908 10132 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAU1 protein_id gnl|my_center|LOCUS_09320 11963 10905 gene locus_tag LOCUS_09330 11963 10905 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073574.1 protein_id gnl|my_center|LOCUS_09330 12713 12183 gene locus_tag LOCUS_09340 gene hprT 12713 12183 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073575.1 protein_id gnl|my_center|LOCUS_09340 13417 12755 gene locus_tag LOCUS_09350 gene ubiX 13417 12755 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT8 protein_id gnl|my_center|LOCUS_09350 14897 13470 gene locus_tag LOCUS_09360 gene mpl 14897 13470 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT7 protein_id gnl|my_center|LOCUS_09360 >Feature sequence050 <1 999 gene locus_tag LOCUS_09370 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B6Q0:magnesium transporter MgtE 1167 1976 gene locus_tag LOCUS_09380 1167 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074288.1 protein_id gnl|my_center|LOCUS_09380 2765 2124 gene locus_tag LOCUS_09390 2765 2124 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071069.1 protein_id gnl|my_center|LOCUS_09390 3685 2861 gene locus_tag LOCUS_09400 3685 2861 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071070.1 protein_id gnl|my_center|LOCUS_09400 3883 4713 gene locus_tag LOCUS_09410 gene nadE 3883 4713 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF2 protein_id gnl|my_center|LOCUS_09410 5290 4802 gene locus_tag LOCUS_09420 5290 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072106.1 protein_id gnl|my_center|LOCUS_09420 5468 6889 gene locus_tag LOCUS_09430 5468 6889 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 protein_id gnl|my_center|LOCUS_09430 6982 7863 gene locus_tag LOCUS_09440 6982 7863 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_09440 7875 11432 gene locus_tag LOCUS_09450 7875 11432 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_09450 13867 11681 gene locus_tag LOCUS_09460 13867 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14146 14427 gene locus_tag LOCUS_09470 14146 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 15207 14569 gene locus_tag LOCUS_09480 15207 14569 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_09480 15804 15728 gene locus_tag LOCUS_t00080 15804 15728 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 35 613 gene locus_tag LOCUS_09490 gene nfuA 35 613 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P2 protein_id gnl|my_center|LOCUS_09490 2065 728 gene locus_tag LOCUS_09500 gene dinF 2065 728 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 protein_id gnl|my_center|LOCUS_09500 2087 3145 gene locus_tag LOCUS_09510 2087 3145 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_09510 4214 3171 gene locus_tag LOCUS_09520 gene cheB1 4214 3171 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_09520 5152 4268 gene locus_tag LOCUS_09530 gene cheR3 5152 4268 CDS product chemotaxis protein methyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKL3 protein_id gnl|my_center|LOCUS_09530 8494 5276 gene locus_tag LOCUS_09540 8494 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 9084 8512 gene locus_tag LOCUS_09550 gene cheW 9084 8512 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_09550 11204 9195 gene locus_tag LOCUS_09560 11204 9195 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_09560 11607 11245 gene locus_tag LOCUS_09570 gene cheY 11607 11245 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_09570 11918 11610 gene locus_tag LOCUS_09580 11918 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 12177 13427 gene locus_tag LOCUS_09590 12177 13427 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095134.1 protein_id gnl|my_center|LOCUS_09590 13424 14089 gene locus_tag LOCUS_09600 13424 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 14102 14341 gene locus_tag LOCUS_09610 14102 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14396 14950 gene locus_tag LOCUS_09620 14396 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence052 319 1755 gene locus_tag LOCUS_09630 319 1755 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 protein_id gnl|my_center|LOCUS_09630 4489 3143 gene locus_tag LOCUS_09640 4489 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6137 4635 gene locus_tag LOCUS_09650 6137 4635 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073484.1 protein_id gnl|my_center|LOCUS_09650 7658 6447 gene locus_tag LOCUS_09660 7658 6447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073485.1 protein_id gnl|my_center|LOCUS_09660 8993 7692 gene locus_tag LOCUS_09670 8993 7692 CDS product ABC macrolide family export system permease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073486.1 protein_id gnl|my_center|LOCUS_09670 9811 9005 gene locus_tag LOCUS_09680 9811 9005 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073487.1 protein_id gnl|my_center|LOCUS_09680 10376 9981 gene locus_tag LOCUS_09690 10376 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11652 10387 gene locus_tag LOCUS_09700 11652 10387 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_09700 12224 12571 gene locus_tag LOCUS_09710 12224 12571 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947495.1 protein_id gnl|my_center|LOCUS_09710 13001 12618 gene locus_tag LOCUS_09720 13001 12618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073500.1 protein_id gnl|my_center|LOCUS_09720 13886 13062 gene locus_tag LOCUS_09730 gene btuF 13886 13062 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_09730 14049 14135 gene locus_tag LOCUS_t00090 14049 14135 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15622 15455 gene locus_tag LOCUS_09740 15622 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence053 518 1591 gene locus_tag LOCUS_09750 518 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1603 2958 gene locus_tag LOCUS_09760 1603 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2930 3337 gene locus_tag LOCUS_09770 2930 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704480.1 protein_id gnl|my_center|LOCUS_09770 3334 4527 gene locus_tag LOCUS_09780 3334 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4506 6041 gene locus_tag LOCUS_09790 4506 6041 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_09790 6117 7349 gene locus_tag LOCUS_09800 6117 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 7346 8119 gene locus_tag LOCUS_09810 7346 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9374 8145 gene locus_tag LOCUS_09820 gene sstT 9374 8145 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL5 protein_id gnl|my_center|LOCUS_09820 10455 9559 gene locus_tag LOCUS_09830 gene cheV 10455 9559 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 protein_id gnl|my_center|LOCUS_09830 12074 10548 gene locus_tag LOCUS_09840 12074 10548 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479787.1 protein_id gnl|my_center|LOCUS_09840 12587 12117 gene locus_tag LOCUS_09850 12587 12117 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073020.1 protein_id gnl|my_center|LOCUS_09850 13994 12690 gene locus_tag LOCUS_09860 13994 12690 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_09860 14715 14167 gene locus_tag LOCUS_09870 gene ogt 14715 14167 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL1 protein_id gnl|my_center|LOCUS_09870 15566 14712 gene locus_tag LOCUS_09880 15566 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence054 404 580 gene locus_tag LOCUS_09890 404 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 984 1199 gene locus_tag LOCUS_09900 984 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530530.1 protein_id gnl|my_center|LOCUS_09900 1452 1775 gene locus_tag LOCUS_09910 1452 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09910 3206 1992 gene locus_tag LOCUS_09920 3206 1992 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072239.1 protein_id gnl|my_center|LOCUS_09920 4713 3436 gene locus_tag LOCUS_09930 gene gluP 4713 3436 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225587.1 protein_id gnl|my_center|LOCUS_09930 6411 4774 gene locus_tag LOCUS_09940 gene algA 6411 4774 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_09940 6903 9632 gene locus_tag LOCUS_09950 gene malA 6903 9632 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_09950 9715 11226 gene locus_tag LOCUS_09960 9715 11226 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 protein_id gnl|my_center|LOCUS_09960 11223 12623 gene locus_tag LOCUS_09970 11223 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12776 14752 gene locus_tag LOCUS_09980 12776 14752 CDS product O-glycosyl hydrolase family 13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_09980 <15542 14951 gene locus_tag LOCUS_09990 <15542 14951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000010608.1:ATP-dependent RNA helicase RhlE >Feature sequence055 5350 887 gene locus_tag LOCUS_10000 5350 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 6509 5364 gene locus_tag LOCUS_10010 6509 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7306 6743 gene locus_tag LOCUS_10020 7306 6743 CDS product PilD processed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071407.1 protein_id gnl|my_center|LOCUS_10020 7597 9738 gene locus_tag LOCUS_10030 7597 9738 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263020.1 protein_id gnl|my_center|LOCUS_10030 9837 10334 gene locus_tag LOCUS_10040 9837 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 12076 10442 gene locus_tag LOCUS_10050 12076 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 protein_id gnl|my_center|LOCUS_10050 12411 12160 gene locus_tag LOCUS_10060 12411 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 12724 12401 gene locus_tag LOCUS_10070 12724 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 13034 13198 gene locus_tag LOCUS_10080 13034 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence056 1781 2164 gene locus_tag LOCUS_10090 gene cueR 1781 2164 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071836.1 protein_id gnl|my_center|LOCUS_10090 4296 2257 gene locus_tag LOCUS_10100 4296 2257 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071835.1 protein_id gnl|my_center|LOCUS_10100 4589 4329 gene locus_tag LOCUS_10110 4589 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071834.1 protein_id gnl|my_center|LOCUS_10110 5557 4799 gene locus_tag LOCUS_10120 gene ivdG 5557 4799 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 protein_id gnl|my_center|LOCUS_10120 6482 5562 gene locus_tag LOCUS_10130 gene ivdF 6482 5562 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC2 protein_id gnl|my_center|LOCUS_10130 7755 6622 gene locus_tag LOCUS_10140 gene ivdE 7755 6622 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_10140 8528 7755 gene locus_tag LOCUS_10150 gene ivdD 8528 7755 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 protein_id gnl|my_center|LOCUS_10150 9745 8588 gene locus_tag LOCUS_10160 gene ivdC 9745 8588 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_10160 11400 9895 gene locus_tag LOCUS_10170 gene ivdB 11400 9895 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 protein_id gnl|my_center|LOCUS_10170 12793 11603 gene locus_tag LOCUS_10180 gene ivdA 12793 11603 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_10180 14188 13241 gene locus_tag LOCUS_10190 gene metA 14188 13241 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC8 protein_id gnl|my_center|LOCUS_10190 14440 14261 gene locus_tag LOCUS_10200 14440 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence057 426 79 gene locus_tag LOCUS_10210 gene sdhD 426 79 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSF7 protein_id gnl|my_center|LOCUS_10210 794 420 gene locus_tag LOCUS_10220 gene sdhC 794 420 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072026.1 protein_id gnl|my_center|LOCUS_10220 1227 2519 gene locus_tag LOCUS_10230 gene gltA 1227 2519 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFP4 protein_id gnl|my_center|LOCUS_10230 3302 2598 gene locus_tag LOCUS_10240 3302 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3223 3495 gene locus_tag LOCUS_10250 3223 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4868 3786 gene locus_tag LOCUS_10260 4868 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5695 7278 gene locus_tag LOCUS_10270 5695 7278 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479531.1 protein_id gnl|my_center|LOCUS_10270 7650 8777 gene locus_tag LOCUS_10280 7650 8777 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_10280 8791 12060 gene locus_tag LOCUS_10290 8791 12060 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence058 1581 208 gene locus_tag LOCUS_10300 1581 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2402 4153 gene locus_tag LOCUS_10310 2402 4153 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG94 protein_id gnl|my_center|LOCUS_10310 4158 5888 gene locus_tag LOCUS_10320 gene hutH 4158 5888 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA45 protein_id gnl|my_center|LOCUS_10320 5903 7648 gene locus_tag LOCUS_10330 5903 7648 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947938.1 protein_id gnl|my_center|LOCUS_10330 7661 8737 gene locus_tag LOCUS_10340 gene fabH2 7661 8737 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CUB8 protein_id gnl|my_center|LOCUS_10340 8755 8997 gene locus_tag LOCUS_10350 8755 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10642 9308 gene locus_tag LOCUS_10360 10642 9308 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA2 protein_id gnl|my_center|LOCUS_10360 11277 10690 gene locus_tag LOCUS_10370 11277 10690 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA3 protein_id gnl|my_center|LOCUS_10370 12608 11394 gene locus_tag LOCUS_10380 gene yfbQ 12608 11394 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072448.1 protein_id gnl|my_center|LOCUS_10380 13579 13016 gene locus_tag LOCUS_10390 gene efp 13579 13016 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP9 protein_id gnl|my_center|LOCUS_10390 14799 13627 gene locus_tag LOCUS_10400 14799 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence059 <1 705 gene locus_tag LOCUS_10410 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074242.1:two-component sensor histidine kinase 3873 778 gene locus_tag LOCUS_10420 3873 778 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073327.1 protein_id gnl|my_center|LOCUS_10420 5012 3873 gene locus_tag LOCUS_10430 5012 3873 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073326.1 protein_id gnl|my_center|LOCUS_10430 5314 5766 gene locus_tag LOCUS_10440 5314 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5931 6410 gene locus_tag LOCUS_10450 5931 6410 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 protein_id gnl|my_center|LOCUS_10450 8561 6771 gene locus_tag LOCUS_10460 8561 6771 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071730.1 protein_id gnl|my_center|LOCUS_10460 8790 9680 gene locus_tag LOCUS_10470 8790 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11027 10056 gene locus_tag LOCUS_10480 gene pstS 11027 10056 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_10480 12594 11248 gene locus_tag LOCUS_10490 gene phoR 12594 11248 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071728.1 protein_id gnl|my_center|LOCUS_10490 13327 12638 gene locus_tag LOCUS_10500 gene phoB 13327 12638 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 protein_id gnl|my_center|LOCUS_10500 14476 13520 gene locus_tag LOCUS_10510 14476 13520 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence060 132 917 gene locus_tag LOCUS_10520 gene speE 132 917 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60594 protein_id gnl|my_center|LOCUS_10520 1491 1060 gene locus_tag LOCUS_10530 1491 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070549.1 protein_id gnl|my_center|LOCUS_10530 3594 1930 gene locus_tag LOCUS_10540 3594 1930 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883104.1 protein_id gnl|my_center|LOCUS_10540 3704 3931 gene locus_tag LOCUS_10550 3704 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4122 5534 gene locus_tag LOCUS_10560 gene sbcB 4122 5534 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG2 protein_id gnl|my_center|LOCUS_10560 5630 6520 gene locus_tag LOCUS_10570 gene cdd 5630 6520 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG1 protein_id gnl|my_center|LOCUS_10570 7472 6597 gene locus_tag LOCUS_10580 gene garR 7472 6597 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 protein_id gnl|my_center|LOCUS_10580 8023 7544 gene locus_tag LOCUS_10590 gene yciA 8023 7544 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072708.1 protein_id gnl|my_center|LOCUS_10590 8495 8127 gene locus_tag LOCUS_10600 8495 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072709.1 protein_id gnl|my_center|LOCUS_10600 9935 8697 gene locus_tag LOCUS_10610 gene fabF 9935 8697 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH5 protein_id gnl|my_center|LOCUS_10610 10339 10106 gene locus_tag LOCUS_10620 gene acpP 10339 10106 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH4 protein_id gnl|my_center|LOCUS_10620 11355 10609 gene locus_tag LOCUS_10630 gene fabG 11355 10609 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_10630 12291 11365 gene locus_tag LOCUS_10640 gene fabD 12291 11365 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH2 protein_id gnl|my_center|LOCUS_10640 13323 12364 gene locus_tag LOCUS_10650 gene fabH 13323 12364 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH1 protein_id gnl|my_center|LOCUS_10650 14364 13336 gene locus_tag LOCUS_10660 gene plsX 14364 13336 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH0 protein_id gnl|my_center|LOCUS_10660 14550 14380 gene locus_tag LOCUS_10670 gene rpmF 14550 14380 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG9 protein_id gnl|my_center|LOCUS_10670 >Feature sequence061 200 955 gene locus_tag LOCUS_10680 gene bamD 200 955 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE4 protein_id gnl|my_center|LOCUS_10680 1236 1311 gene locus_tag LOCUS_t00100 1236 1311 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1484 1807 gene locus_tag LOCUS_10690 1484 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2779 2090 gene locus_tag LOCUS_10700 gene rsuA 2779 2090 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW18 protein_id gnl|my_center|LOCUS_10700 2739 2978 gene locus_tag LOCUS_10710 2739 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3383 5467 gene locus_tag LOCUS_10720 gene pepO 3383 5467 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_10720 5652 6455 gene locus_tag LOCUS_10730 gene relV 5652 6455 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073608.1 protein_id gnl|my_center|LOCUS_10730 6616 7017 gene locus_tag LOCUS_10740 6616 7017 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073609.1 protein_id gnl|my_center|LOCUS_10740 7155 7655 gene locus_tag LOCUS_10750 7155 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073610.1 protein_id gnl|my_center|LOCUS_10750 8399 7776 gene locus_tag LOCUS_10760 8399 7776 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_10760 11043 8500 gene locus_tag LOCUS_10770 11043 8500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918466.1 protein_id gnl|my_center|LOCUS_10770 11398 12705 gene locus_tag LOCUS_10780 11398 12705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_10780 12717 14228 gene locus_tag LOCUS_10790 12717 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence062 1371 136 gene locus_tag LOCUS_10800 gene ftsA 1371 136 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q0 protein_id gnl|my_center|LOCUS_10800 2183 1371 gene locus_tag LOCUS_10810 gene ftsQ 2183 1371 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P9 protein_id gnl|my_center|LOCUS_10810 3739 2270 gene locus_tag LOCUS_10820 gene murC 3739 2270 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P8 protein_id gnl|my_center|LOCUS_10820 4838 3741 gene locus_tag LOCUS_10830 gene murG 4838 3741 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX35 protein_id gnl|my_center|LOCUS_10830 6052 4838 gene locus_tag LOCUS_10840 gene ftsW 6052 4838 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P7 protein_id gnl|my_center|LOCUS_10840 7394 6045 gene locus_tag LOCUS_10850 gene murD 7394 6045 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P6 protein_id gnl|my_center|LOCUS_10850 8483 7401 gene locus_tag LOCUS_10860 gene mraY 8483 7401 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P5 protein_id gnl|my_center|LOCUS_10860 9850 8483 gene locus_tag LOCUS_10870 gene murF 9850 8483 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P4 protein_id gnl|my_center|LOCUS_10870 11325 9847 gene locus_tag LOCUS_10880 gene murE 11325 9847 CDS product UDP-N-acetylmuramyl-tripeptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P3 protein_id gnl|my_center|LOCUS_10880 13067 11325 gene locus_tag LOCUS_10890 gene ftsI 13067 11325 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_10890 13462 13148 gene locus_tag LOCUS_10900 gene ftsL 13462 13148 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P1 protein_id gnl|my_center|LOCUS_10900 14472 13531 gene locus_tag LOCUS_10910 gene rsmH 14472 13531 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P0 protein_id gnl|my_center|LOCUS_10910 >Feature sequence063 302 1408 gene locus_tag LOCUS_10920 gene oel1 302 1408 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_10920 1608 2648 gene locus_tag LOCUS_10930 gene selD 1608 2648 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK99 protein_id gnl|my_center|LOCUS_10930 2648 3757 gene locus_tag LOCUS_10940 gene selU 2648 3757 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKA0 protein_id gnl|my_center|LOCUS_10940 5556 3787 gene locus_tag LOCUS_10950 5556 3787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070590.1 protein_id gnl|my_center|LOCUS_10950 6472 5657 gene locus_tag LOCUS_10960 gene cysQ 6472 5657 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 protein_id gnl|my_center|LOCUS_10960 7088 6543 gene locus_tag LOCUS_10970 gene nudE 7088 6543 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 protein_id gnl|my_center|LOCUS_10970 7272 7937 gene locus_tag LOCUS_10980 gene yrfG 7272 7937 CDS product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070574.1 protein_id gnl|my_center|LOCUS_10980 8782 8021 gene locus_tag LOCUS_10990 gene gspN 8782 8021 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 protein_id gnl|my_center|LOCUS_10990 9284 8808 gene locus_tag LOCUS_11000 gene gspM 9284 8808 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC0 protein_id gnl|my_center|LOCUS_11000 10479 9286 gene locus_tag LOCUS_11010 gene gspL 10479 9286 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_11010 11578 10577 gene locus_tag LOCUS_11020 gene gspK 11578 10577 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC2 protein_id gnl|my_center|LOCUS_11020 12323 11655 gene locus_tag LOCUS_11030 gene gspJ 12323 11655 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070569.1 protein_id gnl|my_center|LOCUS_11030 12693 12304 gene locus_tag LOCUS_11040 gene gspI 12693 12304 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070568.1 protein_id gnl|my_center|LOCUS_11040 13279 12683 gene locus_tag LOCUS_11050 gene gspH 13279 12683 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 protein_id gnl|my_center|LOCUS_11050 13796 13362 gene locus_tag LOCUS_11060 gene gspG 13796 13362 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 protein_id gnl|my_center|LOCUS_11060 <14410 13903 gene locus_tag LOCUS_11070 <14410 13903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070565.1:type II secretion system protein GspF >Feature sequence064 1115 1450 gene locus_tag LOCUS_11080 1115 1450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070901.1 protein_id gnl|my_center|LOCUS_11080 1687 1562 gene locus_tag LOCUS_11090 1687 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2583 3797 gene locus_tag LOCUS_11100 2583 3797 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_11100 3781 4695 gene locus_tag LOCUS_11110 gene znuA 3781 4695 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_11110 4776 5579 gene locus_tag LOCUS_11120 gene znuB 4776 5579 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_11120 5746 6471 gene locus_tag LOCUS_11130 gene plsC 5746 6471 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA1 protein_id gnl|my_center|LOCUS_11130 6650 7066 gene locus_tag LOCUS_11140 gene rraB 6650 7066 CDS product regulator of ribonuclease activity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA0 protein_id gnl|my_center|LOCUS_11140 8106 7141 gene locus_tag LOCUS_11150 8106 7141 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_11150 9115 8120 gene locus_tag LOCUS_11160 gene cheC 9115 8120 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_11160 9328 10134 gene locus_tag LOCUS_11170 9328 10134 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 protein_id gnl|my_center|LOCUS_11170 10984 10232 gene locus_tag LOCUS_11180 10984 10232 CDS product DUF3530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070912.1 protein_id gnl|my_center|LOCUS_11180 14224 11318 gene locus_tag LOCUS_11190 gene rapA 14224 11318 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ93 protein_id gnl|my_center|LOCUS_11190 >Feature sequence065 1478 939 gene locus_tag LOCUS_11200 gene pilP 1478 939 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070656.1 protein_id gnl|my_center|LOCUS_11200 2101 1475 gene locus_tag LOCUS_11210 gene pilO 2101 1475 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070655.1 protein_id gnl|my_center|LOCUS_11210 2673 2098 gene locus_tag LOCUS_11220 gene pilN 2673 2098 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070654.1 protein_id gnl|my_center|LOCUS_11220 3704 2661 gene locus_tag LOCUS_11230 gene pilM 3704 2661 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 protein_id gnl|my_center|LOCUS_11230 3926 6451 gene locus_tag LOCUS_11240 gene mcrA 3926 6451 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 protein_id gnl|my_center|LOCUS_11240 7919 6555 gene locus_tag LOCUS_11250 gene argH 7919 6555 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK27 protein_id gnl|my_center|LOCUS_11250 9214 7991 gene locus_tag LOCUS_11260 gene argG 9214 7991 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK28 protein_id gnl|my_center|LOCUS_11260 10189 9281 gene locus_tag LOCUS_11270 gene argF 10189 9281 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK29 protein_id gnl|my_center|LOCUS_11270 11077 10292 gene locus_tag LOCUS_11280 gene argB 11077 10292 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59301 protein_id gnl|my_center|LOCUS_11280 12081 11101 gene locus_tag LOCUS_11290 gene argC 12081 11101 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59309 protein_id gnl|my_center|LOCUS_11290 12347 13498 gene locus_tag LOCUS_11300 gene argE 12347 13498 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFQ7 protein_id gnl|my_center|LOCUS_11300 >Feature sequence066 1603 497 gene locus_tag LOCUS_11310 1603 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2710 1844 gene locus_tag LOCUS_11320 gene ubiA 2710 1844 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJJ5 protein_id gnl|my_center|LOCUS_11320 4984 2819 gene locus_tag LOCUS_11330 gene uvrD 4984 2819 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJJ6 protein_id gnl|my_center|LOCUS_11330 5463 5110 gene locus_tag LOCUS_11340 gene yoaB 5463 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_11340 6506 5565 gene locus_tag LOCUS_11350 6506 5565 CDS product stomatin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073827.1 protein_id gnl|my_center|LOCUS_11350 7450 6503 gene locus_tag LOCUS_11360 7450 6503 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073828.1 protein_id gnl|my_center|LOCUS_11360 7969 7508 gene locus_tag LOCUS_11370 7969 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073829.1 protein_id gnl|my_center|LOCUS_11370 9152 8391 gene locus_tag LOCUS_11380 gene udp 9152 8391 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9X9 protein_id gnl|my_center|LOCUS_11380 10074 9610 gene locus_tag LOCUS_11390 10074 9610 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 protein_id gnl|my_center|LOCUS_11390 11267 10383 gene locus_tag LOCUS_11400 11267 10383 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_11400 11483 11728 gene locus_tag LOCUS_11410 11483 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 12248 11790 gene locus_tag LOCUS_11420 gene elaA 12248 11790 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070867.1 protein_id gnl|my_center|LOCUS_11420 14082 12403 gene locus_tag LOCUS_11430 14082 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence067 1 441 gene locus_tag LOCUS_11440 1 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1837 512 gene locus_tag LOCUS_11450 1837 512 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070951.1 protein_id gnl|my_center|LOCUS_11450 2511 1837 gene locus_tag LOCUS_11460 2511 1837 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070952.1 protein_id gnl|my_center|LOCUS_11460 2881 2543 gene locus_tag LOCUS_11470 2881 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070953.1 protein_id gnl|my_center|LOCUS_11470 3599 2964 gene locus_tag LOCUS_11480 gene crp 3599 2964 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 protein_id gnl|my_center|LOCUS_11480 4054 4845 gene locus_tag LOCUS_11490 4054 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070955.1 protein_id gnl|my_center|LOCUS_11490 6144 5257 gene locus_tag LOCUS_11500 6144 5257 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG1 protein_id gnl|my_center|LOCUS_11500 6548 6312 gene locus_tag LOCUS_11510 6548 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071168.1 protein_id gnl|my_center|LOCUS_11510 7522 6551 gene locus_tag LOCUS_11520 gene yheT 7522 6551 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_11520 7703 8212 gene locus_tag LOCUS_11530 7703 8212 CDS product TAT leader-containing periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071170.1 protein_id gnl|my_center|LOCUS_11530 8307 9902 gene locus_tag LOCUS_11540 8307 9902 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_11540 10403 9960 gene locus_tag LOCUS_11550 10403 9960 CDS product DUF2390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071173.1 protein_id gnl|my_center|LOCUS_11550 12403 10493 gene locus_tag LOCUS_11560 gene yheS 12403 10493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071174.1 protein_id gnl|my_center|LOCUS_11560 12585 12785 gene locus_tag LOCUS_11570 12585 12785 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071175.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence068 562 729 gene locus_tag LOCUS_11580 562 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1137 1586 gene locus_tag LOCUS_11590 gene yvbK 1137 1586 CDS product putative N-acetyltransferase YvbK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32248 protein_id gnl|my_center|LOCUS_11590 1654 2307 gene locus_tag LOCUS_11600 1654 2307 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_11600 4010 2706 gene locus_tag LOCUS_11610 4010 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4877 5104 gene locus_tag LOCUS_11620 4877 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6299 5547 gene locus_tag LOCUS_11630 6299 5547 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 protein_id gnl|my_center|LOCUS_11630 8726 6450 gene locus_tag LOCUS_11640 8726 6450 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 protein_id gnl|my_center|LOCUS_11640 9154 10530 gene locus_tag LOCUS_11650 9154 10530 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073737.1 protein_id gnl|my_center|LOCUS_11650 11608 10859 gene locus_tag LOCUS_11660 gene menA 11608 10859 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFQ9 protein_id gnl|my_center|LOCUS_11660 12116 13015 gene locus_tag LOCUS_11670 gene tesB 12116 13015 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 protein_id gnl|my_center|LOCUS_11670 13079 13477 gene locus_tag LOCUS_11680 gene ybaY 13079 13477 CDS product chaperone for general secretion pathway YbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072015.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence069 1441 2805 gene locus_tag LOCUS_11690 1441 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_11690 2859 3884 gene locus_tag LOCUS_11700 2859 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_11700 3897 6212 gene locus_tag LOCUS_11710 3897 6212 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_11710 6479 11317 gene locus_tag LOCUS_11720 gene gdh 6479 11317 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_11720 11382 12401 gene locus_tag LOCUS_11730 gene pyrD 11382 12401 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDZ8 protein_id gnl|my_center|LOCUS_11730 12567 13100 gene locus_tag LOCUS_11740 gene zapC 12567 13100 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDZ9 protein_id gnl|my_center|LOCUS_11740 >Feature sequence070 311 505 gene locus_tag LOCUS_11750 311 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11750 2055 835 gene locus_tag LOCUS_11760 2055 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 protein_id gnl|my_center|LOCUS_11760 2982 2056 gene locus_tag LOCUS_11770 2982 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4124 2991 gene locus_tag LOCUS_11780 4124 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_11780 5181 4117 gene locus_tag LOCUS_11790 5181 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_11790 7363 6035 gene locus_tag LOCUS_11800 7363 6035 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 protein_id gnl|my_center|LOCUS_11800 7989 7450 gene locus_tag LOCUS_11810 gene vspR 7989 7450 CDS product transcriptional regulator VspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVG9 protein_id gnl|my_center|LOCUS_11810 8121 8327 gene locus_tag LOCUS_11820 8121 8327 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_11820 9046 9942 gene locus_tag LOCUS_11830 9046 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 10816 10178 gene locus_tag LOCUS_11840 10816 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 <13763 10813 gene locus_tag LOCUS_11850 <13763 10813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477239.1:integrase >Feature sequence071 257 99 gene locus_tag LOCUS_11860 257 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073011.1 protein_id gnl|my_center|LOCUS_11860 424 1017 gene locus_tag LOCUS_11870 424 1017 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073012.1 protein_id gnl|my_center|LOCUS_11870 1143 1805 gene locus_tag LOCUS_11880 1143 1805 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 protein_id gnl|my_center|LOCUS_11880 2316 1915 gene locus_tag LOCUS_11890 2316 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073015.1 protein_id gnl|my_center|LOCUS_11890 2931 4208 gene locus_tag LOCUS_11900 2931 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4195 5391 gene locus_tag LOCUS_11910 4195 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 5388 6236 gene locus_tag LOCUS_11920 5388 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6229 6849 gene locus_tag LOCUS_11930 6229 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11930 6873 7184 gene locus_tag LOCUS_11940 6873 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7256 8518 gene locus_tag LOCUS_11950 7256 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8550 9746 gene locus_tag LOCUS_11960 8550 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 9791 11038 gene locus_tag LOCUS_11970 9791 11038 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_11970 11004 12146 gene locus_tag LOCUS_11980 11004 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence072 1121 546 gene locus_tag LOCUS_11990 1121 546 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073871.1 protein_id gnl|my_center|LOCUS_11990 1344 1799 gene locus_tag LOCUS_12000 1344 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2055 4208 gene locus_tag LOCUS_12010 2055 4208 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_12010 4275 5612 gene locus_tag LOCUS_12020 4275 5612 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338058.1 protein_id gnl|my_center|LOCUS_12020 5609 7321 gene locus_tag LOCUS_12030 5609 7321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 protein_id gnl|my_center|LOCUS_12030 7323 8006 gene locus_tag LOCUS_12040 7323 8006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709894.1 protein_id gnl|my_center|LOCUS_12040 8049 8666 gene locus_tag LOCUS_12050 8049 8666 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307237.1 protein_id gnl|my_center|LOCUS_12050 9233 10042 gene locus_tag LOCUS_12060 9233 10042 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_12060 10272 10739 gene locus_tag LOCUS_12070 10272 10739 CDS product DUF386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 protein_id gnl|my_center|LOCUS_12070 11041 13353 gene locus_tag LOCUS_12080 11041 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence073 147 839 gene locus_tag LOCUS_12090 147 839 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_12090 922 3282 gene locus_tag LOCUS_12100 922 3282 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_12100 3429 4607 gene locus_tag LOCUS_12110 gene metC 3429 4607 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_12110 5351 4710 gene locus_tag LOCUS_12120 5351 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 5595 6773 gene locus_tag LOCUS_12130 5595 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7614 6862 gene locus_tag LOCUS_12140 gene ybgI 7614 6862 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX0 protein_id gnl|my_center|LOCUS_12140 7891 8097 gene locus_tag LOCUS_12150 7891 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 8610 8128 gene locus_tag LOCUS_12160 8610 8128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072571.1 protein_id gnl|my_center|LOCUS_12160 8666 9376 gene locus_tag LOCUS_12170 gene aat 8666 9376 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW8 protein_id gnl|my_center|LOCUS_12170 9366 10079 gene locus_tag LOCUS_12180 gene ate 9366 10079 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW7 protein_id gnl|my_center|LOCUS_12180 10218 10436 gene locus_tag LOCUS_12190 gene infA 10218 10436 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69225 protein_id gnl|my_center|LOCUS_12190 11457 10540 gene locus_tag LOCUS_12200 11457 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12200 12798 11518 gene locus_tag LOCUS_12210 12798 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12210 13144 12836 gene locus_tag LOCUS_12220 gene clpS 13144 12836 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW4 protein_id gnl|my_center|LOCUS_12220 >Feature sequence074 819 4088 gene locus_tag LOCUS_12230 819 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4161 4697 gene locus_tag LOCUS_12240 4161 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_12240 4744 4977 gene locus_tag LOCUS_12250 4744 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4934 6418 gene locus_tag LOCUS_12260 4934 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_12260 6535 7422 gene locus_tag LOCUS_12270 6535 7422 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_12270 7560 7859 gene locus_tag LOCUS_12280 7560 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8635 9810 gene locus_tag LOCUS_12290 8635 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 9820 10767 gene locus_tag LOCUS_12300 9820 10767 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_12300 10757 11137 gene locus_tag LOCUS_12310 10757 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence075 477 1838 gene locus_tag LOCUS_12320 477 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261111.1 protein_id gnl|my_center|LOCUS_12320 2444 2794 gene locus_tag LOCUS_12330 gene ypfE 2444 2794 CDS product ethanolamine utilization protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356956.1 protein_id gnl|my_center|LOCUS_12330 2796 3266 gene locus_tag LOCUS_12340 2796 3266 CDS product ethanolamine utilization protein EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904035.1 protein_id gnl|my_center|LOCUS_12340 3297 4013 gene locus_tag LOCUS_12350 gene eutQ 3297 4013 CDS product ethanolamine utilization protein EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733932.1 protein_id gnl|my_center|LOCUS_12350 4016 4891 gene locus_tag LOCUS_12360 gene eutT 4016 4891 CDS product ethanolamine utilization cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651289.1 protein_id gnl|my_center|LOCUS_12360 4878 5849 gene locus_tag LOCUS_12370 gene eutD 4878 5849 CDS product ethanolamine utilization protein EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77218 protein_id gnl|my_center|LOCUS_12370 5889 6218 gene locus_tag LOCUS_12380 gene cchA 5889 6218 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_12380 6249 6524 gene locus_tag LOCUS_12390 gene cchA 6249 6524 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_12390 6587 6880 gene locus_tag LOCUS_12400 gene eutN 6587 6880 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AEJ8 protein_id gnl|my_center|LOCUS_12400 6921 8354 gene locus_tag LOCUS_12410 6921 8354 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 protein_id gnl|my_center|LOCUS_12410 8358 9197 gene locus_tag LOCUS_12420 8358 9197 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929726.1 protein_id gnl|my_center|LOCUS_12420 9201 10445 gene locus_tag LOCUS_12430 gene eutG 9201 10445 CDS product alcohol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178767.1 protein_id gnl|my_center|LOCUS_12430 10445 11875 gene locus_tag LOCUS_12440 gene eutA 10445 11875 CDS product ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4U1 protein_id gnl|my_center|LOCUS_12440 11889 13253 gene locus_tag LOCUS_12450 gene eutB 11889 13253 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769994.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence076 1644 226 gene locus_tag LOCUS_12460 gene ampG 1644 226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_12460 2109 1783 gene locus_tag LOCUS_12470 2109 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073583.1 protein_id gnl|my_center|LOCUS_12470 2811 2272 gene locus_tag LOCUS_12480 gene ppiA 2811 2272 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT0 protein_id gnl|my_center|LOCUS_12480 3485 2919 gene locus_tag LOCUS_12490 3485 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073581.1 protein_id gnl|my_center|LOCUS_12490 3743 4747 gene locus_tag LOCUS_12500 3743 4747 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 protein_id gnl|my_center|LOCUS_12500 4903 5748 gene locus_tag LOCUS_12510 4903 5748 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_12510 6175 6552 gene locus_tag LOCUS_12520 6175 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7536 6838 gene locus_tag LOCUS_12530 7536 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 8046 8243 gene locus_tag LOCUS_12540 8046 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8219 8608 gene locus_tag LOCUS_12550 8219 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12550 9855 8674 gene locus_tag LOCUS_12560 9855 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 11838 9976 gene locus_tag LOCUS_12570 11838 9976 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence077 795 334 gene locus_tag LOCUS_12580 795 334 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_12580 1081 1359 gene locus_tag LOCUS_12590 gene trpR 1081 1359 CDS product Trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073277.1 protein_id gnl|my_center|LOCUS_12590 1757 1371 gene locus_tag LOCUS_12600 1757 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073276.1 protein_id gnl|my_center|LOCUS_12600 2503 1886 gene locus_tag LOCUS_12610 gene slyD 2503 1886 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT2 protein_id gnl|my_center|LOCUS_12610 3216 5681 gene locus_tag LOCUS_12620 gene thrA 3216 5681 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073273.1 protein_id gnl|my_center|LOCUS_12620 5758 6762 gene locus_tag LOCUS_12630 gene thrB 5758 6762 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT5 protein_id gnl|my_center|LOCUS_12630 6774 8054 gene locus_tag LOCUS_12640 gene thrC 6774 8054 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073271.1 protein_id gnl|my_center|LOCUS_12640 8315 8611 gene locus_tag LOCUS_12650 8315 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8980 11028 gene locus_tag LOCUS_12660 8980 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11151 12248 gene locus_tag LOCUS_12670 11151 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12406 12942 gene locus_tag LOCUS_12680 12406 12942 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073378.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence078 2403 61 gene locus_tag LOCUS_12690 gene mrcB 2403 61 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ40 protein_id gnl|my_center|LOCUS_12690 5038 2450 gene locus_tag LOCUS_12700 gene hrpB 5038 2450 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070959.1 protein_id gnl|my_center|LOCUS_12700 5246 5854 gene locus_tag LOCUS_12710 gene ligT 5246 5854 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ46 protein_id gnl|my_center|LOCUS_12710 6955 6059 gene locus_tag LOCUS_12720 6955 6059 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762543.1 protein_id gnl|my_center|LOCUS_12720 7212 7949 gene locus_tag LOCUS_12730 gene gpmA 7212 7949 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_12730 7986 8783 gene locus_tag LOCUS_12740 7986 8783 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_12740 8923 10155 gene locus_tag LOCUS_12750 8923 10155 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_12750 10223 11257 gene locus_tag LOCUS_12760 10223 11257 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_12760 11758 11426 gene locus_tag LOCUS_12770 11758 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 12735 11770 gene locus_tag LOCUS_12780 12735 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence079 1347 721 gene locus_tag LOCUS_12790 1347 721 CDS product DUF2913 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071589.1 protein_id gnl|my_center|LOCUS_12790 2811 1366 gene locus_tag LOCUS_12800 2811 1366 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 protein_id gnl|my_center|LOCUS_12800 3154 4479 gene locus_tag LOCUS_12810 3154 4479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704849.1 protein_id gnl|my_center|LOCUS_12810 5818 4604 gene locus_tag LOCUS_12820 5818 4604 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707630.1 protein_id gnl|my_center|LOCUS_12820 5929 6471 gene locus_tag LOCUS_12830 5929 6471 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707629.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 8387 6600 gene locus_tag LOCUS_12840 gene ampP 8387 6600 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 protein_id gnl|my_center|LOCUS_12840 8768 9964 gene locus_tag LOCUS_12850 8768 9964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206489.1 protein_id gnl|my_center|LOCUS_12850 10177 11394 gene locus_tag LOCUS_12860 10177 11394 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_12860 12070 11600 gene locus_tag LOCUS_12870 gene fklB 12070 11600 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH40 protein_id gnl|my_center|LOCUS_12870 12562 12188 gene locus_tag LOCUS_12880 12562 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence080 1726 4266 gene locus_tag LOCUS_12890 gene topA 1726 4266 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDN8 protein_id gnl|my_center|LOCUS_12890 5387 4614 gene locus_tag LOCUS_12900 5387 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072596.1 protein_id gnl|my_center|LOCUS_12900 5613 6587 gene locus_tag LOCUS_12910 gene cysB 5613 6587 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072595.1 protein_id gnl|my_center|LOCUS_12910 8063 6687 gene locus_tag LOCUS_12920 gene sdaA 8063 6687 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072262.1 protein_id gnl|my_center|LOCUS_12920 8415 9425 gene locus_tag LOCUS_12930 gene nagZ 8415 9425 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEW2 protein_id gnl|my_center|LOCUS_12930 9521 10060 gene locus_tag LOCUS_12940 9521 10060 CDS product UPF0227 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59273 protein_id gnl|my_center|LOCUS_12940 10470 10745 gene locus_tag LOCUS_12950 gene acyP 10470 10745 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEW0 protein_id gnl|my_center|LOCUS_12950 11785 10844 gene locus_tag LOCUS_12960 11785 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072266.1 protein_id gnl|my_center|LOCUS_12960 <13074 11787 gene locus_tag LOCUS_12970 <13074 11787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEV8:transcription-repair-coupling factor >Feature sequence081 1193 21 gene locus_tag LOCUS_12980 1193 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_12980 1822 2532 gene locus_tag LOCUS_12990 1822 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 protein_id gnl|my_center|LOCUS_12990 2770 6477 gene locus_tag LOCUS_13000 2770 6477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_13000 6477 7100 gene locus_tag LOCUS_13010 6477 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7100 8341 gene locus_tag LOCUS_13020 7100 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 8434 9327 gene locus_tag LOCUS_13030 8434 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 10040 11314 gene locus_tag LOCUS_13040 10040 11314 CDS product proton/sodium:glutamate symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 protein_id gnl|my_center|LOCUS_13040 11594 11860 gene locus_tag LOCUS_13050 11594 11860 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073999.1 protein_id gnl|my_center|LOCUS_13050 <13015 12149 gene locus_tag LOCUS_13060 <13015 12149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAB6:fructose-1,6-bisphosphatase class 1 >Feature sequence082 872 1234 gene locus_tag LOCUS_13070 gene yfiA 872 1234 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073280.1 protein_id gnl|my_center|LOCUS_13070 2168 1989 gene locus_tag LOCUS_13080 2168 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2495 4477 gene locus_tag LOCUS_13090 gene pheA 2495 4477 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071575.1 protein_id gnl|my_center|LOCUS_13090 6152 5049 gene locus_tag LOCUS_13100 gene hcr 6152 5049 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071572.1 protein_id gnl|my_center|LOCUS_13100 7886 6228 gene locus_tag LOCUS_13110 gene hcp 7886 6228 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH67 protein_id gnl|my_center|LOCUS_13110 9251 8112 gene locus_tag LOCUS_13120 gene tyrA 9251 8112 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH68 protein_id gnl|my_center|LOCUS_13120 10417 9326 gene locus_tag LOCUS_13130 gene aroF 10417 9326 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH69 protein_id gnl|my_center|LOCUS_13130 11266 10913 gene locus_tag LOCUS_13140 gene rplS 11266 10913 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH70 protein_id gnl|my_center|LOCUS_13140 12048 11320 gene locus_tag LOCUS_13150 gene trmD 12048 11320 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX44 protein_id gnl|my_center|LOCUS_13150 12594 12064 gene locus_tag LOCUS_13160 gene rimM 12594 12064 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH71 protein_id gnl|my_center|LOCUS_13160 12866 12615 gene locus_tag LOCUS_13170 gene rpsP 12866 12615 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_13170 >Feature sequence083 263 352 gene locus_tag LOCUS_t00110 263 352 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2164 722 gene locus_tag LOCUS_13180 2164 722 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103638.1 protein_id gnl|my_center|LOCUS_13180 3723 2284 gene locus_tag LOCUS_13190 gene cpsB 3723 2284 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079297.1 protein_id gnl|my_center|LOCUS_13190 5626 3926 gene locus_tag LOCUS_13200 5626 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_13200 7116 5896 gene locus_tag LOCUS_13210 7116 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_13210 7279 7692 gene locus_tag LOCUS_13220 7279 7692 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_13220 7952 10252 gene locus_tag LOCUS_13230 7952 10252 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJZ5 protein_id gnl|my_center|LOCUS_13230 10498 11088 gene locus_tag LOCUS_13240 10498 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_13240 11951 12529 gene locus_tag LOCUS_13250 11951 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038836.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence084 2831 138 gene locus_tag LOCUS_13260 2831 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 5143 3422 gene locus_tag LOCUS_13270 5143 3422 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071884.1 protein_id gnl|my_center|LOCUS_13270 5337 6200 gene locus_tag LOCUS_13280 5337 6200 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUP9 protein_id gnl|my_center|LOCUS_13280 6778 6296 gene locus_tag LOCUS_13290 6778 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9286 6908 gene locus_tag LOCUS_13300 9286 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9983 9276 gene locus_tag LOCUS_13310 9983 9276 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_13310 11247 9976 gene locus_tag LOCUS_13320 11247 9976 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_13320 11419 11574 gene locus_tag LOCUS_13330 11419 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 11632 12105 gene locus_tag LOCUS_13340 11632 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence085 2105 1380 gene locus_tag LOCUS_13350 2105 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085111.1 protein_id gnl|my_center|LOCUS_13350 2294 2530 gene locus_tag LOCUS_13360 2294 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3470 2697 gene locus_tag LOCUS_13370 3470 2697 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_13370 4305 3463 gene locus_tag LOCUS_13380 4305 3463 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_13380 4830 4378 gene locus_tag LOCUS_13390 4830 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6136 5120 gene locus_tag LOCUS_13400 6136 5120 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073847.1 protein_id gnl|my_center|LOCUS_13400 6840 7646 gene locus_tag LOCUS_13410 6840 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 8593 8219 gene locus_tag LOCUS_13420 gene metJ 8593 8219 CDS product Met repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA52 protein_id gnl|my_center|LOCUS_13420 8767 9927 gene locus_tag LOCUS_13430 gene metB 8767 9927 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073769.1 protein_id gnl|my_center|LOCUS_13430 9950 12337 gene locus_tag LOCUS_13440 gene metL 9950 12337 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073768.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence086 794 3874 gene locus_tag LOCUS_13450 794 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4906 6036 gene locus_tag LOCUS_13460 4906 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_13460 6216 6132 gene locus_tag LOCUS_t00120 6216 6132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7473 6862 gene locus_tag LOCUS_13470 7473 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073639.1 protein_id gnl|my_center|LOCUS_13470 7708 9303 gene locus_tag LOCUS_13480 7708 9303 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073640.1 protein_id gnl|my_center|LOCUS_13480 10237 9398 gene locus_tag LOCUS_13490 10237 9398 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 protein_id gnl|my_center|LOCUS_13490 10804 11832 gene locus_tag LOCUS_13500 gene omp35 10804 11832 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence087 702 82 gene locus_tag LOCUS_13510 702 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073186.1 protein_id gnl|my_center|LOCUS_13510 1990 716 gene locus_tag LOCUS_13520 gene hisS 1990 716 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC33 protein_id gnl|my_center|LOCUS_13520 3266 2151 gene locus_tag LOCUS_13530 gene ispG 3266 2151 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC32 protein_id gnl|my_center|LOCUS_13530 4368 3388 gene locus_tag LOCUS_13540 gene rodZ 4368 3388 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073189.1 protein_id gnl|my_center|LOCUS_13540 5090 4368 gene locus_tag LOCUS_13550 gene pilF 5090 4368 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_13550 6309 5188 gene locus_tag LOCUS_13560 gene rlmN 6309 5188 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC29 protein_id gnl|my_center|LOCUS_13560 6586 7683 gene locus_tag LOCUS_13570 6586 7683 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073192.1 protein_id gnl|my_center|LOCUS_13570 7812 9560 gene locus_tag LOCUS_13580 7812 9560 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073193.1 protein_id gnl|my_center|LOCUS_13580 10142 9642 gene locus_tag LOCUS_13590 10142 9642 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073197.1 protein_id gnl|my_center|LOCUS_13590 10585 10283 gene locus_tag LOCUS_13600 gene nrfJ 10585 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073198.1 protein_id gnl|my_center|LOCUS_13600 10979 10737 gene locus_tag LOCUS_13610 10979 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_13610 11708 12388 gene locus_tag LOCUS_13620 11708 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence088 3092 300 gene locus_tag LOCUS_13630 gene cirA 3092 300 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037060.1 protein_id gnl|my_center|LOCUS_13630 4222 3482 gene locus_tag LOCUS_13640 4222 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5906 4224 gene locus_tag LOCUS_13650 5906 4224 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_13650 6637 5906 gene locus_tag LOCUS_13660 6637 5906 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_13660 7539 6838 gene locus_tag LOCUS_13670 7539 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 8862 7648 gene locus_tag LOCUS_13680 8862 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 9923 8871 gene locus_tag LOCUS_13690 9923 8871 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_13690 11097 9952 gene locus_tag LOCUS_13700 11097 9952 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_13700 11271 12014 gene locus_tag LOCUS_13710 11271 12014 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence089 32 949 gene locus_tag LOCUS_13720 32 949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071366.1 protein_id gnl|my_center|LOCUS_13720 1721 1053 gene locus_tag LOCUS_13730 1721 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1612 1818 gene locus_tag LOCUS_13740 1612 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1984 2214 gene locus_tag LOCUS_13750 1984 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2894 2478 gene locus_tag LOCUS_13760 2894 2478 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073595.1 protein_id gnl|my_center|LOCUS_13760 4813 3539 gene locus_tag LOCUS_13770 gene proA 4813 3539 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU1 protein_id gnl|my_center|LOCUS_13770 5994 4870 gene locus_tag LOCUS_13780 gene proB 5994 4870 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU2 protein_id gnl|my_center|LOCUS_13780 7468 6179 gene locus_tag LOCUS_13790 7468 6179 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071361.1 protein_id gnl|my_center|LOCUS_13790 10114 8432 gene locus_tag LOCUS_13800 10114 8432 CDS product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071359.1 protein_id gnl|my_center|LOCUS_13800 10281 11741 gene locus_tag LOCUS_13810 gene pepD 10281 11741 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071358.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence090 988 1461 gene locus_tag LOCUS_13820 988 1461 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 protein_id gnl|my_center|LOCUS_13820 1647 1826 gene locus_tag LOCUS_13830 1647 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13830 1864 2184 gene locus_tag LOCUS_13840 1864 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3510 2761 gene locus_tag LOCUS_13850 3510 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3847 4230 gene locus_tag LOCUS_13860 3847 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4393 5100 gene locus_tag LOCUS_13870 4393 5100 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707968.1 protein_id gnl|my_center|LOCUS_13870 5160 6383 gene locus_tag LOCUS_13880 5160 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6683 7528 gene locus_tag LOCUS_13890 gene kynA 6683 7528 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK2 protein_id gnl|my_center|LOCUS_13890 7611 8798 gene locus_tag LOCUS_13900 7611 8798 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_13900 8851 9474 gene locus_tag LOCUS_13910 8851 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 10162 9590 gene locus_tag LOCUS_13920 gene miaE 10162 9590 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022063.1 protein_id gnl|my_center|LOCUS_13920 10886 10254 gene locus_tag LOCUS_13930 10886 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 11716 10940 gene locus_tag LOCUS_13940 11716 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence091 <1 695 gene locus_tag LOCUS_13950 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071997.1:transposase 1407 5282 gene locus_tag LOCUS_13960 gene hrpA 1407 5282 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 protein_id gnl|my_center|LOCUS_13960 5822 6133 gene locus_tag LOCUS_13970 5822 6133 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463501.1 protein_id gnl|my_center|LOCUS_13970 6130 8619 gene locus_tag LOCUS_13980 gene napA 6130 8619 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLR4 protein_id gnl|my_center|LOCUS_13980 8629 9084 gene locus_tag LOCUS_13990 8629 9084 CDS product periplasmic nitrate reductase cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233067.2 protein_id gnl|my_center|LOCUS_13990 9105 9695 gene locus_tag LOCUS_14000 gene napC 9105 9695 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3J8 protein_id gnl|my_center|LOCUS_14000 9705 9833 gene locus_tag LOCUS_14010 9705 9833 CDS product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 protein_id gnl|my_center|LOCUS_14010 10959 10027 gene locus_tag LOCUS_14020 10959 10027 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263006.1 protein_id gnl|my_center|LOCUS_14020 11123 11296 gene locus_tag LOCUS_14030 11123 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12313 11303 gene locus_tag LOCUS_14040 gene ddl 12313 11303 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEZ2 protein_id gnl|my_center|LOCUS_14040 >Feature sequence092 1891 257 gene locus_tag LOCUS_14050 gene gshA 1891 257 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBF9 protein_id gnl|my_center|LOCUS_14050 4895 2061 gene locus_tag LOCUS_14060 4895 2061 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_14060 5466 5044 gene locus_tag LOCUS_14070 5466 5044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073390.1 protein_id gnl|my_center|LOCUS_14070 5728 6984 gene locus_tag LOCUS_14080 5728 6984 CDS product amino acid:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073391.1 protein_id gnl|my_center|LOCUS_14080 7126 7311 gene locus_tag LOCUS_14090 7126 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7480 7815 gene locus_tag LOCUS_14100 7480 7815 CDS product zinc chelation protein SecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 protein_id gnl|my_center|LOCUS_14100 9174 8044 gene locus_tag LOCUS_14110 9174 8044 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_14110 10985 9183 gene locus_tag LOCUS_14120 10985 9183 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_14120 11252 11007 gene locus_tag LOCUS_14130 11252 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 12234 12158 gene locus_tag LOCUS_t00130 12234 12158 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12394 12318 gene locus_tag LOCUS_t00140 12394 12318 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 485 859 gene locus_tag LOCUS_14140 485 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1464 1763 gene locus_tag LOCUS_14150 1464 1763 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887091.1 protein_id gnl|my_center|LOCUS_14150 3079 1826 gene locus_tag LOCUS_14160 gene rulB 3079 1826 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 protein_id gnl|my_center|LOCUS_14160 3649 3146 gene locus_tag LOCUS_14170 gene umuD 3649 3146 CDS product DNA polymerase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 protein_id gnl|my_center|LOCUS_14170 3805 4611 gene locus_tag LOCUS_14180 3805 4611 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219484.1 protein_id gnl|my_center|LOCUS_14180 4702 5622 gene locus_tag LOCUS_14190 gene ppaC 4702 5622 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_14190 8277 5863 gene locus_tag LOCUS_14200 8277 5863 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073257.1 protein_id gnl|my_center|LOCUS_14200 8472 8681 gene locus_tag LOCUS_14210 8472 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 9048 11348 gene locus_tag LOCUS_14220 9048 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11957 11496 gene locus_tag LOCUS_14230 11957 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_14230 12406 11954 gene locus_tag LOCUS_14240 12406 11954 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380356.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence094 2473 137 gene locus_tag LOCUS_14250 2473 137 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_14250 4060 2495 gene locus_tag LOCUS_14260 4060 2495 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 protein_id gnl|my_center|LOCUS_14260 6808 4082 gene locus_tag LOCUS_14270 gene malA 6808 4082 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_14270 8769 6937 gene locus_tag LOCUS_14280 8769 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9259 9927 gene locus_tag LOCUS_14290 gene attE 9259 9927 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071147.1 protein_id gnl|my_center|LOCUS_14290 9944 12430 gene locus_tag LOCUS_14300 gene attFG 9944 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071146.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence095 <1 851 gene locus_tag LOCUS_14310 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071837.1:copper-translocating P-type ATPase 1162 2754 gene locus_tag LOCUS_14320 gene ybiT 1162 2754 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071838.1 protein_id gnl|my_center|LOCUS_14320 4271 2913 gene locus_tag LOCUS_14330 4271 2913 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_14330 4812 4417 gene locus_tag LOCUS_14340 4812 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5073 5738 gene locus_tag LOCUS_14350 5073 5738 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103931.1 protein_id gnl|my_center|LOCUS_14350 5797 6675 gene locus_tag LOCUS_14360 gene prpB 5797 6675 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW1 protein_id gnl|my_center|LOCUS_14360 6860 7984 gene locus_tag LOCUS_14370 gene prpC 6860 7984 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_14370 8088 10706 gene locus_tag LOCUS_14380 gene acnD 8088 10706 CDS product 2-methylcitrate dehydratase (2-methyl-trans-aconitate forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW3 protein_id gnl|my_center|LOCUS_14380 10862 12136 gene locus_tag LOCUS_14390 10862 12136 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence096 226 867 gene locus_tag LOCUS_14400 226 867 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071069.1 protein_id gnl|my_center|LOCUS_14400 2888 1293 gene locus_tag LOCUS_14410 gene phnE 2888 1293 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_14410 3558 2869 gene locus_tag LOCUS_14420 gene phnE 3558 2869 CDS product phosphate/phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125172.1 protein_id gnl|my_center|LOCUS_14420 4425 3571 gene locus_tag LOCUS_14430 gene phnD 4425 3571 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_14430 4346 4672 gene locus_tag LOCUS_14440 4346 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4653 5327 gene locus_tag LOCUS_14450 gene phoP 4653 5327 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072043.1 protein_id gnl|my_center|LOCUS_14450 5318 6670 gene locus_tag LOCUS_14460 gene phoQ 5318 6670 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072042.1 protein_id gnl|my_center|LOCUS_14460 7499 6807 gene locus_tag LOCUS_14470 7499 6807 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_14470 7652 8911 gene locus_tag LOCUS_14480 7652 8911 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072040.1 protein_id gnl|my_center|LOCUS_14480 9130 9450 gene locus_tag LOCUS_14490 9130 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10402 9455 gene locus_tag LOCUS_14500 gene corA 10402 9455 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFM9 protein_id gnl|my_center|LOCUS_14500 10887 10528 gene locus_tag LOCUS_14510 10887 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 11077 11754 gene locus_tag LOCUS_14520 11077 11754 CDS product UPF0319 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBF2 protein_id gnl|my_center|LOCUS_14520 12239 11910 gene locus_tag LOCUS_14530 12239 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence097 659 2248 gene locus_tag LOCUS_14540 gene purH 659 2248 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM1 protein_id gnl|my_center|LOCUS_14540 2435 3727 gene locus_tag LOCUS_14550 gene purD 2435 3727 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM2 protein_id gnl|my_center|LOCUS_14550 4003 3794 gene locus_tag LOCUS_14560 4003 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4148 4849 gene locus_tag LOCUS_14570 4148 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_14570 4861 5595 gene locus_tag LOCUS_14580 4861 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_14580 5678 6418 gene locus_tag LOCUS_14590 5678 6418 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_14590 6472 7947 gene locus_tag LOCUS_14600 6472 7947 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_14600 9133 8069 gene locus_tag LOCUS_14610 gene hemE 9133 8069 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM8 protein_id gnl|my_center|LOCUS_14610 9636 10103 gene locus_tag LOCUS_14620 gene rsd 9636 10103 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_14620 11130 10393 gene locus_tag LOCUS_14630 11130 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106512.1 protein_id gnl|my_center|LOCUS_14630 11554 11381 gene locus_tag LOCUS_14640 11554 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence098 114 1628 gene locus_tag LOCUS_14650 gene purF 114 1628 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR8 protein_id gnl|my_center|LOCUS_14650 1746 2666 gene locus_tag LOCUS_14660 1746 2666 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262976.1 protein_id gnl|my_center|LOCUS_14660 3054 2788 gene locus_tag LOCUS_14670 3054 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3243 5210 gene locus_tag LOCUS_14680 gene topB 3243 5210 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECS1 protein_id gnl|my_center|LOCUS_14680 5439 6338 gene locus_tag LOCUS_14690 5439 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6488 6943 gene locus_tag LOCUS_14700 6488 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6985 7590 gene locus_tag LOCUS_14710 6985 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7726 8682 gene locus_tag LOCUS_14720 7726 8682 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_14720 10148 11614 gene locus_tag LOCUS_14730 10148 11614 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704412.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence099 1050 397 gene locus_tag LOCUS_14740 gene cobO 1050 397 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_14740 2782 1157 gene locus_tag LOCUS_14750 gene cobQ 2782 1157 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI15 protein_id gnl|my_center|LOCUS_14750 3654 3100 gene locus_tag LOCUS_14760 gene cobU 3654 3100 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 protein_id gnl|my_center|LOCUS_14760 4536 3763 gene locus_tag LOCUS_14770 gene cobS 4536 3763 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI17 protein_id gnl|my_center|LOCUS_14770 5616 4588 gene locus_tag LOCUS_14780 gene cobT 5616 4588 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI18 protein_id gnl|my_center|LOCUS_14780 7111 5987 gene locus_tag LOCUS_14790 gene btuC 7111 5987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_14790 8018 7101 gene locus_tag LOCUS_14800 gene btuD 8018 7101 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_14800 9167 8499 gene locus_tag LOCUS_14810 gene cobC 9167 8499 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071291.1 protein_id gnl|my_center|LOCUS_14810 12061 9239 gene locus_tag LOCUS_14820 12061 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence100 1162 485 gene locus_tag LOCUS_14830 1162 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070522.1 protein_id gnl|my_center|LOCUS_14830 1908 1372 gene locus_tag LOCUS_14840 1908 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070527.1 protein_id gnl|my_center|LOCUS_14840 2105 3370 gene locus_tag LOCUS_14850 gene ybdG 2105 3370 CDS product small conductance mechanosensitive ion channel protein YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 protein_id gnl|my_center|LOCUS_14850 3990 3367 gene locus_tag LOCUS_14860 3990 3367 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 protein_id gnl|my_center|LOCUS_14860 4563 4159 gene locus_tag LOCUS_14870 gene sycT 4563 4159 CDS product chaperone protein SycT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU66 protein_id gnl|my_center|LOCUS_14870 5531 4560 gene locus_tag LOCUS_14880 gene yopT1 5531 4560 CDS product cysteine protease yopT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU65 protein_id gnl|my_center|LOCUS_14880 7000 5549 gene locus_tag LOCUS_14890 7000 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7211 7633 gene locus_tag LOCUS_14900 gene yerA 7211 7633 CDS product YopE regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31490 protein_id gnl|my_center|LOCUS_14900 8712 7666 gene locus_tag LOCUS_14910 8712 7666 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477705.1 protein_id gnl|my_center|LOCUS_14910 9503 8709 gene locus_tag LOCUS_14920 9503 8709 CDS product EscT/YscT/HrcT family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464642.1 protein_id gnl|my_center|LOCUS_14920 9766 9500 gene locus_tag LOCUS_14930 9766 9500 CDS product EscS/YscS/HrcS family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087672.1 protein_id gnl|my_center|LOCUS_14930 10425 9775 gene locus_tag LOCUS_14940 10425 9775 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_14940 11381 10428 gene locus_tag LOCUS_14950 11381 10428 CDS product type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105899.1 protein_id gnl|my_center|LOCUS_14950 12099 11374 gene locus_tag LOCUS_14960 12099 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence101 244 999 gene locus_tag LOCUS_14970 244 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332026.1 protein_id gnl|my_center|LOCUS_14970 1049 2800 gene locus_tag LOCUS_14980 1049 2800 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072065.1 protein_id gnl|my_center|LOCUS_14980 3482 4033 gene locus_tag LOCUS_14990 3482 4033 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_14990 4613 6505 gene locus_tag LOCUS_15000 4613 6505 CDS product alkaline serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473082.1 protein_id gnl|my_center|LOCUS_15000 6995 6600 gene locus_tag LOCUS_15010 6995 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 7279 7995 gene locus_tag LOCUS_15020 7279 7995 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705365.1 protein_id gnl|my_center|LOCUS_15020 8200 10788 gene locus_tag LOCUS_15030 gene pepN 8200 10788 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_15030 12012 10945 gene locus_tag LOCUS_15040 12012 10945 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072365.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence102 1292 195 gene locus_tag LOCUS_15050 1292 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3081 1231 gene locus_tag LOCUS_15060 3081 1231 CDS product Zn-dependent oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072412.1 protein_id gnl|my_center|LOCUS_15060 4006 3044 gene locus_tag LOCUS_15070 4006 3044 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_15070 5514 4009 gene locus_tag LOCUS_15080 5514 4009 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_15080 6269 5526 gene locus_tag LOCUS_15090 6269 5526 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418596.1 protein_id gnl|my_center|LOCUS_15090 7340 6348 gene locus_tag LOCUS_15100 gene cmoB 7340 6348 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE6 protein_id gnl|my_center|LOCUS_15100 8141 7407 gene locus_tag LOCUS_15110 gene cmoA 8141 7407 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE7 protein_id gnl|my_center|LOCUS_15110 8384 11089 gene locus_tag LOCUS_15120 8384 11089 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072409.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence103 1140 460 gene locus_tag LOCUS_15130 1140 460 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_15130 2405 1248 gene locus_tag LOCUS_15140 gene yqhD 2405 1248 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074098.1 protein_id gnl|my_center|LOCUS_15140 3158 2550 gene locus_tag LOCUS_15150 gene nemR 3158 2550 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074097.1 protein_id gnl|my_center|LOCUS_15150 3364 4887 gene locus_tag LOCUS_15160 gene yifB 3364 4887 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070714.1 protein_id gnl|my_center|LOCUS_15160 5029 5907 gene locus_tag LOCUS_15170 5029 5907 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 protein_id gnl|my_center|LOCUS_15170 5929 6861 gene locus_tag LOCUS_15180 5929 6861 CDS product phospholipid/glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070712.1 protein_id gnl|my_center|LOCUS_15180 7088 7498 gene locus_tag LOCUS_15190 7088 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8675 7587 gene locus_tag LOCUS_15200 gene ilvE 8675 7587 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070705.1 protein_id gnl|my_center|LOCUS_15200 10396 9038 gene locus_tag LOCUS_15210 10396 9038 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 protein_id gnl|my_center|LOCUS_15210 10955 11557 gene locus_tag LOCUS_15220 gene oprH 10955 11557 CDS product PhoP/Q and low Mg2+ inducible outer membrane protein H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence104 924 1715 gene locus_tag LOCUS_15230 924 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073526.1 protein_id gnl|my_center|LOCUS_15230 2011 2496 gene locus_tag LOCUS_15240 2011 2496 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073525.1 protein_id gnl|my_center|LOCUS_15240 2845 2573 gene locus_tag LOCUS_15250 2845 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4389 2974 gene locus_tag LOCUS_15260 4389 2974 CDS product MltA-interacting MipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 protein_id gnl|my_center|LOCUS_15260 4735 6552 gene locus_tag LOCUS_15270 gene cysJ 4735 6552 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ9 protein_id gnl|my_center|LOCUS_15270 6650 8401 gene locus_tag LOCUS_15280 gene cysI 6650 8401 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB00 protein_id gnl|my_center|LOCUS_15280 8379 9164 gene locus_tag LOCUS_15290 gene cysH 8379 9164 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB01 protein_id gnl|my_center|LOCUS_15290 9556 11301 gene locus_tag LOCUS_15300 9556 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_15300 11402 11815 gene locus_tag LOCUS_15310 11402 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence105 <1 1756 gene locus_tag LOCUS_15320 <1 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072374.1:acyl-CoA dehydrogenase 3280 1847 gene locus_tag LOCUS_15330 gene dacB 3280 1847 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_15330 3561 3388 gene locus_tag LOCUS_15340 3561 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072372.1 protein_id gnl|my_center|LOCUS_15340 3921 4253 gene locus_tag LOCUS_15350 3921 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072371.1 protein_id gnl|my_center|LOCUS_15350 4265 5578 gene locus_tag LOCUS_15360 gene pssA 4265 5578 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEJ1 protein_id gnl|my_center|LOCUS_15360 5612 6397 gene locus_tag LOCUS_15370 5612 6397 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072367.1 protein_id gnl|my_center|LOCUS_15370 6755 7978 gene locus_tag LOCUS_15380 6755 7978 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_15380 7978 11139 gene locus_tag LOCUS_15390 7978 11139 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766158.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence106 1166 963 gene locus_tag LOCUS_15400 1166 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2570 1590 gene locus_tag LOCUS_15410 2570 1590 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_15410 2794 4215 gene locus_tag LOCUS_15420 2794 4215 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974134.1 protein_id gnl|my_center|LOCUS_15420 5184 4267 gene locus_tag LOCUS_15430 5184 4267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706520.1 protein_id gnl|my_center|LOCUS_15430 5413 6936 gene locus_tag LOCUS_15440 5413 6936 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706522.1 protein_id gnl|my_center|LOCUS_15440 7061 7234 gene locus_tag LOCUS_15450 7061 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7237 8730 gene locus_tag LOCUS_15460 7237 8730 CDS product cytosine/uracil/thiamine/allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706524.1 protein_id gnl|my_center|LOCUS_15460 8735 10423 gene locus_tag LOCUS_15470 8735 10423 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1I0 protein_id gnl|my_center|LOCUS_15470 10485 11198 gene locus_tag LOCUS_15480 10485 11198 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence107 86 898 gene locus_tag LOCUS_15490 86 898 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU8 protein_id gnl|my_center|LOCUS_15490 1064 2128 gene locus_tag LOCUS_15500 gene aroH 1064 2128 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU7 protein_id gnl|my_center|LOCUS_15500 2302 2730 gene locus_tag LOCUS_15510 2302 2730 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072593.1 protein_id gnl|my_center|LOCUS_15510 2952 3611 gene locus_tag LOCUS_15520 2952 3611 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_15520 4829 4218 gene locus_tag LOCUS_15530 4829 4218 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071749.1 protein_id gnl|my_center|LOCUS_15530 8367 4945 gene locus_tag LOCUS_15540 gene prlS 8367 4945 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072681.1 protein_id gnl|my_center|LOCUS_15540 8546 10498 gene locus_tag LOCUS_15550 gene acsA 8546 10498 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK3 protein_id gnl|my_center|LOCUS_15550 >Feature sequence108 1098 1568 gene locus_tag LOCUS_15560 gene argR 1098 1568 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR6 protein_id gnl|my_center|LOCUS_15560 1868 2332 gene locus_tag LOCUS_15570 1868 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2473 2652 gene locus_tag LOCUS_15580 2473 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2813 3025 gene locus_tag LOCUS_15590 gene cspG 2813 3025 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_15590 4390 3527 gene locus_tag LOCUS_15600 4390 3527 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263017.1 protein_id gnl|my_center|LOCUS_15600 4742 4512 gene locus_tag LOCUS_15610 4742 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7835 4818 gene locus_tag LOCUS_15620 7835 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8643 8239 gene locus_tag LOCUS_15630 gene rrf 8643 8239 CDS product ribosome recycling factor Rrf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071091.1 protein_id gnl|my_center|LOCUS_15630 9013 9945 gene locus_tag LOCUS_15640 9013 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 9958 10317 gene locus_tag LOCUS_15650 9958 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10333 10683 gene locus_tag LOCUS_15660 10333 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 10692 11369 gene locus_tag LOCUS_15670 10692 11369 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence109 <1 1408 gene locus_tag LOCUS_15680 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071534.1:glutamate synthase large subunit 1494 2900 gene locus_tag LOCUS_15690 gene gltD 1494 2900 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071533.1 protein_id gnl|my_center|LOCUS_15690 3478 4542 gene locus_tag LOCUS_15700 3478 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4889 5581 gene locus_tag LOCUS_15710 gene mtnN 4889 5581 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHA7 protein_id gnl|my_center|LOCUS_15710 5649 6632 gene locus_tag LOCUS_15720 gene cobD 5649 6632 CDS product cobalamin biosynthesis protein CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071531.1 protein_id gnl|my_center|LOCUS_15720 6716 7105 gene locus_tag LOCUS_15730 6716 7105 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_15730 7102 7722 gene locus_tag LOCUS_15740 gene yadS 7102 7722 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071529.1 protein_id gnl|my_center|LOCUS_15740 7806 8216 gene locus_tag LOCUS_15750 7806 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071528.1 protein_id gnl|my_center|LOCUS_15750 8866 10500 gene locus_tag LOCUS_15760 gene yhiP 8866 10500 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_15760 <11731 10630 gene locus_tag LOCUS_15770 <11731 10630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHB3:tyrosine--tRNA ligase >Feature sequence110 1209 856 gene locus_tag LOCUS_15780 gene cctA 1209 856 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 protein_id gnl|my_center|LOCUS_15780 2587 1727 gene locus_tag LOCUS_15790 gene htpX 2587 1727 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDL5 protein_id gnl|my_center|LOCUS_15790 3902 3207 gene locus_tag LOCUS_15800 gene bioD 3902 3207 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK9 protein_id gnl|my_center|LOCUS_15800 4708 3899 gene locus_tag LOCUS_15810 gene bioC 4708 3899 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK8 protein_id gnl|my_center|LOCUS_15810 5889 4741 gene locus_tag LOCUS_15820 gene bioF 5889 4741 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072678.1 protein_id gnl|my_center|LOCUS_15820 6997 5933 gene locus_tag LOCUS_15830 gene bioB 6997 5933 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK6 protein_id gnl|my_center|LOCUS_15830 7108 8505 gene locus_tag LOCUS_15840 gene bioA 7108 8505 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072680.1 protein_id gnl|my_center|LOCUS_15840 10878 8656 gene locus_tag LOCUS_15850 10878 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence111 1821 568 gene locus_tag LOCUS_15860 1821 568 CDS product proton/sodium:glutamate symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 protein_id gnl|my_center|LOCUS_15860 2161 3450 gene locus_tag LOCUS_15870 gene gltP 2161 3450 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_15870 3553 3984 gene locus_tag LOCUS_15880 3553 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4286 5515 gene locus_tag LOCUS_15890 gene gltS 4286 5515 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707131.1 protein_id gnl|my_center|LOCUS_15890 6116 5601 gene locus_tag LOCUS_15900 6116 5601 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 protein_id gnl|my_center|LOCUS_15900 6490 6239 gene locus_tag LOCUS_15910 6490 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071752.1 protein_id gnl|my_center|LOCUS_15910 6810 7022 gene locus_tag LOCUS_15920 6810 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7474 7070 gene locus_tag LOCUS_15930 7474 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 9138 8005 gene locus_tag LOCUS_15940 gene rsgA2 9138 8005 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_15940 10216 9512 gene locus_tag LOCUS_15950 10216 9512 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_15950 10424 10585 gene locus_tag LOCUS_15960 10424 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence112 1243 2145 gene locus_tag LOCUS_15970 gene ydhB 1243 2145 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072356.1 protein_id gnl|my_center|LOCUS_15970 2351 3013 gene locus_tag LOCUS_15980 gene yccA 2351 3013 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_15980 3154 3543 gene locus_tag LOCUS_15990 gene tusD 3154 3543 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072358.1 protein_id gnl|my_center|LOCUS_15990 3543 3899 gene locus_tag LOCUS_16000 gene tusC 3543 3899 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 protein_id gnl|my_center|LOCUS_16000 3899 4180 gene locus_tag LOCUS_16010 gene tusB 3899 4180 CDS product sulfurtransferase TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072360.1 protein_id gnl|my_center|LOCUS_16010 4177 4512 gene locus_tag LOCUS_16020 gene tusE 4177 4512 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEK2 protein_id gnl|my_center|LOCUS_16020 5903 4617 gene locus_tag LOCUS_16030 gene serS 5903 4617 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEQ9 protein_id gnl|my_center|LOCUS_16030 6296 5922 gene locus_tag LOCUS_16040 gene crcB 6296 5922 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER0 protein_id gnl|my_center|LOCUS_16040 7620 6289 gene locus_tag LOCUS_16050 7620 6289 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072308.1 protein_id gnl|my_center|LOCUS_16050 8263 7637 gene locus_tag LOCUS_16060 gene lolA 8263 7637 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER2 protein_id gnl|my_center|LOCUS_16060 10867 8333 gene locus_tag LOCUS_16070 10867 8333 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705741.1 protein_id gnl|my_center|LOCUS_16070 11545 11039 gene locus_tag LOCUS_16080 gene lrp 11545 11039 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence113 974 2407 gene locus_tag LOCUS_16090 gene rsmF 974 2407 CDS product ribosomal RNA small subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDY2 protein_id gnl|my_center|LOCUS_16090 2479 2874 gene locus_tag LOCUS_16100 2479 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3894 3106 gene locus_tag LOCUS_16110 gene ycfH 3894 3106 CDS product DNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072559.1 protein_id gnl|my_center|LOCUS_16110 4372 4046 gene locus_tag LOCUS_16120 4372 4046 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072560.1 protein_id gnl|my_center|LOCUS_16120 5294 4380 gene locus_tag LOCUS_16130 gene holB 5294 4380 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072561.1 protein_id gnl|my_center|LOCUS_16130 5926 5294 gene locus_tag LOCUS_16140 gene tmk 5926 5294 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX8 protein_id gnl|my_center|LOCUS_16140 6930 5923 gene locus_tag LOCUS_16150 gene yceG 6930 5923 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072563.1 protein_id gnl|my_center|LOCUS_16150 7754 6927 gene locus_tag LOCUS_16160 gene pabC 7754 6927 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 protein_id gnl|my_center|LOCUS_16160 7953 7768 gene locus_tag LOCUS_16170 7953 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 8692 8057 gene locus_tag LOCUS_16180 gene udk 8692 8057 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX4 protein_id gnl|my_center|LOCUS_16180 9763 8702 gene locus_tag LOCUS_16190 gene apbC 9763 8702 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX3 protein_id gnl|my_center|LOCUS_16190 >Feature sequence114 1795 839 gene locus_tag LOCUS_16200 gene tal 1795 839 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH2 protein_id gnl|my_center|LOCUS_16200 2101 1916 gene locus_tag LOCUS_16210 2101 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3270 2179 gene locus_tag LOCUS_16220 3270 2179 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073374.1 protein_id gnl|my_center|LOCUS_16220 5893 3527 gene locus_tag LOCUS_16230 gene xfp 5893 3527 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073372.1 protein_id gnl|my_center|LOCUS_16230 6319 7761 gene locus_tag LOCUS_16240 6319 7761 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262527.1 protein_id gnl|my_center|LOCUS_16240 7886 8662 gene locus_tag LOCUS_16250 7886 8662 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_16250 9969 10358 gene locus_tag LOCUS_16260 9969 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 10473 10700 gene locus_tag LOCUS_16270 10473 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence115 2090 1050 gene locus_tag LOCUS_16280 2090 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2815 2111 gene locus_tag LOCUS_16290 2815 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 5518 2816 gene locus_tag LOCUS_16300 5518 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5973 5515 gene locus_tag LOCUS_16310 5973 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6693 6142 gene locus_tag LOCUS_16320 6693 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9902 7605 gene locus_tag LOCUS_16330 9902 7605 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 protein_id gnl|my_center|LOCUS_16330 <11465 10263 gene locus_tag LOCUS_16340 <11465 10263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072970.1:beta-ketoacyl-[acyl-carrier-protein] synthase I >Feature sequence116 <1 1642 gene locus_tag LOCUS_16350 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001155015.1:regulatory protein LuxO 1693 2010 gene locus_tag LOCUS_16360 1693 2010 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_16360 2041 2415 gene locus_tag LOCUS_16370 2041 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073568.1 protein_id gnl|my_center|LOCUS_16370 3594 2590 gene locus_tag LOCUS_16380 3594 2590 CDS product interphotoreceptor retinoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_16380 5056 4271 gene locus_tag LOCUS_16390 5056 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5230 5072 gene locus_tag LOCUS_16400 5230 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5463 6389 gene locus_tag LOCUS_16410 5463 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 protein_id gnl|my_center|LOCUS_16410 6553 8517 gene locus_tag LOCUS_16420 6553 8517 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_16420 9805 9134 gene locus_tag LOCUS_16430 9805 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 10440 9937 gene locus_tag LOCUS_16440 10440 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10896 11099 gene locus_tag LOCUS_16450 10896 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence117 347 2893 gene locus_tag LOCUS_16460 347 2893 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_16460 3624 3037 gene locus_tag LOCUS_16470 3624 3037 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074221.1 protein_id gnl|my_center|LOCUS_16470 3748 3557 gene locus_tag LOCUS_16480 3748 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3850 4635 gene locus_tag LOCUS_16490 gene bioH 3850 4635 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8N6 protein_id gnl|my_center|LOCUS_16490 4714 5226 gene locus_tag LOCUS_16500 4714 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074223.1 protein_id gnl|my_center|LOCUS_16500 7277 5223 gene locus_tag LOCUS_16510 7277 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_16510 9929 7599 gene locus_tag LOCUS_16520 gene tex 9929 7599 CDS product transcription accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 protein_id gnl|my_center|LOCUS_16520 11012 10128 gene locus_tag LOCUS_16530 11012 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence118 342 602 gene locus_tag LOCUS_16540 342 602 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_16540 2294 639 gene locus_tag LOCUS_16550 2294 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2739 2314 gene locus_tag LOCUS_16560 2739 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271117.1 protein_id gnl|my_center|LOCUS_16560 4100 2736 gene locus_tag LOCUS_16570 4100 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882133.1 protein_id gnl|my_center|LOCUS_16570 8926 4367 gene locus_tag LOCUS_16580 gene accADCB 8926 4367 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071130.1 protein_id gnl|my_center|LOCUS_16580 9043 9954 gene locus_tag LOCUS_16590 9043 9954 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence119 3102 49 gene locus_tag LOCUS_16600 3102 49 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263656.1 protein_id gnl|my_center|LOCUS_16600 3563 3973 gene locus_tag LOCUS_16610 3563 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4122 4829 gene locus_tag LOCUS_16620 4122 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 protein_id gnl|my_center|LOCUS_16620 4971 5315 gene locus_tag LOCUS_16630 gene hpcD 4971 5315 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261059.1 protein_id gnl|my_center|LOCUS_16630 7073 5397 gene locus_tag LOCUS_16640 gene asnB 7073 5397 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072704.1 protein_id gnl|my_center|LOCUS_16640 9192 7498 gene locus_tag LOCUS_16650 9192 7498 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 protein_id gnl|my_center|LOCUS_16650 10274 9630 gene locus_tag LOCUS_16660 gene purN 10274 9630 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI7 protein_id gnl|my_center|LOCUS_16660 <11329 10274 gene locus_tag LOCUS_16670 <11329 10274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EDI8:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence120 1037 1918 gene locus_tag LOCUS_16680 1037 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2534 3043 gene locus_tag LOCUS_16690 gene purE-2 2534 3043 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 protein_id gnl|my_center|LOCUS_16690 3269 5374 gene locus_tag LOCUS_16700 3269 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073381.1 protein_id gnl|my_center|LOCUS_16700 5442 6056 gene locus_tag LOCUS_16710 5442 6056 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073380.1 protein_id gnl|my_center|LOCUS_16710 6046 6867 gene locus_tag LOCUS_16720 6046 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7125 10409 gene locus_tag LOCUS_16730 7125 10409 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT8 protein_id gnl|my_center|LOCUS_16730 10668 10835 gene locus_tag LOCUS_16740 10668 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence121 5554 4835 gene locus_tag LOCUS_16750 gene pfaR 5554 4835 CDS product transcriptional regulator of eicosapentaenoic acid synthesis PfaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071760.1 protein_id gnl|my_center|LOCUS_16750 6061 6573 gene locus_tag LOCUS_16760 6061 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6554 7000 gene locus_tag LOCUS_16770 6554 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 7054 7224 gene locus_tag LOCUS_16780 7054 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 7233 7394 gene locus_tag LOCUS_16790 7233 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16790 7357 7569 gene locus_tag LOCUS_16800 7357 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 7883 8743 gene locus_tag LOCUS_16810 gene pfaE 7883 8743 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071761.1 protein_id gnl|my_center|LOCUS_16810 10111 8900 gene locus_tag LOCUS_16820 10111 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_16820 <11229 10435 gene locus_tag LOCUS_16830 <11229 10435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGJ4:NADPH-dependent 7-cyano-7-deazaguanine reductase >Feature sequence122 56 131 gene locus_tag LOCUS_t00150 56 131 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 247 2151 gene locus_tag LOCUS_16840 247 2151 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 protein_id gnl|my_center|LOCUS_16840 2263 2841 gene locus_tag LOCUS_16850 gene rnfA 2263 2841 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE81 protein_id gnl|my_center|LOCUS_16850 2844 3413 gene locus_tag LOCUS_16860 gene rnfB 2844 3413 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_16860 3407 5398 gene locus_tag LOCUS_16870 gene rnfC 3407 5398 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE79 protein_id gnl|my_center|LOCUS_16870 5402 6454 gene locus_tag LOCUS_16880 gene rnfD 5402 6454 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE78 protein_id gnl|my_center|LOCUS_16880 6470 7108 gene locus_tag LOCUS_16890 gene rnfG 6470 7108 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE77 protein_id gnl|my_center|LOCUS_16890 7105 7875 gene locus_tag LOCUS_16900 gene rnfE 7105 7875 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE76 protein_id gnl|my_center|LOCUS_16900 7933 8574 gene locus_tag LOCUS_16910 gene nth 7933 8574 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE75 protein_id gnl|my_center|LOCUS_16910 8951 9361 gene locus_tag LOCUS_16920 gene gloA 8951 9361 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD7 protein_id gnl|my_center|LOCUS_16920 <11216 9450 gene locus_tag LOCUS_16930 <11216 9450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072403.1:TonB-dependent receptor >Feature sequence123 1723 794 gene locus_tag LOCUS_16940 1723 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912716.1 protein_id gnl|my_center|LOCUS_16940 2487 1720 gene locus_tag LOCUS_16950 2487 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266314.1 protein_id gnl|my_center|LOCUS_16950 4774 2705 gene locus_tag LOCUS_16960 gene glyS 4774 2705 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS6 protein_id gnl|my_center|LOCUS_16960 5649 4786 gene locus_tag LOCUS_16970 gene glyQ 5649 4786 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_16970 5872 6477 gene locus_tag LOCUS_16980 gene tag 5872 6477 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070432.1 protein_id gnl|my_center|LOCUS_16980 9892 6653 gene locus_tag LOCUS_16990 9892 6653 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_16990 10756 10319 gene locus_tag LOCUS_17000 10756 10319 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_17000 10967 10791 gene locus_tag LOCUS_17010 10967 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence124 260 5107 gene locus_tag LOCUS_17020 260 5107 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267393.1 protein_id gnl|my_center|LOCUS_17020 6005 5313 gene locus_tag LOCUS_17030 gene senC 6005 5313 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 protein_id gnl|my_center|LOCUS_17030 6987 6073 gene locus_tag LOCUS_17040 gene cyoE 6987 6073 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P7 protein_id gnl|my_center|LOCUS_17040 8053 7070 gene locus_tag LOCUS_17050 gene ctaA 8053 7070 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_17050 8598 8053 gene locus_tag LOCUS_17060 8598 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 protein_id gnl|my_center|LOCUS_17060 9584 8748 gene locus_tag LOCUS_17070 9584 8748 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q0 protein_id gnl|my_center|LOCUS_17070 9717 9935 gene locus_tag LOCUS_17080 9717 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074206.1 protein_id gnl|my_center|LOCUS_17080 10918 10043 gene locus_tag LOCUS_17090 gene coxC 10918 10043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence125 252 386 gene locus_tag LOCUS_17100 252 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 417 1013 gene locus_tag LOCUS_17110 417 1013 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_17110 1092 1325 gene locus_tag LOCUS_17120 1092 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1806 1420 gene locus_tag LOCUS_17130 1806 1420 CDS product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 protein_id gnl|my_center|LOCUS_17130 2732 1959 gene locus_tag LOCUS_17140 gene xni 2732 1959 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGP9 protein_id gnl|my_center|LOCUS_17140 4176 2821 gene locus_tag LOCUS_17150 4176 2821 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071722.1 protein_id gnl|my_center|LOCUS_17150 5835 4279 gene locus_tag LOCUS_17160 5835 4279 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071723.1 protein_id gnl|my_center|LOCUS_17160 8133 5968 gene locus_tag LOCUS_17170 8133 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071724.1 protein_id gnl|my_center|LOCUS_17170 8302 10104 gene locus_tag LOCUS_17180 8302 10104 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_17180 11117 10206 gene locus_tag LOCUS_17190 gene rdgC 11117 10206 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGP3 protein_id gnl|my_center|LOCUS_17190 >Feature sequence126 27 200 gene locus_tag LOCUS_17200 gene rpmG 27 200 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M4 protein_id gnl|my_center|LOCUS_17200 570 1814 gene locus_tag LOCUS_17210 gene argA 570 1814 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59292 protein_id gnl|my_center|LOCUS_17210 2776 1880 gene locus_tag LOCUS_17220 gene rarD 2776 1880 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 protein_id gnl|my_center|LOCUS_17220 3389 2925 gene locus_tag LOCUS_17230 gene yigI 3389 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_17230 3555 5387 gene locus_tag LOCUS_17240 gene recQ 3555 5387 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073918.1 protein_id gnl|my_center|LOCUS_17240 7311 5560 gene locus_tag LOCUS_17250 7311 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7827 9398 gene locus_tag LOCUS_17260 gene leuA 7827 9398 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N2 protein_id gnl|my_center|LOCUS_17260 9443 10546 gene locus_tag LOCUS_17270 gene leuB 9443 10546 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N3 protein_id gnl|my_center|LOCUS_17270 >Feature sequence127 1204 191 gene locus_tag LOCUS_17280 1204 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071774.1 protein_id gnl|my_center|LOCUS_17280 1368 1688 gene locus_tag LOCUS_17290 gene yqcC 1368 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 protein_id gnl|my_center|LOCUS_17290 1702 2529 gene locus_tag LOCUS_17300 gene truC 1702 2529 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071776.1 protein_id gnl|my_center|LOCUS_17300 2711 2526 gene locus_tag LOCUS_17310 2711 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2812 3276 gene locus_tag LOCUS_17320 gene yqcA 2812 3276 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071778.1 protein_id gnl|my_center|LOCUS_17320 3228 4697 gene locus_tag LOCUS_17330 gene ptsG 3228 4697 CDS product PTS glucose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071779.1 protein_id gnl|my_center|LOCUS_17330 4780 5613 gene locus_tag LOCUS_17340 gene purU 4780 5613 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGI0 protein_id gnl|my_center|LOCUS_17340 6067 5723 gene locus_tag LOCUS_17350 6067 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7133 6309 gene locus_tag LOCUS_17360 gene dapD 7133 6309 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH9 protein_id gnl|my_center|LOCUS_17360 9779 7200 gene locus_tag LOCUS_17370 gene glnD 9779 7200 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH8 protein_id gnl|my_center|LOCUS_17370 10668 9871 gene locus_tag LOCUS_17380 gene map 10668 9871 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH7 protein_id gnl|my_center|LOCUS_17380 10884 10669 gene locus_tag LOCUS_17390 10884 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence128 148 1539 gene locus_tag LOCUS_17400 148 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_17400 1550 2155 gene locus_tag LOCUS_17410 1550 2155 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071314.1 protein_id gnl|my_center|LOCUS_17410 2347 4971 gene locus_tag LOCUS_17420 2347 4971 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 protein_id gnl|my_center|LOCUS_17420 5225 5437 gene locus_tag LOCUS_17430 5225 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 6082 5516 gene locus_tag LOCUS_17440 6082 5516 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_17440 8260 6476 gene locus_tag LOCUS_17450 gene phoD 8260 6476 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_17450 8494 8913 gene locus_tag LOCUS_17460 8494 8913 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 protein_id gnl|my_center|LOCUS_17460 9693 9070 gene locus_tag LOCUS_17470 9693 9070 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU9 protein_id gnl|my_center|LOCUS_17470 9938 10594 gene locus_tag LOCUS_17480 gene rpiA 9938 10594 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHR7 protein_id gnl|my_center|LOCUS_17480 >Feature sequence129 1125 169 gene locus_tag LOCUS_17490 gene dsdC 1125 169 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602600.1 protein_id gnl|my_center|LOCUS_17490 2517 1174 gene locus_tag LOCUS_17500 gene dsdA 2517 1174 CDS product D-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJW5 protein_id gnl|my_center|LOCUS_17500 3864 3466 gene locus_tag LOCUS_17510 gene acpS 3864 3466 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH77 protein_id gnl|my_center|LOCUS_17510 4694 3957 gene locus_tag LOCUS_17520 gene pdxJ 4694 3957 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH78 protein_id gnl|my_center|LOCUS_17520 5617 4925 gene locus_tag LOCUS_17530 gene recO 5617 4925 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH79 protein_id gnl|my_center|LOCUS_17530 6787 5780 gene locus_tag LOCUS_17540 gene era 6787 5780 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH80 protein_id gnl|my_center|LOCUS_17540 7461 6784 gene locus_tag LOCUS_17550 gene rnc 7461 6784 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH81 protein_id gnl|my_center|LOCUS_17550 8380 7463 gene locus_tag LOCUS_17560 gene lepB 8380 7463 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH82 protein_id gnl|my_center|LOCUS_17560 10348 8537 gene locus_tag LOCUS_17570 gene lepA 10348 8537 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH83 protein_id gnl|my_center|LOCUS_17570 >Feature sequence130 1047 856 gene locus_tag LOCUS_17580 1047 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 997 1263 gene locus_tag LOCUS_17590 997 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1494 1360 gene locus_tag LOCUS_17600 1494 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1820 2044 gene locus_tag LOCUS_17610 1820 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073826.1 protein_id gnl|my_center|LOCUS_17610 3056 2142 gene locus_tag LOCUS_17620 3056 2142 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 protein_id gnl|my_center|LOCUS_17620 4217 3138 gene locus_tag LOCUS_17630 gene tqsA 4217 3138 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_17630 4305 4685 gene locus_tag LOCUS_17640 gene folX 4305 4685 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_17640 4870 4682 gene locus_tag LOCUS_17650 4870 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5007 5921 gene locus_tag LOCUS_17660 gene yfcH 5007 5921 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 protein_id gnl|my_center|LOCUS_17660 6239 5979 gene locus_tag LOCUS_17670 6239 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 8707 6254 gene locus_tag LOCUS_17680 gene ybbP 8707 6254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 protein_id gnl|my_center|LOCUS_17680 9459 8707 gene locus_tag LOCUS_17690 gene ybbA 9459 8707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_17690 9437 10078 gene locus_tag LOCUS_17700 gene tesA 9437 10078 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072832.1 protein_id gnl|my_center|LOCUS_17700 10441 10752 gene locus_tag LOCUS_17710 10441 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence131 1668 2630 gene locus_tag LOCUS_17720 1668 2630 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262938.1 protein_id gnl|my_center|LOCUS_17720 3406 2627 gene locus_tag LOCUS_17730 gene yfcA 3406 2627 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB6 protein_id gnl|my_center|LOCUS_17730 3533 4420 gene locus_tag LOCUS_17740 3533 4420 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072765.1 protein_id gnl|my_center|LOCUS_17740 5042 4656 gene locus_tag LOCUS_17750 5042 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 protein_id gnl|my_center|LOCUS_17750 5310 5077 gene locus_tag LOCUS_17760 5310 5077 CDS product S4 RNA-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 protein_id gnl|my_center|LOCUS_17760 5910 5374 gene locus_tag LOCUS_17770 gene rimJ 5910 5374 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071953.1 protein_id gnl|my_center|LOCUS_17770 6207 5929 gene locus_tag LOCUS_17780 gene ppiC 6207 5929 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071952.1 protein_id gnl|my_center|LOCUS_17780 8210 6363 gene locus_tag LOCUS_17790 8210 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_17790 8344 8853 gene locus_tag LOCUS_17800 8344 8853 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071950.1 protein_id gnl|my_center|LOCUS_17800 10216 8957 gene locus_tag LOCUS_17810 10216 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071949.1 protein_id gnl|my_center|LOCUS_17810 <10855 10219 gene locus_tag LOCUS_17820 <10855 10219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFY6:protein TonB >Feature sequence132 1726 500 gene locus_tag LOCUS_17830 gene visC 1726 500 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071081.1 protein_id gnl|my_center|LOCUS_17830 3118 1832 gene locus_tag LOCUS_17840 gene ubiH 3118 1832 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071080.1 protein_id gnl|my_center|LOCUS_17840 3769 3194 gene locus_tag LOCUS_17850 3769 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071079.1 protein_id gnl|my_center|LOCUS_17850 4050 4358 gene locus_tag LOCUS_17860 gene zapA 4050 4358 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR2 protein_id gnl|my_center|LOCUS_17860 5095 5730 gene locus_tag LOCUS_17870 gene ygfA 5095 5730 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR3 protein_id gnl|my_center|LOCUS_17870 6000 6488 gene locus_tag LOCUS_17880 gene nlpE 6000 6488 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073050.1 protein_id gnl|my_center|LOCUS_17880 7171 6503 gene locus_tag LOCUS_17890 gene ung 7171 6503 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB78 protein_id gnl|my_center|LOCUS_17890 7521 7775 gene locus_tag LOCUS_17900 7521 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 7912 8247 gene locus_tag LOCUS_17910 7912 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073455.1 protein_id gnl|my_center|LOCUS_17910 8906 8292 gene locus_tag LOCUS_17920 8906 8292 CDS product amino acid efflux permease RhtB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 protein_id gnl|my_center|LOCUS_17920 9297 10766 gene locus_tag LOCUS_17930 9297 10766 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073458.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence133 1837 125 gene locus_tag LOCUS_17940 1837 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2942 2427 gene locus_tag LOCUS_17950 2942 2427 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_17950 3219 2926 gene locus_tag LOCUS_17960 3219 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55365 protein_id gnl|my_center|LOCUS_17960 3430 3993 gene locus_tag LOCUS_17970 3430 3993 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 protein_id gnl|my_center|LOCUS_17970 4279 4971 gene locus_tag LOCUS_17980 4279 4971 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074392.1 protein_id gnl|my_center|LOCUS_17980 5924 5082 gene locus_tag LOCUS_17990 5924 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 6961 5933 gene locus_tag LOCUS_18000 6961 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 7223 6978 gene locus_tag LOCUS_18010 7223 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 7684 7220 gene locus_tag LOCUS_18020 7684 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8681 9247 gene locus_tag LOCUS_18030 8681 9247 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235713.1 protein_id gnl|my_center|LOCUS_18030 9628 10575 gene locus_tag LOCUS_18040 9628 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence134 1392 706 gene locus_tag LOCUS_18050 1392 706 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_18050 1849 1436 gene locus_tag LOCUS_18060 1849 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_18060 3665 1908 gene locus_tag LOCUS_18070 gene speE 3665 1908 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX8 protein_id gnl|my_center|LOCUS_18070 4625 3726 gene locus_tag LOCUS_18080 4625 3726 CDS product ATP synthase F0 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_18080 5598 4639 gene locus_tag LOCUS_18090 5598 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_18090 5868 8729 gene locus_tag LOCUS_18100 gene glnE 5868 8729 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAY1 protein_id gnl|my_center|LOCUS_18100 8978 9727 gene locus_tag LOCUS_18110 8978 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 10463 10741 gene locus_tag LOCUS_18120 10463 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence135 6960 7241 gene locus_tag LOCUS_18130 6960 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 7950 7354 gene locus_tag LOCUS_18140 7950 7354 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887706.1 protein_id gnl|my_center|LOCUS_18140 9189 8479 gene locus_tag LOCUS_18150 gene algR 9189 8479 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_18150 9686 9189 gene locus_tag LOCUS_18160 9686 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence136 632 417 gene locus_tag LOCUS_18170 632 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1071 2477 gene locus_tag LOCUS_18180 1071 2477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 protein_id gnl|my_center|LOCUS_18180 2772 4181 gene locus_tag LOCUS_18190 gene dbpA 2772 4181 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_18190 4565 5467 gene locus_tag LOCUS_18200 4565 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5915 5781 gene locus_tag LOCUS_18210 5915 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7771 6167 gene locus_tag LOCUS_18220 7771 6167 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_18220 8780 8010 gene locus_tag LOCUS_18230 8780 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 10734 9271 gene locus_tag LOCUS_18240 gene rhlE 10734 9271 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV8 protein_id gnl|my_center|LOCUS_18240 >Feature sequence137 283 1530 gene locus_tag LOCUS_18250 gene nqrF 283 1530 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV4 protein_id gnl|my_center|LOCUS_18250 1665 2681 gene locus_tag LOCUS_18260 gene apbE 1665 2681 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV3 protein_id gnl|my_center|LOCUS_18260 2806 3030 gene locus_tag LOCUS_18270 2806 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071354.1 protein_id gnl|my_center|LOCUS_18270 3266 3736 gene locus_tag LOCUS_18280 gene brf2 3266 3736 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_18280 3748 4215 gene locus_tag LOCUS_18290 gene brf1 3748 4215 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_18290 4369 4575 gene locus_tag LOCUS_18300 4369 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4760 6760 gene locus_tag LOCUS_18310 4760 6760 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071312.1 protein_id gnl|my_center|LOCUS_18310 7087 8217 gene locus_tag LOCUS_18320 gene frmA 7087 8217 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E800 protein_id gnl|my_center|LOCUS_18320 8361 9218 gene locus_tag LOCUS_18330 gene frmB 8361 9218 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_18330 9399 10508 gene locus_tag LOCUS_18340 gene dinB 9399 10508 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU9 protein_id gnl|my_center|LOCUS_18340 >Feature sequence138 1116 157 gene locus_tag LOCUS_18350 1116 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1496 1990 gene locus_tag LOCUS_18360 1496 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2924 4108 gene locus_tag LOCUS_18370 2924 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4413 6341 gene locus_tag LOCUS_18380 4413 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6601 7275 gene locus_tag LOCUS_18390 6601 7275 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461971.1 protein_id gnl|my_center|LOCUS_18390 7995 7294 gene locus_tag LOCUS_18400 gene senC 7995 7294 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 protein_id gnl|my_center|LOCUS_18400 8438 8079 gene locus_tag LOCUS_18410 8438 8079 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709070.1 protein_id gnl|my_center|LOCUS_18410 9265 8573 gene locus_tag LOCUS_18420 gene coxP 9265 8573 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 protein_id gnl|my_center|LOCUS_18420 10029 9349 gene locus_tag LOCUS_18430 gene coxO 10029 9349 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709068.1 protein_id gnl|my_center|LOCUS_18430 <10632 10029 gene locus_tag LOCUS_18440 <10632 10029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P98000:alternative cytochrome c oxidase subunit 1 >Feature sequence139 1009 428 gene locus_tag LOCUS_18450 1009 428 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070643.1 protein_id gnl|my_center|LOCUS_18450 1485 1006 gene locus_tag LOCUS_18460 gene ccmH 1485 1006 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070642.1 protein_id gnl|my_center|LOCUS_18460 2036 1482 gene locus_tag LOCUS_18470 gene ccmG 2036 1482 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_18470 4033 2054 gene locus_tag LOCUS_18480 gene ccmF 4033 2054 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 protein_id gnl|my_center|LOCUS_18480 4450 5697 gene locus_tag LOCUS_18490 gene ccmI 4450 5697 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 protein_id gnl|my_center|LOCUS_18490 6126 5833 gene locus_tag LOCUS_18500 gene scyA 6126 5833 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_18500 6493 7140 gene locus_tag LOCUS_18510 gene ccmA 6493 7140 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK40 protein_id gnl|my_center|LOCUS_18510 7150 7836 gene locus_tag LOCUS_18520 gene ccmB 7150 7836 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_18520 7838 8584 gene locus_tag LOCUS_18530 gene ccmC 7838 8584 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070635.1 protein_id gnl|my_center|LOCUS_18530 8584 8781 gene locus_tag LOCUS_18540 gene ccmD 8584 8781 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK43 protein_id gnl|my_center|LOCUS_18540 8781 9266 gene locus_tag LOCUS_18550 gene ccmE 8781 9266 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK44 protein_id gnl|my_center|LOCUS_18550 10325 9930 gene locus_tag LOCUS_18560 gene rplQ 10325 9930 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK46 protein_id gnl|my_center|LOCUS_18560 >Feature sequence140 699 73 gene locus_tag LOCUS_18570 gene ccoO 699 73 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072350.1 protein_id gnl|my_center|LOCUS_18570 2139 712 gene locus_tag LOCUS_18580 gene ccoN 2139 712 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_18580 2401 2874 gene locus_tag LOCUS_18590 2401 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072352.1 protein_id gnl|my_center|LOCUS_18590 4485 2890 gene locus_tag LOCUS_18600 4485 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_18600 5203 6495 gene locus_tag LOCUS_18610 5203 6495 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 protein_id gnl|my_center|LOCUS_18610 8717 8031 gene locus_tag LOCUS_18620 8717 8031 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 protein_id gnl|my_center|LOCUS_18620 10135 8996 gene locus_tag LOCUS_18630 gene czcO 10135 8996 CDS product putative oxidoreductase CzcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07085 protein_id gnl|my_center|LOCUS_18630 >Feature sequence141 276 1535 gene locus_tag LOCUS_18640 gene lolC 276 1535 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072271.1 protein_id gnl|my_center|LOCUS_18640 2209 1688 gene locus_tag LOCUS_18650 2209 1688 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_18650 2505 4532 gene locus_tag LOCUS_18660 2505 4532 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481856.1 protein_id gnl|my_center|LOCUS_18660 4566 6386 gene locus_tag LOCUS_18670 gene msbA 4566 6386 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDF0 protein_id gnl|my_center|LOCUS_18670 6390 7412 gene locus_tag LOCUS_18680 gene lpxK 6390 7412 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDF1 protein_id gnl|my_center|LOCUS_18680 7402 7581 gene locus_tag LOCUS_18690 7402 7581 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDF2 protein_id gnl|my_center|LOCUS_18690 7754 8476 gene locus_tag LOCUS_18700 7754 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44162 protein_id gnl|my_center|LOCUS_18700 8722 10320 gene locus_tag LOCUS_18710 8722 10320 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072230.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence142 1084 1956 gene locus_tag LOCUS_18720 1084 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_18720 1966 3258 gene locus_tag LOCUS_18730 1966 3258 CDS product DUF4785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071846.1 protein_id gnl|my_center|LOCUS_18730 4055 3699 gene locus_tag LOCUS_18740 4055 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071064.1 protein_id gnl|my_center|LOCUS_18740 5423 4173 gene locus_tag LOCUS_18750 5423 4173 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_18750 5775 5437 gene locus_tag LOCUS_18760 gene glnK 5775 5437 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071066.1 protein_id gnl|my_center|LOCUS_18760 7263 6205 gene locus_tag LOCUS_18770 gene lptG 7263 6205 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_18770 8138 7260 gene locus_tag LOCUS_18780 gene lptF 8138 7260 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_18780 8594 10102 gene locus_tag LOCUS_18790 gene pepA2 8594 10102 CDS product putative cytosol aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH62 protein_id gnl|my_center|LOCUS_18790 >Feature sequence143 749 174 gene locus_tag LOCUS_18800 gene calR 749 174 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073479.1 protein_id gnl|my_center|LOCUS_18800 2291 855 gene locus_tag LOCUS_18810 gene calB 2291 855 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB51 protein_id gnl|my_center|LOCUS_18810 2996 3427 gene locus_tag LOCUS_18820 2996 3427 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 protein_id gnl|my_center|LOCUS_18820 3533 3976 gene locus_tag LOCUS_18830 3533 3976 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 protein_id gnl|my_center|LOCUS_18830 5661 4252 gene locus_tag LOCUS_18840 5661 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 6709 6128 gene locus_tag LOCUS_18850 6709 6128 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073259.1 protein_id gnl|my_center|LOCUS_18850 6891 7943 gene locus_tag LOCUS_18860 gene sye4 6891 7943 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073258.1 protein_id gnl|my_center|LOCUS_18860 8863 9591 gene locus_tag LOCUS_18870 8863 9591 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_18870 9639 10340 gene locus_tag LOCUS_18880 9639 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence144 <1 2677 gene locus_tag LOCUS_18890 <1 2677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E4T6:DNA helicase 3494 2802 gene locus_tag LOCUS_18900 3494 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4441 3935 gene locus_tag LOCUS_18910 4441 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4616 4449 gene locus_tag LOCUS_18920 4616 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4777 4616 gene locus_tag LOCUS_18930 4777 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5731 5006 gene locus_tag LOCUS_18940 5731 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5883 6521 gene locus_tag LOCUS_18950 5883 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763433.1 protein_id gnl|my_center|LOCUS_18950 7629 6562 gene locus_tag LOCUS_18960 7629 6562 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_18960 8812 7727 gene locus_tag LOCUS_18970 8812 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 9151 9774 gene locus_tag LOCUS_18980 gene gmk 9151 9774 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU6 protein_id gnl|my_center|LOCUS_18980 9831 10115 gene locus_tag LOCUS_18990 gene rpoZ 9831 10115 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU7 protein_id gnl|my_center|LOCUS_18990 >Feature sequence145 953 186 gene locus_tag LOCUS_19000 gene moeB 953 186 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070541.1 protein_id gnl|my_center|LOCUS_19000 2301 1057 gene locus_tag LOCUS_19010 gene moeA 2301 1057 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070542.1 protein_id gnl|my_center|LOCUS_19010 2941 2771 gene locus_tag LOCUS_19020 2941 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3227 3754 gene locus_tag LOCUS_19030 gene ftn 3227 3754 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF4 protein_id gnl|my_center|LOCUS_19030 7015 3809 gene locus_tag LOCUS_19040 7015 3809 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070544.1 protein_id gnl|my_center|LOCUS_19040 8025 7372 gene locus_tag LOCUS_19050 gene ribB 8025 7372 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF2 protein_id gnl|my_center|LOCUS_19050 >Feature sequence146 359 1582 gene locus_tag LOCUS_19060 359 1582 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267685.1 protein_id gnl|my_center|LOCUS_19060 1654 2838 gene locus_tag LOCUS_19070 gene garK 1654 2838 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 protein_id gnl|my_center|LOCUS_19070 3059 4717 gene locus_tag LOCUS_19080 3059 4717 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 protein_id gnl|my_center|LOCUS_19080 5528 4746 gene locus_tag LOCUS_19090 gene map 5528 4746 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_19090 5740 5525 gene locus_tag LOCUS_19100 5740 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5964 6860 gene locus_tag LOCUS_19110 gene sitA 5964 6860 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182930.1 protein_id gnl|my_center|LOCUS_19110 6949 7812 gene locus_tag LOCUS_19120 6949 7812 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709591.1 protein_id gnl|my_center|LOCUS_19120 7895 8815 gene locus_tag LOCUS_19130 gene sitC 7895 8815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973877.1 protein_id gnl|my_center|LOCUS_19130 8799 9701 gene locus_tag LOCUS_19140 8799 9701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390642.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence147 223 405 gene locus_tag LOCUS_19150 223 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1189 503 gene locus_tag LOCUS_19160 1189 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3990 2419 gene locus_tag LOCUS_19170 3990 2419 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_19170 4351 4617 gene locus_tag LOCUS_19180 4351 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4827 6932 gene locus_tag LOCUS_19190 4827 6932 CDS product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 protein_id gnl|my_center|LOCUS_19190 7020 7586 gene locus_tag LOCUS_19200 7020 7586 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262849.1 protein_id gnl|my_center|LOCUS_19200 7879 8085 gene locus_tag LOCUS_19210 7879 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_19210 9374 8082 gene locus_tag LOCUS_19220 gene queG 9374 8082 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAN7 protein_id gnl|my_center|LOCUS_19220 >Feature sequence148 <1 670 gene locus_tag LOCUS_19230 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHS6:carbamoyl-phosphate synthase small chain 690 3908 gene locus_tag LOCUS_19240 gene carB 690 3908 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS5 protein_id gnl|my_center|LOCUS_19240 4308 4784 gene locus_tag LOCUS_19250 gene greA 4308 4784 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM8 protein_id gnl|my_center|LOCUS_19250 5298 4999 gene locus_tag LOCUS_19260 gene yhbY 5298 4999 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 protein_id gnl|my_center|LOCUS_19260 5390 6019 gene locus_tag LOCUS_19270 gene rlmE 5390 6019 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM3 protein_id gnl|my_center|LOCUS_19270 6065 8038 gene locus_tag LOCUS_19280 gene ftsH 6065 8038 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM2 protein_id gnl|my_center|LOCUS_19280 8166 9008 gene locus_tag LOCUS_19290 gene folP 8166 9008 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence149 1133 855 gene locus_tag LOCUS_19300 gene hfq 1133 855 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ69 protein_id gnl|my_center|LOCUS_19300 2118 1228 gene locus_tag LOCUS_19310 gene miaA 2118 1228 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX50 protein_id gnl|my_center|LOCUS_19310 4068 2203 gene locus_tag LOCUS_19320 gene mutL 4068 2203 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ70 protein_id gnl|my_center|LOCUS_19320 5401 4118 gene locus_tag LOCUS_19330 gene amiB 5401 4118 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 protein_id gnl|my_center|LOCUS_19330 5901 5443 gene locus_tag LOCUS_19340 gene yjeE 5901 5443 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_19340 9004 6293 gene locus_tag LOCUS_19350 9004 6293 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640332.1 protein_id gnl|my_center|LOCUS_19350 9997 9059 gene locus_tag LOCUS_19360 9997 9059 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109398.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence150 1195 398 gene locus_tag LOCUS_19370 1195 398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_19370 1668 1252 gene locus_tag LOCUS_19380 1668 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070890.1 protein_id gnl|my_center|LOCUS_19380 1879 2409 gene locus_tag LOCUS_19390 1879 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070891.1 protein_id gnl|my_center|LOCUS_19390 2837 2520 gene locus_tag LOCUS_19400 2837 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3548 3267 gene locus_tag LOCUS_19410 3548 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 4195 4731 gene locus_tag LOCUS_19420 4195 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_19420 5157 4846 gene locus_tag LOCUS_19430 5157 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070896.1 protein_id gnl|my_center|LOCUS_19430 5214 6095 gene locus_tag LOCUS_19440 gene gumN 5214 6095 CDS product protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070897.1 protein_id gnl|my_center|LOCUS_19440 6272 6898 gene locus_tag LOCUS_19450 gene cheD 6272 6898 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKL4 protein_id gnl|my_center|LOCUS_19450 7166 8050 gene locus_tag LOCUS_19460 7166 8050 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070899.1 protein_id gnl|my_center|LOCUS_19460 9082 8135 gene locus_tag LOCUS_19470 9082 8135 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_19470 <9992 9179 gene locus_tag LOCUS_19480 <9992 9179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263910.1:mechanosensitive ion channel protein >Feature sequence151 942 265 gene locus_tag LOCUS_19490 942 265 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M2 protein_id gnl|my_center|LOCUS_19490 1111 2352 gene locus_tag LOCUS_19500 gene dfp 1111 2352 CDS product bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 protein_id gnl|my_center|LOCUS_19500 2356 2814 gene locus_tag LOCUS_19510 gene dut 2356 2814 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M0 protein_id gnl|my_center|LOCUS_19510 2949 3542 gene locus_tag LOCUS_19520 gene slmA 2949 3542 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 protein_id gnl|my_center|LOCUS_19520 3681 5645 gene locus_tag LOCUS_19530 3681 5645 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_19530 5871 6530 gene locus_tag LOCUS_19540 gene folE 5871 6530 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L6 protein_id gnl|my_center|LOCUS_19540 7361 6720 gene locus_tag LOCUS_19550 gene pyrE 7361 6720 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L5 protein_id gnl|my_center|LOCUS_19550 8160 7447 gene locus_tag LOCUS_19560 gene rph 8160 7447 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L4 protein_id gnl|my_center|LOCUS_19560 8355 9218 gene locus_tag LOCUS_19570 8355 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073931.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence152 3510 1546 gene locus_tag LOCUS_19580 3510 1546 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269325.1 protein_id gnl|my_center|LOCUS_19580 4438 3689 gene locus_tag LOCUS_19590 gene yafD 4438 3689 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262419.1 protein_id gnl|my_center|LOCUS_19590 4778 6235 gene locus_tag LOCUS_19600 gene clsA 4778 6235 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRH2 protein_id gnl|my_center|LOCUS_19600 6475 6565 gene locus_tag LOCUS_t00160 6475 6565 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7767 6958 gene locus_tag LOCUS_19610 7767 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263728.1 protein_id gnl|my_center|LOCUS_19610 <9863 7970 gene locus_tag LOCUS_19620 <9863 7970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706458.1:methyl-accepting chemotaxis protein >Feature sequence153 <1 1501 gene locus_tag LOCUS_19630 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071584.1:carboxypeptidase M32 1687 1944 gene locus_tag LOCUS_19640 1687 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071581.1 protein_id gnl|my_center|LOCUS_19640 2034 2558 gene locus_tag LOCUS_19650 2034 2558 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 protein_id gnl|my_center|LOCUS_19650 4518 3118 gene locus_tag LOCUS_19660 gene nrfA 4518 3118 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC7 protein_id gnl|my_center|LOCUS_19660 4766 6469 gene locus_tag LOCUS_19670 gene narQ 4766 6469 CDS product two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073712.1 protein_id gnl|my_center|LOCUS_19670 6548 7177 gene locus_tag LOCUS_19680 gene narP 6548 7177 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073713.1 protein_id gnl|my_center|LOCUS_19680 7636 7262 gene locus_tag LOCUS_19690 7636 7262 CDS product UPF0231 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC4 protein_id gnl|my_center|LOCUS_19690 8591 7809 gene locus_tag LOCUS_19700 gene fklB 8591 7809 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 protein_id gnl|my_center|LOCUS_19700 8759 9730 gene locus_tag LOCUS_19710 8759 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071318.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence154 38 910 gene locus_tag LOCUS_19720 gene rmlA 38 910 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_19720 2220 919 gene locus_tag LOCUS_19730 2220 919 CDS product teichoic acid biosynthesis protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107919.1 protein_id gnl|my_center|LOCUS_19730 3700 2267 gene locus_tag LOCUS_19740 3700 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5908 3791 gene locus_tag LOCUS_19750 5908 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6256 6110 gene locus_tag LOCUS_19760 6256 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8083 6380 gene locus_tag LOCUS_19770 8083 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 8700 8482 gene locus_tag LOCUS_19780 8700 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9181 8840 gene locus_tag LOCUS_19790 9181 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence155 237 1454 gene locus_tag LOCUS_19800 237 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1738 1487 gene locus_tag LOCUS_19810 1738 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263413.1 protein_id gnl|my_center|LOCUS_19810 1924 4230 gene locus_tag LOCUS_19820 1924 4230 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009952308.1 protein_id gnl|my_center|LOCUS_19820 4572 4372 gene locus_tag LOCUS_19830 4572 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4667 5119 gene locus_tag LOCUS_19840 4667 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5765 5526 gene locus_tag LOCUS_19850 5765 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 6081 8627 gene locus_tag LOCUS_19860 6081 8627 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_19860 <9639 9126 gene locus_tag LOCUS_19870 <9639 9126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071997.1:transposase >Feature sequence156 994 1206 gene locus_tag LOCUS_19880 994 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1998 1582 gene locus_tag LOCUS_19890 1998 1582 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072250.1 protein_id gnl|my_center|LOCUS_19890 3418 2381 gene locus_tag LOCUS_19900 gene iaaA 3418 2381 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_19900 3745 3533 gene locus_tag LOCUS_19910 3745 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3630 5402 gene locus_tag LOCUS_19920 3630 5402 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072177.1 protein_id gnl|my_center|LOCUS_19920 5399 9364 gene locus_tag LOCUS_19930 5399 9364 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072176.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence157 418 221 gene locus_tag LOCUS_19940 418 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3000 595 gene locus_tag LOCUS_19950 3000 595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_19950 3715 3002 gene locus_tag LOCUS_19960 3715 3002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_19960 5002 3746 gene locus_tag LOCUS_19970 5002 3746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_19970 5257 6684 gene locus_tag LOCUS_19980 5257 6684 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_19980 6717 8069 gene locus_tag LOCUS_19990 6717 8069 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_19990 9268 8234 gene locus_tag LOCUS_20000 gene yncI 9268 8234 CDS product putative transposase YncI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7R5 protein_id gnl|my_center|LOCUS_20000 >Feature sequence158 86 367 gene locus_tag LOCUS_20010 86 367 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE15 protein_id gnl|my_center|LOCUS_20010 631 1116 gene locus_tag LOCUS_20020 631 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 1273 1713 gene locus_tag LOCUS_20030 1273 1713 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE17 protein_id gnl|my_center|LOCUS_20030 2315 1776 gene locus_tag LOCUS_20040 gene dsbB 2315 1776 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59346 protein_id gnl|my_center|LOCUS_20040 4047 2464 gene locus_tag LOCUS_20050 gene nhaB 4047 2464 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED79 protein_id gnl|my_center|LOCUS_20050 4353 5108 gene locus_tag LOCUS_20060 gene fadR 4353 5108 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED80 protein_id gnl|my_center|LOCUS_20060 5806 6990 gene locus_tag LOCUS_20070 5806 6990 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860940.1 protein_id gnl|my_center|LOCUS_20070 6987 7763 gene locus_tag LOCUS_20080 6987 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 8019 7798 gene locus_tag LOCUS_20090 8019 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 7973 8485 gene locus_tag LOCUS_20100 7973 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 8571 9329 gene locus_tag LOCUS_20110 8571 9329 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence159 428 592 gene locus_tag LOCUS_20120 gene ccoQ 428 592 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072349.1 protein_id gnl|my_center|LOCUS_20120 589 1560 gene locus_tag LOCUS_20130 gene ccoP 589 1560 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_20130 1671 2150 gene locus_tag LOCUS_20140 gene ccoH 1671 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_20140 2283 4682 gene locus_tag LOCUS_20150 gene ccoI 2283 4682 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 protein_id gnl|my_center|LOCUS_20150 4679 4873 gene locus_tag LOCUS_20160 gene ccoS 4679 4873 CDS product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072345.1 protein_id gnl|my_center|LOCUS_20160 4870 5562 gene locus_tag LOCUS_20170 4870 5562 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_20170 5687 6367 gene locus_tag LOCUS_20180 gene etrA 5687 6367 CDS product electron transport regulator A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46148 protein_id gnl|my_center|LOCUS_20180 6553 7485 gene locus_tag LOCUS_20190 gene uspE 6553 7485 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_20190 7593 8543 gene locus_tag LOCUS_20200 gene ttcA 7593 8543 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM4 protein_id gnl|my_center|LOCUS_20200 9274 8648 gene locus_tag LOCUS_20210 9274 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072340.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence160 737 1450 gene locus_tag LOCUS_20220 737 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1447 1920 gene locus_tag LOCUS_20230 1447 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2002 3507 gene locus_tag LOCUS_20240 2002 3507 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704358.1 protein_id gnl|my_center|LOCUS_20240 4095 4802 gene locus_tag LOCUS_20250 4095 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4799 5275 gene locus_tag LOCUS_20260 4799 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6925 5636 gene locus_tag LOCUS_20270 gene pip 6925 5636 CDS product proline iminopeptidase Pip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072953.1 protein_id gnl|my_center|LOCUS_20270 7248 7892 gene locus_tag LOCUS_20280 7248 7892 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_20280 8354 8989 gene locus_tag LOCUS_20290 gene mocA 8354 8989 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072949.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence161 131 1552 gene locus_tag LOCUS_20300 131 1552 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_20300 4880 1788 gene locus_tag LOCUS_20310 4880 1788 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_20310 5881 4877 gene locus_tag LOCUS_20320 5881 4877 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_20320 7374 6259 gene locus_tag LOCUS_20330 gene bamC 7374 6259 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFT6 protein_id gnl|my_center|LOCUS_20330 8310 7378 gene locus_tag LOCUS_20340 gene dapA 8310 7378 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFT7 protein_id gnl|my_center|LOCUS_20340 8501 9040 gene locus_tag LOCUS_20350 gene gcvR 8501 9040 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071987.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence162 1237 368 gene locus_tag LOCUS_20360 1237 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1699 1328 gene locus_tag LOCUS_20370 1699 1328 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072800.1 protein_id gnl|my_center|LOCUS_20370 2601 2242 gene locus_tag LOCUS_20380 2601 2242 CDS product topoisomerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072801.1 protein_id gnl|my_center|LOCUS_20380 3342 2767 gene locus_tag LOCUS_20390 gene yceI 3342 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_20390 4136 3495 gene locus_tag LOCUS_20400 gene pdxH 4136 3495 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED71 protein_id gnl|my_center|LOCUS_20400 5100 4159 gene locus_tag LOCUS_20410 gene speB 5100 4159 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263658.1 protein_id gnl|my_center|LOCUS_20410 6069 5125 gene locus_tag LOCUS_20420 gene speD 6069 5125 CDS product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 protein_id gnl|my_center|LOCUS_20420 8043 6130 gene locus_tag LOCUS_20430 gene speA 8043 6130 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU5 protein_id gnl|my_center|LOCUS_20430 8376 9212 gene locus_tag LOCUS_20440 gene yitL 8376 9212 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence163 228 593 gene locus_tag LOCUS_20450 228 593 CDS product DUF3478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070857.1 protein_id gnl|my_center|LOCUS_20450 840 1040 gene locus_tag LOCUS_20460 840 1040 CDS product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070858.1 protein_id gnl|my_center|LOCUS_20460 1200 1754 gene locus_tag LOCUS_20470 1200 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070859.1 protein_id gnl|my_center|LOCUS_20470 1983 3326 gene locus_tag LOCUS_20480 1983 3326 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_20480 3347 4636 gene locus_tag LOCUS_20490 3347 4636 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_20490 4671 7931 gene locus_tag LOCUS_20500 4671 7931 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_20500 8681 9169 gene locus_tag LOCUS_20510 8681 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence164 994 1413 gene locus_tag LOCUS_20520 994 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2931 1576 gene locus_tag LOCUS_20530 2931 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4530 3772 gene locus_tag LOCUS_20540 4530 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5173 4523 gene locus_tag LOCUS_20550 5173 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 6112 5708 gene locus_tag LOCUS_20560 6112 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20560 6687 6049 gene locus_tag LOCUS_20570 6687 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 8041 6803 gene locus_tag LOCUS_20580 8041 6803 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479444.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence165 <1 771 gene locus_tag LOCUS_20590 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073466.1:flagellar motor protein MotA 768 1184 gene locus_tag LOCUS_20600 gene exbD 768 1184 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073467.1 protein_id gnl|my_center|LOCUS_20600 1237 2190 gene locus_tag LOCUS_20610 gene hmuB 1237 2190 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073468.1 protein_id gnl|my_center|LOCUS_20610 2218 3234 gene locus_tag LOCUS_20620 gene hmuC 2218 3234 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073469.1 protein_id gnl|my_center|LOCUS_20620 3246 4010 gene locus_tag LOCUS_20630 gene hmuV 3246 4010 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB59 protein_id gnl|my_center|LOCUS_20630 4210 4542 gene locus_tag LOCUS_20640 4210 4542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 protein_id gnl|my_center|LOCUS_20640 5487 4594 gene locus_tag LOCUS_20650 5487 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5777 6409 gene locus_tag LOCUS_20660 5777 6409 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_20660 8989 6494 gene locus_tag LOCUS_20670 8989 6494 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073256.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence166 983 393 gene locus_tag LOCUS_20680 983 393 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_20680 2640 1057 gene locus_tag LOCUS_20690 2640 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 3469 2642 gene locus_tag LOCUS_20700 3469 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3682 3972 gene locus_tag LOCUS_20710 3682 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073474.1 protein_id gnl|my_center|LOCUS_20710 5364 4117 gene locus_tag LOCUS_20720 gene hmp 5364 4117 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMY3 protein_id gnl|my_center|LOCUS_20720 6865 5549 gene locus_tag LOCUS_20730 6865 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_20730 7023 6862 gene locus_tag LOCUS_20740 7023 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 7308 8933 gene locus_tag LOCUS_20750 7308 8933 CDS product regulatory protein LuxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155015.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence167 533 180 gene locus_tag LOCUS_20760 533 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070917.1 protein_id gnl|my_center|LOCUS_20760 873 2714 gene locus_tag LOCUS_20770 873 2714 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 protein_id gnl|my_center|LOCUS_20770 3314 2733 gene locus_tag LOCUS_20780 gene fsxA 3314 2733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 protein_id gnl|my_center|LOCUS_20780 3623 3946 gene locus_tag LOCUS_20790 gene cutA 3623 3946 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_20790 4004 5869 gene locus_tag LOCUS_20800 gene dsbD 4004 5869 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY1 protein_id gnl|my_center|LOCUS_20800 5992 7617 gene locus_tag LOCUS_20810 5992 7617 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_20810 7795 8787 gene locus_tag LOCUS_20820 7795 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence168 475 1869 gene locus_tag LOCUS_20830 475 1869 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070914.1 protein_id gnl|my_center|LOCUS_20830 2156 5863 gene locus_tag LOCUS_20840 2156 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 6069 8474 gene locus_tag LOCUS_20850 6069 8474 CDS product periplasmic metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 protein_id gnl|my_center|LOCUS_20850 8599 8901 gene locus_tag LOCUS_20860 8599 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence169 <1 2935 gene locus_tag LOCUS_20870 <1 2935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070924.1:mechanosensitive ion channel protein MscS 3544 3212 gene locus_tag LOCUS_20880 3544 3212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070922.1 protein_id gnl|my_center|LOCUS_20880 3593 4519 gene locus_tag LOCUS_20890 3593 4519 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 protein_id gnl|my_center|LOCUS_20890 7244 4971 gene locus_tag LOCUS_20900 gene parC 7244 4971 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK5 protein_id gnl|my_center|LOCUS_20900 8404 7241 gene locus_tag LOCUS_20910 8404 7241 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073644.1 protein_id gnl|my_center|LOCUS_20910 <8996 8450 gene locus_tag LOCUS_20920 <8996 8450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAK3:DNA topoisomerase 4 subunit B >Feature sequence170 1696 206 gene locus_tag LOCUS_20930 1696 206 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_20930 2329 1919 gene locus_tag LOCUS_20940 2329 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20940 2474 2295 gene locus_tag LOCUS_20950 2474 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20950 2763 2518 gene locus_tag LOCUS_20960 2763 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20960 3878 2799 gene locus_tag LOCUS_20970 3878 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20970 4011 4259 gene locus_tag LOCUS_20980 4011 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4502 5080 gene locus_tag LOCUS_20990 4502 5080 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070825.1 protein_id gnl|my_center|LOCUS_20990 6396 5692 gene locus_tag LOCUS_21000 6396 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6771 6457 gene locus_tag LOCUS_21010 6771 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7908 7513 gene locus_tag LOCUS_21020 7908 7513 CDS product toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263501.1 protein_id gnl|my_center|LOCUS_21020 8198 7905 gene locus_tag LOCUS_21030 8198 7905 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554755.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence171 683 210 gene locus_tag LOCUS_21040 gene nrdG 683 210 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDC9 protein_id gnl|my_center|LOCUS_21040 2893 776 gene locus_tag LOCUS_21050 gene nrdD 2893 776 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072754.1 protein_id gnl|my_center|LOCUS_21050 3945 3199 gene locus_tag LOCUS_21060 3945 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072755.1 protein_id gnl|my_center|LOCUS_21060 4531 4061 gene locus_tag LOCUS_21070 4531 4061 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707349.1 protein_id gnl|my_center|LOCUS_21070 4773 5771 gene locus_tag LOCUS_21080 4773 5771 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707351.1 protein_id gnl|my_center|LOCUS_21080 6826 5891 gene locus_tag LOCUS_21090 6826 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 protein_id gnl|my_center|LOCUS_21090 7302 8639 gene locus_tag LOCUS_21100 7302 8639 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence172 1661 606 gene locus_tag LOCUS_21110 1661 606 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_21110 1941 2288 gene locus_tag LOCUS_21120 1941 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 protein_id gnl|my_center|LOCUS_21120 2403 3098 gene locus_tag LOCUS_21130 2403 3098 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_21130 4276 3221 gene locus_tag LOCUS_21140 4276 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 6122 4419 gene locus_tag LOCUS_21150 6122 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 6370 6924 gene locus_tag LOCUS_21160 6370 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 7026 8384 gene locus_tag LOCUS_21170 gene tauD 7026 8384 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331272.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence173 <1 2581 gene locus_tag LOCUS_21180 <1 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase 2581 4833 gene locus_tag LOCUS_21190 gene pfaB 2581 4833 CDS product omega-3 polyunsaturated fatty acid synthase PfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071758.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence174 650 1375 gene locus_tag LOCUS_21200 gene ubiG 650 1375 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG9 protein_id gnl|my_center|LOCUS_21200 1375 2055 gene locus_tag LOCUS_21210 1375 2055 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072391.1 protein_id gnl|my_center|LOCUS_21210 2480 4768 gene locus_tag LOCUS_21220 gene nrdA 2480 4768 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG7 protein_id gnl|my_center|LOCUS_21220 4881 6011 gene locus_tag LOCUS_21230 gene nrdB 4881 6011 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072393.1 protein_id gnl|my_center|LOCUS_21230 6001 6360 gene locus_tag LOCUS_21240 6001 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 8817 6784 gene locus_tag LOCUS_21250 gene fadH 8817 6784 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence175 65 1915 gene locus_tag LOCUS_21260 gene secD 65 1915 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM5 protein_id gnl|my_center|LOCUS_21260 1928 2875 gene locus_tag LOCUS_21270 gene secF 1928 2875 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM6 protein_id gnl|my_center|LOCUS_21270 3111 3443 gene locus_tag LOCUS_21280 3111 3443 CDS product zinc-finger-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 protein_id gnl|my_center|LOCUS_21280 3514 4425 gene locus_tag LOCUS_21290 3514 4425 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073004.1 protein_id gnl|my_center|LOCUS_21290 4528 5070 gene locus_tag LOCUS_21300 gene yaeQ 4528 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_21300 5686 5285 gene locus_tag LOCUS_21310 5686 5285 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_21310 6724 5921 gene locus_tag LOCUS_21320 gene suhB 6724 5921 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 protein_id gnl|my_center|LOCUS_21320 6879 7643 gene locus_tag LOCUS_21330 gene trmJ 6879 7643 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEV2 protein_id gnl|my_center|LOCUS_21330 7655 8476 gene locus_tag LOCUS_21340 gene cysE 7655 8476 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence176 2530 305 gene locus_tag LOCUS_21350 gene icd 2530 305 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_21350 2932 3651 gene locus_tag LOCUS_21360 2932 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 3912 5042 gene locus_tag LOCUS_21370 gene mnmA 3912 5042 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX40 protein_id gnl|my_center|LOCUS_21370 5046 5660 gene locus_tag LOCUS_21380 gene hflD 5046 5660 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV9 protein_id gnl|my_center|LOCUS_21380 5688 7058 gene locus_tag LOCUS_21390 gene purB 5688 7058 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV8 protein_id gnl|my_center|LOCUS_21390 7146 8270 gene locus_tag LOCUS_21400 7146 8270 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072583.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence177 <1 1387 gene locus_tag LOCUS_21410 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E8S5:signal recognition particle receptor FtsY 1437 2132 gene locus_tag LOCUS_21420 gene ftsE 1437 2132 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 protein_id gnl|my_center|LOCUS_21420 2168 3133 gene locus_tag LOCUS_21430 gene ftsX 2168 3133 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_21430 3476 4336 gene locus_tag LOCUS_21440 gene rpoH 3476 4336 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S8 protein_id gnl|my_center|LOCUS_21440 6430 4928 gene locus_tag LOCUS_21450 gene menE 6430 4928 CDS product 2-succinylbenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074179.1 protein_id gnl|my_center|LOCUS_21450 7512 6445 gene locus_tag LOCUS_21460 gene menC 7512 6445 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8T2 protein_id gnl|my_center|LOCUS_21460 8291 7509 gene locus_tag LOCUS_21470 gene menH 8291 7509 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8T3 protein_id gnl|my_center|LOCUS_21470 >Feature sequence178 1567 83 gene locus_tag LOCUS_21480 1567 83 CDS product signal transduction protein with HDOD/GAF domains inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_21480 4330 2462 gene locus_tag LOCUS_21490 4330 2462 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071667.1 protein_id gnl|my_center|LOCUS_21490 4602 4396 gene locus_tag LOCUS_21500 4602 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5559 4738 gene locus_tag LOCUS_21510 5559 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 protein_id gnl|my_center|LOCUS_21510 6042 6551 gene locus_tag LOCUS_21520 gene bamE 6042 6551 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGW5 protein_id gnl|my_center|LOCUS_21520 6963 6631 gene locus_tag LOCUS_21530 6963 6631 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGW6 protein_id gnl|my_center|LOCUS_21530 7451 7020 gene locus_tag LOCUS_21540 gene yfjG 7451 7020 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071662.1 protein_id gnl|my_center|LOCUS_21540 7754 8251 gene locus_tag LOCUS_21550 gene smpB 7754 8251 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGW8 protein_id gnl|my_center|LOCUS_21550 >Feature sequence179 1044 67 gene locus_tag LOCUS_21560 gene bkdA2 1044 67 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_21560 2226 1048 gene locus_tag LOCUS_21570 gene bkdA1 2226 1048 CDS product 3-methyl-2-oxobutanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_21570 3458 2424 gene locus_tag LOCUS_21580 gene astE 3458 2424 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN9 protein_id gnl|my_center|LOCUS_21580 3793 4272 gene locus_tag LOCUS_21590 gene msrA 3793 4272 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP0 protein_id gnl|my_center|LOCUS_21590 5986 4322 gene locus_tag LOCUS_21600 gene pgm 5986 4322 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072327.1 protein_id gnl|my_center|LOCUS_21600 6812 6258 gene locus_tag LOCUS_21610 gene seqA 6812 6258 CDS product negative modulator of initiation of replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP2 protein_id gnl|my_center|LOCUS_21610 7217 7885 gene locus_tag LOCUS_21620 gene ybfF 7217 7885 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072325.1 protein_id gnl|my_center|LOCUS_21620 7968 8183 gene locus_tag LOCUS_21630 7968 8183 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072324.1 protein_id gnl|my_center|LOCUS_21630 8194 8466 gene locus_tag LOCUS_21640 gene ybfE 8194 8466 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072323.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence180 968 24 gene locus_tag LOCUS_21650 gene gspB 968 24 CDS product general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071511.1 protein_id gnl|my_center|LOCUS_21650 2572 968 gene locus_tag LOCUS_21660 gene gspA 2572 968 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_21660 2782 4023 gene locus_tag LOCUS_21670 gene cca 2782 4023 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW05 protein_id gnl|my_center|LOCUS_21670 4244 4510 gene locus_tag LOCUS_21680 gene lpp 4244 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071508.1 protein_id gnl|my_center|LOCUS_21680 5703 4801 gene locus_tag LOCUS_21690 5703 4801 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705230.1 protein_id gnl|my_center|LOCUS_21690 6841 5897 gene locus_tag LOCUS_21700 6841 5897 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071507.1 protein_id gnl|my_center|LOCUS_21700 7704 6904 gene locus_tag LOCUS_21710 gene uppP1 7704 6904 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_21710 8306 7776 gene locus_tag LOCUS_21720 8306 7776 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence181 <1 627 gene locus_tag LOCUS_21730 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070775.1:type II secretion system protein F 671 1582 gene locus_tag LOCUS_21740 gene pilD 671 1582 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP8 protein_id gnl|my_center|LOCUS_21740 1626 2231 gene locus_tag LOCUS_21750 gene coaE 1626 2231 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP9 protein_id gnl|my_center|LOCUS_21750 2239 2973 gene locus_tag LOCUS_21760 gene zapD 2239 2973 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ0 protein_id gnl|my_center|LOCUS_21760 3086 3298 gene locus_tag LOCUS_21770 gene yacG 3086 3298 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ1 protein_id gnl|my_center|LOCUS_21770 3304 3720 gene locus_tag LOCUS_21780 gene mutT 3304 3720 CDS product 7,8-dihydro-8-oxoguanine-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 protein_id gnl|my_center|LOCUS_21780 4075 5079 gene locus_tag LOCUS_21790 4075 5079 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707373.1 protein_id gnl|my_center|LOCUS_21790 5164 6063 gene locus_tag LOCUS_21800 5164 6063 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706548.1 protein_id gnl|my_center|LOCUS_21800 6056 7327 gene locus_tag LOCUS_21810 6056 7327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_21810 7327 8541 gene locus_tag LOCUS_21820 7327 8541 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence182 382 149 gene locus_tag LOCUS_21830 382 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 879 478 gene locus_tag LOCUS_21840 879 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1431 892 gene locus_tag LOCUS_21850 1431 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1706 1500 gene locus_tag LOCUS_21860 1706 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098810.1 protein_id gnl|my_center|LOCUS_21860 1780 2847 gene locus_tag LOCUS_21870 1780 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2876 3598 gene locus_tag LOCUS_21880 2876 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3609 4220 gene locus_tag LOCUS_21890 3609 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 4223 5266 gene locus_tag LOCUS_21900 4223 5266 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 protein_id gnl|my_center|LOCUS_21900 6257 5373 gene locus_tag LOCUS_21910 6257 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479243.1 protein_id gnl|my_center|LOCUS_21910 6984 8195 gene locus_tag LOCUS_21920 gene intA 6984 8195 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071660.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence183 634 5 gene locus_tag LOCUS_21930 634 5 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073435.1 protein_id gnl|my_center|LOCUS_21930 1470 691 gene locus_tag LOCUS_21940 gene djlA 1470 691 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_21940 2221 1535 gene locus_tag LOCUS_21950 2221 1535 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073437.1 protein_id gnl|my_center|LOCUS_21950 3090 2218 gene locus_tag LOCUS_21960 3090 2218 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_21960 3496 5712 gene locus_tag LOCUS_21970 gene lptD 3496 5712 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB96 protein_id gnl|my_center|LOCUS_21970 5882 7141 gene locus_tag LOCUS_21980 gene surA 5882 7141 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB95 protein_id gnl|my_center|LOCUS_21980 7147 8133 gene locus_tag LOCUS_21990 gene pdxA 7147 8133 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB94 protein_id gnl|my_center|LOCUS_21990 >Feature sequence184 2169 1330 gene locus_tag LOCUS_22000 2169 1330 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_22000 2550 2383 gene locus_tag LOCUS_22010 2550 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2498 2932 gene locus_tag LOCUS_22020 2498 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 protein_id gnl|my_center|LOCUS_22020 2963 3535 gene locus_tag LOCUS_22030 gene yecM 2963 3535 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072218.1 protein_id gnl|my_center|LOCUS_22030 3839 3663 gene locus_tag LOCUS_22040 3839 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4474 4184 gene locus_tag LOCUS_22050 4474 4184 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704510.1 protein_id gnl|my_center|LOCUS_22050 6748 5912 gene locus_tag LOCUS_22060 6748 5912 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_22060 7697 6813 gene locus_tag LOCUS_22070 gene queD 7697 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence185 1844 207 gene locus_tag LOCUS_22080 1844 207 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811649.1 protein_id gnl|my_center|LOCUS_22080 2989 2525 gene locus_tag LOCUS_22090 2989 2525 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261941.1 protein_id gnl|my_center|LOCUS_22090 4045 3143 gene locus_tag LOCUS_22100 4045 3143 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090845.1 protein_id gnl|my_center|LOCUS_22100 4397 4032 gene locus_tag LOCUS_22110 4397 4032 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_22110 6365 4494 gene locus_tag LOCUS_22120 6365 4494 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074163.1 protein_id gnl|my_center|LOCUS_22120 6960 7565 gene locus_tag LOCUS_22130 6960 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence186 5684 5310 gene locus_tag LOCUS_22140 5684 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 6501 5776 gene locus_tag LOCUS_22150 6501 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 6857 7651 gene locus_tag LOCUS_22160 6857 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence187 626 2104 gene locus_tag LOCUS_22170 626 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3443 2280 gene locus_tag LOCUS_22180 gene natB 3443 2280 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 protein_id gnl|my_center|LOCUS_22180 4364 3630 gene locus_tag LOCUS_22190 gene natA 4364 3630 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 protein_id gnl|my_center|LOCUS_22190 5976 4357 gene locus_tag LOCUS_22200 5976 4357 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 protein_id gnl|my_center|LOCUS_22200 6068 6436 gene locus_tag LOCUS_22210 6068 6436 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_22210 6480 7337 gene locus_tag LOCUS_22220 6480 7337 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence188 1046 1648 gene locus_tag LOCUS_22230 gene yjdF 1046 1648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_22230 1912 2577 gene locus_tag LOCUS_22240 gene csgD 1912 2577 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071154.1 protein_id gnl|my_center|LOCUS_22240 3035 5707 gene locus_tag LOCUS_22250 gene exeM 3035 5707 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071320.1 protein_id gnl|my_center|LOCUS_22250 6008 6448 gene locus_tag LOCUS_22260 6008 6448 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 protein_id gnl|my_center|LOCUS_22260 6521 6769 gene locus_tag LOCUS_22270 6521 6769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071323.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence189 262 2427 gene locus_tag LOCUS_22280 gene mnmC 262 2427 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR0 protein_id gnl|my_center|LOCUS_22280 3101 2508 gene locus_tag LOCUS_22290 3101 2508 CDS product RNA methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072972.1 protein_id gnl|my_center|LOCUS_22290 3367 3098 gene locus_tag LOCUS_22300 gene yfcL 3367 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072973.1 protein_id gnl|my_center|LOCUS_22300 4620 3496 gene locus_tag LOCUS_22310 4620 3496 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_22310 5912 4740 gene locus_tag LOCUS_22320 5912 4740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 protein_id gnl|my_center|LOCUS_22320 7179 6085 gene locus_tag LOCUS_22330 gene aroC 7179 6085 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW14 protein_id gnl|my_center|LOCUS_22330 <8248 7339 gene locus_tag LOCUS_22340 <8248 7339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECQ4:50S ribosomal protein L3 glutamine methyltransferase >Feature sequence190 422 264 gene locus_tag LOCUS_22350 422 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3033 646 gene locus_tag LOCUS_22360 3033 646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_22360 3727 3035 gene locus_tag LOCUS_22370 3727 3035 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_22370 4008 3760 gene locus_tag LOCUS_22380 4008 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5063 4113 gene locus_tag LOCUS_22390 5063 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 5267 6640 gene locus_tag LOCUS_22400 5267 6640 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_22400 6644 7975 gene locus_tag LOCUS_22410 6644 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence191 321 1169 gene locus_tag LOCUS_22420 321 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072335.1 protein_id gnl|my_center|LOCUS_22420 1413 2423 gene locus_tag LOCUS_22430 gene gapA 1413 2423 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN3 protein_id gnl|my_center|LOCUS_22430 2729 3430 gene locus_tag LOCUS_22440 gene trmJ 2729 3430 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM3 protein_id gnl|my_center|LOCUS_22440 3780 4250 gene locus_tag LOCUS_22450 gene brf2 3780 4250 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_22450 4252 4734 gene locus_tag LOCUS_22460 gene brf1 4252 4734 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_22460 5451 5059 gene locus_tag LOCUS_22470 5451 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5964 5689 gene locus_tag LOCUS_22480 5964 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261432.1 protein_id gnl|my_center|LOCUS_22480 7512 6154 gene locus_tag LOCUS_22490 gene tauD 7512 6154 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331272.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence192 352 2598 gene locus_tag LOCUS_22500 352 2598 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072947.1 protein_id gnl|my_center|LOCUS_22500 2925 3449 gene locus_tag LOCUS_22510 2925 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072946.1 protein_id gnl|my_center|LOCUS_22510 3500 4948 gene locus_tag LOCUS_22520 3500 4948 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479118.1 protein_id gnl|my_center|LOCUS_22520 5247 5882 gene locus_tag LOCUS_22530 5247 5882 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence193 2245 548 gene locus_tag LOCUS_22540 gene batD 2245 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 protein_id gnl|my_center|LOCUS_22540 4167 2239 gene locus_tag LOCUS_22550 gene batB 4167 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_22550 5173 4169 gene locus_tag LOCUS_22560 gene batA 5173 4169 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_22560 5691 5167 gene locus_tag LOCUS_22570 5691 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 6461 5691 gene locus_tag LOCUS_22580 6461 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 protein_id gnl|my_center|LOCUS_22580 6372 6560 gene locus_tag LOCUS_22590 6372 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 7578 6622 gene locus_tag LOCUS_22600 7578 6622 CDS product MoxR-like ATPase in aerotolerance operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence194 320 1726 gene locus_tag LOCUS_22610 gene aggA 320 1726 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 protein_id gnl|my_center|LOCUS_22610 1726 2325 gene locus_tag LOCUS_22620 1726 2325 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073980.1 protein_id gnl|my_center|LOCUS_22620 2344 3051 gene locus_tag LOCUS_22630 2344 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073981.1 protein_id gnl|my_center|LOCUS_22630 3060 4985 gene locus_tag LOCUS_22640 3060 4985 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073982.1 protein_id gnl|my_center|LOCUS_22640 6989 5100 gene locus_tag LOCUS_22650 6989 5100 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883104.1 protein_id gnl|my_center|LOCUS_22650 7497 7421 gene locus_tag LOCUS_t00170 7497 7421 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7765 7689 gene locus_tag LOCUS_t00180 7765 7689 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7895 7820 gene locus_tag LOCUS_t00190 7895 7820 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8036 7960 gene locus_tag LOCUS_t00200 8036 7960 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence195 129 812 gene locus_tag LOCUS_22660 129 812 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072773.1 protein_id gnl|my_center|LOCUS_22660 916 1140 gene locus_tag LOCUS_22670 916 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1672 3216 gene locus_tag LOCUS_22680 gene pntA 1672 3216 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS96 protein_id gnl|my_center|LOCUS_22680 3230 4630 gene locus_tag LOCUS_22690 gene pntB 3230 4630 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ6 protein_id gnl|my_center|LOCUS_22690 5060 7900 gene locus_tag LOCUS_22700 5060 7900 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence196 3150 148 gene locus_tag LOCUS_22710 3150 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4179 3337 gene locus_tag LOCUS_22720 4179 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4787 4311 gene locus_tag LOCUS_22730 4787 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5479 4859 gene locus_tag LOCUS_22740 5479 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 6178 5603 gene locus_tag LOCUS_22750 6178 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence197 504 337 gene locus_tag LOCUS_22760 504 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1022 1210 gene locus_tag LOCUS_22770 1022 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 1756 2214 gene locus_tag LOCUS_22780 gene nsrR 1756 2214 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070460.1 protein_id gnl|my_center|LOCUS_22780 2982 2242 gene locus_tag LOCUS_22790 gene yibQ 2982 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_22790 4278 3058 gene locus_tag LOCUS_22800 4278 3058 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070462.1 protein_id gnl|my_center|LOCUS_22800 5444 4311 gene locus_tag LOCUS_22810 5444 4311 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_22810 6999 5455 gene locus_tag LOCUS_22820 gene gpmI 6999 5455 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59175 protein_id gnl|my_center|LOCUS_22820 7241 7675 gene locus_tag LOCUS_22830 7241 7675 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence198 165 551 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcacaggcagcttagaaa 1012 1158 gene locus_tag LOCUS_22840 1012 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1322 1555 gene locus_tag LOCUS_22850 1322 1555 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 protein_id gnl|my_center|LOCUS_22850 1556 1954 gene locus_tag LOCUS_22860 gene vapC 1556 1954 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JND5 protein_id gnl|my_center|LOCUS_22860 2554 2414 gene locus_tag LOCUS_22870 2554 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3987 6164 gene locus_tag LOCUS_22880 3987 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 6168 6980 gene locus_tag LOCUS_22890 6168 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 7636 7346 gene locus_tag LOCUS_22900 7636 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence199 679 2778 gene locus_tag LOCUS_22910 gene flhA 679 2778 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073098.1 protein_id gnl|my_center|LOCUS_22910 2790 4181 gene locus_tag LOCUS_22920 gene flhF 2790 4181 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 protein_id gnl|my_center|LOCUS_22920 4174 5067 gene locus_tag LOCUS_22930 gene flhG 4174 5067 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD2 protein_id gnl|my_center|LOCUS_22930 5060 5779 gene locus_tag LOCUS_22940 gene fliA 5060 5779 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD3 protein_id gnl|my_center|LOCUS_22940 5797 6204 gene locus_tag LOCUS_22950 gene cheY 5797 6204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_22950 6217 6954 gene locus_tag LOCUS_22960 gene cheZ 6217 6954 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD5 protein_id gnl|my_center|LOCUS_22960 >Feature sequence200 <1 1674 gene locus_tag LOCUS_22970 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ED70:DNA ligase 1827 2342 gene locus_tag LOCUS_22980 1827 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072780.1 protein_id gnl|my_center|LOCUS_22980 3109 4311 gene locus_tag LOCUS_22990 3109 4311 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072779.1 protein_id gnl|my_center|LOCUS_22990 4378 5253 gene locus_tag LOCUS_23000 gene yeeZ 4378 5253 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072778.1 protein_id gnl|my_center|LOCUS_23000 5378 5995 gene locus_tag LOCUS_23010 5378 5995 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDA2 protein_id gnl|my_center|LOCUS_23010 6177 6716 gene locus_tag LOCUS_23020 6177 6716 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106004.1 protein_id gnl|my_center|LOCUS_23020 6912 6763 gene locus_tag LOCUS_23030 6912 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 7678 7088 gene locus_tag LOCUS_23040 7678 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence201 2298 352 gene locus_tag LOCUS_23050 2298 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2617 2309 gene locus_tag LOCUS_23060 2617 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3829 2630 gene locus_tag LOCUS_23070 3829 2630 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706358.1 protein_id gnl|my_center|LOCUS_23070 4800 3826 gene locus_tag LOCUS_23080 4800 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4945 4754 gene locus_tag LOCUS_23090 4945 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 7732 5792 gene locus_tag LOCUS_23100 7732 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence202 883 677 gene locus_tag LOCUS_23110 883 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 960 1850 gene locus_tag LOCUS_23120 gene metF 960 1850 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA55 protein_id gnl|my_center|LOCUS_23120 1903 2325 gene locus_tag LOCUS_23130 1903 2325 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 protein_id gnl|my_center|LOCUS_23130 2318 2545 gene locus_tag LOCUS_23140 2318 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3396 2992 gene locus_tag LOCUS_23150 3396 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 4018 3638 gene locus_tag LOCUS_23160 4018 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4152 5279 gene locus_tag LOCUS_23170 4152 5279 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_23170 5422 5865 gene locus_tag LOCUS_23180 5422 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 6829 5879 gene locus_tag LOCUS_23190 6829 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261945.1 protein_id gnl|my_center|LOCUS_23190 <7750 7219 gene locus_tag LOCUS_23200 <7750 7219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EA75:ATP-dependent RNA helicase DeaD >Feature sequence203 181 97 gene locus_tag LOCUS_t00210 181 97 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 479 403 gene locus_tag LOCUS_t00220 479 403 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1886 795 gene locus_tag LOCUS_23210 gene ychF 1886 795 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN4 protein_id gnl|my_center|LOCUS_23210 2603 2019 gene locus_tag LOCUS_23220 gene pth 2603 2019 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN5 protein_id gnl|my_center|LOCUS_23220 3994 2801 gene locus_tag LOCUS_23230 gene ubiF 3994 2801 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071414.1 protein_id gnl|my_center|LOCUS_23230 4649 6073 gene locus_tag LOCUS_23240 gene miaB 4649 6073 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX45 protein_id gnl|my_center|LOCUS_23240 6208 7251 gene locus_tag LOCUS_23250 gene ybeZ 6208 7251 CDS product ATP-binding protein YbeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071411.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence204 534 1274 gene locus_tag LOCUS_23260 534 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_23260 1518 2255 gene locus_tag LOCUS_23270 1518 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2248 2772 gene locus_tag LOCUS_23280 2248 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3161 4546 gene locus_tag LOCUS_23290 3161 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071222.1 protein_id gnl|my_center|LOCUS_23290 6702 4579 gene locus_tag LOCUS_23300 6702 4579 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071223.1 protein_id gnl|my_center|LOCUS_23300 6871 6686 gene locus_tag LOCUS_23310 6871 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7238 6951 gene locus_tag LOCUS_23320 7238 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence205 1692 2420 gene locus_tag LOCUS_23330 1692 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2957 4021 gene locus_tag LOCUS_23340 2957 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4563 5231 gene locus_tag LOCUS_23350 4563 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5931 5728 gene locus_tag LOCUS_23360 5931 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 <7698 6006 gene locus_tag LOCUS_23370 <7698 6006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123110.1:multidrug resistance protein >Feature sequence206 3097 1427 gene locus_tag LOCUS_23380 3097 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071119.1 protein_id gnl|my_center|LOCUS_23380 4429 3347 gene locus_tag LOCUS_23390 gene rsmC 4429 3347 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIL1 protein_id gnl|my_center|LOCUS_23390 4787 5230 gene locus_tag LOCUS_23400 4787 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5214 6374 gene locus_tag LOCUS_23410 5214 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence207 1 279 gene locus_tag LOCUS_23420 1 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 485 829 gene locus_tag LOCUS_23430 485 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1373 954 gene locus_tag LOCUS_23440 1373 954 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072587.1 protein_id gnl|my_center|LOCUS_23440 1958 1506 gene locus_tag LOCUS_23450 1958 1506 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072588.1 protein_id gnl|my_center|LOCUS_23450 5125 2069 gene locus_tag LOCUS_23460 5125 2069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072589.1 protein_id gnl|my_center|LOCUS_23460 7611 5242 gene locus_tag LOCUS_23470 gene ppsA 7611 5242 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU9 protein_id gnl|my_center|LOCUS_23470 >Feature sequence208 1067 516 gene locus_tag LOCUS_23480 gene gmhB 1067 516 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB1 protein_id gnl|my_center|LOCUS_23480 1422 1700 gene locus_tag LOCUS_23490 1422 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23490 1758 2318 gene locus_tag LOCUS_23500 1758 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23500 2327 2503 gene locus_tag LOCUS_23510 2327 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 4733 4329 gene locus_tag LOCUS_23520 4733 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 6371 4995 gene locus_tag LOCUS_23530 6371 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7437 6355 gene locus_tag LOCUS_23540 7437 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence209 165 1169 gene locus_tag LOCUS_23550 165 1169 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083855.1 protein_id gnl|my_center|LOCUS_23550 1519 1340 gene locus_tag LOCUS_23560 1519 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1836 3992 gene locus_tag LOCUS_23570 1836 3992 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_23570 4240 4076 gene locus_tag LOCUS_23580 4240 4076 CDS product Pmp3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 protein_id gnl|my_center|LOCUS_23580 4931 4257 gene locus_tag LOCUS_23590 4931 4257 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074068.1 protein_id gnl|my_center|LOCUS_23590 6363 5026 gene locus_tag LOCUS_23600 6363 5026 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074069.1 protein_id gnl|my_center|LOCUS_23600 7009 6332 gene locus_tag LOCUS_23610 7009 6332 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074070.1 protein_id gnl|my_center|LOCUS_23610 7555 7019 gene locus_tag LOCUS_23620 7555 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074071.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence210 372 1133 gene locus_tag LOCUS_23630 372 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073675.1 protein_id gnl|my_center|LOCUS_23630 2425 1523 gene locus_tag LOCUS_23640 2425 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4057 3302 gene locus_tag LOCUS_23650 gene rlmB 4057 3302 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_23650 6562 4073 gene locus_tag LOCUS_23660 gene rnr 6562 4073 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG7 protein_id gnl|my_center|LOCUS_23660 7287 6631 gene locus_tag LOCUS_23670 gene motX 7287 6631 CDS product flagellar rotation associated protein MotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073679.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence211 89 4027 gene locus_tag LOCUS_23680 89 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 4632 4120 gene locus_tag LOCUS_23690 4632 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 5827 4721 gene locus_tag LOCUS_23700 gene dapA 5827 4721 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 protein_id gnl|my_center|LOCUS_23700 7251 5902 gene locus_tag LOCUS_23710 gene lysC 7251 5902 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence212 86 919 gene locus_tag LOCUS_23720 gene cysG 86 919 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073514.1 protein_id gnl|my_center|LOCUS_23720 1780 926 gene locus_tag LOCUS_23730 1780 926 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073510.1 protein_id gnl|my_center|LOCUS_23730 2276 1824 gene locus_tag LOCUS_23740 2276 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2516 2325 gene locus_tag LOCUS_23750 2516 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2594 3100 gene locus_tag LOCUS_23760 2594 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3133 3483 gene locus_tag LOCUS_23770 3133 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3500 4843 gene locus_tag LOCUS_23780 3500 4843 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963230.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence213 131 772 gene locus_tag LOCUS_23790 gene eda 131 772 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_23790 1203 2234 gene locus_tag LOCUS_23800 1203 2234 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971230.1 protein_id gnl|my_center|LOCUS_23800 2305 2724 gene locus_tag LOCUS_23810 2305 2724 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_23810 3198 4229 gene locus_tag LOCUS_23820 3198 4229 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_23820 6966 4276 gene locus_tag LOCUS_23830 gene yfiQ 6966 4276 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072179.1 protein_id gnl|my_center|LOCUS_23830 7506 7430 gene locus_tag LOCUS_t00230 7506 7430 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence214 799 978 gene locus_tag LOCUS_23840 799 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2095 1232 gene locus_tag LOCUS_23850 2095 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2733 2110 gene locus_tag LOCUS_23860 2733 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3760 2897 gene locus_tag LOCUS_23870 3760 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 5330 3747 gene locus_tag LOCUS_23880 5330 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 7015 5330 gene locus_tag LOCUS_23890 7015 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 <7563 7008 gene locus_tag LOCUS_23900 <7563 7008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073936.1:SAM-dependent methyltransferase >Feature sequence215 475 550 gene locus_tag LOCUS_t00240 475 550 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 716 791 gene locus_tag LOCUS_t00250 716 791 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1456 1118 gene locus_tag LOCUS_23910 gene glnB 1456 1118 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_23910 1712 2224 gene locus_tag LOCUS_23920 gene fimT 1712 2224 CDS product type IV minor pilin protein FimT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073354.1 protein_id gnl|my_center|LOCUS_23920 2347 2910 gene locus_tag LOCUS_23930 gene fimU 2347 2910 CDS product type IV pilus biogenesis protein FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 protein_id gnl|my_center|LOCUS_23930 3480 3190 gene locus_tag LOCUS_23940 3480 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3860 3477 gene locus_tag LOCUS_23950 gene pilE 3860 3477 CDS product type IV minor pilin protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_23950 7441 3905 gene locus_tag LOCUS_23960 gene pilY 7441 3905 CDS product type IV pili system adhesin PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence216 2464 2643 gene locus_tag LOCUS_23970 2464 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23970 2656 3270 gene locus_tag LOCUS_23980 2656 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23980 3902 4297 gene locus_tag LOCUS_23990 3902 4297 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_23990 4297 5085 gene locus_tag LOCUS_24000 4297 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073593.1 protein_id gnl|my_center|LOCUS_24000 5304 6566 gene locus_tag LOCUS_24010 5304 6566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence217 <1 1499 gene locus_tag LOCUS_24020 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:phosphodiesterase 1746 2912 gene locus_tag LOCUS_24030 1746 2912 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 protein_id gnl|my_center|LOCUS_24030 3034 3831 gene locus_tag LOCUS_24040 3034 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3908 4324 gene locus_tag LOCUS_24050 3908 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 5770 4364 gene locus_tag LOCUS_24060 5770 4364 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 protein_id gnl|my_center|LOCUS_24060 6399 5914 gene locus_tag LOCUS_24070 gene accB 6399 5914 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_24070 6929 6474 gene locus_tag LOCUS_24080 gene aroQ 6929 6474 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KU6 protein_id gnl|my_center|LOCUS_24080 >Feature sequence218 4494 667 gene locus_tag LOCUS_24090 gene purL 4494 667 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC57 protein_id gnl|my_center|LOCUS_24090 4863 6305 gene locus_tag LOCUS_24100 gene mltF 4863 6305 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC56 protein_id gnl|my_center|LOCUS_24100 7141 6530 gene locus_tag LOCUS_24110 7141 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence219 2331 559 gene locus_tag LOCUS_24120 2331 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 3390 2914 gene locus_tag LOCUS_24130 3390 2914 CDS product virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 protein_id gnl|my_center|LOCUS_24130 3677 3390 gene locus_tag LOCUS_24140 3677 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5059 4616 gene locus_tag LOCUS_24150 5059 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5951 7153 gene locus_tag LOCUS_24160 5951 7153 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073055.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence220 364 762 gene locus_tag LOCUS_24170 364 762 CDS product toxin-antitoxin system antidote Mnt family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_24170 802 1209 gene locus_tag LOCUS_24180 802 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_24180 3017 1698 gene locus_tag LOCUS_24190 3017 1698 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_24190 3343 3011 gene locus_tag LOCUS_24200 3343 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 5409 4237 gene locus_tag LOCUS_24210 5409 4237 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_24210 6482 5601 gene locus_tag LOCUS_24220 gene galU 6482 5601 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44878 protein_id gnl|my_center|LOCUS_24220 <7470 6556 gene locus_tag LOCUS_24230 <7470 6556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZAE1:undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase >Feature sequence221 25 975 gene locus_tag LOCUS_24240 25 975 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971111.1 protein_id gnl|my_center|LOCUS_24240 2756 1089 gene locus_tag LOCUS_24250 gene recN 2756 1089 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP7 protein_id gnl|my_center|LOCUS_24250 3893 2895 gene locus_tag LOCUS_24260 3893 2895 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073308.1 protein_id gnl|my_center|LOCUS_24260 4820 4215 gene locus_tag LOCUS_24270 4820 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 protein_id gnl|my_center|LOCUS_24270 <7422 4795 gene locus_tag LOCUS_24280 <7422 4795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBQ2:histidine kinase >Feature sequence222 <1 2863 gene locus_tag LOCUS_24290 <1 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073797.1:DUF3971 domain-containing protein 2832 3680 gene locus_tag LOCUS_24300 2832 3680 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073796.1 protein_id gnl|my_center|LOCUS_24300 3732 5183 gene locus_tag LOCUS_24310 gene tldD 3732 5183 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073795.1 protein_id gnl|my_center|LOCUS_24310 5303 6718 gene locus_tag LOCUS_24320 5303 6718 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 protein_id gnl|my_center|LOCUS_24320 6708 7244 gene locus_tag LOCUS_24330 6708 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24330 >Feature sequence223 1024 1263 gene locus_tag LOCUS_24340 gene xseB 1024 1263 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PTY3 protein_id gnl|my_center|LOCUS_24340 1264 2145 gene locus_tag LOCUS_24350 gene ispA 1264 2145 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071705.1 protein_id gnl|my_center|LOCUS_24350 2167 4032 gene locus_tag LOCUS_24360 gene dxs 2167 4032 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGR9 protein_id gnl|my_center|LOCUS_24360 4807 4178 gene locus_tag LOCUS_24370 gene grpE 4807 4178 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGS0 protein_id gnl|my_center|LOCUS_24370 4949 5827 gene locus_tag LOCUS_24380 gene nadK 4949 5827 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGS1 protein_id gnl|my_center|LOCUS_24380 7096 5891 gene locus_tag LOCUS_24390 gene tonB 7096 5891 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073757.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence224 1193 2338 gene locus_tag LOCUS_24400 gene sbcD 1193 2338 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB8 protein_id gnl|my_center|LOCUS_24400 2335 5391 gene locus_tag LOCUS_24410 gene sbcC 2335 5391 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB9 protein_id gnl|my_center|LOCUS_24410 5697 7013 gene locus_tag LOCUS_24420 5697 7013 CDS product subfamily M23B unassigned peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072761.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence225 340 1245 gene locus_tag LOCUS_24430 340 1245 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074121.1 protein_id gnl|my_center|LOCUS_24430 2330 2914 gene locus_tag LOCUS_24440 2330 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2992 4284 gene locus_tag LOCUS_24450 2992 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 5704 4463 gene locus_tag LOCUS_24460 gene rlmF 5704 4463 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_24460 6207 5770 gene locus_tag LOCUS_24470 6207 5770 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 protein_id gnl|my_center|LOCUS_24470 6297 6860 gene locus_tag LOCUS_24480 gene ubiC 6297 6860 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKG2 protein_id gnl|my_center|LOCUS_24480 >Feature sequence226 2915 741 gene locus_tag LOCUS_24490 gene aggC 2915 741 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 protein_id gnl|my_center|LOCUS_24490 <7393 3035 gene locus_tag LOCUS_24500 <7393 3035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:type I secretion C-terminal target domain-containing protein >Feature sequence227 160 1839 gene locus_tag LOCUS_24510 160 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530108.1 protein_id gnl|my_center|LOCUS_24510 3960 2221 gene locus_tag LOCUS_24520 3960 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4210 4806 gene locus_tag LOCUS_24530 4210 4806 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_24530 5191 5757 gene locus_tag LOCUS_24540 5191 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence228 320 1057 gene locus_tag LOCUS_24550 gene pdsO 320 1057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072226.1 protein_id gnl|my_center|LOCUS_24550 1152 1694 gene locus_tag LOCUS_24560 1152 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1651 1941 gene locus_tag LOCUS_24570 1651 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4643 2016 gene locus_tag LOCUS_24580 4643 2016 CDS product multivalent adhesion molecule 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072556.1 protein_id gnl|my_center|LOCUS_24580 5271 4612 gene locus_tag LOCUS_24590 5271 4612 CDS product PqiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072555.1 protein_id gnl|my_center|LOCUS_24590 5818 5264 gene locus_tag LOCUS_24600 5818 5264 CDS product PqiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072554.1 protein_id gnl|my_center|LOCUS_24600 6115 6420 gene locus_tag LOCUS_24610 gene yebG 6115 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072553.1 protein_id gnl|my_center|LOCUS_24610 6438 6896 gene locus_tag LOCUS_24620 gene yebR 6438 6896 CDS product free methionine-R-sulfoxide reductase YebR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072552.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence229 <1 643 gene locus_tag LOCUS_24630 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072770.1:GntR family transcriptional regulator 738 1802 gene locus_tag LOCUS_24640 gene fabH 738 1802 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDA9 protein_id gnl|my_center|LOCUS_24640 2109 1930 gene locus_tag LOCUS_24650 2109 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 4442 2406 gene locus_tag LOCUS_24660 gene phoX 4442 2406 CDS product monomeric alkaline phosphatase PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072366.1 protein_id gnl|my_center|LOCUS_24660 5556 4558 gene locus_tag LOCUS_24670 5556 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267647.1 protein_id gnl|my_center|LOCUS_24670 6775 5543 gene locus_tag LOCUS_24680 6775 5543 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 protein_id gnl|my_center|LOCUS_24680 7305 6772 gene locus_tag LOCUS_24690 7305 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence230 586 128 gene locus_tag LOCUS_24700 gene mraZ 586 128 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N9 protein_id gnl|my_center|LOCUS_24700 982 1281 gene locus_tag LOCUS_24710 982 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2804 1311 gene locus_tag LOCUS_24720 gene glpK 2804 1311 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N7 protein_id gnl|my_center|LOCUS_24720 3380 2853 gene locus_tag LOCUS_24730 3380 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 5021 3648 gene locus_tag LOCUS_24740 5021 3648 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073912.1 protein_id gnl|my_center|LOCUS_24740 6120 5515 gene locus_tag LOCUS_24750 gene leuD 6120 5515 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N5 protein_id gnl|my_center|LOCUS_24750 <7353 6202 gene locus_tag LOCUS_24760 <7353 6202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E9N4:3-isopropylmalate dehydratase large subunit >Feature sequence231 <1 3301 gene locus_tag LOCUS_24770 <1 3301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:type I secretion C-terminal target domain-containing protein 3397 4863 gene locus_tag LOCUS_24780 3397 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 protein_id gnl|my_center|LOCUS_24780 4873 5349 gene locus_tag LOCUS_24790 4873 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 5352 5819 gene locus_tag LOCUS_24800 5352 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence232 1823 537 gene locus_tag LOCUS_24810 1823 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2350 1892 gene locus_tag LOCUS_24820 2350 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2817 2347 gene locus_tag LOCUS_24830 2817 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4155 2827 gene locus_tag LOCUS_24840 4155 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106056.1 protein_id gnl|my_center|LOCUS_24840 4648 4370 gene locus_tag LOCUS_24850 4648 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6121 4667 gene locus_tag LOCUS_24860 6121 4667 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 protein_id gnl|my_center|LOCUS_24860 6973 6161 gene locus_tag LOCUS_24870 6973 6161 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence233 628 1665 gene locus_tag LOCUS_24880 628 1665 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKY1 protein_id gnl|my_center|LOCUS_24880 1738 3108 gene locus_tag LOCUS_24890 1738 3108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_24890 3153 4076 gene locus_tag LOCUS_24900 3153 4076 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108679.1 protein_id gnl|my_center|LOCUS_24900 4104 4754 gene locus_tag LOCUS_24910 4104 4754 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481262.1 protein_id gnl|my_center|LOCUS_24910 4914 6023 gene locus_tag LOCUS_24920 4914 6023 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039122.1 protein_id gnl|my_center|LOCUS_24920 6658 6203 gene locus_tag LOCUS_24930 6658 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070928.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence234 <1 1291 gene locus_tag LOCUS_24940 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAW7:bifunctional protein PutA 3276 1483 gene locus_tag LOCUS_24950 gene cydC 3276 1483 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073554.1 protein_id gnl|my_center|LOCUS_24950 5078 3273 gene locus_tag LOCUS_24960 gene cydD 5078 3273 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073555.1 protein_id gnl|my_center|LOCUS_24960 5792 5430 gene locus_tag LOCUS_24970 5792 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261384.1 protein_id gnl|my_center|LOCUS_24970 6081 5872 gene locus_tag LOCUS_24980 6081 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6443 6958 gene locus_tag LOCUS_24990 6443 6958 CDS product pilin structural protein V10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073556.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence235 586 1101 gene locus_tag LOCUS_25000 586 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25000 1223 1591 gene locus_tag LOCUS_25010 1223 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071848.1 protein_id gnl|my_center|LOCUS_25010 1637 2197 gene locus_tag LOCUS_25020 1637 2197 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261386.1 protein_id gnl|my_center|LOCUS_25020 4854 2350 gene locus_tag LOCUS_25030 gene cga 4854 2350 CDS product glucan 14-alpha-glucosidase Cga inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072434.1 protein_id gnl|my_center|LOCUS_25030 6491 4911 gene locus_tag LOCUS_25040 gene malT 6491 4911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence236 2071 1076 gene locus_tag LOCUS_25050 gene add 2071 1076 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186V5 protein_id gnl|my_center|LOCUS_25050 4157 2322 gene locus_tag LOCUS_25060 4157 2322 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 protein_id gnl|my_center|LOCUS_25060 4493 4930 gene locus_tag LOCUS_25070 4493 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073615.1 protein_id gnl|my_center|LOCUS_25070 5111 6037 gene locus_tag LOCUS_25080 5111 6037 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence237 482 697 gene locus_tag LOCUS_25090 482 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072548.1 protein_id gnl|my_center|LOCUS_25090 1023 3080 gene locus_tag LOCUS_25100 1023 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_25100 3099 4463 gene locus_tag LOCUS_25110 3099 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_25110 4517 5542 gene locus_tag LOCUS_25120 4517 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence238 <1 570 gene locus_tag LOCUS_25130 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFA0:phenylalanine--tRNA ligase alpha subunit 585 2972 gene locus_tag LOCUS_25140 gene pheT 585 2972 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF99 protein_id gnl|my_center|LOCUS_25140 2977 3273 gene locus_tag LOCUS_25150 gene ihfA 2977 3273 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF98 protein_id gnl|my_center|LOCUS_25150 3304 4296 gene locus_tag LOCUS_25160 gene lpxM 3304 4296 CDS product lipid A biosynthesis myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF97 protein_id gnl|my_center|LOCUS_25160 4384 5916 gene locus_tag LOCUS_25170 4384 5916 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704358.1 protein_id gnl|my_center|LOCUS_25170 6546 6199 gene locus_tag LOCUS_25180 6546 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence239 <1 2008 gene locus_tag LOCUS_25190 <1 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071683.1:diguanylate cyclase 2068 3360 gene locus_tag LOCUS_25200 2068 3360 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071684.1 protein_id gnl|my_center|LOCUS_25200 3637 3443 gene locus_tag LOCUS_25210 3637 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3965 4720 gene locus_tag LOCUS_25220 3965 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 5138 5641 gene locus_tag LOCUS_25230 5138 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 5906 5712 gene locus_tag LOCUS_25240 5906 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25240 6729 6034 gene locus_tag LOCUS_25250 6729 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25250 >Feature sequence240 616 128 gene locus_tag LOCUS_25260 gene cvpA 616 128 CDS product bacteriocin production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 protein_id gnl|my_center|LOCUS_25260 1403 729 gene locus_tag LOCUS_25270 gene dedD 1403 729 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171804.1 protein_id gnl|my_center|LOCUS_25270 2682 1387 gene locus_tag LOCUS_25280 gene folC 2682 1387 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072965.1 protein_id gnl|my_center|LOCUS_25280 3542 2757 gene locus_tag LOCUS_25290 gene truA 3542 2757 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSU2 protein_id gnl|my_center|LOCUS_25290 6170 3723 gene locus_tag LOCUS_25300 6170 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 <6893 6371 gene locus_tag LOCUS_25310 <6893 6371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECR3:aspartate-semialdehyde dehydrogenase >Feature sequence241 <1 1333 gene locus_tag LOCUS_25320 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIJ7:elongation factor G 2 1492 2112 gene locus_tag LOCUS_25330 1492 2112 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454194.1 protein_id gnl|my_center|LOCUS_25330 3158 2127 gene locus_tag LOCUS_25340 gene malR 3158 2127 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_25340 3999 3295 gene locus_tag LOCUS_25350 3999 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072258.1 protein_id gnl|my_center|LOCUS_25350 4267 4653 gene locus_tag LOCUS_25360 4267 4653 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 protein_id gnl|my_center|LOCUS_25360 4701 4958 gene locus_tag LOCUS_25370 gene ptsH 4701 4958 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072255.1 protein_id gnl|my_center|LOCUS_25370 4998 6713 gene locus_tag LOCUS_25380 gene ptsI 4998 6713 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEX4 protein_id gnl|my_center|LOCUS_25380 >Feature sequence242 <1 691 gene locus_tag LOCUS_25390 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHY4:catalase 1326 760 gene locus_tag LOCUS_25400 1326 760 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 protein_id gnl|my_center|LOCUS_25400 1838 3037 gene locus_tag LOCUS_25410 1838 3037 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071327.1 protein_id gnl|my_center|LOCUS_25410 3291 5447 gene locus_tag LOCUS_25420 3291 5447 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_25420 <6819 6270 gene locus_tag LOCUS_25430 <6819 6270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071191.1:transposase >Feature sequence243 1193 2920 gene locus_tag LOCUS_25440 1193 2920 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_25440 4581 3028 gene locus_tag LOCUS_25450 gene gnd 4581 3028 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFR5 protein_id gnl|my_center|LOCUS_25450 5348 5761 gene locus_tag LOCUS_25460 gene liuR 5348 5761 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072005.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence244 355 2493 gene locus_tag LOCUS_25470 355 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2518 5328 gene locus_tag LOCUS_25480 2518 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 5475 6281 gene locus_tag LOCUS_25490 5475 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence245 <1 2219 gene locus_tag LOCUS_25500 <1 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206636.1:ligand-gated channel protein 2361 3281 gene locus_tag LOCUS_25510 2361 3281 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_25510 3341 4591 gene locus_tag LOCUS_25520 gene prrB 3341 4591 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 protein_id gnl|my_center|LOCUS_25520 4633 5178 gene locus_tag LOCUS_25530 gene prrA 4633 5178 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073862.1 protein_id gnl|my_center|LOCUS_25530 <6728 5308 gene locus_tag LOCUS_25540 <6728 5308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119294.1:copper transporter porin >Feature sequence246 568 1182 gene locus_tag LOCUS_25550 568 1182 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 protein_id gnl|my_center|LOCUS_25550 1142 1417 gene locus_tag LOCUS_25560 1142 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1481 1663 gene locus_tag LOCUS_25570 1481 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2199 2471 gene locus_tag LOCUS_25580 2199 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3311 2592 gene locus_tag LOCUS_25590 3311 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3721 3434 gene locus_tag LOCUS_25600 3721 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4439 5971 gene locus_tag LOCUS_25610 4439 5971 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_25610 5992 6645 gene locus_tag LOCUS_25620 5992 6645 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence247 <1 574 gene locus_tag LOCUS_25630 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EB93:ribosomal RNA small subunit methyltransferase A 674 1054 gene locus_tag LOCUS_25640 gene apaG 674 1054 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB92 protein_id gnl|my_center|LOCUS_25640 1074 1898 gene locus_tag LOCUS_25650 gene apaH 1074 1898 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB91 protein_id gnl|my_center|LOCUS_25650 2032 4059 gene locus_tag LOCUS_25660 2032 4059 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 protein_id gnl|my_center|LOCUS_25660 4569 4180 gene locus_tag LOCUS_25670 4569 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073446.1 protein_id gnl|my_center|LOCUS_25670 5153 4671 gene locus_tag LOCUS_25680 gene folA 5153 4671 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_25680 5730 5122 gene locus_tag LOCUS_25690 5730 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 <6681 5754 gene locus_tag LOCUS_25700 <6681 5754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EB83:GTPase Obg >Feature sequence248 44 1693 gene locus_tag LOCUS_25710 gene ubiB 44 1693 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R5 protein_id gnl|my_center|LOCUS_25710 1755 1994 gene locus_tag LOCUS_25720 gene tatA 1755 1994 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R4 protein_id gnl|my_center|LOCUS_25720 2001 2405 gene locus_tag LOCUS_25730 gene tatB 2001 2405 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R3 protein_id gnl|my_center|LOCUS_25730 2409 3158 gene locus_tag LOCUS_25740 gene tatC 2409 3158 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R2 protein_id gnl|my_center|LOCUS_25740 3235 3792 gene locus_tag LOCUS_25750 3235 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 protein_id gnl|my_center|LOCUS_25750 3792 4631 gene locus_tag LOCUS_25760 gene tatD 3792 4631 CDS product DNase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073889.1 protein_id gnl|my_center|LOCUS_25760 4618 6483 gene locus_tag LOCUS_25770 4618 6483 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence249 18 93 gene locus_tag LOCUS_t00260 18 93 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 155 230 gene locus_tag LOCUS_t00270 155 230 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 438 665 gene locus_tag LOCUS_25780 438 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073026.1 protein_id gnl|my_center|LOCUS_25780 764 2044 gene locus_tag LOCUS_25790 764 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3239 2058 gene locus_tag LOCUS_25800 3239 2058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072018.1 protein_id gnl|my_center|LOCUS_25800 3394 4272 gene locus_tag LOCUS_25810 3394 4272 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072017.1 protein_id gnl|my_center|LOCUS_25810 4359 4700 gene locus_tag LOCUS_25820 gene fklB 4359 4700 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJL0 protein_id gnl|my_center|LOCUS_25820 5450 4794 gene locus_tag LOCUS_25830 gene maiA 5450 4794 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_25830 6561 5575 gene locus_tag LOCUS_25840 gene fahA 6561 5575 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence250 411 2021 gene locus_tag LOCUS_25850 gene ybiT 411 2021 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 protein_id gnl|my_center|LOCUS_25850 3577 2237 gene locus_tag LOCUS_25860 3577 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 protein_id gnl|my_center|LOCUS_25860 3908 3570 gene locus_tag LOCUS_25870 3908 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 5381 4488 gene locus_tag LOCUS_25880 5381 4488 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071481.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence251 583 305 gene locus_tag LOCUS_25890 583 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1122 694 gene locus_tag LOCUS_25900 1122 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1471 1244 gene locus_tag LOCUS_25910 1471 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1936 1646 gene locus_tag LOCUS_25920 1936 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2869 2243 gene locus_tag LOCUS_25930 2869 2243 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477263.1 protein_id gnl|my_center|LOCUS_25930 3201 3004 gene locus_tag LOCUS_25940 3201 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3942 4214 gene locus_tag LOCUS_25950 3942 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25950 4227 4634 gene locus_tag LOCUS_25960 4227 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25960 4555 4728 gene locus_tag LOCUS_25970 4555 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 <6578 5527 gene locus_tag LOCUS_25980 <6578 5527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073319.1:energy-dependent translational throttle protein EttA >Feature sequence252 1372 542 gene locus_tag LOCUS_25990 gene pssA 1372 542 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_25990 1594 1947 gene locus_tag LOCUS_26000 1594 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4667 2094 gene locus_tag LOCUS_26010 gene clpB 4667 2094 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE6 protein_id gnl|my_center|LOCUS_26010 5508 4789 gene locus_tag LOCUS_26020 gene yfiH 5508 4789 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE5 protein_id gnl|my_center|LOCUS_26020 <6564 5526 gene locus_tag LOCUS_26030 <6564 5526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K4PU17:pseudouridine synthase >Feature sequence253 2146 380 gene locus_tag LOCUS_26040 2146 380 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P83223 protein_id gnl|my_center|LOCUS_26040 2455 3486 gene locus_tag LOCUS_26050 gene omp35 2455 3486 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 protein_id gnl|my_center|LOCUS_26050 3671 4570 gene locus_tag LOCUS_26060 3671 4570 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072514.1 protein_id gnl|my_center|LOCUS_26060 4664 5896 gene locus_tag LOCUS_26070 4664 5896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence254 1598 1801 gene locus_tag LOCUS_26080 1598 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 5015 2016 gene locus_tag LOCUS_26090 gene oar 5015 2016 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 protein_id gnl|my_center|LOCUS_26090 5490 5684 gene locus_tag LOCUS_26100 5490 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 6226 5861 gene locus_tag LOCUS_26110 6226 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence255 1387 4347 gene locus_tag LOCUS_26120 1387 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261971.1 protein_id gnl|my_center|LOCUS_26120 5430 4333 gene locus_tag LOCUS_26130 5430 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence256 433 2484 gene locus_tag LOCUS_26140 gene hmuA 433 2484 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_26140 2532 2681 gene locus_tag LOCUS_26150 2532 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2653 3183 gene locus_tag LOCUS_26160 gene hmuX 2653 3183 CDS product heme iron utilization protein HmuX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073463.1 protein_id gnl|my_center|LOCUS_26160 3221 3829 gene locus_tag LOCUS_26170 gene hmuZ 3221 3829 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073462.1 protein_id gnl|my_center|LOCUS_26170 3997 5910 gene locus_tag LOCUS_26180 3997 5910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073461.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence257 921 3674 gene locus_tag LOCUS_26190 gene polA 921 3674 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_26190 5122 4433 gene locus_tag LOCUS_26200 gene engB 5122 4433 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J7 protein_id gnl|my_center|LOCUS_26200 5291 5911 gene locus_tag LOCUS_26210 gene cytcB 5291 5911 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence258 391 1074 gene locus_tag LOCUS_26220 391 1074 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072402.1 protein_id gnl|my_center|LOCUS_26220 1227 2354 gene locus_tag LOCUS_26230 1227 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_26230 2382 2699 gene locus_tag LOCUS_26240 2382 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072400.1 protein_id gnl|my_center|LOCUS_26240 2696 2977 gene locus_tag LOCUS_26250 2696 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072399.1 protein_id gnl|my_center|LOCUS_26250 4144 3131 gene locus_tag LOCUS_26260 gene ansA 4144 3131 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_26260 6197 4356 gene locus_tag LOCUS_26270 gene sppA 6197 4356 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG2 protein_id gnl|my_center|LOCUS_26270 >Feature sequence259 1096 512 gene locus_tag LOCUS_26280 1096 512 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIC6 protein_id gnl|my_center|LOCUS_26280 1695 2987 gene locus_tag LOCUS_26290 gene sdaC 1695 2987 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071199.1 protein_id gnl|my_center|LOCUS_26290 3644 3114 gene locus_tag LOCUS_26300 3644 3114 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_26300 3914 4243 gene locus_tag LOCUS_26310 3914 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4804 4391 gene locus_tag LOCUS_26320 4804 4391 CDS product heat-shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071203.1 protein_id gnl|my_center|LOCUS_26320 5379 4927 gene locus_tag LOCUS_26330 5379 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 5443 6054 gene locus_tag LOCUS_26340 5443 6054 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071206.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence260 190 1272 gene locus_tag LOCUS_26350 gene yfgO 190 1272 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072783.1 protein_id gnl|my_center|LOCUS_26350 2244 1351 gene locus_tag LOCUS_26360 gene argP 2244 1351 CDS product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072782.1 protein_id gnl|my_center|LOCUS_26360 2373 2984 gene locus_tag LOCUS_26370 gene argO 2373 2984 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072781.1 protein_id gnl|my_center|LOCUS_26370 3206 3072 gene locus_tag LOCUS_26380 3206 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3809 3546 gene locus_tag LOCUS_26390 3809 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26390 4765 4049 gene locus_tag LOCUS_26400 4765 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 5303 4917 gene locus_tag LOCUS_26410 5303 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5476 5300 gene locus_tag LOCUS_26420 5476 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 5954 5565 gene locus_tag LOCUS_26430 5954 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence261 <1 2353 gene locus_tag LOCUS_26440 <1 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EDG6:ribonuclease E 2482 4038 gene locus_tag LOCUS_26450 2482 4038 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_26450 5081 4179 gene locus_tag LOCUS_26460 gene selR 5081 4179 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE02 protein_id gnl|my_center|LOCUS_26460 5384 6223 gene locus_tag LOCUS_26470 5384 6223 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072539.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence262 1917 1003 gene locus_tag LOCUS_26480 1917 1003 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454899.1 protein_id gnl|my_center|LOCUS_26480 2236 3159 gene locus_tag LOCUS_26490 2236 3159 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_26490 3192 4472 gene locus_tag LOCUS_26500 3192 4472 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 protein_id gnl|my_center|LOCUS_26500 5563 6144 gene locus_tag LOCUS_26510 5563 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence263 <1 1308 gene locus_tag LOCUS_26520 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EKT2:chromosomal replication initiator protein DnaA 1328 2428 gene locus_tag LOCUS_26530 gene dnaN 1328 2428 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT1 protein_id gnl|my_center|LOCUS_26530 2639 3736 gene locus_tag LOCUS_26540 gene recF 2639 3736 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT0 protein_id gnl|my_center|LOCUS_26540 3813 6158 gene locus_tag LOCUS_26550 gene gyrB 3813 6158 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_26550 >Feature sequence264 51 2510 gene locus_tag LOCUS_26560 51 2510 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_26560 2657 3688 gene locus_tag LOCUS_26570 gene sohB 2657 3688 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_26570 4379 4023 gene locus_tag LOCUS_26580 4379 4023 CDS product conjugal transfer protein TraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072089.1 protein_id gnl|my_center|LOCUS_26580 5508 4576 gene locus_tag LOCUS_26590 gene dusC 5508 4576 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD1 protein_id gnl|my_center|LOCUS_26590 5884 6252 gene locus_tag LOCUS_26600 5884 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence265 2632 566 gene locus_tag LOCUS_26610 2632 566 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948448.1 protein_id gnl|my_center|LOCUS_26610 2953 2663 gene locus_tag LOCUS_26620 2953 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3272 4720 gene locus_tag LOCUS_26630 3272 4720 CDS product cell wall degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705139.1 protein_id gnl|my_center|LOCUS_26630 4725 5135 gene locus_tag LOCUS_26640 4725 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5766 5960 gene locus_tag LOCUS_26650 5766 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence266 213 440 gene locus_tag LOCUS_26660 213 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 501 1301 gene locus_tag LOCUS_26670 501 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2086 1754 gene locus_tag LOCUS_26680 2086 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 4879 2099 gene locus_tag LOCUS_26690 4879 2099 CDS product alkaline-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095755.1 protein_id gnl|my_center|LOCUS_26690 5040 5717 gene locus_tag LOCUS_26700 5040 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence267 93 1055 gene locus_tag LOCUS_26710 93 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1059 1472 gene locus_tag LOCUS_26720 1059 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1663 2013 gene locus_tag LOCUS_26730 1663 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2201 3085 gene locus_tag LOCUS_26740 2201 3085 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 protein_id gnl|my_center|LOCUS_26740 3702 5060 gene locus_tag LOCUS_26750 3702 5060 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_26750 5813 5301 gene locus_tag LOCUS_26760 5813 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26760 6257 5841 gene locus_tag LOCUS_26770 6257 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26770 >Feature sequence268 1191 1736 gene locus_tag LOCUS_26780 1191 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071562.1 protein_id gnl|my_center|LOCUS_26780 3189 1912 gene locus_tag LOCUS_26790 3189 1912 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_26790 4198 3410 gene locus_tag LOCUS_26800 4198 3410 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071564.1 protein_id gnl|my_center|LOCUS_26800 4503 5876 gene locus_tag LOCUS_26810 gene ffh 4503 5876 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH73 protein_id gnl|my_center|LOCUS_26810 >Feature sequence269 1083 514 gene locus_tag LOCUS_26820 gene yecM 1083 514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072218.1 protein_id gnl|my_center|LOCUS_26820 1548 1114 gene locus_tag LOCUS_26830 1548 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 protein_id gnl|my_center|LOCUS_26830 1496 1663 gene locus_tag LOCUS_26840 1496 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1876 2715 gene locus_tag LOCUS_26850 1876 2715 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_26850 2936 4456 gene locus_tag LOCUS_26860 2936 4456 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_26860 4793 4599 gene locus_tag LOCUS_26870 4793 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 5464 5018 gene locus_tag LOCUS_26880 5464 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072732.1 protein_id gnl|my_center|LOCUS_26880 6113 5757 gene locus_tag LOCUS_26890 6113 5757 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072730.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence270 125 466 gene locus_tag LOCUS_26900 125 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1328 1591 gene locus_tag LOCUS_26910 1328 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1643 2257 gene locus_tag LOCUS_26920 1643 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3134 2391 gene locus_tag LOCUS_26930 3134 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4005 3295 gene locus_tag LOCUS_26940 4005 3295 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_26940 5610 4063 gene locus_tag LOCUS_26950 5610 4063 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_26950 6093 5695 gene locus_tag LOCUS_26960 6093 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence271 3362 348 gene locus_tag LOCUS_26970 gene oar 3362 348 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 protein_id gnl|my_center|LOCUS_26970 6011 3789 gene locus_tag LOCUS_26980 6011 3789 CDS product peptidase S46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073664.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence272 2509 1334 gene locus_tag LOCUS_26990 gene vmeA 2509 1334 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074282.1 protein_id gnl|my_center|LOCUS_26990 3591 2893 gene locus_tag LOCUS_27000 3591 2893 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074284.1 protein_id gnl|my_center|LOCUS_27000 3848 4498 gene locus_tag LOCUS_27010 gene gst 3848 4498 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074285.1 protein_id gnl|my_center|LOCUS_27010 5055 4525 gene locus_tag LOCUS_27020 5055 4525 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_27020 <6205 5221 gene locus_tag LOCUS_27030 <6205 5221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074287.1:oligopeptidase A >Feature sequence273 63 362 gene locus_tag LOCUS_27040 63 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 943 1587 gene locus_tag LOCUS_27050 gene ompW 943 1587 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071823.1 protein_id gnl|my_center|LOCUS_27050 2446 1673 gene locus_tag LOCUS_27060 2446 1673 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071824.1 protein_id gnl|my_center|LOCUS_27060 3116 2787 gene locus_tag LOCUS_27070 3116 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27070 3711 3124 gene locus_tag LOCUS_27080 3711 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4951 5154 gene locus_tag LOCUS_27090 4951 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence274 368 946 gene locus_tag LOCUS_27100 368 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 949 1983 gene locus_tag LOCUS_27110 949 1983 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 protein_id gnl|my_center|LOCUS_27110 1976 3115 gene locus_tag LOCUS_27120 1976 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3231 3491 gene locus_tag LOCUS_27130 3231 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3891 3604 gene locus_tag LOCUS_27140 3891 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 4979 4014 gene locus_tag LOCUS_27150 4979 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 5544 5302 gene locus_tag LOCUS_27160 5544 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence275 1010 21 gene locus_tag LOCUS_27170 gene fbp 1010 21 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 protein_id gnl|my_center|LOCUS_27170 1321 3588 gene locus_tag LOCUS_27180 gene dpp4 1321 3588 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_27180 4705 3986 gene locus_tag LOCUS_27190 gene arcA 4705 3986 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644695.1 protein_id gnl|my_center|LOCUS_27190 5283 5741 gene locus_tag LOCUS_27200 5283 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073718.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence276 633 247 gene locus_tag LOCUS_27210 633 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2978 621 gene locus_tag LOCUS_27220 2978 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3218 3898 gene locus_tag LOCUS_27230 3218 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3921 4481 gene locus_tag LOCUS_27240 3921 4481 CDS product thiol:disulfide interchange protein tlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269072.1 protein_id gnl|my_center|LOCUS_27240 4509 5531 gene locus_tag LOCUS_27250 4509 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence277 288 198 gene locus_tag LOCUS_t00280 288 198 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 572 2338 gene locus_tag LOCUS_27260 572 2338 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071971.1 protein_id gnl|my_center|LOCUS_27260 2407 2922 gene locus_tag LOCUS_27270 gene fabA 2407 2922 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV9 protein_id gnl|my_center|LOCUS_27270 3198 3022 gene locus_tag LOCUS_27280 gene rmf 3198 3022 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFW0 protein_id gnl|my_center|LOCUS_27280 5345 3438 gene locus_tag LOCUS_27290 5345 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071968.1 protein_id gnl|my_center|LOCUS_27290 <6106 5386 gene locus_tag LOCUS_27300 <6106 5386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071967.1:ABC transporter ATPase >Feature sequence278 1005 385 gene locus_tag LOCUS_27310 gene yciO 1005 385 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072921.1 protein_id gnl|my_center|LOCUS_27310 1993 1118 gene locus_tag LOCUS_27320 gene trpH 1993 1118 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072922.1 protein_id gnl|my_center|LOCUS_27320 2499 4055 gene locus_tag LOCUS_27330 gene trpE 2499 4055 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV4 protein_id gnl|my_center|LOCUS_27330 4052 4669 gene locus_tag LOCUS_27340 gene trpG 4052 4669 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072925.1 protein_id gnl|my_center|LOCUS_27340 4666 5721 gene locus_tag LOCUS_27350 gene trpD 4666 5721 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV2 protein_id gnl|my_center|LOCUS_27350 >Feature sequence279 610 362 gene locus_tag LOCUS_27360 610 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1180 641 gene locus_tag LOCUS_27370 1180 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120754.1 protein_id gnl|my_center|LOCUS_27370 1402 1887 gene locus_tag LOCUS_27380 gene azu 1402 1887 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVD5 protein_id gnl|my_center|LOCUS_27380 2089 1949 gene locus_tag LOCUS_27390 2089 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2334 4085 gene locus_tag LOCUS_27400 2334 4085 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211122.1 protein_id gnl|my_center|LOCUS_27400 4137 5741 gene locus_tag LOCUS_27410 gene lsrK 4137 5741 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJ57 protein_id gnl|my_center|LOCUS_27410 >Feature sequence280 286 77 gene locus_tag LOCUS_27420 286 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 557 270 gene locus_tag LOCUS_27430 557 270 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_27430 1769 813 gene locus_tag LOCUS_27440 gene yidZ 1769 813 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073741.1 protein_id gnl|my_center|LOCUS_27440 3033 1744 gene locus_tag LOCUS_27450 gene mdtL 3033 1744 CDS product multidrug resistance protein MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA87 protein_id gnl|my_center|LOCUS_27450 4835 3531 gene locus_tag LOCUS_27460 gene hmgA 4835 3531 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 protein_id gnl|my_center|LOCUS_27460 5181 5696 gene locus_tag LOCUS_27470 5181 5696 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence281 157 1341 gene locus_tag LOCUS_27480 gene yhiN 157 1341 CDS product HI0933 family flavoprotein YhiN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070468.1 protein_id gnl|my_center|LOCUS_27480 1827 1543 gene locus_tag LOCUS_27490 1827 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1889 2062 gene locus_tag LOCUS_27500 1889 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3541 2477 gene locus_tag LOCUS_27510 3541 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_27510 4203 3538 gene locus_tag LOCUS_27520 4203 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_27520 5640 4879 gene locus_tag LOCUS_27530 5640 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence282 513 4283 gene locus_tag LOCUS_27540 gene metH 513 4283 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071290.1 protein_id gnl|my_center|LOCUS_27540 4962 5225 gene locus_tag LOCUS_27550 4962 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263641.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence283 101 574 gene locus_tag LOCUS_27560 gene smg 101 574 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ5 protein_id gnl|my_center|LOCUS_27560 871 641 gene locus_tag LOCUS_27570 871 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1433 852 gene locus_tag LOCUS_27580 1433 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1569 2132 gene locus_tag LOCUS_27590 gene yrdD 1569 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070452.1 protein_id gnl|my_center|LOCUS_27590 2292 2849 gene locus_tag LOCUS_27600 gene tsaC 2292 2849 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ3 protein_id gnl|my_center|LOCUS_27600 2912 3832 gene locus_tag LOCUS_27610 gene hemF 2912 3832 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ2 protein_id gnl|my_center|LOCUS_27610 3965 4789 gene locus_tag LOCUS_27620 gene aroE 3965 4789 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ0 protein_id gnl|my_center|LOCUS_27620 4786 5049 gene locus_tag LOCUS_27630 4786 5049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704275.1 protein_id gnl|my_center|LOCUS_27630 5661 5107 gene locus_tag LOCUS_27640 gene yrdA 5661 5107 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence284 856 1611 gene locus_tag LOCUS_27650 856 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1627 2598 gene locus_tag LOCUS_27660 1627 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2630 3688 gene locus_tag LOCUS_27670 2630 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3698 4294 gene locus_tag LOCUS_27680 3698 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4380 5711 gene locus_tag LOCUS_27690 4380 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence285 923 1846 gene locus_tag LOCUS_27700 923 1846 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM7 protein_id gnl|my_center|LOCUS_27700 3124 1931 gene locus_tag LOCUS_27710 gene aspC 3124 1931 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM8 protein_id gnl|my_center|LOCUS_27710 3642 3557 gene locus_tag LOCUS_t00290 3642 3557 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3803 3730 gene locus_tag LOCUS_t00300 3803 3730 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4050 3975 gene locus_tag LOCUS_t00310 4050 3975 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <5905 4477 gene locus_tag LOCUS_27720 <5905 4477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEN1:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence286 1345 3435 gene locus_tag LOCUS_27730 1345 3435 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_27730 3458 4030 gene locus_tag LOCUS_27740 3458 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5231 5455 gene locus_tag LOCUS_27750 5231 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence287 70 1191 gene locus_tag LOCUS_27760 gene flrB 70 1191 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073115.1 protein_id gnl|my_center|LOCUS_27760 1184 2545 gene locus_tag LOCUS_27770 gene flrC 1184 2545 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_27770 2781 3125 gene locus_tag LOCUS_27780 gene fliE 2781 3125 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB4 protein_id gnl|my_center|LOCUS_27780 3197 4900 gene locus_tag LOCUS_27790 gene fliF 3197 4900 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB5 protein_id gnl|my_center|LOCUS_27790 >Feature sequence288 4377 3208 gene locus_tag LOCUS_27800 gene hemY 4377 3208 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073975.1 protein_id gnl|my_center|LOCUS_27800 5558 4374 gene locus_tag LOCUS_27810 gene hemX 5558 4374 CDS product uroporphyrinogen III methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073974.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence289 400 909 gene locus_tag LOCUS_27820 gene crr 400 909 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072253.1 protein_id gnl|my_center|LOCUS_27820 1640 1455 gene locus_tag LOCUS_27830 1640 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1697 2221 gene locus_tag LOCUS_27840 1697 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27840 2184 2426 gene locus_tag LOCUS_27850 2184 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3323 2445 gene locus_tag LOCUS_27860 3323 2445 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114539.1 protein_id gnl|my_center|LOCUS_27860 3729 3514 gene locus_tag LOCUS_27870 3729 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4768 3791 gene locus_tag LOCUS_27880 4768 3791 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence290 765 412 gene locus_tag LOCUS_27890 765 412 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 protein_id gnl|my_center|LOCUS_27890 1774 1262 gene locus_tag LOCUS_27900 gene lspA 1774 1262 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMS8 protein_id gnl|my_center|LOCUS_27900 2522 2241 gene locus_tag LOCUS_27910 2522 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4939 2753 gene locus_tag LOCUS_27920 gene ycaO 4939 2753 CDS product protein involved in RimO-mediated beta-methylthiolation of ribosomal protein S12 YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence291 695 2344 gene locus_tag LOCUS_27930 gene nuoM 695 2344 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815944.1 protein_id gnl|my_center|LOCUS_27930 2341 3765 gene locus_tag LOCUS_27940 gene nuoN 2341 3765 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRI1 protein_id gnl|my_center|LOCUS_27940 3907 4983 gene locus_tag LOCUS_27950 3907 4983 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence292 <1 1245 gene locus_tag LOCUS_27960 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071757.1:beta-hydroxyacyl-ACP dehydratase 1401 3029 gene locus_tag LOCUS_27970 gene pfaD 1401 3029 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 protein_id gnl|my_center|LOCUS_27970 4338 5498 gene locus_tag LOCUS_27980 4338 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence293 425 973 gene locus_tag LOCUS_27990 gene sprT 425 973 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK5 protein_id gnl|my_center|LOCUS_27990 1254 1982 gene locus_tag LOCUS_28000 gene rsmE 1254 1982 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK7 protein_id gnl|my_center|LOCUS_28000 2078 3043 gene locus_tag LOCUS_28010 gene gshB 2078 3043 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK8 protein_id gnl|my_center|LOCUS_28010 3134 4486 gene locus_tag LOCUS_28020 gene phoA 3134 4486 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071122.1 protein_id gnl|my_center|LOCUS_28020 <5782 4496 gene locus_tag LOCUS_28030 <5782 4496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:GGDEF domain-containing protein >Feature sequence294 <1 2614 gene locus_tag LOCUS_28040 <1 2614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEH1:DNA gyrase subunit A 2769 3860 gene locus_tag LOCUS_28050 gene serC 2769 3860 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH2 protein_id gnl|my_center|LOCUS_28050 5248 4043 gene locus_tag LOCUS_28060 gene aspC 5248 4043 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_28060 >Feature sequence295 1247 453 gene locus_tag LOCUS_28070 gene nqrC 1247 453 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV7 protein_id gnl|my_center|LOCUS_28070 2439 1240 gene locus_tag LOCUS_28080 gene nqrB 2439 1240 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV8 protein_id gnl|my_center|LOCUS_28080 3779 2439 gene locus_tag LOCUS_28090 gene nqrA 3779 2439 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV9 protein_id gnl|my_center|LOCUS_28090 4754 4245 gene locus_tag LOCUS_28100 gene luxS 4754 4245 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHW1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence296 <1 994 gene locus_tag LOCUS_28110 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073792.1:ABC transporter 991 2157 gene locus_tag LOCUS_28120 991 2157 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073791.1 protein_id gnl|my_center|LOCUS_28120 4885 2387 gene locus_tag LOCUS_28130 4885 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 protein_id gnl|my_center|LOCUS_28130 5507 4968 gene locus_tag LOCUS_28140 5507 4968 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA30 protein_id gnl|my_center|LOCUS_28140 >Feature sequence297 60 1136 gene locus_tag LOCUS_28150 60 1136 CDS product GlyGly-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074239.1 protein_id gnl|my_center|LOCUS_28150 1311 3767 gene locus_tag LOCUS_28160 1311 3767 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071669.1 protein_id gnl|my_center|LOCUS_28160 3948 5105 gene locus_tag LOCUS_28170 3948 5105 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_28170 5514 5080 gene locus_tag LOCUS_28180 5514 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence298 2953 968 gene locus_tag LOCUS_28190 gene mtrC 2953 968 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071901.1 protein_id gnl|my_center|LOCUS_28190 5599 3377 gene locus_tag LOCUS_28200 gene omcA 5599 3377 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence299 <1 1150 gene locus_tag LOCUS_28210 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEE9:aspartate--tRNA ligase 1277 2023 gene locus_tag LOCUS_28220 1277 2023 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_28220 2027 2548 gene locus_tag LOCUS_28230 gene ruvC 2027 2548 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF1 protein_id gnl|my_center|LOCUS_28230 2545 3162 gene locus_tag LOCUS_28240 gene ruvA 2545 3162 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF2 protein_id gnl|my_center|LOCUS_28240 3192 4211 gene locus_tag LOCUS_28250 gene ruvB 3192 4211 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF3 protein_id gnl|my_center|LOCUS_28250 4588 4259 gene locus_tag LOCUS_28260 4588 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 4928 4560 gene locus_tag LOCUS_28270 4928 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 5094 5561 gene locus_tag LOCUS_28280 5094 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence300 47 2644 gene locus_tag LOCUS_28290 gene acnB 47 2644 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN1 protein_id gnl|my_center|LOCUS_28290 3232 2837 gene locus_tag LOCUS_28300 3232 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_28300 4685 3360 gene locus_tag LOCUS_28310 gene hslU 4685 3360 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9U9 protein_id gnl|my_center|LOCUS_28310 5287 4763 gene locus_tag LOCUS_28320 gene hslV 5287 4763 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9V0 protein_id gnl|my_center|LOCUS_28320 >Feature sequence301 160 1683 gene locus_tag LOCUS_28330 gene fumB 160 1683 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEY7 protein_id gnl|my_center|LOCUS_28330 1960 3963 gene locus_tag LOCUS_28340 1960 3963 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072247.1 protein_id gnl|my_center|LOCUS_28340 4118 4252 gene locus_tag LOCUS_28350 4118 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 <5621 4362 gene locus_tag LOCUS_28360 <5621 4362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0K4:isocitrate lyase >Feature sequence302 1051 392 gene locus_tag LOCUS_28370 1051 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2769 1279 gene locus_tag LOCUS_28380 2769 1279 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E421 protein_id gnl|my_center|LOCUS_28380 3845 2895 gene locus_tag LOCUS_28390 gene panE 3845 2895 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAS5 protein_id gnl|my_center|LOCUS_28390 4459 4944 gene locus_tag LOCUS_28400 4459 4944 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAS7 protein_id gnl|my_center|LOCUS_28400 >Feature sequence303 934 494 gene locus_tag LOCUS_28410 gene mioC 934 494 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070417.1 protein_id gnl|my_center|LOCUS_28410 1946 1128 gene locus_tag LOCUS_28420 gene ubiG 1946 1128 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE9 protein_id gnl|my_center|LOCUS_28420 2133 2690 gene locus_tag LOCUS_28430 2133 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082253.1 protein_id gnl|my_center|LOCUS_28430 2897 4375 gene locus_tag LOCUS_28440 2897 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence304 649 1143 gene locus_tag LOCUS_28450 649 1143 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K75 protein_id gnl|my_center|LOCUS_28450 1366 1743 gene locus_tag LOCUS_28460 1366 1743 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708433.1 protein_id gnl|my_center|LOCUS_28460 2005 2286 gene locus_tag LOCUS_28470 2005 2286 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_28470 2510 2761 gene locus_tag LOCUS_28480 2510 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3032 3406 gene locus_tag LOCUS_28490 3032 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3537 4886 gene locus_tag LOCUS_28500 gene fumC1 3537 4886 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51404 protein_id gnl|my_center|LOCUS_28500 <5608 4937 gene locus_tag LOCUS_28510 <5608 4937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948131.1:phosphatase PAP2 family protein >Feature sequence305 1156 827 gene locus_tag LOCUS_28520 gene mshK 1156 827 CDS product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073815.1 protein_id gnl|my_center|LOCUS_28520 1793 1137 gene locus_tag LOCUS_28530 gene mshJ 1793 1137 CDS product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073816.1 protein_id gnl|my_center|LOCUS_28530 2395 1790 gene locus_tag LOCUS_28540 gene mshI2 2395 1790 CDS product MSHA biogenesis protein MshI2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073817.1 protein_id gnl|my_center|LOCUS_28540 3318 2392 gene locus_tag LOCUS_28550 gene mshI1 3318 2392 CDS product MSHA biogenesis protein MshI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073818.1 protein_id gnl|my_center|LOCUS_28550 5561 3651 gene locus_tag LOCUS_28560 gene mshH 5561 3651 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073819.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence306 594 2390 gene locus_tag LOCUS_28570 gene icfE 594 2390 CDS product long-chain-fatty-acid--CoA ligase IcfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070488.1 protein_id gnl|my_center|LOCUS_28570 2479 2883 gene locus_tag LOCUS_28580 2479 2883 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070490.1 protein_id gnl|my_center|LOCUS_28580 3423 2980 gene locus_tag LOCUS_28590 3423 2980 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_28590 4229 3552 gene locus_tag LOCUS_28600 gene mtnC 4229 3552 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKK8 protein_id gnl|my_center|LOCUS_28600 >Feature sequence307 1088 576 gene locus_tag LOCUS_28610 1088 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2571 1501 gene locus_tag LOCUS_28620 2571 1501 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693486.1 protein_id gnl|my_center|LOCUS_28620 2680 3690 gene locus_tag LOCUS_28630 gene dusA 2680 3690 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_28630 3976 4275 gene locus_tag LOCUS_28640 3976 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073657.1 protein_id gnl|my_center|LOCUS_28640 4409 4639 gene locus_tag LOCUS_28650 4409 4639 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073655.1 protein_id gnl|my_center|LOCUS_28650 5510 4773 gene locus_tag LOCUS_28660 gene echH 5510 4773 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence308 1267 1611 gene locus_tag LOCUS_28670 gene holD 1267 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071390.1 protein_id gnl|my_center|LOCUS_28670 1619 2080 gene locus_tag LOCUS_28680 gene rimI 1619 2080 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ7 protein_id gnl|my_center|LOCUS_28680 3117 2152 gene locus_tag LOCUS_28690 gene lipA 3117 2152 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ6 protein_id gnl|my_center|LOCUS_28690 3767 3114 gene locus_tag LOCUS_28700 gene lipB 3767 3114 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_28700 4194 3928 gene locus_tag LOCUS_28710 4194 3928 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ4 protein_id gnl|my_center|LOCUS_28710 5405 4314 gene locus_tag LOCUS_28720 gene dacA 5405 4314 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071395.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence309 2659 623 gene locus_tag LOCUS_28730 gene recD 2659 623 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF46 protein_id gnl|my_center|LOCUS_28730 <5536 2656 gene locus_tag LOCUS_28740 <5536 2656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EF45:RecBCD enzyme subunit RecB >Feature sequence310 735 650 gene locus_tag LOCUS_t00320 735 650 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 896 823 gene locus_tag LOCUS_t00330 896 823 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1044 969 gene locus_tag LOCUS_t00340 1044 969 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1852 1295 gene locus_tag LOCUS_28750 gene pgsA 1852 1295 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071974.1 protein_id gnl|my_center|LOCUS_28750 4004 2241 gene locus_tag LOCUS_28760 gene uvrC 4004 2241 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV4 protein_id gnl|my_center|LOCUS_28760 4817 4173 gene locus_tag LOCUS_28770 gene uvrY 4817 4173 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence311 3127 536 gene locus_tag LOCUS_28780 3127 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3586 3134 gene locus_tag LOCUS_28790 3586 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 4639 4896 gene locus_tag LOCUS_28800 4639 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence312 1133 396 gene locus_tag LOCUS_28810 1133 396 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PTX7 protein_id gnl|my_center|LOCUS_28810 2973 1612 gene locus_tag LOCUS_28820 gene metT 2973 1612 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071333.1 protein_id gnl|my_center|LOCUS_28820 3430 3957 gene locus_tag LOCUS_28830 3430 3957 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_28830 4406 4137 gene locus_tag LOCUS_28840 4406 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 4834 4547 gene locus_tag LOCUS_28850 4834 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence313 252 34 gene locus_tag LOCUS_28860 252 34 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_28860 437 255 gene locus_tag LOCUS_28870 437 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28870 2114 861 gene locus_tag LOCUS_28880 2114 861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 protein_id gnl|my_center|LOCUS_28880 3313 2291 gene locus_tag LOCUS_28890 gene gapA 3313 2291 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_28890 3695 3348 gene locus_tag LOCUS_28900 gene arsR 3695 3348 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 protein_id gnl|my_center|LOCUS_28900 5427 4087 gene locus_tag LOCUS_28910 gene tldE 5427 4087 CDS product peptidase PMbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073785.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence314 1140 1409 gene locus_tag LOCUS_28920 gene feoA 1140 1409 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071906.1 protein_id gnl|my_center|LOCUS_28920 1402 3693 gene locus_tag LOCUS_28930 gene feoB 1402 3693 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG28 protein_id gnl|my_center|LOCUS_28930 >Feature sequence315 437 1309 gene locus_tag LOCUS_28940 437 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1302 2024 gene locus_tag LOCUS_28950 1302 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence316 1707 700 gene locus_tag LOCUS_28960 1707 700 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072427.1 protein_id gnl|my_center|LOCUS_28960 2114 2713 gene locus_tag LOCUS_28970 gene lipA 2114 2713 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_28970 3669 2731 gene locus_tag LOCUS_28980 3669 2731 CDS product chloramphenicol-sensitive protein RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481255.1 protein_id gnl|my_center|LOCUS_28980 <5446 3925 gene locus_tag LOCUS_28990 <5446 3925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918969.1:Tat pathway signal protein >Feature sequence317 355 834 gene locus_tag LOCUS_29000 355 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 883 1428 gene locus_tag LOCUS_29010 gene yihI 883 1428 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D7 protein_id gnl|my_center|LOCUS_29010 1507 1974 gene locus_tag LOCUS_29020 1507 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074315.1 protein_id gnl|my_center|LOCUS_29020 2240 3580 gene locus_tag LOCUS_29030 gene hemN 2240 3580 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D5 protein_id gnl|my_center|LOCUS_29030 3854 3618 gene locus_tag LOCUS_29040 3854 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence318 1269 700 gene locus_tag LOCUS_29050 gene ahpC 1269 700 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_29050 2203 1460 gene locus_tag LOCUS_29060 2203 1460 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071239.1 protein_id gnl|my_center|LOCUS_29060 3090 2353 gene locus_tag LOCUS_29070 3090 2353 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121775.1 protein_id gnl|my_center|LOCUS_29070 4162 3173 gene locus_tag LOCUS_29080 gene ldhA 4162 3173 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071244.1 protein_id gnl|my_center|LOCUS_29080 4480 4779 gene locus_tag LOCUS_29090 4480 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 4754 5311 gene locus_tag LOCUS_29100 4754 5311 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence319 98 2101 gene locus_tag LOCUS_29110 98 2101 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073164.1 protein_id gnl|my_center|LOCUS_29110 2505 2335 gene locus_tag LOCUS_29120 2505 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2631 2506 gene locus_tag LOCUS_29130 gene ybgT 2631 2506 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073165.1 protein_id gnl|my_center|LOCUS_29130 3786 2647 gene locus_tag LOCUS_29140 gene cydB 3786 2647 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073166.1 protein_id gnl|my_center|LOCUS_29140 <5343 3801 gene locus_tag LOCUS_29150 <5343 3801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073167.1:cytochrome bd oxidase subunit I >Feature sequence320 33 512 gene locus_tag LOCUS_29160 33 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073157.1 protein_id gnl|my_center|LOCUS_29160 567 1160 gene locus_tag LOCUS_29170 567 1160 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_29170 1850 1227 gene locus_tag LOCUS_29180 1850 1227 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 protein_id gnl|my_center|LOCUS_29180 1995 3125 gene locus_tag LOCUS_29190 1995 3125 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence321 389 189 gene locus_tag LOCUS_29200 gene fdhX 389 189 CDS product formate dehydrogenase accessory protein FdhX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074127.1 protein_id gnl|my_center|LOCUS_29200 1285 599 gene locus_tag LOCUS_29210 gene fdhT 1285 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074126.1 protein_id gnl|my_center|LOCUS_29210 2981 1296 gene locus_tag LOCUS_29220 2981 1296 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074125.1 protein_id gnl|my_center|LOCUS_29220 3823 3188 gene locus_tag LOCUS_29230 3823 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074124.1 protein_id gnl|my_center|LOCUS_29230 4293 3820 gene locus_tag LOCUS_29240 4293 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074123.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence322 5224 707 gene locus_tag LOCUS_29250 5224 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence323 348 818 gene locus_tag LOCUS_29260 348 818 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_29260 2097 862 gene locus_tag LOCUS_29270 2097 862 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071478.1 protein_id gnl|my_center|LOCUS_29270 3301 2459 gene locus_tag LOCUS_29280 3301 2459 CDS product signal transduction superfamily protein with modified HD-GYP domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 protein_id gnl|my_center|LOCUS_29280 3602 4981 gene locus_tag LOCUS_29290 gene yegQ 3602 4981 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence324 <1 934 gene locus_tag LOCUS_29300 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EE00:ribosome biogenesis GTPase A 1865 4483 gene locus_tag LOCUS_29310 1865 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence325 <1 862 gene locus_tag LOCUS_29320 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEI0:30S ribosomal protein S1 935 1222 gene locus_tag LOCUS_29330 gene ihfB 935 1222 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI1 protein_id gnl|my_center|LOCUS_29330 1345 1635 gene locus_tag LOCUS_29340 gene lapA 1345 1635 CDS product putative lipopolysaccharide assembly protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI2 protein_id gnl|my_center|LOCUS_29340 1637 2797 gene locus_tag LOCUS_29350 gene yciM 1637 2797 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI3 protein_id gnl|my_center|LOCUS_29350 2901 3596 gene locus_tag LOCUS_29360 gene pyrF 2901 3596 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI4 protein_id gnl|my_center|LOCUS_29360 3646 4461 gene locus_tag LOCUS_29370 3646 4461 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_29370 4496 5059 gene locus_tag LOCUS_29380 4496 5059 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072375.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence326 337 1836 gene locus_tag LOCUS_29390 gene nusA 337 1836 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL6 protein_id gnl|my_center|LOCUS_29390 1863 4541 gene locus_tag LOCUS_29400 gene infB 1863 4541 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL5 protein_id gnl|my_center|LOCUS_29400 4619 5041 gene locus_tag LOCUS_29410 gene rbfA 4619 5041 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL4 protein_id gnl|my_center|LOCUS_29410 >Feature sequence327 1128 589 gene locus_tag LOCUS_29420 gene hemG 1128 589 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070443.1 protein_id gnl|my_center|LOCUS_29420 1327 1632 gene locus_tag LOCUS_29430 1327 1632 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 protein_id gnl|my_center|LOCUS_29430 2394 1951 gene locus_tag LOCUS_29440 gene slyA 2394 1951 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228179.1 protein_id gnl|my_center|LOCUS_29440 2808 2398 gene locus_tag LOCUS_29450 2808 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 4391 3741 gene locus_tag LOCUS_29460 4391 3741 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706361.1 protein_id gnl|my_center|LOCUS_29460 <5238 4531 gene locus_tag LOCUS_29470 <5238 4531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524793.1:MBL fold hydrolase >Feature sequence328 181 1656 gene locus_tag LOCUS_29480 181 1656 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455312.1 protein_id gnl|my_center|LOCUS_29480 2091 1678 gene locus_tag LOCUS_29490 2091 1678 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 protein_id gnl|my_center|LOCUS_29490 4816 3836 gene locus_tag LOCUS_29500 gene ygfZ 4816 3836 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH8 protein_id gnl|my_center|LOCUS_29500 5179 4985 gene locus_tag LOCUS_29510 5179 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence329 96 2156 gene locus_tag LOCUS_29520 gene rep 96 2156 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9F8 protein_id gnl|my_center|LOCUS_29520 4860 2230 gene locus_tag LOCUS_29530 4860 2230 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073983.1 protein_id gnl|my_center|LOCUS_29530 5108 5184 gene locus_tag LOCUS_t00350 5108 5184 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence330 1326 2435 gene locus_tag LOCUS_29540 1326 2435 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_29540 2886 2488 gene locus_tag LOCUS_29550 2886 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263148.1 protein_id gnl|my_center|LOCUS_29550 2984 4318 gene locus_tag LOCUS_29560 2984 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074243.1 protein_id gnl|my_center|LOCUS_29560 5034 4315 gene locus_tag LOCUS_29570 gene rsuA 5034 4315 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRK5 protein_id gnl|my_center|LOCUS_29570 >Feature sequence331 956 1399 gene locus_tag LOCUS_29580 956 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1610 1434 gene locus_tag LOCUS_29590 1610 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 2047 3705 gene locus_tag LOCUS_29600 2047 3705 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070720.1 protein_id gnl|my_center|LOCUS_29600 3887 4819 gene locus_tag LOCUS_29610 gene yrbG 3887 4819 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence332 4492 2408 gene locus_tag LOCUS_29620 gene prc 4492 2408 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072550.1 protein_id gnl|my_center|LOCUS_29620 <5095 4517 gene locus_tag LOCUS_29630 <5095 4517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EDY8:RNA chaperone ProQ >Feature sequence333 409 1392 gene locus_tag LOCUS_29640 409 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 protein_id gnl|my_center|LOCUS_29640 2648 1476 gene locus_tag LOCUS_29650 2648 1476 CDS product chromate efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071255.1 protein_id gnl|my_center|LOCUS_29650 3938 2763 gene locus_tag LOCUS_29660 gene glpD 3938 2763 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_29660 4475 4026 gene locus_tag LOCUS_29670 gene ohrR 4475 4026 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071252.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence334 293 757 gene locus_tag LOCUS_29680 293 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 801 1946 gene locus_tag LOCUS_29690 801 1946 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459708.1 protein_id gnl|my_center|LOCUS_29690 4256 2322 gene locus_tag LOCUS_29700 4256 2322 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_29700 4900 4568 gene locus_tag LOCUS_29710 4900 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29710 >Feature sequence335 526 1476 gene locus_tag LOCUS_29720 526 1476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_29720 1737 2141 gene locus_tag LOCUS_29730 1737 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2417 2917 gene locus_tag LOCUS_29740 gene sodN 2417 2917 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80735 protein_id gnl|my_center|LOCUS_29740 2943 3236 gene locus_tag LOCUS_29750 2943 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3740 3579 gene locus_tag LOCUS_29760 3740 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 4312 3821 gene locus_tag LOCUS_29770 4312 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072037.1 protein_id gnl|my_center|LOCUS_29770 <4990 4317 gene locus_tag LOCUS_29780 <4990 4317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFN2:NAD-dependent protein deacylase >Feature sequence336 546 1148 gene locus_tag LOCUS_29790 546 1148 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBY7 protein_id gnl|my_center|LOCUS_29790 1249 2385 gene locus_tag LOCUS_29800 gene yggW 1249 2385 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073228.1 protein_id gnl|my_center|LOCUS_29800 2668 4500 gene locus_tag LOCUS_29810 2668 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence337 2765 996 gene locus_tag LOCUS_29820 gene oleC 2765 996 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071876.1 protein_id gnl|my_center|LOCUS_29820 3739 2852 gene locus_tag LOCUS_29830 gene oleB 3739 2852 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_29830 4902 3853 gene locus_tag LOCUS_29840 gene oleA 4902 3853 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence338 1031 2287 gene locus_tag LOCUS_29850 gene glyA 1031 2287 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBN8 protein_id gnl|my_center|LOCUS_29850 2404 2853 gene locus_tag LOCUS_29860 gene nrdR 2404 2853 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBN9 protein_id gnl|my_center|LOCUS_29860 2911 4053 gene locus_tag LOCUS_29870 gene ribD 2911 4053 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP0 protein_id gnl|my_center|LOCUS_29870 4057 4719 gene locus_tag LOCUS_29880 4057 4719 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence339 484 248 gene locus_tag LOCUS_29890 484 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 855 481 gene locus_tag LOCUS_29900 855 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1256 879 gene locus_tag LOCUS_29910 1256 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1764 1348 gene locus_tag LOCUS_29920 1764 1348 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_29920 2652 1972 gene locus_tag LOCUS_29930 2652 1972 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071471.1 protein_id gnl|my_center|LOCUS_29930 3020 4564 gene locus_tag LOCUS_29940 3020 4564 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071593.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence340 2114 1797 gene locus_tag LOCUS_29950 2114 1797 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q67 protein_id gnl|my_center|LOCUS_29950 2606 2217 gene locus_tag LOCUS_29960 2606 2217 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105951.1 protein_id gnl|my_center|LOCUS_29960 4877 3399 gene locus_tag LOCUS_29970 gene der 4877 3399 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC36 protein_id gnl|my_center|LOCUS_29970 >Feature sequence341 3934 1046 gene locus_tag LOCUS_29980 gene gcvP 3934 1046 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ6 protein_id gnl|my_center|LOCUS_29980 4611 4222 gene locus_tag LOCUS_29990 gene gcvH 4611 4222 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_29990 >Feature sequence342 677 1480 gene locus_tag LOCUS_30000 677 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1755 2150 gene locus_tag LOCUS_30010 1755 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889202.1 protein_id gnl|my_center|LOCUS_30010 2550 3923 gene locus_tag LOCUS_30020 2550 3923 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_30020 4846 4571 gene locus_tag LOCUS_30030 4846 4571 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070888.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence343 919 1842 gene locus_tag LOCUS_30040 919 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 2174 2785 gene locus_tag LOCUS_30050 2174 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 2987 3718 gene locus_tag LOCUS_30060 2987 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 4366 4491 gene locus_tag LOCUS_30070 4366 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence344 235 924 gene locus_tag LOCUS_30080 gene queC 235 924 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE85 protein_id gnl|my_center|LOCUS_30080 1101 1544 gene locus_tag LOCUS_30090 1101 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3630 1615 gene locus_tag LOCUS_30100 gene uvrB 3630 1615 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE83 protein_id gnl|my_center|LOCUS_30100 4676 4751 gene locus_tag LOCUS_t00360 4676 4751 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence345 1598 2557 gene locus_tag LOCUS_30110 gene rluC 1598 2557 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 protein_id gnl|my_center|LOCUS_30110 2554 3207 gene locus_tag LOCUS_30120 2554 3207 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_30120 3457 3278 gene locus_tag LOCUS_30130 3457 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4086 3493 gene locus_tag LOCUS_30140 4086 3493 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG7 protein_id gnl|my_center|LOCUS_30140 >Feature sequence346 820 287 gene locus_tag LOCUS_30150 gene atpH 820 287 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B7 protein_id gnl|my_center|LOCUS_30150 1307 837 gene locus_tag LOCUS_30160 gene atpF 1307 837 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B6 protein_id gnl|my_center|LOCUS_30160 1589 1332 gene locus_tag LOCUS_30170 gene atpE 1589 1332 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS9 protein_id gnl|my_center|LOCUS_30170 2437 1616 gene locus_tag LOCUS_30180 gene atpB 2437 1616 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B4 protein_id gnl|my_center|LOCUS_30180 3945 3058 gene locus_tag LOCUS_30190 gene parB 3945 3058 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_30190 4749 3961 gene locus_tag LOCUS_30200 gene parA 4749 3961 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence347 463 1458 gene locus_tag LOCUS_30210 gene lypA 463 1458 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 protein_id gnl|my_center|LOCUS_30210 3917 1545 gene locus_tag LOCUS_30220 3917 1545 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074320.1 protein_id gnl|my_center|LOCUS_30220 4451 4777 gene locus_tag LOCUS_30230 4451 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence348 605 2128 gene locus_tag LOCUS_30240 605 2128 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 protein_id gnl|my_center|LOCUS_30240 4598 2220 gene locus_tag LOCUS_30250 4598 2220 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478021.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence349 51 947 gene locus_tag LOCUS_30260 gene lldR 51 947 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073307.1 protein_id gnl|my_center|LOCUS_30260 1679 1110 gene locus_tag LOCUS_30270 gene lldG 1679 1110 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071697.1 protein_id gnl|my_center|LOCUS_30270 3057 1684 gene locus_tag LOCUS_30280 gene lldF 3057 1684 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071698.1 protein_id gnl|my_center|LOCUS_30280 3811 3068 gene locus_tag LOCUS_30290 gene lldE 3811 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071699.1 protein_id gnl|my_center|LOCUS_30290 4279 4037 gene locus_tag LOCUS_30300 4279 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 4674 4387 gene locus_tag LOCUS_30310 4674 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence350 632 2812 gene locus_tag LOCUS_30320 632 2812 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence351 735 3494 gene locus_tag LOCUS_30330 gene wza 735 3494 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073080.1 protein_id gnl|my_center|LOCUS_30330 3741 4097 gene locus_tag LOCUS_30340 gene wzd 3741 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073079.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence352 1401 322 gene locus_tag LOCUS_30350 1401 322 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462329.1 protein_id gnl|my_center|LOCUS_30350 1604 2521 gene locus_tag LOCUS_30360 1604 2521 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071019.1 protein_id gnl|my_center|LOCUS_30360 3254 2589 gene locus_tag LOCUS_30370 3254 2589 CDS product Qnr family quinolone resistance pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 protein_id gnl|my_center|LOCUS_30370 <4711 3352 gene locus_tag LOCUS_30380 <4711 3352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071020.1:MATE family efflux transporter >Feature sequence353 504 2006 gene locus_tag LOCUS_30390 504 2006 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072148.1 protein_id gnl|my_center|LOCUS_30390 >Feature sequence354 1754 669 gene locus_tag LOCUS_30400 1754 669 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073748.1 protein_id gnl|my_center|LOCUS_30400 <4680 2347 gene locus_tag LOCUS_30410 <4680 2347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EA79:UvrABC system protein A >Feature sequence355 627 280 gene locus_tag LOCUS_30420 627 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454158.1 protein_id gnl|my_center|LOCUS_30420 1861 755 gene locus_tag LOCUS_30430 gene modC 1861 755 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_30430 2564 1884 gene locus_tag LOCUS_30440 gene modB 2564 1884 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_30440 3416 2568 gene locus_tag LOCUS_30450 gene modA 3416 2568 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_30450 3943 3476 gene locus_tag LOCUS_30460 gene moaE 3943 3476 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074081.1 protein_id gnl|my_center|LOCUS_30460 4196 3945 gene locus_tag LOCUS_30470 gene moaD 4196 3945 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E943 protein_id gnl|my_center|LOCUS_30470 >Feature sequence356 >Feature sequence357 276 43 gene locus_tag LOCUS_30480 276 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 325 960 gene locus_tag LOCUS_30490 gene syd 325 960 CDS product protein Syd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGJ3 protein_id gnl|my_center|LOCUS_30490 1783 1010 gene locus_tag LOCUS_30500 1783 1010 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071767.1 protein_id gnl|my_center|LOCUS_30500 2103 1783 gene locus_tag LOCUS_30510 2103 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071768.1 protein_id gnl|my_center|LOCUS_30510 2251 2622 gene locus_tag LOCUS_30520 2251 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 protein_id gnl|my_center|LOCUS_30520 2863 2636 gene locus_tag LOCUS_30530 2863 2636 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071770.1 protein_id gnl|my_center|LOCUS_30530 3034 3678 gene locus_tag LOCUS_30540 3034 3678 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence358 711 94 gene locus_tag LOCUS_30550 gene yigP 711 94 CDS product DUF1243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073883.1 protein_id gnl|my_center|LOCUS_30550 1540 785 gene locus_tag LOCUS_30560 gene ubiE 1540 785 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R7 protein_id gnl|my_center|LOCUS_30560 2807 1764 gene locus_tag LOCUS_30570 gene hutG 2807 1764 CDS product formimidoylglutamase HutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073881.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence359 616 2025 gene locus_tag LOCUS_30580 gene glnA 616 2025 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E976 protein_id gnl|my_center|LOCUS_30580 2201 4357 gene locus_tag LOCUS_30590 2201 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence360 35 1345 gene locus_tag LOCUS_30600 gene fadI 35 1345 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP6 protein_id gnl|my_center|LOCUS_30600 1351 3477 gene locus_tag LOCUS_30610 gene fadJ 1351 3477 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_30610 3839 4063 gene locus_tag LOCUS_30620 3839 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 4355 4236 gene locus_tag LOCUS_30630 4355 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072983.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence361 315 417 gene locus_tag LOCUS_r00010 315 417 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 527 603 gene locus_tag LOCUS_t00370 527 603 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1318 2349 gene locus_tag LOCUS_30640 gene murB 1318 2349 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK85 protein_id gnl|my_center|LOCUS_30640 2342 3304 gene locus_tag LOCUS_30650 gene birA 2342 3304 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK84 protein_id gnl|my_center|LOCUS_30650 4269 3319 gene locus_tag LOCUS_30660 gene coaA 4269 3319 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK83 protein_id gnl|my_center|LOCUS_30660 4502 4577 gene locus_tag LOCUS_t00380 4502 4577 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence362 1201 3246 gene locus_tag LOCUS_30670 1201 3246 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071438.1 protein_id gnl|my_center|LOCUS_30670 3596 3327 gene locus_tag LOCUS_30680 gene rpsO 3596 3327 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL3 protein_id gnl|my_center|LOCUS_30680 <4581 3726 gene locus_tag LOCUS_30690 <4581 3726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K4PSE0:tRNA pseudouridine synthase B >Feature sequence363 1358 864 gene locus_tag LOCUS_30700 gene pgpA 1358 864 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_30700 2317 1358 gene locus_tag LOCUS_30710 gene thiL 2317 1358 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP5 protein_id gnl|my_center|LOCUS_30710 2827 2423 gene locus_tag LOCUS_30720 gene nusB 2827 2423 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP4 protein_id gnl|my_center|LOCUS_30720 3318 2836 gene locus_tag LOCUS_30730 gene ribH 3318 2836 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 protein_id gnl|my_center|LOCUS_30730 4544 3441 gene locus_tag LOCUS_30740 gene ribBA 4544 3441 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP2 protein_id gnl|my_center|LOCUS_30740 >Feature sequence364 1257 61 gene locus_tag LOCUS_30750 gene ackA 1257 61 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED55 protein_id gnl|my_center|LOCUS_30750 1510 1893 gene locus_tag LOCUS_30760 1510 1893 CDS product UPF0208 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED56 protein_id gnl|my_center|LOCUS_30760 2672 1932 gene locus_tag LOCUS_30770 gene pflA 2672 1932 CDS product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED57 protein_id gnl|my_center|LOCUS_30770 <4574 2770 gene locus_tag LOCUS_30780 <4574 2770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072817.1:formate acetyltransferase >Feature sequence365 2964 1249 gene locus_tag LOCUS_30790 2964 1249 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074027.1 protein_id gnl|my_center|LOCUS_30790 3341 2964 gene locus_tag LOCUS_30800 3341 2964 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 protein_id gnl|my_center|LOCUS_30800 <4566 3334 gene locus_tag LOCUS_30810 <4566 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074025.1:aconitate hydratase >Feature sequence366 690 920 gene locus_tag LOCUS_30820 690 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 895 1221 gene locus_tag LOCUS_30830 895 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 2444 1590 gene locus_tag LOCUS_30840 2444 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 2764 2609 gene locus_tag LOCUS_30850 2764 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3460 2774 gene locus_tag LOCUS_30860 3460 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 4097 3441 gene locus_tag LOCUS_30870 4097 3441 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973373.1 protein_id gnl|my_center|LOCUS_30870 4527 4204 gene locus_tag LOCUS_30880 4527 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence367 2301 1126 gene locus_tag LOCUS_30890 gene pgk 2301 1126 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_30890 3533 2511 gene locus_tag LOCUS_30900 gene epd 3533 2511 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB2 protein_id gnl|my_center|LOCUS_30900 4556 3870 gene locus_tag LOCUS_30910 4556 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence368 358 1632 gene locus_tag LOCUS_30920 gene pncC 358 1632 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK32 protein_id gnl|my_center|LOCUS_30920 2254 1712 gene locus_tag LOCUS_30930 2254 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070645.1 protein_id gnl|my_center|LOCUS_30930 <4540 2254 gene locus_tag LOCUS_30940 <4540 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EK30:phosphoenolpyruvate carboxylase >Feature sequence369 1002 796 gene locus_tag LOCUS_30950 gene cspA 1002 796 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_30950 2139 1303 gene locus_tag LOCUS_30960 gene rlmA 2139 1303 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_30960 2944 2129 gene locus_tag LOCUS_30970 2944 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072722.1 protein_id gnl|my_center|LOCUS_30970 4304 4092 gene locus_tag LOCUS_30980 4304 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30980 4488 4315 gene locus_tag LOCUS_30990 4488 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30990 >Feature sequence370 681 1379 gene locus_tag LOCUS_31000 681 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 2013 1648 gene locus_tag LOCUS_31010 2013 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 2624 2004 gene locus_tag LOCUS_31020 gene dmsG 2624 2004 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 protein_id gnl|my_center|LOCUS_31020 <4512 2673 gene locus_tag LOCUS_31030 <4512 2673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074011.1:lipoprotein >Feature sequence371 3509 720 gene locus_tag LOCUS_31040 3509 720 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 protein_id gnl|my_center|LOCUS_31040 3837 4307 gene locus_tag LOCUS_31050 gene sixA 3837 4307 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072979.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence372 879 334 gene locus_tag LOCUS_31060 879 334 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZL8 protein_id gnl|my_center|LOCUS_31060 1086 2030 gene locus_tag LOCUS_31070 1086 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 4216 2231 gene locus_tag LOCUS_31080 4216 2231 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706082.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence373 742 3597 gene locus_tag LOCUS_31090 742 3597 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence374 830 1225 gene locus_tag LOCUS_31100 830 1225 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_31100 1225 2013 gene locus_tag LOCUS_31110 1225 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073593.1 protein_id gnl|my_center|LOCUS_31110 2223 3485 gene locus_tag LOCUS_31120 2223 3485 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence375 2343 3029 gene locus_tag LOCUS_31130 2343 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 4402 3227 gene locus_tag LOCUS_31140 4402 3227 CDS product octopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485002.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence376 <1 2836 gene locus_tag LOCUS_31150 <1 2836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074128.1:formate dehydrogenase 2864 3454 gene locus_tag LOCUS_31160 gene fdhB 2864 3454 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074129.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence377 671 321 gene locus_tag LOCUS_31170 671 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 protein_id gnl|my_center|LOCUS_31170 1940 759 gene locus_tag LOCUS_31180 1940 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2140 2979 gene locus_tag LOCUS_31190 gene mlaA 2140 2979 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 protein_id gnl|my_center|LOCUS_31190 3046 4149 gene locus_tag LOCUS_31200 3046 4149 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073083.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence378 43 942 gene locus_tag LOCUS_31210 43 942 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073893.1 protein_id gnl|my_center|LOCUS_31210 1003 3726 gene locus_tag LOCUS_31220 gene secA 1003 3726 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q5 protein_id gnl|my_center|LOCUS_31220 >Feature sequence379 544 17 gene locus_tag LOCUS_31230 544 17 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071518.1 protein_id gnl|my_center|LOCUS_31230 944 573 gene locus_tag LOCUS_31240 944 573 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071519.1 protein_id gnl|my_center|LOCUS_31240 2522 1413 gene locus_tag LOCUS_31250 gene anmK 2522 1413 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_31250 4063 2624 gene locus_tag LOCUS_31260 4063 2624 CDS product family M23 zinc metallopeptidase with OapA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence380 2035 407 gene locus_tag LOCUS_31270 gene hutU 2035 407 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ5 protein_id gnl|my_center|LOCUS_31270 2962 2261 gene locus_tag LOCUS_31280 gene hutC 2962 2261 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence381 <1 1031 gene locus_tag LOCUS_31290 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229058.1:type IV secretion protein Rhs 1301 1450 gene locus_tag LOCUS_31300 1301 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 1466 2200 gene locus_tag LOCUS_31310 1466 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2812 3666 gene locus_tag LOCUS_31320 2812 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3667 3975 gene locus_tag LOCUS_31330 3667 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence382 394 1971 gene locus_tag LOCUS_31340 394 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073515.1 protein_id gnl|my_center|LOCUS_31340 2012 2359 gene locus_tag LOCUS_31350 2012 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2599 3123 gene locus_tag LOCUS_31360 2599 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 4100 3246 gene locus_tag LOCUS_31370 4100 3246 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence383 252 1094 gene locus_tag LOCUS_31380 gene yhiR 252 1094 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8K5 protein_id gnl|my_center|LOCUS_31380 1536 1327 gene locus_tag LOCUS_31390 1536 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1685 3124 gene locus_tag LOCUS_31400 gene vmrA 1685 3124 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263736.1 protein_id gnl|my_center|LOCUS_31400 4216 3242 gene locus_tag LOCUS_31410 4216 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence384 1804 242 gene locus_tag LOCUS_31420 1804 242 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268561.1 protein_id gnl|my_center|LOCUS_31420 2485 3030 gene locus_tag LOCUS_31430 gene rfaH 2485 3030 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECE8 protein_id gnl|my_center|LOCUS_31430 >Feature sequence385 562 293 gene locus_tag LOCUS_31440 562 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 699 2111 gene locus_tag LOCUS_31450 699 2111 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970945.1 protein_id gnl|my_center|LOCUS_31450 4003 2060 gene locus_tag LOCUS_31460 4003 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 >Feature sequence386 1416 43 gene locus_tag LOCUS_31470 1416 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 3677 1473 gene locus_tag LOCUS_31480 3677 1473 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_31480 4056 3850 gene locus_tag LOCUS_31490 4056 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence387 1421 147 gene locus_tag LOCUS_31500 1421 147 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK7 protein_id gnl|my_center|LOCUS_31500 2377 1583 gene locus_tag LOCUS_31510 2377 1583 CDS product hydrolase TatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071443.1 protein_id gnl|my_center|LOCUS_31510 4148 2568 gene locus_tag LOCUS_31520 gene prfC 4148 2568 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU03 protein_id gnl|my_center|LOCUS_31520 >Feature sequence388 1045 668 gene locus_tag LOCUS_31530 1045 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_31530 1814 1122 gene locus_tag LOCUS_31540 gene yiiM 1814 1122 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074088.1 protein_id gnl|my_center|LOCUS_31540 2894 2058 gene locus_tag LOCUS_31550 2894 2058 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074090.1 protein_id gnl|my_center|LOCUS_31550 3134 2991 gene locus_tag LOCUS_31560 3134 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3748 3188 gene locus_tag LOCUS_31570 3748 3188 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550468.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence389 2 337 gene locus_tag LOCUS_31580 2 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 334 702 gene locus_tag LOCUS_31590 334 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938931.1 protein_id gnl|my_center|LOCUS_31590 683 1870 gene locus_tag LOCUS_31600 683 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097385.1 protein_id gnl|my_center|LOCUS_31600 1870 2550 gene locus_tag LOCUS_31610 1870 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2550 3128 gene locus_tag LOCUS_31620 2550 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3130 3933 gene locus_tag LOCUS_31630 3130 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence390 427 1872 gene locus_tag LOCUS_31640 427 1872 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 protein_id gnl|my_center|LOCUS_31640 2823 2011 gene locus_tag LOCUS_31650 2823 2011 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072750.1 protein_id gnl|my_center|LOCUS_31650 3512 2895 gene locus_tag LOCUS_31660 gene ribA 3512 2895 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDD1 protein_id gnl|my_center|LOCUS_31660 4166 3810 gene locus_tag LOCUS_31670 4166 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072752.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence391 50 679 gene locus_tag LOCUS_31680 gene rnt 50 679 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDJ2 protein_id gnl|my_center|LOCUS_31680 1515 910 gene locus_tag LOCUS_31690 gene tsaA 1515 910 CDS product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_31690 1939 3147 gene locus_tag LOCUS_31700 gene yuiF 1939 3147 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 protein_id gnl|my_center|LOCUS_31700 3906 3280 gene locus_tag LOCUS_31710 gene upp 3906 3280 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI9 protein_id gnl|my_center|LOCUS_31710 >Feature sequence392 903 286 gene locus_tag LOCUS_31720 gene can 903 286 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB3 protein_id gnl|my_center|LOCUS_31720 1857 1024 gene locus_tag LOCUS_31730 1857 1024 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072440.1 protein_id gnl|my_center|LOCUS_31730 2640 1966 gene locus_tag LOCUS_31740 2640 1966 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072439.1 protein_id gnl|my_center|LOCUS_31740 3764 2634 gene locus_tag LOCUS_31750 gene dapE 3764 2634 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB6 protein_id gnl|my_center|LOCUS_31750 4105 3761 gene locus_tag LOCUS_31760 4105 3761 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072437.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence393 160 1830 gene locus_tag LOCUS_31770 160 1830 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_31770 2099 2647 gene locus_tag LOCUS_31780 2099 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence394 474 1019 gene locus_tag LOCUS_31790 474 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_31790 1140 2183 gene locus_tag LOCUS_31800 gene glnL 1140 2183 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074100.1 protein_id gnl|my_center|LOCUS_31800 2254 3663 gene locus_tag LOCUS_31810 gene glnG 2254 3663 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074101.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence395 322 11 gene locus_tag LOCUS_31820 322 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 321 743 gene locus_tag LOCUS_31830 321 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1180 1404 gene locus_tag LOCUS_31840 1180 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2099 1602 gene locus_tag LOCUS_31850 2099 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2873 2223 gene locus_tag LOCUS_31860 2873 2223 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_31860 3005 3127 gene locus_tag LOCUS_31870 3005 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3157 3843 gene locus_tag LOCUS_31880 3157 3843 CDS product dUMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169692.1 protein_id gnl|my_center|LOCUS_31880 3981 4071 gene locus_tag LOCUS_t00390 3981 4071 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence396 672 493 gene locus_tag LOCUS_31890 672 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 1136 669 gene locus_tag LOCUS_31900 1136 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 2350 1163 gene locus_tag LOCUS_31910 2350 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3902 2433 gene locus_tag LOCUS_31920 3902 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence397 1828 1046 gene locus_tag LOCUS_31930 1828 1046 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 protein_id gnl|my_center|LOCUS_31930 <4056 2518 gene locus_tag LOCUS_31940 <4056 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072403.1:TonB-dependent receptor >Feature sequence398 <1 724 gene locus_tag LOCUS_31950 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBX8:tRNA (guanine-N(7)-)-methyltransferase 805 1128 gene locus_tag LOCUS_31960 gene yggL 805 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073234.1 protein_id gnl|my_center|LOCUS_31960 1116 1253 gene locus_tag LOCUS_31970 1116 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1531 2364 gene locus_tag LOCUS_31980 1531 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073232.1 protein_id gnl|my_center|LOCUS_31980 2808 3749 gene locus_tag LOCUS_31990 2808 3749 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073231.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence399 2337 187 gene locus_tag LOCUS_32000 2337 187 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072692.1 protein_id gnl|my_center|LOCUS_32000 3827 2958 gene locus_tag LOCUS_32010 gene motY 3827 2958 CDS product smf-dependent flagellar motor protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 protein_id gnl|my_center|LOCUS_32010 3936 3817 gene locus_tag LOCUS_32020 3936 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence400 405 752 gene locus_tag LOCUS_32030 405 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073241.1 protein_id gnl|my_center|LOCUS_32030 1913 975 gene locus_tag LOCUS_32040 1913 975 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_32040 2181 2657 gene locus_tag LOCUS_32050 2181 2657 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence401 968 396 gene locus_tag LOCUS_32060 968 396 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691652.1 protein_id gnl|my_center|LOCUS_32060 2961 1105 gene locus_tag LOCUS_32070 2961 1105 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence402 133 609 gene locus_tag LOCUS_32080 133 609 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 protein_id gnl|my_center|LOCUS_32080 1539 682 gene locus_tag LOCUS_32090 1539 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2522 1608 gene locus_tag LOCUS_32100 2522 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32100 3571 2408 gene locus_tag LOCUS_32110 3571 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32110 >Feature sequence403 <1 2038 gene locus_tag LOCUS_32120 <1 2038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458992.1:TonB-dependent receptor 2645 2109 gene locus_tag LOCUS_32130 2645 2109 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_32130 3955 2939 gene locus_tag LOCUS_32140 gene hemB 3955 2939 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_32140 >Feature sequence404 1477 158 gene locus_tag LOCUS_32150 gene pepQ 1477 158 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR8 protein_id gnl|my_center|LOCUS_32150 1764 3917 gene locus_tag LOCUS_32160 gene fadB 1764 3917 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR9 protein_id gnl|my_center|LOCUS_32160 >Feature sequence405 1206 610 gene locus_tag LOCUS_32170 1206 610 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 protein_id gnl|my_center|LOCUS_32170 1594 2382 gene locus_tag LOCUS_32180 gene miaE 1594 2382 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071910.1 protein_id gnl|my_center|LOCUS_32180 3181 2447 gene locus_tag LOCUS_32190 gene lpxH 3181 2447 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG24 protein_id gnl|my_center|LOCUS_32190 3754 3191 gene locus_tag LOCUS_32200 gene ppiB 3754 3191 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_32200 >Feature sequence406 <1 1258 gene locus_tag LOCUS_32210 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJQ5:ATP-dependent RNA helicase RhlB 1275 2186 gene locus_tag LOCUS_32220 gene gppA 1275 2186 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070768.1 protein_id gnl|my_center|LOCUS_32220 2350 2517 gene locus_tag LOCUS_32230 2350 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence407 1871 654 gene locus_tag LOCUS_32240 gene nqrF 1871 654 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EID5 protein_id gnl|my_center|LOCUS_32240 2553 1945 gene locus_tag LOCUS_32250 gene nqrE 2553 1945 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EID6 protein_id gnl|my_center|LOCUS_32250 3186 2563 gene locus_tag LOCUS_32260 gene nqrD 3186 2563 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EID7 protein_id gnl|my_center|LOCUS_32260 3970 3188 gene locus_tag LOCUS_32270 gene nqrC 3970 3188 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EID8 protein_id gnl|my_center|LOCUS_32270 >Feature sequence408 3575 753 gene locus_tag LOCUS_32280 3575 753 CDS product periplasmic peptidase family S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence409 1443 748 gene locus_tag LOCUS_32290 gene trmH 1443 748 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8P8 protein_id gnl|my_center|LOCUS_32290 1917 1534 gene locus_tag LOCUS_32300 1917 1534 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_32300 <3984 1950 gene locus_tag LOCUS_32310 <3984 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070723.1:bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase >Feature sequence410 1719 2306 gene locus_tag LOCUS_32320 1719 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2484 2867 gene locus_tag LOCUS_32330 2484 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence411 267 623 gene locus_tag LOCUS_32340 267 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1544 651 gene locus_tag LOCUS_32350 gene hmgR 1544 651 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_32350 1769 2809 gene locus_tag LOCUS_32360 gene hppD 1769 2809 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072057.1 protein_id gnl|my_center|LOCUS_32360 2965 3582 gene locus_tag LOCUS_32370 2965 3582 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence412 578 1522 gene locus_tag LOCUS_32380 gene nahR 578 1522 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence413 200 529 gene locus_tag LOCUS_32390 200 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1349 627 gene locus_tag LOCUS_32400 1349 627 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 protein_id gnl|my_center|LOCUS_32400 2275 1349 gene locus_tag LOCUS_32410 gene xerC 2275 1349 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ5 protein_id gnl|my_center|LOCUS_32410 3034 2396 gene locus_tag LOCUS_32420 3034 2396 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073966.1 protein_id gnl|my_center|LOCUS_32420 3873 3031 gene locus_tag LOCUS_32430 gene dapF 3873 3031 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H5 protein_id gnl|my_center|LOCUS_32430 >Feature sequence414 331 2406 gene locus_tag LOCUS_32440 gene recG 331 2406 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9C0 protein_id gnl|my_center|LOCUS_32440 2568 3434 gene locus_tag LOCUS_32450 2568 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence415 624 1223 gene locus_tag LOCUS_32460 624 1223 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 protein_id gnl|my_center|LOCUS_32460 2454 1300 gene locus_tag LOCUS_32470 2454 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602840.1 protein_id gnl|my_center|LOCUS_32470 2838 2533 gene locus_tag LOCUS_32480 2838 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence416 2101 1529 gene locus_tag LOCUS_32490 2101 1529 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 protein_id gnl|my_center|LOCUS_32490 3146 2307 gene locus_tag LOCUS_32500 gene cpdA 3146 2307 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK1 protein_id gnl|my_center|LOCUS_32500 3506 3159 gene locus_tag LOCUS_32510 3506 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence417 326 1063 gene locus_tag LOCUS_32520 326 1063 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_32520 2017 1151 gene locus_tag LOCUS_32530 gene rluB 2017 1151 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PST1 protein_id gnl|my_center|LOCUS_32530 3825 2572 gene locus_tag LOCUS_32540 3825 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence418 <1 686 gene locus_tag LOCUS_32550 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070849.1:NAD(P)H-flavin reductase 1073 861 gene locus_tag LOCUS_32560 gene yozG 1073 861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946172.1 protein_id gnl|my_center|LOCUS_32560 1621 1106 gene locus_tag LOCUS_32570 1621 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 1808 3862 gene locus_tag LOCUS_32580 1808 3862 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730594.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence419 365 817 gene locus_tag LOCUS_32590 365 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 1895 858 gene locus_tag LOCUS_32600 1895 858 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 protein_id gnl|my_center|LOCUS_32600 3244 2090 gene locus_tag LOCUS_32610 gene metK 3244 2090 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB4 protein_id gnl|my_center|LOCUS_32610 >Feature sequence420 618 247 gene locus_tag LOCUS_32620 gene erpA 618 247 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC4 protein_id gnl|my_center|LOCUS_32620 1495 713 gene locus_tag LOCUS_32630 1495 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071516.1 protein_id gnl|my_center|LOCUS_32630 1621 3291 gene locus_tag LOCUS_32640 1621 3291 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_32640 3539 3757 gene locus_tag LOCUS_32650 3539 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence421 1144 317 gene locus_tag LOCUS_32660 1144 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 1255 3450 gene locus_tag LOCUS_32670 gene priA 1255 3450 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Y8 protein_id gnl|my_center|LOCUS_32670 >Feature sequence422 453 1190 gene locus_tag LOCUS_32680 453 1190 CDS product L-cystine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707928.1 protein_id gnl|my_center|LOCUS_32680 2148 1546 gene locus_tag LOCUS_32690 2148 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2867 2145 gene locus_tag LOCUS_32700 2867 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3247 2990 gene locus_tag LOCUS_32710 3247 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3479 3297 gene locus_tag LOCUS_32720 3479 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence423 3781 899 gene locus_tag LOCUS_32730 gene btuB 3781 899 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence424 379 1206 gene locus_tag LOCUS_32740 379 1206 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231936.2 protein_id gnl|my_center|LOCUS_32740 1697 2470 gene locus_tag LOCUS_32750 gene deoC 1697 2470 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK4 protein_id gnl|my_center|LOCUS_32750 >Feature sequence425 953 444 gene locus_tag LOCUS_32760 gene crr 953 444 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072253.1 protein_id gnl|my_center|LOCUS_32760 2742 1027 gene locus_tag LOCUS_32770 gene ptsI 2742 1027 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEX4 protein_id gnl|my_center|LOCUS_32770 3044 2787 gene locus_tag LOCUS_32780 gene ptsH 3044 2787 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072255.1 protein_id gnl|my_center|LOCUS_32780 3478 3092 gene locus_tag LOCUS_32790 3478 3092 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence426 2213 1254 gene locus_tag LOCUS_32800 gene tolA 2213 1254 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072688.1 protein_id gnl|my_center|LOCUS_32800 2651 2217 gene locus_tag LOCUS_32810 gene tolR 2651 2217 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_32810 3340 2651 gene locus_tag LOCUS_32820 gene tolQ 3340 2651 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 protein_id gnl|my_center|LOCUS_32820 3728 3330 gene locus_tag LOCUS_32830 gene ybgC 3728 3330 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072691.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence427 59 481 gene locus_tag LOCUS_32840 gene fkpB 59 481 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI6 protein_id gnl|my_center|LOCUS_32840 485 1432 gene locus_tag LOCUS_32850 gene ispH 485 1432 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI7 protein_id gnl|my_center|LOCUS_32850 1674 2231 gene locus_tag LOCUS_32860 gene pilV 1674 2231 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073361.1 protein_id gnl|my_center|LOCUS_32860 2232 3212 gene locus_tag LOCUS_32870 gene pilW 2232 3212 CDS product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_32870 3250 3702 gene locus_tag LOCUS_32880 gene pilX 3250 3702 CDS product pilus assembly protein PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073359.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence428 1896 1084 gene locus_tag LOCUS_32890 gene dapB 1896 1084 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS7 protein_id gnl|my_center|LOCUS_32890 2648 2031 gene locus_tag LOCUS_32900 gene fklB 2648 2031 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_32900 3533 2733 gene locus_tag LOCUS_32910 3533 2733 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence429 1355 108 gene locus_tag LOCUS_32920 gene nqrB 1355 108 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EID9 protein_id gnl|my_center|LOCUS_32920 2716 1355 gene locus_tag LOCUS_32930 gene nqrA 2716 1355 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIE0 protein_id gnl|my_center|LOCUS_32930 <3725 3020 gene locus_tag LOCUS_32940 <3725 3020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073551.1:membrane protein >Feature sequence430 597 2198 gene locus_tag LOCUS_32950 gene fadD 597 2198 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 protein_id gnl|my_center|LOCUS_32950 3405 2308 gene locus_tag LOCUS_32960 3405 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence431 1302 745 gene locus_tag LOCUS_32970 gene frr 1302 745 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH2 protein_id gnl|my_center|LOCUS_32970 2141 1401 gene locus_tag LOCUS_32980 gene pyrH 2141 1401 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH3 protein_id gnl|my_center|LOCUS_32980 3079 2231 gene locus_tag LOCUS_32990 gene tsf 3079 2231 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH4 protein_id gnl|my_center|LOCUS_32990 >Feature sequence432 45 135 gene locus_tag LOCUS_t00400 45 135 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1390 3630 gene locus_tag LOCUS_33000 1390 3630 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089033.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence433 760 521 gene locus_tag LOCUS_33010 760 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33010 1243 2379 gene locus_tag LOCUS_33020 1243 2379 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_33020 2391 3131 gene locus_tag LOCUS_33030 2391 3131 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence434 187 5 gene locus_tag LOCUS_33040 187 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 666 2789 gene locus_tag LOCUS_33050 666 2789 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973771.1 protein_id gnl|my_center|LOCUS_33050 3451 3149 gene locus_tag LOCUS_33060 3451 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence435 844 2430 gene locus_tag LOCUS_33070 844 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence436 152 1303 gene locus_tag LOCUS_33080 152 1303 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence437 273 815 gene locus_tag LOCUS_33090 273 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 818 1666 gene locus_tag LOCUS_33100 818 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence438 208 1494 gene locus_tag LOCUS_33110 208 1494 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_33110 1690 2304 gene locus_tag LOCUS_33120 1690 2304 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529393.1 protein_id gnl|my_center|LOCUS_33120 2703 3470 gene locus_tag LOCUS_33130 2703 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence439 371 904 gene locus_tag LOCUS_33140 371 904 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 protein_id gnl|my_center|LOCUS_33140 2164 1157 gene locus_tag LOCUS_33150 gene trpS 2164 1157 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK12 protein_id gnl|my_center|LOCUS_33150 2868 2161 gene locus_tag LOCUS_33160 gene gph 2868 2161 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_33160 <3544 2872 gene locus_tag LOCUS_33170 <3544 2872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EK14:ribulose-phosphate 3-epimerase >Feature sequence440 278 424 gene locus_tag LOCUS_33180 278 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 648 1199 gene locus_tag LOCUS_33190 648 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1217 2182 gene locus_tag LOCUS_33200 1217 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2172 2858 gene locus_tag LOCUS_33210 2172 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence441 1635 19 gene locus_tag LOCUS_33220 1635 19 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_33220 2679 3248 gene locus_tag LOCUS_33230 2679 3248 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence442 1037 1963 gene locus_tag LOCUS_33240 1037 1963 CDS product RNA pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 protein_id gnl|my_center|LOCUS_33240 2210 2668 gene locus_tag LOCUS_33250 2210 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 <3504 2677 gene locus_tag LOCUS_33260 <3504 2677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073865.1:metallophosphatase-binding domain protein >Feature sequence443 453 2876 gene locus_tag LOCUS_33270 gene sapSH 453 2876 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073002.1 protein_id gnl|my_center|LOCUS_33270 3007 3363 gene locus_tag LOCUS_33280 3007 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072748.1 protein_id gnl|my_center|LOCUS_33280 >Feature sequence444 326 3382 gene locus_tag LOCUS_33290 326 3382 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263656.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence445 44 736 gene locus_tag LOCUS_33300 44 736 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_33300 978 2018 gene locus_tag LOCUS_33310 978 2018 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453776.1 protein_id gnl|my_center|LOCUS_33310 <3443 2111 gene locus_tag LOCUS_33320 <3443 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070800.1:permease >Feature sequence446 1918 1652 gene locus_tag LOCUS_33330 1918 1652 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence447 105 1952 gene locus_tag LOCUS_33340 105 1952 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_33340 2797 2003 gene locus_tag LOCUS_33350 2797 2003 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence448 <1 1097 gene locus_tag LOCUS_33360 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073971.1:adenylate cyclase 1519 1190 gene locus_tag LOCUS_33370 gene cyaY 1519 1190 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H2 protein_id gnl|my_center|LOCUS_33370 1830 1979 gene locus_tag LOCUS_33380 1830 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 1984 3228 gene locus_tag LOCUS_33390 gene lysA 1984 3228 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 protein_id gnl|my_center|LOCUS_33390 >Feature sequence449 1051 1266 gene locus_tag LOCUS_33400 1051 1266 CDS product UPF0352 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF26 protein_id gnl|my_center|LOCUS_33400 1367 3154 gene locus_tag LOCUS_33410 gene yejM 1367 3154 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072211.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence450 333 205 gene locus_tag LOCUS_33420 333 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 581 1096 gene locus_tag LOCUS_33430 581 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 2346 1387 gene locus_tag LOCUS_33440 2346 1387 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263913.1 protein_id gnl|my_center|LOCUS_33440 2445 2984 gene locus_tag LOCUS_33450 2445 2984 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence451 1015 1470 gene locus_tag LOCUS_33460 gene dgkA 1015 1470 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF02 protein_id gnl|my_center|LOCUS_33460 1827 2738 gene locus_tag LOCUS_33470 1827 2738 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072231.1 protein_id gnl|my_center|LOCUS_33470 <3395 2799 gene locus_tag LOCUS_33480 <3395 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072557.1:membrane protein >Feature sequence452 1416 2333 gene locus_tag LOCUS_33490 1416 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence453 3185 366 gene locus_tag LOCUS_33500 gene dld 3185 366 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071700.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence454 76 1683 gene locus_tag LOCUS_33510 gene bkdB 76 1683 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN6 protein_id gnl|my_center|LOCUS_33510 1817 2884 gene locus_tag LOCUS_33520 gene nadA 1817 2884 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_33520 >Feature sequence455 179 24 gene locus_tag LOCUS_33530 179 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1516 575 gene locus_tag LOCUS_33540 gene nrfD 1516 575 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 protein_id gnl|my_center|LOCUS_33540 2208 1513 gene locus_tag LOCUS_33550 gene nfrC 2208 1513 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262126.1 protein_id gnl|my_center|LOCUS_33550 3279 2776 gene locus_tag LOCUS_33560 3279 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence456 463 1254 gene locus_tag LOCUS_33570 463 1254 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_33570 1238 2149 gene locus_tag LOCUS_33580 gene cheW 1238 2149 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073089.1 protein_id gnl|my_center|LOCUS_33580 2157 2642 gene locus_tag LOCUS_33590 gene cheW 2157 2642 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_33590 2705 3109 gene locus_tag LOCUS_33600 2705 3109 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence457 3241 395 gene locus_tag LOCUS_33610 3241 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence458 180 1052 gene locus_tag LOCUS_33620 gene sucD 180 1052 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN7 protein_id gnl|my_center|LOCUS_33620 1446 1309 gene locus_tag LOCUS_33630 1446 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 1758 2258 gene locus_tag LOCUS_33640 1758 2258 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072034.1 protein_id gnl|my_center|LOCUS_33640 3155 2724 gene locus_tag LOCUS_33650 gene fur 3155 2724 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072035.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence459 79 3 gene locus_tag LOCUS_t00410 79 3 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 346 270 gene locus_tag LOCUS_t00420 346 270 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 467 391 gene locus_tag LOCUS_t00430 467 391 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2180 804 gene locus_tag LOCUS_33660 gene norM 2180 804 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 protein_id gnl|my_center|LOCUS_33660 2213 2848 gene locus_tag LOCUS_33670 gene ribC 2213 2848 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_33670 2953 3120 gene locus_tag LOCUS_33680 2953 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence460 699 1091 gene locus_tag LOCUS_33690 699 1091 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_33690 2129 1173 gene locus_tag LOCUS_33700 2129 1173 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 protein_id gnl|my_center|LOCUS_33700 <3151 2452 gene locus_tag LOCUS_33710 <3151 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HLD2:adenylyl-sulfate kinase >Feature sequence461 590 63 gene locus_tag LOCUS_33720 gene hemG 590 63 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 protein_id gnl|my_center|LOCUS_33720 2153 696 gene locus_tag LOCUS_33730 gene trkH 2153 696 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_33730 2807 2298 gene locus_tag LOCUS_33740 gene yigZ 2807 2298 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070439.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence462 1617 124 gene locus_tag LOCUS_33750 gene rsmB 1617 124 CDS product tRNA/rRNA cytosine-C5-methylase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_33750 1902 2243 gene locus_tag LOCUS_33760 1902 2243 CDS product UPF0267 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GA3 protein_id gnl|my_center|LOCUS_33760 2960 2289 gene locus_tag LOCUS_33770 2960 2289 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence463 >Feature sequence464 759 7 gene locus_tag LOCUS_33780 gene pdhR 759 7 CDS product transcriptional regulator PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070781.1 protein_id gnl|my_center|LOCUS_33780 1821 970 gene locus_tag LOCUS_33790 gene ampE 1821 970 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070780.1 protein_id gnl|my_center|LOCUS_33790 2451 1927 gene locus_tag LOCUS_33800 gene ampD 2451 1927 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070779.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence465 1184 405 gene locus_tag LOCUS_33810 gene csgG 1184 405 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073480.1 protein_id gnl|my_center|LOCUS_33810 1589 1188 gene locus_tag LOCUS_33820 gene csgF 1589 1188 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_33820 2020 1625 gene locus_tag LOCUS_33830 gene csgE 2020 1625 CDS product curli production assembly protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073482.1 protein_id gnl|my_center|LOCUS_33830 <3095 2381 gene locus_tag LOCUS_33840 <3095 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EA81:single-stranded DNA-binding protein >Feature sequence466 2911 800 gene locus_tag LOCUS_33850 gene mtrB 2911 800 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence467 17 481 gene locus_tag LOCUS_33860 17 481 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_33860 629 2317 gene locus_tag LOCUS_33870 gene maeA 629 2317 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAP2 protein_id gnl|my_center|LOCUS_33870 >Feature sequence468 914 327 gene locus_tag LOCUS_33880 914 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 1137 928 gene locus_tag LOCUS_33890 1137 928 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_33890 1727 1137 gene locus_tag LOCUS_33900 1727 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 <3078 2526 gene locus_tag LOCUS_33910 <3078 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KIK9:phosphoheptose isomerase >Feature sequence469 131 724 gene locus_tag LOCUS_33920 131 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072268.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence470 696 106 gene locus_tag LOCUS_33930 gene gmhA 696 106 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK08 protein_id gnl|my_center|LOCUS_33930 1126 776 gene locus_tag LOCUS_33940 1126 776 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK07 protein_id gnl|my_center|LOCUS_33940 2917 1139 gene locus_tag LOCUS_33950 gene lppC 2917 1139 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070672.1 protein_id gnl|my_center|LOCUS_33950 >Feature sequence471 1040 753 gene locus_tag LOCUS_33960 1040 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 1728 1042 gene locus_tag LOCUS_33970 1728 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 2742 1732 gene locus_tag LOCUS_33980 2742 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533587.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence472 391 912 gene locus_tag LOCUS_33990 gene fliL 391 912 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 protein_id gnl|my_center|LOCUS_33990 1028 2056 gene locus_tag LOCUS_34000 gene fliM 1028 2056 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC2 protein_id gnl|my_center|LOCUS_34000 2125 2508 gene locus_tag LOCUS_34010 gene fliN 2125 2508 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC3 protein_id gnl|my_center|LOCUS_34010 2516 2887 gene locus_tag LOCUS_34020 gene fliO 2516 2887 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC4 protein_id gnl|my_center|LOCUS_34020 >Feature sequence473 328 1308 gene locus_tag LOCUS_34030 328 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1305 2519 gene locus_tag LOCUS_34040 1305 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2503 2805 gene locus_tag LOCUS_34050 2503 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence474 >Feature sequence475 558 34 gene locus_tag LOCUS_34060 gene hscB 558 34 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU6 protein_id gnl|my_center|LOCUS_34060 902 579 gene locus_tag LOCUS_34070 gene iscA 902 579 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU7 protein_id gnl|my_center|LOCUS_34070 1300 917 gene locus_tag LOCUS_34080 gene iscU 1300 917 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU8 protein_id gnl|my_center|LOCUS_34080 2552 1338 gene locus_tag LOCUS_34090 gene iscS 2552 1338 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU9 protein_id gnl|my_center|LOCUS_34090 >Feature sequence476 85 555 gene locus_tag LOCUS_34100 85 555 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070600.1 protein_id gnl|my_center|LOCUS_34100 1457 600 gene locus_tag LOCUS_34110 gene murI 1457 600 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK90 protein_id gnl|my_center|LOCUS_34110 1646 2743 gene locus_tag LOCUS_34120 gene trmA 1646 2743 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX51 protein_id gnl|my_center|LOCUS_34120 >Feature sequence477 1541 264 gene locus_tag LOCUS_34130 gene clpX 1541 264 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG18 protein_id gnl|my_center|LOCUS_34130 2237 1626 gene locus_tag LOCUS_34140 gene clpP 2237 1626 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG19 protein_id gnl|my_center|LOCUS_34140 <2982 2328 gene locus_tag LOCUS_34150 <2982 2328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EG20:trigger factor >Feature sequence478 1445 486 gene locus_tag LOCUS_34160 gene fmt 1445 486 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_34160 1965 1453 gene locus_tag LOCUS_34170 gene def1 1965 1453 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ8 protein_id gnl|my_center|LOCUS_34170 >Feature sequence479 37 1284 gene locus_tag LOCUS_34180 gene nhaD 37 1284 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721316.1 protein_id gnl|my_center|LOCUS_34180 2610 1630 gene locus_tag LOCUS_34190 2610 1630 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence480 358 1434 gene locus_tag LOCUS_34200 gene aroB 358 1434 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK19 protein_id gnl|my_center|LOCUS_34200 1450 2862 gene locus_tag LOCUS_34210 gene damX 1450 2862 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070660.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence481 813 274 gene locus_tag LOCUS_34220 813 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074289.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence482 334 2784 gene locus_tag LOCUS_34230 334 2784 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence483 <1 947 gene locus_tag LOCUS_34240 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456652.1:Flp pilus assembly protein TadA 957 1934 gene locus_tag LOCUS_34250 957 1934 CDS product pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 protein_id gnl|my_center|LOCUS_34250 1937 2905 gene locus_tag LOCUS_34260 1937 2905 CDS product pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence484 273 977 gene locus_tag LOCUS_34270 273 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072994.1 protein_id gnl|my_center|LOCUS_34270 1113 2564 gene locus_tag LOCUS_34280 1113 2564 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266449.1 protein_id gnl|my_center|LOCUS_34280 >Feature sequence485 2121 1159 gene locus_tag LOCUS_34290 2121 1159 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence486 >Feature sequence487 <1 835 gene locus_tag LOCUS_34300 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E8K6:ribosomal RNA small subunit methyltransferase J 1244 2872 gene locus_tag LOCUS_34310 1244 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence488 487 1605 gene locus_tag LOCUS_34320 gene fic 487 1605 CDS product adenosine monophosphate-protein transferase SoFic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9K5 protein_id gnl|my_center|LOCUS_34320 >Feature sequence489 2007 160 gene locus_tag LOCUS_34330 2007 160 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 protein_id gnl|my_center|LOCUS_34330 2875 2627 gene locus_tag LOCUS_34340 2875 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence490 362 1084 gene locus_tag LOCUS_34350 362 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070693.1 protein_id gnl|my_center|LOCUS_34350 1186 1485 gene locus_tag LOCUS_34360 1186 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 1618 1911 gene locus_tag LOCUS_34370 1618 1911 CDS product DUF3630 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070696.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence491 711 1025 gene locus_tag LOCUS_34380 711 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34380 1025 2410 gene locus_tag LOCUS_34390 1025 2410 CDS product NTPase KAP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706042.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34390 >Feature sequence492 264 461 gene locus_tag LOCUS_34400 264 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 867 637 gene locus_tag LOCUS_34410 867 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 968 1342 gene locus_tag LOCUS_34420 968 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1432 1953 gene locus_tag LOCUS_34430 1432 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 <2861 2036 gene locus_tag LOCUS_34440 <2861 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000833420.1:membrane protein >Feature sequence493 522 1757 gene locus_tag LOCUS_34450 522 1757 CDS product 7-keto-8-aminopelargonate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887165.1 protein_id gnl|my_center|LOCUS_34450 1757 2518 gene locus_tag LOCUS_34460 gene tauD 1757 2518 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_34460 2521 2727 gene locus_tag LOCUS_34470 2521 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence494 576 734 gene locus_tag LOCUS_34480 576 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 981 847 gene locus_tag LOCUS_34490 981 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 1277 1630 gene locus_tag LOCUS_34500 1277 1630 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 protein_id gnl|my_center|LOCUS_34500 1845 2423 gene locus_tag LOCUS_34510 1845 2423 CDS product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence495 727 458 gene locus_tag LOCUS_34520 gene fliQ 727 458 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 protein_id gnl|my_center|LOCUS_34520 1482 736 gene locus_tag LOCUS_34530 gene fliP 1482 736 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC5 protein_id gnl|my_center|LOCUS_34530 1763 1479 gene locus_tag LOCUS_34540 1763 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 1729 1872 gene locus_tag LOCUS_34550 1729 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2247 1864 gene locus_tag LOCUS_34560 gene fliN 2247 1864 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC3 protein_id gnl|my_center|LOCUS_34560 >Feature sequence496 1148 309 gene locus_tag LOCUS_34570 gene glpG 1148 309 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_34570 1485 1177 gene locus_tag LOCUS_34580 gene glpE 1485 1177 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J2 protein_id gnl|my_center|LOCUS_34580 2604 1579 gene locus_tag LOCUS_34590 gene tdh 2604 1579 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_34590 2808 2605 gene locus_tag LOCUS_34600 2808 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence497 290 1069 gene locus_tag LOCUS_34610 290 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence498 596 883 gene locus_tag LOCUS_34620 596 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2200 1139 gene locus_tag LOCUS_34630 2200 1139 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867262.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence499 <1 586 gene locus_tag LOCUS_34640 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073109.1:flagellum-specific ATP synthase FliI 638 1084 gene locus_tag LOCUS_34650 gene fliJ 638 1084 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073108.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence500 2376 1099 gene locus_tag LOCUS_34660 gene serS 2376 1099 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KB2 protein_id gnl|my_center|LOCUS_34660 >Feature sequence501 362 1045 gene locus_tag LOCUS_34670 362 1045 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU8 protein_id gnl|my_center|LOCUS_34670 1150 1986 gene locus_tag LOCUS_34680 1150 1986 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071978.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence502 148 1179 gene locus_tag LOCUS_34690 148 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456611.1 protein_id gnl|my_center|LOCUS_34690 2645 1245 gene locus_tag LOCUS_34700 gene asnS 2645 1245 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEZ1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence503 818 270 gene locus_tag LOCUS_34710 818 270 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074024.1 protein_id gnl|my_center|LOCUS_34710 1066 818 gene locus_tag LOCUS_34720 gene acpP 1066 818 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9B5 protein_id gnl|my_center|LOCUS_34720 1332 1075 gene locus_tag LOCUS_34730 1332 1075 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 protein_id gnl|my_center|LOCUS_34730 2122 1316 gene locus_tag LOCUS_34740 2122 1316 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence504 <1 1399 gene locus_tag LOCUS_34750 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109778.1:peptidase S9 1570 2136 gene locus_tag LOCUS_34760 1570 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence505 1109 2038 gene locus_tag LOCUS_34770 gene hemC 1109 2038 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H0 protein_id gnl|my_center|LOCUS_34770 >Feature sequence506 1899 445 gene locus_tag LOCUS_34780 1899 445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073082.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence507 450 247 gene locus_tag LOCUS_34790 450 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 <2700 862 gene locus_tag LOCUS_34800 <2700 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZGZ1:protein TolB >Feature sequence508 874 1116 gene locus_tag LOCUS_34810 874 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence509 1087 761 gene locus_tag LOCUS_34820 1087 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 1888 1115 gene locus_tag LOCUS_34830 1888 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2402 2022 gene locus_tag LOCUS_34840 2402 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700964.1 protein_id gnl|my_center|LOCUS_34840 >Feature sequence510 >Feature sequence511 <1 936 gene locus_tag LOCUS_34850 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073545.1:adenylate cyclase 1955 1149 gene locus_tag LOCUS_34860 gene kvaP 1955 1149 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 protein_id gnl|my_center|LOCUS_34860 2357 2028 gene locus_tag LOCUS_34870 2357 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 protein_id gnl|my_center|LOCUS_34870 >Feature sequence512 501 2423 gene locus_tag LOCUS_34880 gene dnaK 501 2423 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT7 protein_id gnl|my_center|LOCUS_34880 >Feature sequence513 80 1195 gene locus_tag LOCUS_34890 gene ald 80 1195 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_34890 1345 2298 gene locus_tag LOCUS_34900 gene trxB 1345 2298 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER5 protein_id gnl|my_center|LOCUS_34900 >Feature sequence514 46 1200 gene locus_tag LOCUS_34910 gene ybdL 46 1200 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183918.1 protein_id gnl|my_center|LOCUS_34910 1387 1214 gene locus_tag LOCUS_34920 1387 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence515 <1 672 gene locus_tag LOCUS_34930 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S040:transcription termination factor Rho 2540 1263 gene locus_tag LOCUS_34940 gene rlmG 2540 1263 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHW5 protein_id gnl|my_center|LOCUS_34940 >Feature sequence516 1512 4 gene locus_tag LOCUS_34950 gene lysS 1512 4 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI58 protein_id gnl|my_center|LOCUS_34950 <2602 1618 gene locus_tag LOCUS_34960 <2602 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K4PSP3:peptide chain release factor 2 >Feature sequence517 1230 496 gene locus_tag LOCUS_34970 1230 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 1444 1307 gene locus_tag LOCUS_34980 1444 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 2298 1717 gene locus_tag LOCUS_34990 2298 1717 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071342.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence518 1127 321 gene locus_tag LOCUS_35000 1127 321 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939935.1 protein_id gnl|my_center|LOCUS_35000 2004 1168 gene locus_tag LOCUS_35010 2004 1168 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939936.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence519 >Feature sequence520 1486 365 gene locus_tag LOCUS_35020 gene cheB1 1486 365 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD7 protein_id gnl|my_center|LOCUS_35020 <2553 1513 gene locus_tag LOCUS_35030 <2553 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073093.1:chemotaxis protein CheA >Feature sequence521 >Feature sequence522 1670 27 gene locus_tag LOCUS_35040 1670 27 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071701.1 protein_id gnl|my_center|LOCUS_35040 1821 1958 gene locus_tag LOCUS_35050 1821 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence523 498 1 gene locus_tag LOCUS_35060 498 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 707 2176 gene locus_tag LOCUS_35070 gene ubiD 707 2176 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJG1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence524 <1 1861 gene locus_tag LOCUS_35080 <1 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EG15:peptidylprolyl isomerase >Feature sequence525 1264 527 gene locus_tag LOCUS_35090 1264 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1821 1477 gene locus_tag LOCUS_35100 1821 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 2407 1778 gene locus_tag LOCUS_35110 2407 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence526 943 2013 gene locus_tag LOCUS_35120 943 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071615.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence527 >Feature sequence528 1485 58 gene locus_tag LOCUS_35130 1485 58 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_35130 1538 1717 gene locus_tag LOCUS_35140 1538 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence529 <2469 923 gene locus_tag LOCUS_35150 <2469 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070564.1:type II secretion system protein GspE >Feature sequence530 14 340 gene locus_tag LOCUS_35160 14 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 1058 1633 gene locus_tag LOCUS_35170 1058 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 2203 1658 gene locus_tag LOCUS_35180 2203 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence531 48 1460 gene locus_tag LOCUS_35190 gene dnaB 48 1460 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAI5 protein_id gnl|my_center|LOCUS_35190 >Feature sequence532 111 1265 gene locus_tag LOCUS_35200 111 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_35200 1629 1360 gene locus_tag LOCUS_35210 gene grxA 1629 1360 CDS product glutaredoxin, GrxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072684.1 protein_id gnl|my_center|LOCUS_35210 2450 1695 gene locus_tag LOCUS_35220 2450 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence533 121 1515 gene locus_tag LOCUS_35230 gene pabB 121 1515 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072245.1 protein_id gnl|my_center|LOCUS_35230 1551 2141 gene locus_tag LOCUS_35240 gene yeaB 1551 2141 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072244.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence534 1597 17 gene locus_tag LOCUS_35250 1597 17 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 protein_id gnl|my_center|LOCUS_35250 2028 1681 gene locus_tag LOCUS_35260 2028 1681 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883347.1 protein_id gnl|my_center|LOCUS_35260 2345 2022 gene locus_tag LOCUS_35270 2345 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence535 58 1467 gene locus_tag LOCUS_35280 gene trkA 58 1467 CDS product potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070445.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence536 85 1584 gene locus_tag LOCUS_35290 gene TRm27.1 85 1584 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970438.1 protein_id gnl|my_center|LOCUS_35290 1577 2344 gene locus_tag LOCUS_35300 1577 2344 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144054.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence537 382 1842 gene locus_tag LOCUS_35310 gene yfgC 382 1842 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED93 protein_id gnl|my_center|LOCUS_35310 >Feature sequence538 1127 273 gene locus_tag LOCUS_35320 1127 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1214 1537 gene locus_tag LOCUS_35330 1214 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35330 >Feature sequence539 2333 567 gene locus_tag LOCUS_35340 gene sdhA 2333 567 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFP2 protein_id gnl|my_center|LOCUS_35340 >Feature sequence540 829 623 gene locus_tag LOCUS_35350 829 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence541 1958 1668 gene locus_tag LOCUS_35360 gene groS 1958 1668 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX49 protein_id gnl|my_center|LOCUS_35360 >Feature sequence542 >Feature sequence543 <1 2313 gene locus_tag LOCUS_35370 <1 2313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIM0:5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase >Feature sequence544 986 234 gene locus_tag LOCUS_35380 986 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 1607 1095 gene locus_tag LOCUS_35390 1607 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence545 73 157 gene locus_tag LOCUS_t00440 73 157 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 346 1407 gene locus_tag LOCUS_35400 346 1407 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 protein_id gnl|my_center|LOCUS_35400 2256 1588 gene locus_tag LOCUS_35410 gene queE 2256 1588 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE87 protein_id gnl|my_center|LOCUS_35410 >Feature sequence546 1022 279 gene locus_tag LOCUS_35420 1022 279 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_35420 1858 1022 gene locus_tag LOCUS_35430 1858 1022 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_35430 >Feature sequence547 2195 1443 gene locus_tag LOCUS_35440 2195 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence548 47 1060 gene locus_tag LOCUS_35450 gene tsaD 47 1060 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD6 protein_id gnl|my_center|LOCUS_35450 1779 1171 gene locus_tag LOCUS_35460 gene plsY 1779 1171 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59251 protein_id gnl|my_center|LOCUS_35460 >Feature sequence549 625 422 gene locus_tag LOCUS_35470 625 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 708 2075 gene locus_tag LOCUS_35480 708 2075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_35480 >Feature sequence550 <1 1608 gene locus_tag LOCUS_35490 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E9Y7:arginine--tRNA ligase 1629 2216 gene locus_tag LOCUS_35500 gene ftsN 1629 2216 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073825.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence551 2204 1167 gene locus_tag LOCUS_35510 gene queA 2204 1167 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM2 protein_id gnl|my_center|LOCUS_35510 >Feature sequence552 389 90 gene locus_tag LOCUS_35520 389 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35520 >Feature sequence553 >Feature sequence554 416 2254 gene locus_tag LOCUS_35530 416 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence555 >Feature sequence556 534 1712 gene locus_tag LOCUS_35540 534 1712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114347.1 protein_id gnl|my_center|LOCUS_35540 >Feature sequence557 991 458 gene locus_tag LOCUS_35550 991 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 1159 1563 gene locus_tag LOCUS_35560 1159 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957009.1 protein_id gnl|my_center|LOCUS_35560 >Feature sequence558 578 408 gene locus_tag LOCUS_35570 578 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 789 1658 gene locus_tag LOCUS_35580 gene cobA 789 1658 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707178.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence559 <1 685 gene locus_tag LOCUS_35590 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K4PW03:phosphatidylserine decarboxylase proenzyme 725 1600 gene locus_tag LOCUS_35600 725 1600 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence560 535 53 gene locus_tag LOCUS_35610 gene sufE 535 53 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073562.1 protein_id gnl|my_center|LOCUS_35610 1766 552 gene locus_tag LOCUS_35620 gene sufS 1766 552 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV2 protein_id gnl|my_center|LOCUS_35620 >Feature sequence561 >Feature sequence562 1692 826 gene locus_tag LOCUS_35630 1692 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence563 1284 799 gene locus_tag LOCUS_35640 1284 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 <2154 1287 gene locus_tag LOCUS_35650 <2154 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000833420.1:membrane protein >Feature sequence564 >Feature sequence565 1920 949 gene locus_tag LOCUS_35660 gene pomB 1920 949 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence566 >Feature sequence567 424 122 gene locus_tag LOCUS_35670 424 122 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071888.1 protein_id gnl|my_center|LOCUS_35670 1167 421 gene locus_tag LOCUS_35680 1167 421 CDS product branched-chain amino acid efflux pump permease component 1 AzlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_35680 2091 1216 gene locus_tag LOCUS_35690 gene altA 2091 1216 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071890.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence568 599 198 gene locus_tag LOCUS_35700 599 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1162 980 gene locus_tag LOCUS_35710 1162 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 1846 1580 gene locus_tag LOCUS_35720 1846 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence569 412 1956 gene locus_tag LOCUS_35730 412 1956 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070533.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence570 721 11 gene locus_tag LOCUS_35740 gene lolD 721 11 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEV5 protein_id gnl|my_center|LOCUS_35740 2069 837 gene locus_tag LOCUS_35750 gene lolE 2069 837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072269.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence571 <2118 159 gene locus_tag LOCUS_35760 <2118 159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070563.1:type II secretion system protein GspD >Feature sequence572 572 1579 gene locus_tag LOCUS_35770 572 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence573 350 1255 gene locus_tag LOCUS_35780 gene metR 350 1255 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071111.1 protein_id gnl|my_center|LOCUS_35780 <2103 1377 gene locus_tag LOCUS_35790 <2103 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071110.1:histidine kinase >Feature sequence574 >Feature sequence575 696 265 gene locus_tag LOCUS_35800 696 265 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 protein_id gnl|my_center|LOCUS_35800 1434 1003 gene locus_tag LOCUS_35810 1434 1003 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence576 1949 1404 gene locus_tag LOCUS_35820 1949 1404 CDS product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence577 569 249 gene locus_tag LOCUS_35830 569 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 <2086 1417 gene locus_tag LOCUS_35840 <2086 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_308264.1:RhsG core protein with extension >Feature sequence578 134 1414 gene locus_tag LOCUS_35850 134 1414 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072995.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence579 43 246 gene locus_tag LOCUS_35860 gene zapB 43 246 CDS product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX1 protein_id gnl|my_center|LOCUS_35860 497 285 gene locus_tag LOCUS_35870 497 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070699.1 protein_id gnl|my_center|LOCUS_35870 1763 1152 gene locus_tag LOCUS_35880 gene dsbA 1763 1152 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX3 protein_id gnl|my_center|LOCUS_35880 >Feature sequence580 542 1159 gene locus_tag LOCUS_35890 gene lexA 542 1159 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q8 protein_id gnl|my_center|LOCUS_35890 1192 1704 gene locus_tag LOCUS_35900 gene sulA 1192 1704 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q7 protein_id gnl|my_center|LOCUS_35900 >Feature sequence581 >Feature sequence582 546 166 gene locus_tag LOCUS_35910 546 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071844.1 protein_id gnl|my_center|LOCUS_35910 <2067 612 gene locus_tag LOCUS_35920 <2067 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071845.1:transcriptional regulator >Feature sequence583 1851 274 gene locus_tag LOCUS_35930 1851 274 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence584 <1 526 gene locus_tag LOCUS_35940 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGR4:tRNA sulfurtransferase 980 753 gene locus_tag LOCUS_35950 980 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence585 >Feature sequence586 655 912 gene locus_tag LOCUS_35960 655 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 899 1039 gene locus_tag LOCUS_35970 899 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence587 <1 1030 gene locus_tag LOCUS_35980 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000833420.1:membrane protein 1031 1567 gene locus_tag LOCUS_35990 1031 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence588 >Feature sequence589 1438 713 gene locus_tag LOCUS_36000 gene ompR 1438 713 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_36000 >Feature sequence590 <1 1605 gene locus_tag LOCUS_36010 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072981.1:diguanylate cyclase >Feature sequence591 1851 865 gene locus_tag LOCUS_36020 gene fliH 1851 865 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073110.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence592 1693 1581 gene locus_tag LOCUS_r00020 1693 1581 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence593 <1 1102 gene locus_tag LOCUS_36030 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E8A9:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 1222 1848 gene locus_tag LOCUS_36040 gene rsmG 1222 1848 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B0 protein_id gnl|my_center|LOCUS_36040 >Feature sequence594 >Feature sequence595 1675 698 gene locus_tag LOCUS_36050 1675 698 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence596 477 1550 gene locus_tag LOCUS_36060 477 1550 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_36060 >Feature sequence597 >Feature sequence598 >Feature sequence599 1785 1707 gene locus_tag LOCUS_t00450 1785 1707 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence600 >Feature sequence601 <1 1557 gene locus_tag LOCUS_36070 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBI2:putative lipid II flippase MurJ >Feature sequence602 1949 819 gene locus_tag LOCUS_36080 1949 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence603 <1 757 gene locus_tag LOCUS_36090 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECV8:segregation and condensation protein A 758 1390 gene locus_tag LOCUS_36100 gene scpB 758 1390 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ6 protein_id gnl|my_center|LOCUS_36100 >Feature sequence604 598 840 gene locus_tag LOCUS_36110 598 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 <1936 1070 gene locus_tag LOCUS_36120 <1936 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHC8:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence605 5 220 gene locus_tag LOCUS_36130 5 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36130 235 402 gene locus_tag LOCUS_36140 235 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 437 631 gene locus_tag LOCUS_36150 437 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36150 1110 1820 gene locus_tag LOCUS_36160 1110 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence606 <1929 1092 gene locus_tag LOCUS_36170 <1929 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAQ9:ribose-phosphate pyrophosphokinase >Feature sequence607 <1924 1295 gene locus_tag LOCUS_36180 <1924 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EDX2:methionine--tRNA ligase >Feature sequence608 228 1646 gene locus_tag LOCUS_36190 gene cysN 228 1646 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG10 protein_id gnl|my_center|LOCUS_36190 >Feature sequence609 262 798 gene locus_tag LOCUS_36200 gene pal 262 798 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072686.1 protein_id gnl|my_center|LOCUS_36200 818 1546 gene locus_tag LOCUS_36210 gene ybgF 818 1546 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_36210 1731 1806 gene locus_tag LOCUS_t00460 1731 1806 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence610 300 1733 gene locus_tag LOCUS_36220 gene flrA 300 1733 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence611 469 1512 gene locus_tag LOCUS_36230 469 1512 CDS product putative family 20 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HI37 protein_id gnl|my_center|LOCUS_36230 >Feature sequence612 697 242 gene locus_tag LOCUS_36240 697 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence613 3 329 gene locus_tag LOCUS_36250 3 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence614 2 334 gene locus_tag LOCUS_36260 2 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 1451 480 gene locus_tag LOCUS_36270 gene ispB 1451 480 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_36270 >Feature sequence615 1141 374 gene locus_tag LOCUS_36280 1141 374 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 protein_id gnl|my_center|LOCUS_36280 >Feature sequence616 >Feature sequence617 294 43 gene locus_tag LOCUS_36290 294 43 CDS product DUF2999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071035.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence618 418 948 gene locus_tag LOCUS_36300 418 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 949 1806 gene locus_tag LOCUS_36310 gene ispE 949 1806 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR0 protein_id gnl|my_center|LOCUS_36310 >Feature sequence619 960 436 gene locus_tag LOCUS_36320 960 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 1718 954 gene locus_tag LOCUS_36330 1718 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence620 110 478 gene locus_tag LOCUS_36340 110 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1680 721 gene locus_tag LOCUS_36350 gene intI 1680 721 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence621 >Feature sequence622 1188 256 gene locus_tag LOCUS_36360 gene rseB 1188 256 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071553.1 protein_id gnl|my_center|LOCUS_36360 1831 1220 gene locus_tag LOCUS_36370 gene rseA 1831 1220 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH86 protein_id gnl|my_center|LOCUS_36370 >Feature sequence623 <1835 566 gene locus_tag LOCUS_36380 <1835 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EKJ4:histidine ammonia-lyase >Feature sequence624 708 58 gene locus_tag LOCUS_36390 708 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 1208 705 gene locus_tag LOCUS_36400 1208 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 1666 1205 gene locus_tag LOCUS_36410 1666 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence625 440 1831 gene locus_tag LOCUS_36420 440 1831 CDS product NadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence626 708 58 gene locus_tag LOCUS_36430 708 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1208 705 gene locus_tag LOCUS_36440 1208 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1663 1205 gene locus_tag LOCUS_36450 1663 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence627 >Feature sequence628 238 789 gene locus_tag LOCUS_36460 238 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence629 1548 247 gene locus_tag LOCUS_36470 1548 247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 protein_id gnl|my_center|LOCUS_36470 >Feature sequence630 1073 795 gene locus_tag LOCUS_36480 1073 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 <1802 1227 gene locus_tag LOCUS_36490 <1802 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768689.1:adeC/adeK/oprM family multidrug efflux complex outer membrane factor >Feature sequence631 >Feature sequence632 <1 1324 gene locus_tag LOCUS_36500 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012602734.1:replication protein A 1505 1717 gene locus_tag LOCUS_36510 1505 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence633 1092 358 gene locus_tag LOCUS_36520 1092 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence634 56 895 gene locus_tag LOCUS_36530 gene dam 56 895 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK17 protein_id gnl|my_center|LOCUS_36530 1498 1121 gene locus_tag LOCUS_36540 1498 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070663.1 protein_id gnl|my_center|LOCUS_36540 >Feature sequence635 >Feature sequence636 >Feature sequence637 >Feature sequence638 681 67 gene locus_tag LOCUS_36550 681 67 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_36550 781 1263 gene locus_tag LOCUS_36560 781 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence639 <1772 1158 gene locus_tag LOCUS_36570 <1772 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480358.1:peptidase M11 >Feature sequence640 967 704 gene locus_tag LOCUS_36580 967 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 <1755 1102 gene locus_tag LOCUS_36590 <1755 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070546.1:oligopeptidase B >Feature sequence641 1629 592 gene locus_tag LOCUS_36600 gene zipA 1629 592 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED69 protein_id gnl|my_center|LOCUS_36600 >Feature sequence642 68 388 gene locus_tag LOCUS_36610 68 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence643 1271 288 gene locus_tag LOCUS_36620 1271 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence644 1136 117 gene locus_tag LOCUS_36630 gene gpsA 1136 117 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKN9 protein_id gnl|my_center|LOCUS_36630 >Feature sequence645 349 765 gene locus_tag LOCUS_36640 349 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 780 1175 gene locus_tag LOCUS_36650 780 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 1483 1334 gene locus_tag LOCUS_36660 1483 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36660 >Feature sequence646 1622 243 gene locus_tag LOCUS_36670 gene cysS 1622 243 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG22 protein_id gnl|my_center|LOCUS_36670 >Feature sequence647 >Feature sequence648 1124 1345 gene locus_tag LOCUS_36680 1124 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1589 1320 gene locus_tag LOCUS_36690 1589 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420208.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence649 1620 340 gene locus_tag LOCUS_36700 gene aroA 1620 340 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH8 protein_id gnl|my_center|LOCUS_36700 >Feature sequence650 1578 310 gene locus_tag LOCUS_36710 1578 310 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_36710 >Feature sequence651 1296 454 gene locus_tag LOCUS_36720 gene prmC 1296 454 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 protein_id gnl|my_center|LOCUS_36720 >Feature sequence652 926 66 gene locus_tag LOCUS_36730 gene folD 926 66 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG21 protein_id gnl|my_center|LOCUS_36730 1340 1416 gene locus_tag LOCUS_t00470 1340 1416 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1606 1682 gene locus_tag LOCUS_t00480 1606 1682 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence653 1537 824 gene locus_tag LOCUS_36740 1537 824 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074241.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence654 <1684 767 gene locus_tag LOCUS_36750 <1684 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705601.1:RND transporter NodT >Feature sequence655 >Feature sequence656 >Feature sequence657 >Feature sequence658 128 1276 gene locus_tag LOCUS_36760 gene attH 128 1276 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071145.1 protein_id gnl|my_center|LOCUS_36760 >Feature sequence659 1214 984 gene locus_tag LOCUS_36770 1214 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence660 1372 209 gene locus_tag LOCUS_36780 1372 209 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945903.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36780 >Feature sequence661 1366 875 gene locus_tag LOCUS_36790 1366 875 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072147.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence662 66 141 gene locus_tag LOCUS_t00490 66 141 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence663 321 1028 gene locus_tag LOCUS_36800 321 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence664 >Feature sequence665 <1 1291 gene locus_tag LOCUS_36810 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074281.1:multidrug efflux RND transporter permease subunit >Feature sequence666 1263 169 gene locus_tag LOCUS_36820 1263 169 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_36820 >Feature sequence667 <1605 385 gene locus_tag LOCUS_36830 <1605 385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073369.1:peptidase M28 >Feature sequence668 >Feature sequence669 83 1237 gene locus_tag LOCUS_36840 83 1237 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence670 >Feature sequence671 1208 459 gene locus_tag LOCUS_36850 1208 459 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 protein_id gnl|my_center|LOCUS_36850 >Feature sequence672 <1 1234 gene locus_tag LOCUS_36860 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070657.1:secretin >Feature sequence673 <1 1146 gene locus_tag LOCUS_36870 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PDA2:homogentisate 1,2-dioxygenase >Feature sequence674 802 1341 gene locus_tag LOCUS_36880 802 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence675 >Feature sequence676 >Feature sequence677 >Feature sequence678 1482 379 gene locus_tag LOCUS_36890 1482 379 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097393.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence679 <1 1180 gene locus_tag LOCUS_36900 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071873.1:methyltransferase >Feature sequence680 76 897 gene locus_tag LOCUS_36910 76 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence681 <1 847 gene locus_tag LOCUS_36920 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000833420.1:membrane protein >Feature sequence682 671 192 gene locus_tag LOCUS_36930 gene ybaK 671 192 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3V9 protein_id gnl|my_center|LOCUS_36930 1201 674 gene locus_tag LOCUS_36940 1201 674 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence683 <1 1129 gene locus_tag LOCUS_36950 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein 1219 1076 gene locus_tag LOCUS_36960 1219 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 >Feature sequence684 152 586 gene locus_tag LOCUS_36970 gene ygbA 152 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263753.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence685 38 1225 gene locus_tag LOCUS_36980 gene bamB 38 1225 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC35 protein_id gnl|my_center|LOCUS_36980 >Feature sequence686 170 1009 gene locus_tag LOCUS_36990 170 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence687 1076 375 gene locus_tag LOCUS_37000 1076 375 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence688 >Feature sequence689 >Feature sequence690 17 598 gene locus_tag LOCUS_37010 17 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705550.1 protein_id gnl|my_center|LOCUS_37010 >Feature sequence691 <1497 908 gene locus_tag LOCUS_37020 <1497 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479898.1:multidrug resistance protein >Feature sequence692 >Feature sequence693 557 1252 gene locus_tag LOCUS_37030 557 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence694 974 234 gene locus_tag LOCUS_37040 974 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 >Feature sequence695 613 137 gene locus_tag LOCUS_37050 613 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence696 >Feature sequence697 <1 1148 gene locus_tag LOCUS_37060 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHT6:chaperone protein DnaJ >Feature sequence698 563 384 gene locus_tag LOCUS_37070 563 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence699 554 264 gene locus_tag LOCUS_37080 554 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 >Feature sequence700 1 978 gene locus_tag LOCUS_37090 1 978 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence701 384 100 gene locus_tag LOCUS_37100 384 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 531 770 gene locus_tag LOCUS_37110 531 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence702 >Feature sequence703 304 732 gene locus_tag LOCUS_37120 gene rplK 304 732 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK78 protein_id gnl|my_center|LOCUS_37120 >Feature sequence704 >Feature sequence705 <1398 846 gene locus_tag LOCUS_37130 <1398 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECC7:flagellar biosynthetic protein FliR >Feature sequence706 329 748 gene locus_tag LOCUS_37140 329 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence707 >Feature sequence708 >Feature sequence709 137 1270 gene locus_tag LOCUS_37150 137 1270 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence710 1303 1061 gene locus_tag LOCUS_37160 1303 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 >Feature sequence711 1300 737 gene locus_tag LOCUS_37170 gene xpt 1300 737 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZL5 protein_id gnl|my_center|LOCUS_37170 >Feature sequence712 >Feature sequence713 755 144 gene locus_tag LOCUS_37180 755 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37180 1262 786 gene locus_tag LOCUS_37190 1262 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073653.1 protein_id gnl|my_center|LOCUS_37190 >Feature sequence714 394 651 gene locus_tag LOCUS_37200 394 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence715 300 758 gene locus_tag LOCUS_37210 gene ysnE 300 758 CDS product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 protein_id gnl|my_center|LOCUS_37210 871 1131 gene locus_tag LOCUS_37220 871 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence716 2 661 gene locus_tag LOCUS_37230 2 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 639 1052 gene locus_tag LOCUS_37240 639 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 1350 1231 gene locus_tag LOCUS_37250 1350 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence717 >Feature sequence718 >Feature sequence719 592 1173 gene locus_tag LOCUS_37260 592 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 >Feature sequence720 1274 393 gene locus_tag LOCUS_37270 gene prmA 1274 393 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_37270 >Feature sequence721 >Feature sequence722 283 77 gene locus_tag LOCUS_37280 283 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 420 617 gene locus_tag LOCUS_37290 420 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 844 768 gene locus_tag LOCUS_t00500 844 768 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence723 >Feature sequence724 532 230 gene locus_tag LOCUS_37300 532 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence725 422 781 gene locus_tag LOCUS_37310 422 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence726 196 492 gene locus_tag LOCUS_37320 196 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 680 1114 gene locus_tag LOCUS_37330 680 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence727 >Feature sequence728 <1315 422 gene locus_tag LOCUS_37340 <1315 422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120158.1:glycogen debranching enzyme >Feature sequence729 1130 258 gene locus_tag LOCUS_37350 gene sseA 1130 258 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071483.1 protein_id gnl|my_center|LOCUS_37350 >Feature sequence730 201 581 gene locus_tag LOCUS_37360 201 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 818 952 gene locus_tag LOCUS_37370 818 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence731 >Feature sequence732 >Feature sequence733 <1292 287 gene locus_tag LOCUS_37380 <1292 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073162.1:acriflavin resistance protein >Feature sequence734 188 388 gene locus_tag LOCUS_37390 188 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 912 460 gene locus_tag LOCUS_37400 912 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence735 <1 1045 gene locus_tag LOCUS_37410 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071942.1:porin >Feature sequence736 >Feature sequence737 633 202 gene locus_tag LOCUS_37420 633 202 CDS product riboflavin-specific deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_37420 1000 752 gene locus_tag LOCUS_37430 1000 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 >Feature sequence738 429 1199 gene locus_tag LOCUS_37440 429 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence739 >Feature sequence740 <1 1078 gene locus_tag LOCUS_37450 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIQ8:aminomethyltransferase >Feature sequence741 >Feature sequence742 >Feature sequence743 461 757 gene locus_tag LOCUS_37460 gene hlyU 461 757 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006084975.1 protein_id gnl|my_center|LOCUS_37460 1162 896 gene locus_tag LOCUS_37470 gene rpsT 1162 896 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH9 protein_id gnl|my_center|LOCUS_37470 >Feature sequence744 909 700 gene locus_tag LOCUS_37480 909 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence745 130 924 gene locus_tag LOCUS_37490 130 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268011.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence746 249 1112 gene locus_tag LOCUS_37500 249 1112 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence747 <1245 349 gene locus_tag LOCUS_37510 <1245 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBH1:glucose-6-phosphate isomerase >Feature sequence748 753 292 gene locus_tag LOCUS_37520 753 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073254.1 protein_id gnl|my_center|LOCUS_37520 >Feature sequence749 >Feature sequence750 26 442 gene locus_tag LOCUS_37530 gene pilE 26 442 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947631.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence751 >Feature sequence752 1161 316 gene locus_tag LOCUS_37540 gene rsmI 1161 316 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK05 protein_id gnl|my_center|LOCUS_37540 >Feature sequence753 >Feature sequence754 <1 1128 gene locus_tag LOCUS_37550 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EKR0:ribosomal RNA small subunit methyltransferase B >Feature sequence755 100 378 gene locus_tag LOCUS_37560 100 378 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX6 protein_id gnl|my_center|LOCUS_37560 893 968 gene locus_tag LOCUS_t00510 893 968 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence756 >Feature sequence757 734 96 gene locus_tag LOCUS_37570 734 96 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097397.1 protein_id gnl|my_center|LOCUS_37570 >Feature sequence758 422 541 gene locus_tag LOCUS_37580 422 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence759 683 537 gene locus_tag LOCUS_37590 683 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 1031 843 gene locus_tag LOCUS_37600 1031 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence760 1007 879 gene locus_tag LOCUS_37610 1007 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence761 >Feature sequence762 >Feature sequence763 >Feature sequence764 <1189 108 gene locus_tag LOCUS_37620 <1189 108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463769.1:nitrite reductase large subunit >Feature sequence765 >Feature sequence766 >Feature sequence767 >Feature sequence768 420 166 gene locus_tag LOCUS_37630 420 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1135 602 gene locus_tag LOCUS_37640 1135 602 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481267.1 protein_id gnl|my_center|LOCUS_37640 >Feature sequence769 >Feature sequence770 923 276 gene locus_tag LOCUS_37650 923 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence771 <1 1145 gene locus_tag LOCUS_37660 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072414.1:serine rich protein >Feature sequence772 224 48 gene locus_tag LOCUS_37670 224 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 587 408 gene locus_tag LOCUS_37680 587 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence773 >Feature sequence774 61 136 gene locus_tag LOCUS_t00520 61 136 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 176 251 gene locus_tag LOCUS_t00530 176 251 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <1144 606 gene locus_tag LOCUS_37690 <1144 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073024.1:multidrug ABC transporter ATP-binding protein >Feature sequence775 144 926 gene locus_tag LOCUS_37700 144 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 >Feature sequence776 <1 828 gene locus_tag LOCUS_37710 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072757.1:RNA helicase >Feature sequence777 75 1 gene locus_tag LOCUS_t00540 75 1 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <1138 547 gene locus_tag LOCUS_37720 <1138 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0WJ27:RNA polymerase sigma factor RpoD >Feature sequence778 675 322 gene locus_tag LOCUS_37730 675 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070917.1 protein_id gnl|my_center|LOCUS_37730 >Feature sequence779 443 613 gene locus_tag LOCUS_37740 443 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence780 >Feature sequence781 <1117 10 gene locus_tag LOCUS_37750 <1117 10 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986666.1:2-enoate reductase >Feature sequence782 >Feature sequence783 <1116 51 gene locus_tag LOCUS_37760 <1116 51 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EI96:ATP-dependent RNA helicase SrmB >Feature sequence784 >Feature sequence785 682 515 gene locus_tag LOCUS_37770 682 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence786 <1111 319 gene locus_tag LOCUS_37780 <1111 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070778.1:nicotinate-nucleotide diphosphorylase >Feature sequence787 <1109 195 gene locus_tag LOCUS_37790 <1109 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E831:sulfate adenylyltransferase subunit 2 >Feature sequence788 <1 523 gene locus_tag LOCUS_37800 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHM0:phosphoglucosamine mutase >Feature sequence789 654 893 gene locus_tag LOCUS_37810 654 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence790 44 979 gene locus_tag LOCUS_37820 gene ribF 44 979 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI3 protein_id gnl|my_center|LOCUS_37820 >Feature sequence791 >Feature sequence792 >Feature sequence793 129 371 gene locus_tag LOCUS_37830 129 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence794 >Feature sequence795 89 997 gene locus_tag LOCUS_37840 gene gpO 89 997 CDS product phage capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815665.1 protein_id gnl|my_center|LOCUS_37840 >Feature sequence796 176 265 gene locus_tag LOCUS_t00550 176 265 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence797 <1 679 gene locus_tag LOCUS_37850 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268197.1:hemolysin-type calcium-binding protein >Feature sequence798 >Feature sequence799 >Feature sequence800 >Feature sequence801 836 510 gene locus_tag LOCUS_37860 gene trxA 836 510 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ6 protein_id gnl|my_center|LOCUS_37860 >Feature sequence802 84 659 gene locus_tag LOCUS_37870 84 659 CDS product SH3 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073548.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence803 <1077 316 gene locus_tag LOCUS_37880 <1077 316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071942.1:porin >Feature sequence804 >Feature sequence805 >Feature sequence806 286 125 gene locus_tag LOCUS_37890 286 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence807 <1 879 gene locus_tag LOCUS_37900 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFW4:ribosomal RNA large subunit methyltransferase K/L >Feature sequence808 735 322 gene locus_tag LOCUS_37910 735 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 >Feature sequence809 >Feature sequence810 298 516 gene locus_tag LOCUS_37920 298 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 >Feature sequence811 873 73 gene locus_tag LOCUS_37930 873 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence812 >Feature sequence813 >Feature sequence814 >Feature sequence815 506 784 gene locus_tag LOCUS_37940 506 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence816 <1054 159 gene locus_tag LOCUS_37950 <1054 159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071997.1:transposase >Feature sequence817 >Feature sequence818 63 590 gene locus_tag LOCUS_37960 63 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23205 protein_id gnl|my_center|LOCUS_37960 >Feature sequence819 >Feature sequence820 921 13 gene locus_tag LOCUS_37970 921 13 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973719.1 protein_id gnl|my_center|LOCUS_37970 >Feature sequence821 68 1039 gene locus_tag LOCUS_37980 68 1039 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence822 >Feature sequence823 >Feature sequence824 <1039 266 gene locus_tag LOCUS_37990 <1039 266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073465.1:TonB1 energy transduction system for heme uptake energy transducer component TonB >Feature sequence825 >Feature sequence826 366 773 gene locus_tag LOCUS_38000 366 773 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073001.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence827 >Feature sequence828 >Feature sequence829 139 765 gene locus_tag LOCUS_38010 139 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence830 <1 822 gene locus_tag LOCUS_38020 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071997.1:transposase >Feature sequence831 <1031 170 gene locus_tag LOCUS_38030 <1031 170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071997.1:transposase >Feature sequence832 143 577 gene locus_tag LOCUS_38040 143 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence833 >Feature sequence834 >Feature sequence835 955 551 gene locus_tag LOCUS_38050 955 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence836 1018 149 gene locus_tag LOCUS_38060 1018 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence837 >Feature sequence838 <1 604 gene locus_tag LOCUS_38070 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483443.1:dimethylsulfoxide reductase, chain B >Feature sequence839 419 559 gene locus_tag LOCUS_38080 419 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence840 358 74 gene locus_tag LOCUS_38090 358 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 282 455 gene locus_tag LOCUS_38100 282 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence841 936 598 gene locus_tag LOCUS_38110 936 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence842 455 258 gene locus_tag LOCUS_38120 gene iscX 455 258 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072283.1 protein_id gnl|my_center|LOCUS_38120 929 591 gene locus_tag LOCUS_38130 gene fdx 929 591 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072281.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence843 906 13 gene locus_tag LOCUS_38140 906 13 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072943.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence844 529 407 gene locus_tag LOCUS_38150 529 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 >Feature sequence845 >Feature sequence846 12 350 gene locus_tag LOCUS_38160 12 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 456 908 gene locus_tag LOCUS_38170 456 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 >Feature sequence847 147 740 gene locus_tag LOCUS_38180 147 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180