>Feature sequence01 <1 534 gene locus_tag LOCUS_00010 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211882.1:iron-siderophore ABC transporter substrate-binding protein 531 1580 gene locus_tag LOCUS_00020 531 1580 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211881.1 protein_id gnl|my_center|LOCUS_00020 1577 2638 gene locus_tag LOCUS_00030 1577 2638 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211880.1 protein_id gnl|my_center|LOCUS_00030 2635 3510 gene locus_tag LOCUS_00040 2635 3510 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013338.1 protein_id gnl|my_center|LOCUS_00040 3501 4328 gene locus_tag LOCUS_00050 gene putB 3501 4328 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072937.1 protein_id gnl|my_center|LOCUS_00050 4947 5171 gene locus_tag LOCUS_00060 4947 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073826.1 protein_id gnl|my_center|LOCUS_00060 6091 5165 gene locus_tag LOCUS_00070 6091 5165 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 protein_id gnl|my_center|LOCUS_00070 7150 6119 gene locus_tag LOCUS_00080 gene tqsA 7150 6119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_00080 7266 7634 gene locus_tag LOCUS_00090 gene folX 7266 7634 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_00090 7681 8580 gene locus_tag LOCUS_00100 gene yfcH 7681 8580 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 protein_id gnl|my_center|LOCUS_00100 11499 8662 gene locus_tag LOCUS_00110 gene exeS 11499 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071959.1 protein_id gnl|my_center|LOCUS_00110 12272 11754 gene locus_tag LOCUS_00120 12272 11754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706558.1 protein_id gnl|my_center|LOCUS_00120 14485 12272 gene locus_tag LOCUS_00130 14485 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15965 14718 gene locus_tag LOCUS_00140 15965 14718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_00140 17182 15962 gene locus_tag LOCUS_00150 17182 15962 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087405.1 protein_id gnl|my_center|LOCUS_00150 18342 17179 gene locus_tag LOCUS_00160 18342 17179 CDS product macrolide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 protein_id gnl|my_center|LOCUS_00160 19405 18329 gene locus_tag LOCUS_00170 19405 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20039 19395 gene locus_tag LOCUS_00180 20039 19395 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_00180 20755 20348 gene locus_tag LOCUS_00190 20755 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21212 20808 gene locus_tag LOCUS_00200 21212 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072766.1 protein_id gnl|my_center|LOCUS_00200 21723 21268 gene locus_tag LOCUS_00210 21723 21268 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072767.1 protein_id gnl|my_center|LOCUS_00210 22382 21768 gene locus_tag LOCUS_00220 22382 21768 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072768.1 protein_id gnl|my_center|LOCUS_00220 23372 22749 gene locus_tag LOCUS_00230 23372 22749 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_00230 23712 24320 gene locus_tag LOCUS_00240 23712 24320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24333 25070 gene locus_tag LOCUS_00250 24333 25070 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_00250 25686 25138 gene locus_tag LOCUS_00260 gene ydjA 25686 25138 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072654.1 protein_id gnl|my_center|LOCUS_00260 26398 25787 gene locus_tag LOCUS_00270 26398 25787 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_00270 27457 26612 gene locus_tag LOCUS_00280 27457 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072656.1 protein_id gnl|my_center|LOCUS_00280 28592 27510 gene locus_tag LOCUS_00290 gene thiK 28592 27510 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072657.1 protein_id gnl|my_center|LOCUS_00290 29239 28589 gene locus_tag LOCUS_00300 gene pnuT 29239 28589 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_00300 29503 29243 gene locus_tag LOCUS_00310 gene ykoF 29503 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_00310 31723 29567 gene locus_tag LOCUS_00320 31723 29567 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_00320 32039 32251 gene locus_tag LOCUS_00330 gene mopI 32039 32251 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 protein_id gnl|my_center|LOCUS_00330 32289 32963 gene locus_tag LOCUS_00340 gene ung 32289 32963 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC4 protein_id gnl|my_center|LOCUS_00340 34946 33087 gene locus_tag LOCUS_00350 gene ppiD 34946 33087 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG15 protein_id gnl|my_center|LOCUS_00350 35428 35156 gene locus_tag LOCUS_00360 gene hupB 35428 35156 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_00360 38043 35686 gene locus_tag LOCUS_00370 gene lon 38043 35686 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG17 protein_id gnl|my_center|LOCUS_00370 39453 38173 gene locus_tag LOCUS_00380 gene clpX 39453 38173 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG18 protein_id gnl|my_center|LOCUS_00380 40153 39542 gene locus_tag LOCUS_00390 gene clpP 40153 39542 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG19 protein_id gnl|my_center|LOCUS_00390 41547 40243 gene locus_tag LOCUS_00400 gene tig 41547 40243 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG20 protein_id gnl|my_center|LOCUS_00400 41871 41796 gene locus_tag LOCUS_t00010 41871 41796 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 41957 41881 gene locus_tag LOCUS_t00020 41957 41881 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42101 42025 gene locus_tag LOCUS_t00030 42101 42025 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42338 43192 gene locus_tag LOCUS_00410 gene folD 42338 43192 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG21 protein_id gnl|my_center|LOCUS_00410 43668 43279 gene locus_tag LOCUS_00420 43668 43279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072664.1 protein_id gnl|my_center|LOCUS_00420 44138 43686 gene locus_tag LOCUS_00430 44138 43686 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_00430 44635 44135 gene locus_tag LOCUS_00440 44635 44135 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072666.1 protein_id gnl|my_center|LOCUS_00440 44988 44632 gene locus_tag LOCUS_00450 gene hinT 44988 44632 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072667.1 protein_id gnl|my_center|LOCUS_00450 45230 46984 gene locus_tag LOCUS_00460 45230 46984 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 protein_id gnl|my_center|LOCUS_00460 47625 46981 gene locus_tag LOCUS_00470 47625 46981 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072669.1 protein_id gnl|my_center|LOCUS_00470 47810 48550 gene locus_tag LOCUS_00480 47810 48550 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_00480 48992 48645 gene locus_tag LOCUS_00490 gene cctA 48992 48645 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 protein_id gnl|my_center|LOCUS_00490 50162 49296 gene locus_tag LOCUS_00500 gene htpX 50162 49296 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDL5 protein_id gnl|my_center|LOCUS_00500 50454 51164 gene locus_tag LOCUS_00510 gene pepE 50454 51164 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDL3 protein_id gnl|my_center|LOCUS_00510 51903 51211 gene locus_tag LOCUS_00520 gene bioD 51903 51211 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK9 protein_id gnl|my_center|LOCUS_00520 52729 51938 gene locus_tag LOCUS_00530 gene bioC 52729 51938 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK8 protein_id gnl|my_center|LOCUS_00530 53724 52726 gene locus_tag LOCUS_00540 gene bioF 53724 52726 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072678.1 protein_id gnl|my_center|LOCUS_00540 54937 53873 gene locus_tag LOCUS_00550 gene bioB 54937 53873 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK6 protein_id gnl|my_center|LOCUS_00550 55112 56428 gene locus_tag LOCUS_00560 gene bioA 55112 56428 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072680.1 protein_id gnl|my_center|LOCUS_00560 58540 56540 gene locus_tag LOCUS_00570 58540 56540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59489 58926 gene locus_tag LOCUS_00580 59489 58926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072037.1 protein_id gnl|my_center|LOCUS_00580 60223 59489 gene locus_tag LOCUS_00590 gene cobB 60223 59489 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN2 protein_id gnl|my_center|LOCUS_00590 60484 60915 gene locus_tag LOCUS_00600 gene fur 60484 60915 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072035.1 protein_id gnl|my_center|LOCUS_00600 61251 60970 gene locus_tag LOCUS_00610 61251 60970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 61757 61344 gene locus_tag LOCUS_00620 gene rnk 61757 61344 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_00620 63143 62271 gene locus_tag LOCUS_00630 gene sucD 63143 62271 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN7 protein_id gnl|my_center|LOCUS_00630 64309 63143 gene locus_tag LOCUS_00640 gene sucC 64309 63143 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN8 protein_id gnl|my_center|LOCUS_00640 65584 64388 gene locus_tag LOCUS_00650 gene sucB 65584 64388 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN9 protein_id gnl|my_center|LOCUS_00650 68437 65615 gene locus_tag LOCUS_00660 gene sucA 68437 65615 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072030.1 protein_id gnl|my_center|LOCUS_00660 69338 68631 gene locus_tag LOCUS_00670 gene sdhB 69338 68631 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFP1 protein_id gnl|my_center|LOCUS_00670 71117 69351 gene locus_tag LOCUS_00680 gene sdhA 71117 69351 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFP2 protein_id gnl|my_center|LOCUS_00680 71465 71118 gene locus_tag LOCUS_00690 gene sdhD 71465 71118 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSF7 protein_id gnl|my_center|LOCUS_00690 71854 71459 gene locus_tag LOCUS_00700 gene sdhC 71854 71459 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072026.1 protein_id gnl|my_center|LOCUS_00700 72267 73553 gene locus_tag LOCUS_00710 gene gltA 72267 73553 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFP4 protein_id gnl|my_center|LOCUS_00710 74121 75227 gene locus_tag LOCUS_00720 74121 75227 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_00720 75249 78497 gene locus_tag LOCUS_00730 75249 78497 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_00730 78494 81565 gene locus_tag LOCUS_00740 78494 81565 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072022.1 protein_id gnl|my_center|LOCUS_00740 81676 82560 gene locus_tag LOCUS_00750 81676 82560 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_00750 83326 82601 gene locus_tag LOCUS_00760 83326 82601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44162 protein_id gnl|my_center|LOCUS_00760 83784 83605 gene locus_tag LOCUS_00770 83784 83605 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDF2 protein_id gnl|my_center|LOCUS_00770 84802 83789 gene locus_tag LOCUS_00780 gene lpxK 84802 83789 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDF1 protein_id gnl|my_center|LOCUS_00780 86602 84803 gene locus_tag LOCUS_00790 gene msbA 86602 84803 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDF0 protein_id gnl|my_center|LOCUS_00790 88624 86636 gene locus_tag LOCUS_00800 88624 86636 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706584.1 protein_id gnl|my_center|LOCUS_00800 89092 89571 gene locus_tag LOCUS_00810 89092 89571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_00810 90997 89738 gene locus_tag LOCUS_00820 gene lolC 90997 89738 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072271.1 protein_id gnl|my_center|LOCUS_00820 91689 90994 gene locus_tag LOCUS_00830 gene lolD 91689 90994 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEV5 protein_id gnl|my_center|LOCUS_00830 92935 91703 gene locus_tag LOCUS_00840 gene lolE 92935 91703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072269.1 protein_id gnl|my_center|LOCUS_00840 93032 93628 gene locus_tag LOCUS_00850 93032 93628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072268.1 protein_id gnl|my_center|LOCUS_00850 93682 97146 gene locus_tag LOCUS_00860 gene mfd 93682 97146 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEV8 protein_id gnl|my_center|LOCUS_00860 97146 98264 gene locus_tag LOCUS_00870 97146 98264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072266.1 protein_id gnl|my_center|LOCUS_00870 98537 98265 gene locus_tag LOCUS_00880 gene acyP 98537 98265 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEW0 protein_id gnl|my_center|LOCUS_00880 99400 98840 gene locus_tag LOCUS_00890 99400 98840 CDS product UPF0227 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59273 protein_id gnl|my_center|LOCUS_00890 100527 99484 gene locus_tag LOCUS_00900 gene nagZ 100527 99484 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEW2 protein_id gnl|my_center|LOCUS_00900 100799 102175 gene locus_tag LOCUS_00910 gene sdaA 100799 102175 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072262.1 protein_id gnl|my_center|LOCUS_00910 103265 102291 gene locus_tag LOCUS_00920 gene cysB 103265 102291 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072595.1 protein_id gnl|my_center|LOCUS_00920 103492 104271 gene locus_tag LOCUS_00930 103492 104271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072596.1 protein_id gnl|my_center|LOCUS_00930 107130 104488 gene locus_tag LOCUS_00940 gene topA 107130 104488 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDN8 protein_id gnl|my_center|LOCUS_00940 107466 108800 gene locus_tag LOCUS_00950 gene astB 107466 108800 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDN7 protein_id gnl|my_center|LOCUS_00950 111398 108945 gene locus_tag LOCUS_00960 111398 108945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 protein_id gnl|my_center|LOCUS_00960 111619 112971 gene locus_tag LOCUS_00970 gene gltP 111619 112971 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_00970 114413 113109 gene locus_tag LOCUS_00980 gene gsk 114413 113109 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072104.1 protein_id gnl|my_center|LOCUS_00980 115567 114572 gene locus_tag LOCUS_00990 gene hemH1 115567 114572 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_00990 116324 115680 gene locus_tag LOCUS_01000 gene adk 116324 115680 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF5 protein_id gnl|my_center|LOCUS_01000 117357 116512 gene locus_tag LOCUS_01010 117357 116512 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072101.1 protein_id gnl|my_center|LOCUS_01010 119249 117429 gene locus_tag LOCUS_01020 gene htpG 119249 117429 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF7 protein_id gnl|my_center|LOCUS_01020 120114 119515 gene locus_tag LOCUS_01030 gene recR 120114 119515 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF8 protein_id gnl|my_center|LOCUS_01030 120457 120128 gene locus_tag LOCUS_01040 120457 120128 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF9 protein_id gnl|my_center|LOCUS_01040 123488 120588 gene locus_tag LOCUS_01050 gene dnaX 123488 120588 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072097.1 protein_id gnl|my_center|LOCUS_01050 124161 123610 gene locus_tag LOCUS_01060 gene apt 124161 123610 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG1 protein_id gnl|my_center|LOCUS_01060 124652 124257 gene locus_tag LOCUS_01070 124652 124257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 125114 124740 gene locus_tag LOCUS_01080 125114 124740 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG2 protein_id gnl|my_center|LOCUS_01080 126287 125505 gene locus_tag LOCUS_01090 126287 125505 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_01090 127123 126287 gene locus_tag LOCUS_01100 127123 126287 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_01100 127604 127182 gene locus_tag LOCUS_01110 127604 127182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 protein_id gnl|my_center|LOCUS_01110 127862 128851 gene locus_tag LOCUS_01120 gene dusC 127862 128851 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG7 protein_id gnl|my_center|LOCUS_01120 129041 129319 gene locus_tag LOCUS_01130 129041 129319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 132135 129484 gene locus_tag LOCUS_01140 132135 129484 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072436.1 protein_id gnl|my_center|LOCUS_01140 135239 132579 gene locus_tag LOCUS_01150 135239 132579 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072436.1 protein_id gnl|my_center|LOCUS_01150 136059 135628 gene locus_tag LOCUS_01160 gene ndk 136059 135628 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_01160 136656 136459 gene locus_tag LOCUS_01170 gene iscX 136656 136459 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072283.1 protein_id gnl|my_center|LOCUS_01170 137648 136749 gene locus_tag LOCUS_01180 gene rimK2 137648 136749 CDS product putative alpha-L-glutamate ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU3 protein_id gnl|my_center|LOCUS_01180 138202 137867 gene locus_tag LOCUS_01190 gene fdx 138202 137867 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072281.1 protein_id gnl|my_center|LOCUS_01190 140073 138211 gene locus_tag LOCUS_01200 gene hscA 140073 138211 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU5 protein_id gnl|my_center|LOCUS_01200 140681 140157 gene locus_tag LOCUS_01210 gene hscB 140681 140157 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU6 protein_id gnl|my_center|LOCUS_01210 141029 140706 gene locus_tag LOCUS_01220 gene iscA 141029 140706 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU7 protein_id gnl|my_center|LOCUS_01220 141427 141044 gene locus_tag LOCUS_01230 gene iscU 141427 141044 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU8 protein_id gnl|my_center|LOCUS_01230 142674 141460 gene locus_tag LOCUS_01240 gene iscS 142674 141460 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU9 protein_id gnl|my_center|LOCUS_01240 143262 142756 gene locus_tag LOCUS_01250 gene iscR 143262 142756 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072275.1 protein_id gnl|my_center|LOCUS_01250 144238 143417 gene locus_tag LOCUS_01260 gene cysE 144238 143417 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_01260 144981 144253 gene locus_tag LOCUS_01270 gene trmJ 144981 144253 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEV2 protein_id gnl|my_center|LOCUS_01270 145133 145933 gene locus_tag LOCUS_01280 gene suhB 145133 145933 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072272.1 protein_id gnl|my_center|LOCUS_01280 146178 147380 gene locus_tag LOCUS_01290 gene nnrS 146178 147380 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_01290 147467 147871 gene locus_tag LOCUS_01300 147467 147871 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_01300 148136 148438 gene locus_tag LOCUS_01310 148136 148438 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072740.1 protein_id gnl|my_center|LOCUS_01310 148511 149179 gene locus_tag LOCUS_01320 148511 149179 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072741.1 protein_id gnl|my_center|LOCUS_01320 149166 149516 gene locus_tag LOCUS_01330 149166 149516 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072742.1 protein_id gnl|my_center|LOCUS_01330 149752 149510 gene locus_tag LOCUS_01340 149752 149510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 149874 151550 gene locus_tag LOCUS_01350 gene yehU 149874 151550 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 protein_id gnl|my_center|LOCUS_01350 151547 152257 gene locus_tag LOCUS_01360 151547 152257 CDS product putative response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDD7 protein_id gnl|my_center|LOCUS_01360 152392 153834 gene locus_tag LOCUS_01370 152392 153834 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964317.1 protein_id gnl|my_center|LOCUS_01370 154464 153916 gene locus_tag LOCUS_01380 gene yaeQ 154464 153916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_01380 155430 154519 gene locus_tag LOCUS_01390 155430 154519 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073004.1 protein_id gnl|my_center|LOCUS_01390 155789 155430 gene locus_tag LOCUS_01400 155789 155430 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_01400 156137 155820 gene locus_tag LOCUS_01410 156137 155820 CDS product zinc-finger-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 protein_id gnl|my_center|LOCUS_01410 157335 156388 gene locus_tag LOCUS_01420 gene secF 157335 156388 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM6 protein_id gnl|my_center|LOCUS_01420 159164 157347 gene locus_tag LOCUS_01430 gene secD 159164 157347 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM5 protein_id gnl|my_center|LOCUS_01430 159547 159215 gene locus_tag LOCUS_01440 gene yajC 159547 159215 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 protein_id gnl|my_center|LOCUS_01440 160700 159576 gene locus_tag LOCUS_01450 gene tgt 160700 159576 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_01450 161887 160850 gene locus_tag LOCUS_01460 gene queA 161887 160850 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM2 protein_id gnl|my_center|LOCUS_01460 162107 161946 gene locus_tag LOCUS_01470 162107 161946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 162254 162847 gene locus_tag LOCUS_01480 162254 162847 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073012.1 protein_id gnl|my_center|LOCUS_01480 162947 163600 gene locus_tag LOCUS_01490 162947 163600 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 protein_id gnl|my_center|LOCUS_01490 164100 163699 gene locus_tag LOCUS_01500 164100 163699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073015.1 protein_id gnl|my_center|LOCUS_01500 165611 164391 gene locus_tag LOCUS_01510 gene sstT 165611 164391 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL5 protein_id gnl|my_center|LOCUS_01510 166651 165755 gene locus_tag LOCUS_01520 gene cheV 166651 165755 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 protein_id gnl|my_center|LOCUS_01520 168244 166727 gene locus_tag LOCUS_01530 168244 166727 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479787.1 protein_id gnl|my_center|LOCUS_01530 168790 168329 gene locus_tag LOCUS_01540 168790 168329 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073020.1 protein_id gnl|my_center|LOCUS_01540 169447 168878 gene locus_tag LOCUS_01550 gene ogt 169447 168878 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL1 protein_id gnl|my_center|LOCUS_01550 171122 169554 gene locus_tag LOCUS_01560 171122 169554 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073023.1 protein_id gnl|my_center|LOCUS_01560 171389 173230 gene locus_tag LOCUS_01570 171389 173230 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 protein_id gnl|my_center|LOCUS_01570 173593 173916 gene locus_tag LOCUS_01580 173593 173916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 175007 174006 gene locus_tag LOCUS_01590 gene wcvA 175007 174006 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074276.1 protein_id gnl|my_center|LOCUS_01590 176211 175048 gene locus_tag LOCUS_01600 gene ugd 176211 175048 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704874.1 protein_id gnl|my_center|LOCUS_01600 178265 176334 gene locus_tag LOCUS_01610 gene wbfY 178265 176334 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_01610 178854 178303 gene locus_tag LOCUS_01620 178854 178303 CDS product undecaprenyl-phosphate beta-N-acetyl-D-fucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 protein_id gnl|my_center|LOCUS_01620 179782 178856 gene locus_tag LOCUS_01630 179782 178856 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261051.1 protein_id gnl|my_center|LOCUS_01630 180713 179775 gene locus_tag LOCUS_01640 180713 179775 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244127.1 protein_id gnl|my_center|LOCUS_01640 182622 180733 gene locus_tag LOCUS_01650 182622 180733 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 protein_id gnl|my_center|LOCUS_01650 183511 182636 gene locus_tag LOCUS_01660 183511 182636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 184731 183838 gene locus_tag LOCUS_01670 184731 183838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 185899 184745 gene locus_tag LOCUS_01680 185899 184745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 186839 185919 gene locus_tag LOCUS_01690 186839 185919 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203394.1 protein_id gnl|my_center|LOCUS_01690 188129 186879 gene locus_tag LOCUS_01700 188129 186879 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_01700 189232 188126 gene locus_tag LOCUS_01710 189232 188126 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 protein_id gnl|my_center|LOCUS_01710 189989 189234 gene locus_tag LOCUS_01720 189989 189234 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461011.1 protein_id gnl|my_center|LOCUS_01720 190708 189989 gene locus_tag LOCUS_01730 190708 189989 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090507.1 protein_id gnl|my_center|LOCUS_01730 192069 190705 gene locus_tag LOCUS_01740 192069 190705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 192298 192050 gene locus_tag LOCUS_01750 192298 192050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 192693 192292 gene locus_tag LOCUS_01760 192693 192292 CDS product dTDP-6-deoxy-3,4-keto-hexulose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_01760 193240 192683 gene locus_tag LOCUS_01770 gene rfbC 193240 192683 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37780 protein_id gnl|my_center|LOCUS_01770 194175 193306 gene locus_tag LOCUS_01780 gene rfbD 194175 193306 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_01780 195060 194185 gene locus_tag LOCUS_01790 gene rffH 195060 194185 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I4 protein_id gnl|my_center|LOCUS_01790 196166 195060 gene locus_tag LOCUS_01800 gene rfbB 196166 195060 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073075.1 protein_id gnl|my_center|LOCUS_01800 197349 196378 gene locus_tag LOCUS_01810 gene wzz 197349 196378 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_01810 200250 197431 gene locus_tag LOCUS_01820 gene wza 200250 197431 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073080.1 protein_id gnl|my_center|LOCUS_01820 200831 200664 gene locus_tag LOCUS_01830 200831 200664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 201319 200822 gene locus_tag LOCUS_01840 gene rfaH 201319 200822 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECE8 protein_id gnl|my_center|LOCUS_01840 201752 203260 gene locus_tag LOCUS_01850 201752 203260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073082.1 protein_id gnl|my_center|LOCUS_01850 204506 203400 gene locus_tag LOCUS_01860 204506 203400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073083.1 protein_id gnl|my_center|LOCUS_01860 205354 204584 gene locus_tag LOCUS_01870 gene mlaA 205354 204584 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073084.1 protein_id gnl|my_center|LOCUS_01870 205659 207329 gene locus_tag LOCUS_01880 205659 207329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073085.1 protein_id gnl|my_center|LOCUS_01880 207339 207662 gene locus_tag LOCUS_01890 207339 207662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 protein_id gnl|my_center|LOCUS_01890 208198 207785 gene locus_tag LOCUS_01900 208198 207785 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 protein_id gnl|my_center|LOCUS_01900 208725 208231 gene locus_tag LOCUS_01910 gene cheW 208725 208231 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_01910 209704 208733 gene locus_tag LOCUS_01920 gene cheW 209704 208733 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073089.1 protein_id gnl|my_center|LOCUS_01920 210479 209688 gene locus_tag LOCUS_01930 210479 209688 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_01930 211021 210557 gene locus_tag LOCUS_01940 211021 210557 CDS product membrane anchored protein in chemotaxis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073091.1 protein_id gnl|my_center|LOCUS_01940 212162 211014 gene locus_tag LOCUS_01950 gene cheB1 212162 211014 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD7 protein_id gnl|my_center|LOCUS_01950 214498 212183 gene locus_tag LOCUS_01960 gene cheA 214498 212183 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 protein_id gnl|my_center|LOCUS_01960 215250 214513 gene locus_tag LOCUS_01970 gene cheZ 215250 214513 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD5 protein_id gnl|my_center|LOCUS_01970 215647 215264 gene locus_tag LOCUS_01980 gene cheY 215647 215264 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_01980 216413 215694 gene locus_tag LOCUS_01990 gene fliA 216413 215694 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD3 protein_id gnl|my_center|LOCUS_01990 217305 216406 gene locus_tag LOCUS_02000 gene flhG 217305 216406 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD2 protein_id gnl|my_center|LOCUS_02000 218662 217292 gene locus_tag LOCUS_02010 gene flhF 218662 217292 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073097.1 protein_id gnl|my_center|LOCUS_02010 220774 218669 gene locus_tag LOCUS_02020 gene flhA 220774 218669 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073098.1 protein_id gnl|my_center|LOCUS_02020 221978 220842 gene locus_tag LOCUS_02030 gene flhB 221978 220842 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073099.1 protein_id gnl|my_center|LOCUS_02030 222775 221978 gene locus_tag LOCUS_02040 gene fliR 222775 221978 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC7 protein_id gnl|my_center|LOCUS_02040 223048 222779 gene locus_tag LOCUS_02050 gene fliQ 223048 222779 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 protein_id gnl|my_center|LOCUS_02050 223801 223058 gene locus_tag LOCUS_02060 gene fliP 223801 223058 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC5 protein_id gnl|my_center|LOCUS_02060 224157 223798 gene locus_tag LOCUS_02070 224157 223798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 224548 224168 gene locus_tag LOCUS_02080 gene fliN 224548 224168 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC3 protein_id gnl|my_center|LOCUS_02080 225588 224560 gene locus_tag LOCUS_02090 gene fliM 225588 224560 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC2 protein_id gnl|my_center|LOCUS_02090 226140 225616 gene locus_tag LOCUS_02100 gene fliL 226140 225616 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 protein_id gnl|my_center|LOCUS_02100 227709 226207 gene locus_tag LOCUS_02110 gene fliK 227709 226207 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073107.1 protein_id gnl|my_center|LOCUS_02110 228277 227828 gene locus_tag LOCUS_02120 gene fliJ 228277 227828 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073108.1 protein_id gnl|my_center|LOCUS_02120 229743 228400 gene locus_tag LOCUS_02130 gene fliI 229743 228400 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073109.1 protein_id gnl|my_center|LOCUS_02130 230680 229709 gene locus_tag LOCUS_02140 gene fliH 230680 229709 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073110.1 protein_id gnl|my_center|LOCUS_02140 231737 230694 gene locus_tag LOCUS_02150 gene fliG 231737 230694 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB6 protein_id gnl|my_center|LOCUS_02150 233436 231730 gene locus_tag LOCUS_02160 gene fliF 233436 231730 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB5 protein_id gnl|my_center|LOCUS_02160 233810 233478 gene locus_tag LOCUS_02170 gene fliE 233810 233478 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB4 protein_id gnl|my_center|LOCUS_02170 235307 233976 gene locus_tag LOCUS_02180 gene flrC 235307 233976 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_02180 236368 235304 gene locus_tag LOCUS_02190 gene flrB 236368 235304 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073115.1 protein_id gnl|my_center|LOCUS_02190 237725 236448 gene locus_tag LOCUS_02200 gene flrA 237725 236448 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 protein_id gnl|my_center|LOCUS_02200 238481 238164 gene locus_tag LOCUS_02210 gene fliS 238481 238164 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB0 protein_id gnl|my_center|LOCUS_02210 238898 238572 gene locus_tag LOCUS_02220 gene fliT 238898 238572 CDS product flagella biosynthesis chaperone for FliD FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073118.1 protein_id gnl|my_center|LOCUS_02220 240276 238909 gene locus_tag LOCUS_02230 gene fliD 240276 238909 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_02230 240682 240305 gene locus_tag LOCUS_02240 gene flaG 240682 240305 CDS product flagella locus protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 protein_id gnl|my_center|LOCUS_02240 241618 240800 gene locus_tag LOCUS_02250 gene fliC 241618 240800 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA5 protein_id gnl|my_center|LOCUS_02250 242656 241835 gene locus_tag LOCUS_02260 gene fliC 242656 241835 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA5 protein_id gnl|my_center|LOCUS_02260 243957 242752 gene locus_tag LOCUS_02270 gene flgL 243957 242752 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 protein_id gnl|my_center|LOCUS_02270 245894 243969 gene locus_tag LOCUS_02280 gene flgK 245894 243969 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 protein_id gnl|my_center|LOCUS_02280 246925 245915 gene locus_tag LOCUS_02290 gene flgJ 246925 245915 CDS product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073125.1 protein_id gnl|my_center|LOCUS_02290 248042 246951 gene locus_tag LOCUS_02300 gene flgI 248042 246951 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA2 protein_id gnl|my_center|LOCUS_02300 248727 248053 gene locus_tag LOCUS_02310 gene flgH 248727 248053 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA1 protein_id gnl|my_center|LOCUS_02310 249528 248740 gene locus_tag LOCUS_02320 gene flgG 249528 248740 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA0 protein_id gnl|my_center|LOCUS_02320 250298 249540 gene locus_tag LOCUS_02330 gene flgF 250298 249540 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC99 protein_id gnl|my_center|LOCUS_02330 251811 250450 gene locus_tag LOCUS_02340 gene flgE 251811 250450 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 protein_id gnl|my_center|LOCUS_02340 252549 251866 gene locus_tag LOCUS_02350 gene flgD 252549 251866 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC96 protein_id gnl|my_center|LOCUS_02350 252981 252565 gene locus_tag LOCUS_02360 gene flgC 252981 252565 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC95 protein_id gnl|my_center|LOCUS_02360 253382 252984 gene locus_tag LOCUS_02370 gene flgB 253382 252984 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC94 protein_id gnl|my_center|LOCUS_02370 254389 253556 gene locus_tag LOCUS_02380 gene cheR 254389 253556 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073134.1 protein_id gnl|my_center|LOCUS_02380 255454 254534 gene locus_tag LOCUS_02390 gene cheV 255454 254534 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_02390 255697 256350 gene locus_tag LOCUS_02400 gene flgA 255697 256350 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC91 protein_id gnl|my_center|LOCUS_02400 256422 256745 gene locus_tag LOCUS_02410 gene flgM 256422 256745 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073137.1 protein_id gnl|my_center|LOCUS_02410 256745 257176 gene locus_tag LOCUS_02420 gene flgN 256745 257176 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073138.1 protein_id gnl|my_center|LOCUS_02420 257918 257451 gene locus_tag LOCUS_02430 gene flgP 257918 257451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_02430 258523 257918 gene locus_tag LOCUS_02440 gene flgO 258523 257918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073140.1 protein_id gnl|my_center|LOCUS_02440 259290 260447 gene locus_tag LOCUS_02450 gene flgT 259290 260447 CDS product flagella assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073141.1 protein_id gnl|my_center|LOCUS_02450 260503 260578 gene locus_tag LOCUS_t00040 260503 260578 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 261553 262095 gene locus_tag LOCUS_02460 261553 262095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705517.1 protein_id gnl|my_center|LOCUS_02460 262686 262426 gene locus_tag LOCUS_02470 262686 262426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 262792 263007 gene locus_tag LOCUS_02480 262792 263007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 263026 263226 gene locus_tag LOCUS_02490 263026 263226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 263367 264233 gene locus_tag LOCUS_02500 263367 264233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 264976 265458 gene locus_tag LOCUS_02510 264976 265458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 266033 268363 gene locus_tag LOCUS_02520 266033 268363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 269155 268433 gene locus_tag LOCUS_02530 269155 268433 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878856.1 protein_id gnl|my_center|LOCUS_02530 269972 269157 gene locus_tag LOCUS_02540 269972 269157 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939934.1 protein_id gnl|my_center|LOCUS_02540 270880 270014 gene locus_tag LOCUS_02550 270880 270014 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939935.1 protein_id gnl|my_center|LOCUS_02550 271717 270887 gene locus_tag LOCUS_02560 271717 270887 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939936.1 protein_id gnl|my_center|LOCUS_02560 272356 273687 gene locus_tag LOCUS_02570 gene maf 272356 273687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073142.1 protein_id gnl|my_center|LOCUS_02570 273684 273929 gene locus_tag LOCUS_02580 273684 273929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073143.1 protein_id gnl|my_center|LOCUS_02580 273992 274846 gene locus_tag LOCUS_02590 273992 274846 CDS product N-acetylneuraminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073144.1 protein_id gnl|my_center|LOCUS_02590 274894 275733 gene locus_tag LOCUS_02600 gene tkt 274894 275733 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_02600 275726 276691 gene locus_tag LOCUS_02610 275726 276691 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_02610 276691 277440 gene locus_tag LOCUS_02620 276691 277440 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073146.1 protein_id gnl|my_center|LOCUS_02620 277433 278551 gene locus_tag LOCUS_02630 277433 278551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 278553 279740 gene locus_tag LOCUS_02640 278553 279740 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073147.1 protein_id gnl|my_center|LOCUS_02640 280298 280978 gene locus_tag LOCUS_02650 280298 280978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 280975 282924 gene locus_tag LOCUS_02660 280975 282924 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073151.1 protein_id gnl|my_center|LOCUS_02660 282921 284630 gene locus_tag LOCUS_02670 282921 284630 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073152.1 protein_id gnl|my_center|LOCUS_02670 285930 284767 gene locus_tag LOCUS_02680 gene pseC 285930 284767 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073153.1 protein_id gnl|my_center|LOCUS_02680 286922 285927 gene locus_tag LOCUS_02690 gene pseB 286922 285927 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_02690 287235 289667 gene locus_tag LOCUS_02700 287235 289667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_02700 289853 290332 gene locus_tag LOCUS_02710 289853 290332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073157.1 protein_id gnl|my_center|LOCUS_02710 290415 290978 gene locus_tag LOCUS_02720 290415 290978 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_02720 291954 291064 gene locus_tag LOCUS_02730 291954 291064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073159.1 protein_id gnl|my_center|LOCUS_02730 292612 291998 gene locus_tag LOCUS_02740 292612 291998 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 protein_id gnl|my_center|LOCUS_02740 292759 293937 gene locus_tag LOCUS_02750 292759 293937 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_02750 293934 297047 gene locus_tag LOCUS_02760 293934 297047 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_02760 297343 299349 gene locus_tag LOCUS_02770 297343 299349 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073164.1 protein_id gnl|my_center|LOCUS_02770 299814 299401 gene locus_tag LOCUS_02780 gene ybaY 299814 299401 CDS product chaperone for general secretion pathway YbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072015.1 protein_id gnl|my_center|LOCUS_02780 300690 299827 gene locus_tag LOCUS_02790 gene tesB 300690 299827 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 protein_id gnl|my_center|LOCUS_02790 301645 300761 gene locus_tag LOCUS_02800 301645 300761 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072013.1 protein_id gnl|my_center|LOCUS_02800 301879 302754 gene locus_tag LOCUS_02810 gene menA 301879 302754 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFQ9 protein_id gnl|my_center|LOCUS_02810 303150 302836 gene locus_tag LOCUS_02820 gene sugE 303150 302836 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072008.1 protein_id gnl|my_center|LOCUS_02820 305371 303392 gene locus_tag LOCUS_02830 gene prpE 305371 303392 CDS product propionyl-CoA synthetase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072007.1 protein_id gnl|my_center|LOCUS_02830 305690 306097 gene locus_tag LOCUS_02840 gene liuR 305690 306097 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072005.1 protein_id gnl|my_center|LOCUS_02840 306158 307327 gene locus_tag LOCUS_02850 gene liuA 306158 307327 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_02850 307396 309003 gene locus_tag LOCUS_02860 gene liuB 307396 309003 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 protein_id gnl|my_center|LOCUS_02860 309015 309869 gene locus_tag LOCUS_02870 gene liuC 309015 309869 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence02 188 104 gene locus_tag LOCUS_t00050 188 104 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 314 802 gene locus_tag LOCUS_02880 gene s4P 314 802 CDS product queD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072465.1 protein_id gnl|my_center|LOCUS_02880 872 1162 gene locus_tag LOCUS_02890 872 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072464.1 protein_id gnl|my_center|LOCUS_02890 1359 3536 gene locus_tag LOCUS_02900 1359 3536 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072463.1 protein_id gnl|my_center|LOCUS_02900 4052 3573 gene locus_tag LOCUS_02910 4052 3573 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59192 protein_id gnl|my_center|LOCUS_02910 4912 4217 gene locus_tag LOCUS_02920 4912 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5608 5012 gene locus_tag LOCUS_02930 5608 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072461.1 protein_id gnl|my_center|LOCUS_02930 5715 6305 gene locus_tag LOCUS_02940 5715 6305 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072460.1 protein_id gnl|my_center|LOCUS_02940 6412 7059 gene locus_tag LOCUS_02950 gene psrA 6412 7059 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072458.1 protein_id gnl|my_center|LOCUS_02950 7070 9346 gene locus_tag LOCUS_02960 gene fadE1 7070 9346 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072457.1 protein_id gnl|my_center|LOCUS_02960 10961 9522 gene locus_tag LOCUS_02970 gene pykA 10961 9522 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE96 protein_id gnl|my_center|LOCUS_02970 12000 11146 gene locus_tag LOCUS_02980 gene hexR 12000 11146 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 protein_id gnl|my_center|LOCUS_02980 12316 13788 gene locus_tag LOCUS_02990 gene zwf 12316 13788 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE98 protein_id gnl|my_center|LOCUS_02990 13798 14502 gene locus_tag LOCUS_03000 gene pgl 13798 14502 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_03000 14512 16338 gene locus_tag LOCUS_03010 gene edd 14512 16338 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_03010 16358 16999 gene locus_tag LOCUS_03020 gene eda 16358 16999 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_03020 17495 17911 gene locus_tag LOCUS_03030 17495 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18167 17961 gene locus_tag LOCUS_03040 18167 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18920 18183 gene locus_tag LOCUS_03050 gene kdsB 18920 18183 CDS product 8-amino-3,8-dideoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA9 protein_id gnl|my_center|LOCUS_03050 20059 18989 gene locus_tag LOCUS_03060 gene kdnB 20059 18989 CDS product 3-deoxy-alpha-D-manno-octulosonate 8-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB0 protein_id gnl|my_center|LOCUS_03060 21267 20080 gene locus_tag LOCUS_03070 gene kdnA 21267 20080 CDS product 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB1 protein_id gnl|my_center|LOCUS_03070 22116 21505 gene locus_tag LOCUS_03080 gene can 22116 21505 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB3 protein_id gnl|my_center|LOCUS_03080 23051 22218 gene locus_tag LOCUS_03090 23051 22218 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072440.1 protein_id gnl|my_center|LOCUS_03090 23904 23179 gene locus_tag LOCUS_03100 23904 23179 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072439.1 protein_id gnl|my_center|LOCUS_03100 25029 23908 gene locus_tag LOCUS_03110 gene dapE 25029 23908 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB6 protein_id gnl|my_center|LOCUS_03110 25388 25038 gene locus_tag LOCUS_03120 25388 25038 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072437.1 protein_id gnl|my_center|LOCUS_03120 25874 27901 gene locus_tag LOCUS_03130 25874 27901 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 protein_id gnl|my_center|LOCUS_03130 28122 28865 gene locus_tag LOCUS_03140 28122 28865 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_03140 31582 28979 gene locus_tag LOCUS_03150 gene adhE 31582 28979 CDS product aldehyde-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF55 protein_id gnl|my_center|LOCUS_03150 31925 32557 gene locus_tag LOCUS_03160 gene ychE 31925 32557 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF54 protein_id gnl|my_center|LOCUS_03160 35269 32819 gene locus_tag LOCUS_03170 gene fadE2 35269 32819 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072493.1 protein_id gnl|my_center|LOCUS_03170 35522 36322 gene locus_tag LOCUS_03180 35522 36322 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072492.1 protein_id gnl|my_center|LOCUS_03180 37000 36266 gene locus_tag LOCUS_03190 37000 36266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072491.1 protein_id gnl|my_center|LOCUS_03190 37379 37017 gene locus_tag LOCUS_03200 gene adaA 37379 37017 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072490.1 protein_id gnl|my_center|LOCUS_03200 37556 38050 gene locus_tag LOCUS_03210 gene def3 37556 38050 CDS product peptide deformylase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE60 protein_id gnl|my_center|LOCUS_03210 39474 38047 gene locus_tag LOCUS_03220 39474 38047 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106224.1 protein_id gnl|my_center|LOCUS_03220 39627 40769 gene locus_tag LOCUS_03230 39627 40769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 41110 42480 gene locus_tag LOCUS_03240 41110 42480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_03240 42480 45698 gene locus_tag LOCUS_03250 gene dnaE2 42480 45698 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N39 protein_id gnl|my_center|LOCUS_03250 45723 46310 gene locus_tag LOCUS_03260 45723 46310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 47065 46385 gene locus_tag LOCUS_03270 gene yqfA 47065 46385 CDS product channel protein hemolysin III family subfamily YqfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 protein_id gnl|my_center|LOCUS_03270 47671 48534 gene locus_tag LOCUS_03280 47671 48534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 49027 51117 gene locus_tag LOCUS_03290 gene thiC 49027 51117 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EED7 protein_id gnl|my_center|LOCUS_03290 51119 53635 gene locus_tag LOCUS_03300 51119 53635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 53625 53825 gene locus_tag LOCUS_03310 gene thiS 53625 53825 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704416.1 protein_id gnl|my_center|LOCUS_03310 53827 54606 gene locus_tag LOCUS_03320 gene thiG 53827 54606 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE1 protein_id gnl|my_center|LOCUS_03320 54599 55756 gene locus_tag LOCUS_03330 gene thiH 54599 55756 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072416.1 protein_id gnl|my_center|LOCUS_03330 55881 56135 gene locus_tag LOCUS_03340 55881 56135 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072415.1 protein_id gnl|my_center|LOCUS_03340 56745 57566 gene locus_tag LOCUS_03350 56745 57566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 57980 57696 gene locus_tag LOCUS_03360 57980 57696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 58533 58081 gene locus_tag LOCUS_03370 58533 58081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 59820 58924 gene locus_tag LOCUS_03380 59820 58924 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072413.1 protein_id gnl|my_center|LOCUS_03380 60949 59879 gene locus_tag LOCUS_03390 60949 59879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 62732 60909 gene locus_tag LOCUS_03400 62732 60909 CDS product Zn-dependent oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072412.1 protein_id gnl|my_center|LOCUS_03400 63666 62719 gene locus_tag LOCUS_03410 63666 62719 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_03410 65173 63668 gene locus_tag LOCUS_03420 65173 63668 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_03420 65946 65182 gene locus_tag LOCUS_03430 65946 65182 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705414.1 protein_id gnl|my_center|LOCUS_03430 66978 66010 gene locus_tag LOCUS_03440 gene cmoB 66978 66010 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE6 protein_id gnl|my_center|LOCUS_03440 67706 66975 gene locus_tag LOCUS_03450 gene cmoA 67706 66975 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE7 protein_id gnl|my_center|LOCUS_03450 67854 70670 gene locus_tag LOCUS_03460 67854 70670 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072409.1 protein_id gnl|my_center|LOCUS_03460 70859 72640 gene locus_tag LOCUS_03470 gene aspS 70859 72640 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE9 protein_id gnl|my_center|LOCUS_03470 72747 73493 gene locus_tag LOCUS_03480 72747 73493 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_03480 73505 74026 gene locus_tag LOCUS_03490 gene ruvC 73505 74026 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF1 protein_id gnl|my_center|LOCUS_03490 74023 74640 gene locus_tag LOCUS_03500 gene ruvA 74023 74640 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF2 protein_id gnl|my_center|LOCUS_03500 74676 75680 gene locus_tag LOCUS_03510 gene ruvB 74676 75680 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF3 protein_id gnl|my_center|LOCUS_03510 75909 75778 gene locus_tag LOCUS_03520 75909 75778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 76387 75899 gene locus_tag LOCUS_03530 76387 75899 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 protein_id gnl|my_center|LOCUS_03530 76876 76448 gene locus_tag LOCUS_03540 76876 76448 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 protein_id gnl|my_center|LOCUS_03540 77371 79590 gene locus_tag LOCUS_03550 77371 79590 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_03550 79605 81542 gene locus_tag LOCUS_03560 79605 81542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 81837 82106 gene locus_tag LOCUS_03570 81837 82106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03570 83408 82155 gene locus_tag LOCUS_03580 gene uraA 83408 82155 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 protein_id gnl|my_center|LOCUS_03580 83677 84765 gene locus_tag LOCUS_03590 83677 84765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072790.1 protein_id gnl|my_center|LOCUS_03590 84843 85553 gene locus_tag LOCUS_03600 gene hda 84843 85553 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072789.1 protein_id gnl|my_center|LOCUS_03600 87592 85643 gene locus_tag LOCUS_03610 87592 85643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072788.1 protein_id gnl|my_center|LOCUS_03610 88195 87812 gene locus_tag LOCUS_03620 88195 87812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072787.1 protein_id gnl|my_center|LOCUS_03620 88546 88196 gene locus_tag LOCUS_03630 gene arsC 88546 88196 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED91 protein_id gnl|my_center|LOCUS_03630 90138 88669 gene locus_tag LOCUS_03640 gene yfgC 90138 88669 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED93 protein_id gnl|my_center|LOCUS_03640 90223 90468 gene locus_tag LOCUS_03650 90223 90468 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072784.1 protein_id gnl|my_center|LOCUS_03650 90550 91641 gene locus_tag LOCUS_03660 gene yfgO 90550 91641 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072783.1 protein_id gnl|my_center|LOCUS_03660 92600 91707 gene locus_tag LOCUS_03670 gene argP 92600 91707 CDS product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072782.1 protein_id gnl|my_center|LOCUS_03670 92757 93383 gene locus_tag LOCUS_03680 gene argO 92757 93383 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072781.1 protein_id gnl|my_center|LOCUS_03680 93979 93512 gene locus_tag LOCUS_03690 gene bcp 93979 93512 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071986.1 protein_id gnl|my_center|LOCUS_03690 94568 94020 gene locus_tag LOCUS_03700 gene gcvR 94568 94020 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071987.1 protein_id gnl|my_center|LOCUS_03700 94797 95627 gene locus_tag LOCUS_03710 gene dapA 94797 95627 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFT7 protein_id gnl|my_center|LOCUS_03710 95632 96732 gene locus_tag LOCUS_03720 gene bamC 95632 96732 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFT6 protein_id gnl|my_center|LOCUS_03720 97168 98253 gene locus_tag LOCUS_03730 97168 98253 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_03730 98250 101342 gene locus_tag LOCUS_03740 98250 101342 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_03740 102781 101567 gene locus_tag LOCUS_03750 gene emrD 102781 101567 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072369.1 protein_id gnl|my_center|LOCUS_03750 103353 104147 gene locus_tag LOCUS_03760 103353 104147 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072367.1 protein_id gnl|my_center|LOCUS_03760 104250 105533 gene locus_tag LOCUS_03770 104250 105533 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766159.1 protein_id gnl|my_center|LOCUS_03770 105534 108674 gene locus_tag LOCUS_03780 105534 108674 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769702.1 protein_id gnl|my_center|LOCUS_03780 108671 110125 gene locus_tag LOCUS_03790 108671 110125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 protein_id gnl|my_center|LOCUS_03790 110840 110145 gene locus_tag LOCUS_03800 gene trmJ 110840 110145 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM3 protein_id gnl|my_center|LOCUS_03800 111522 110977 gene locus_tag LOCUS_03810 gene eco 111522 110977 CDS product ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEQ7 protein_id gnl|my_center|LOCUS_03810 113876 111813 gene locus_tag LOCUS_03820 gene phoX 113876 111813 CDS product monomeric alkaline phosphatase PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072366.1 protein_id gnl|my_center|LOCUS_03820 114133 115197 gene locus_tag LOCUS_03830 114133 115197 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971230.1 protein_id gnl|my_center|LOCUS_03830 115211 115648 gene locus_tag LOCUS_03840 115211 115648 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_03840 115980 117599 gene locus_tag LOCUS_03850 115980 117599 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072121.1 protein_id gnl|my_center|LOCUS_03850 120379 117677 gene locus_tag LOCUS_03860 gene yfiQ 120379 117677 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072179.1 protein_id gnl|my_center|LOCUS_03860 120680 120604 gene locus_tag LOCUS_t00060 120680 120604 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 120794 120718 gene locus_tag LOCUS_t00070 120794 120718 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 122309 120933 gene locus_tag LOCUS_03870 gene norM 122309 120933 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 protein_id gnl|my_center|LOCUS_03870 122343 122957 gene locus_tag LOCUS_03880 gene ribC 122343 122957 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_03880 123220 123020 gene locus_tag LOCUS_03890 123220 123020 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072299.1 protein_id gnl|my_center|LOCUS_03890 123493 125421 gene locus_tag LOCUS_03900 gene thrS 123493 125421 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER9 protein_id gnl|my_center|LOCUS_03900 125506 125967 gene locus_tag LOCUS_03910 gene infC 125506 125967 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER8 protein_id gnl|my_center|LOCUS_03910 126052 126246 gene locus_tag LOCUS_03920 gene rpmI 126052 126246 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER7 protein_id gnl|my_center|LOCUS_03920 126264 126623 gene locus_tag LOCUS_03930 gene rplT 126264 126623 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_03930 127716 126769 gene locus_tag LOCUS_03940 gene trxB 127716 126769 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER5 protein_id gnl|my_center|LOCUS_03940 128971 127856 gene locus_tag LOCUS_03950 gene ald 128971 127856 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_03950 129152 129655 gene locus_tag LOCUS_03960 gene lrp 129152 129655 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 protein_id gnl|my_center|LOCUS_03960 129851 132460 gene locus_tag LOCUS_03970 gene ftsK 129851 132460 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER3 protein_id gnl|my_center|LOCUS_03970 132494 133093 gene locus_tag LOCUS_03980 gene lolA 132494 133093 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER2 protein_id gnl|my_center|LOCUS_03980 133096 134427 gene locus_tag LOCUS_03990 133096 134427 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072308.1 protein_id gnl|my_center|LOCUS_03990 134420 134794 gene locus_tag LOCUS_04000 gene crcB 134420 134794 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER0 protein_id gnl|my_center|LOCUS_04000 134813 136099 gene locus_tag LOCUS_04010 gene serS 134813 136099 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEQ9 protein_id gnl|my_center|LOCUS_04010 136636 136298 gene locus_tag LOCUS_04020 gene tusE 136636 136298 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEK2 protein_id gnl|my_center|LOCUS_04020 136911 136630 gene locus_tag LOCUS_04030 gene tusB 136911 136630 CDS product sulfurtransferase TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072360.1 protein_id gnl|my_center|LOCUS_04030 137267 136911 gene locus_tag LOCUS_04040 gene tusC 137267 136911 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 protein_id gnl|my_center|LOCUS_04040 137638 137267 gene locus_tag LOCUS_04050 gene tusD 137638 137267 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072358.1 protein_id gnl|my_center|LOCUS_04050 138374 137715 gene locus_tag LOCUS_04060 gene yccA 138374 137715 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_04060 139424 138522 gene locus_tag LOCUS_04070 gene ydhB 139424 138522 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072356.1 protein_id gnl|my_center|LOCUS_04070 139688 140794 gene locus_tag LOCUS_04080 139688 140794 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072355.1 protein_id gnl|my_center|LOCUS_04080 140876 140966 gene locus_tag LOCUS_t00080 140876 140966 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 141381 141154 gene locus_tag LOCUS_04090 141381 141154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 141559 143235 gene locus_tag LOCUS_04100 gene hscC 141559 143235 CDS product chaperone protein HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77319 protein_id gnl|my_center|LOCUS_04100 146156 143229 gene locus_tag LOCUS_04110 146156 143229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 146902 146162 gene locus_tag LOCUS_04120 146902 146162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 148721 147081 gene locus_tag LOCUS_04130 148721 147081 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 protein_id gnl|my_center|LOCUS_04130 149009 148722 gene locus_tag LOCUS_04140 149009 148722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070803.1 protein_id gnl|my_center|LOCUS_04140 149236 149006 gene locus_tag LOCUS_04150 149236 149006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 151415 150138 gene locus_tag LOCUS_04160 151415 150138 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 protein_id gnl|my_center|LOCUS_04160 151921 153498 gene locus_tag LOCUS_04170 151921 153498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_04170 153750 153565 gene locus_tag LOCUS_04180 153750 153565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 154286 155722 gene locus_tag LOCUS_04190 gene ccoN 154286 155722 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_04190 155735 156340 gene locus_tag LOCUS_04200 gene ccoO 155735 156340 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072350.1 protein_id gnl|my_center|LOCUS_04200 156351 156524 gene locus_tag LOCUS_04210 gene ccoQ 156351 156524 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072349.1 protein_id gnl|my_center|LOCUS_04210 156524 157510 gene locus_tag LOCUS_04220 gene ccoP 156524 157510 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_04220 157615 158094 gene locus_tag LOCUS_04230 gene ccoH 157615 158094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_04230 158103 160499 gene locus_tag LOCUS_04240 gene ccoI 158103 160499 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 protein_id gnl|my_center|LOCUS_04240 160496 160720 gene locus_tag LOCUS_04250 gene ccoS 160496 160720 CDS product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072345.1 protein_id gnl|my_center|LOCUS_04250 160710 161402 gene locus_tag LOCUS_04260 160710 161402 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_04260 161530 162210 gene locus_tag LOCUS_04270 gene etrA 161530 162210 CDS product electron transport regulator A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46148 protein_id gnl|my_center|LOCUS_04270 162301 163227 gene locus_tag LOCUS_04280 gene uspE 162301 163227 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_04280 163306 164268 gene locus_tag LOCUS_04290 gene ttcA 163306 164268 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM4 protein_id gnl|my_center|LOCUS_04290 165271 164642 gene locus_tag LOCUS_04300 165271 164642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072340.1 protein_id gnl|my_center|LOCUS_04300 166076 165249 gene locus_tag LOCUS_04310 166076 165249 CDS product glycoside hydrolase family 73 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_04310 166227 167129 gene locus_tag LOCUS_04320 166227 167129 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM7 protein_id gnl|my_center|LOCUS_04320 168414 167221 gene locus_tag LOCUS_04330 gene aspC 168414 167221 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM8 protein_id gnl|my_center|LOCUS_04330 168757 168670 gene locus_tag LOCUS_t00090 168757 168670 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 169077 168990 gene locus_tag LOCUS_t00100 169077 168990 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 171244 169244 gene locus_tag LOCUS_04340 171244 169244 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706458.1 protein_id gnl|my_center|LOCUS_04340 172473 171406 gene locus_tag LOCUS_04350 gene nadA 172473 171406 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_04350 174245 172638 gene locus_tag LOCUS_04360 gene bkdB 174245 172638 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN6 protein_id gnl|my_center|LOCUS_04360 175233 174256 gene locus_tag LOCUS_04370 gene bkdA2 175233 174256 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_04370 176396 175236 gene locus_tag LOCUS_04380 gene bkdA1 176396 175236 CDS product 3-methyl-2-oxobutanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_04380 177615 176578 gene locus_tag LOCUS_04390 gene astE 177615 176578 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN9 protein_id gnl|my_center|LOCUS_04390 177911 178390 gene locus_tag LOCUS_04400 gene msrA 177911 178390 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP0 protein_id gnl|my_center|LOCUS_04400 180110 178461 gene locus_tag LOCUS_04410 gene pgm 180110 178461 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072327.1 protein_id gnl|my_center|LOCUS_04410 180701 180147 gene locus_tag LOCUS_04420 gene seqA 180701 180147 CDS product negative modulator of initiation of replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP2 protein_id gnl|my_center|LOCUS_04420 181003 181779 gene locus_tag LOCUS_04430 gene ybfF 181003 181779 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072325.1 protein_id gnl|my_center|LOCUS_04430 181879 182100 gene locus_tag LOCUS_04440 181879 182100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072324.1 protein_id gnl|my_center|LOCUS_04440 182115 182384 gene locus_tag LOCUS_04450 gene ybfE 182115 182384 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072323.1 protein_id gnl|my_center|LOCUS_04450 182439 182966 gene locus_tag LOCUS_04460 gene fldA 182439 182966 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP7 protein_id gnl|my_center|LOCUS_04460 183045 184241 gene locus_tag LOCUS_04470 183045 184241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 protein_id gnl|my_center|LOCUS_04470 184287 184850 gene locus_tag LOCUS_04480 gene efp 184287 184850 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN67 protein_id gnl|my_center|LOCUS_04480 185843 184959 gene locus_tag LOCUS_04490 185843 184959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 187475 186093 gene locus_tag LOCUS_04500 187475 186093 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_04500 188050 189264 gene locus_tag LOCUS_04510 gene yfbQ 188050 189264 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072448.1 protein_id gnl|my_center|LOCUS_04510 189375 189962 gene locus_tag LOCUS_04520 189375 189962 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA3 protein_id gnl|my_center|LOCUS_04520 189974 191308 gene locus_tag LOCUS_04530 189974 191308 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEA2 protein_id gnl|my_center|LOCUS_04530 191947 191402 gene locus_tag LOCUS_04540 191947 191402 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072375.1 protein_id gnl|my_center|LOCUS_04540 192784 191966 gene locus_tag LOCUS_04550 192784 191966 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_04550 193551 192856 gene locus_tag LOCUS_04560 gene pyrF 193551 192856 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI4 protein_id gnl|my_center|LOCUS_04560 194733 193573 gene locus_tag LOCUS_04570 gene yciM 194733 193573 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI3 protein_id gnl|my_center|LOCUS_04570 195004 194735 gene locus_tag LOCUS_04580 gene lapA 195004 194735 CDS product putative lipopolysaccharide assembly protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI2 protein_id gnl|my_center|LOCUS_04580 195414 195127 gene locus_tag LOCUS_04590 gene ihfB 195414 195127 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI1 protein_id gnl|my_center|LOCUS_04590 197179 195485 gene locus_tag LOCUS_04600 gene rpsA 197179 195485 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI0 protein_id gnl|my_center|LOCUS_04600 197947 197252 gene locus_tag LOCUS_04610 gene cmk 197947 197252 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH9 protein_id gnl|my_center|LOCUS_04610 199383 198103 gene locus_tag LOCUS_04620 gene aroA 199383 198103 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH8 protein_id gnl|my_center|LOCUS_04620 199846 201042 gene locus_tag LOCUS_04630 gene aspC 199846 201042 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_04630 <201924 201129 gene locus_tag LOCUS_04640 <201924 201129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEH2:phosphoserine aminotransferase >Feature sequence03 64 447 gene locus_tag LOCUS_04650 64 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071546.1 protein_id gnl|my_center|LOCUS_04650 464 1372 gene locus_tag LOCUS_04660 gene nhaR 464 1372 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071547.1 protein_id gnl|my_center|LOCUS_04660 1510 1710 gene locus_tag LOCUS_04670 1510 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH90 protein_id gnl|my_center|LOCUS_04670 1691 2113 gene locus_tag LOCUS_04680 1691 2113 CDS product DUF1434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071549.1 protein_id gnl|my_center|LOCUS_04680 3740 2130 gene locus_tag LOCUS_04690 gene nadB 3740 2130 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH88 protein_id gnl|my_center|LOCUS_04690 3940 4518 gene locus_tag LOCUS_04700 gene rpoE 3940 4518 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_04700 4543 5154 gene locus_tag LOCUS_04710 gene rseA 4543 5154 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH86 protein_id gnl|my_center|LOCUS_04710 5164 6096 gene locus_tag LOCUS_04720 gene rseB 5164 6096 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071553.1 protein_id gnl|my_center|LOCUS_04720 6107 6586 gene locus_tag LOCUS_04730 gene rseC 6107 6586 CDS product sigma E factor positive regulatory protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071554.1 protein_id gnl|my_center|LOCUS_04730 6704 8494 gene locus_tag LOCUS_04740 gene lepA 6704 8494 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH83 protein_id gnl|my_center|LOCUS_04740 8664 9578 gene locus_tag LOCUS_04750 gene lepB 8664 9578 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH82 protein_id gnl|my_center|LOCUS_04750 9575 10258 gene locus_tag LOCUS_04760 gene rnc 9575 10258 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH81 protein_id gnl|my_center|LOCUS_04760 10255 11244 gene locus_tag LOCUS_04770 gene era 10255 11244 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH80 protein_id gnl|my_center|LOCUS_04770 11253 11975 gene locus_tag LOCUS_04780 gene recO 11253 11975 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH79 protein_id gnl|my_center|LOCUS_04780 12092 12829 gene locus_tag LOCUS_04790 gene pdxJ 12092 12829 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH78 protein_id gnl|my_center|LOCUS_04790 12829 13209 gene locus_tag LOCUS_04800 gene acpS 12829 13209 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH77 protein_id gnl|my_center|LOCUS_04800 13504 14043 gene locus_tag LOCUS_04810 13504 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071562.1 protein_id gnl|my_center|LOCUS_04810 15248 14067 gene locus_tag LOCUS_04820 15248 14067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_04820 16223 15435 gene locus_tag LOCUS_04830 16223 15435 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071564.1 protein_id gnl|my_center|LOCUS_04830 16529 17902 gene locus_tag LOCUS_04840 gene ffh 16529 17902 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH73 protein_id gnl|my_center|LOCUS_04840 18118 18369 gene locus_tag LOCUS_04850 gene rpsP 18118 18369 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_04850 18391 18921 gene locus_tag LOCUS_04860 gene rimM 18391 18921 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH71 protein_id gnl|my_center|LOCUS_04860 18938 19681 gene locus_tag LOCUS_04870 gene trmD 18938 19681 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX44 protein_id gnl|my_center|LOCUS_04870 19716 20069 gene locus_tag LOCUS_04880 gene rplS 19716 20069 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH70 protein_id gnl|my_center|LOCUS_04880 20370 21461 gene locus_tag LOCUS_04890 gene aroF 20370 21461 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH69 protein_id gnl|my_center|LOCUS_04890 21475 22614 gene locus_tag LOCUS_04900 gene tyrA 21475 22614 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH68 protein_id gnl|my_center|LOCUS_04900 22844 24505 gene locus_tag LOCUS_04910 gene hcp 22844 24505 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH67 protein_id gnl|my_center|LOCUS_04910 24574 25671 gene locus_tag LOCUS_04920 gene hcr 24574 25671 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071572.1 protein_id gnl|my_center|LOCUS_04920 25771 26106 gene locus_tag LOCUS_04930 25771 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071573.1 protein_id gnl|my_center|LOCUS_04930 26153 27454 gene locus_tag LOCUS_04940 26153 27454 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071574.1 protein_id gnl|my_center|LOCUS_04940 29397 27442 gene locus_tag LOCUS_04950 gene pheA 29397 27442 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071575.1 protein_id gnl|my_center|LOCUS_04950 30017 29664 gene locus_tag LOCUS_04960 gene yfiA 30017 29664 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073280.1 protein_id gnl|my_center|LOCUS_04960 30331 31008 gene locus_tag LOCUS_04970 30331 31008 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_04970 31523 31071 gene locus_tag LOCUS_04980 31523 31071 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_04980 31721 31996 gene locus_tag LOCUS_04990 gene trpR 31721 31996 CDS product Trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073277.1 protein_id gnl|my_center|LOCUS_04990 32378 31998 gene locus_tag LOCUS_05000 32378 31998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073276.1 protein_id gnl|my_center|LOCUS_05000 32652 32416 gene locus_tag LOCUS_05010 32652 32416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 33178 32534 gene locus_tag LOCUS_05020 gene slyD 33178 32534 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT2 protein_id gnl|my_center|LOCUS_05020 33839 36304 gene locus_tag LOCUS_05030 gene thrA 33839 36304 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073273.1 protein_id gnl|my_center|LOCUS_05030 36301 37260 gene locus_tag LOCUS_05040 gene thrB 36301 37260 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT5 protein_id gnl|my_center|LOCUS_05040 37299 38582 gene locus_tag LOCUS_05050 gene thrC 37299 38582 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073271.1 protein_id gnl|my_center|LOCUS_05050 39589 38735 gene locus_tag LOCUS_05060 gene nfo 39589 38735 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z593 protein_id gnl|my_center|LOCUS_05060 39689 41698 gene locus_tag LOCUS_05070 39689 41698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 41686 42813 gene locus_tag LOCUS_05080 41686 42813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 42972 43514 gene locus_tag LOCUS_05090 42972 43514 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073378.1 protein_id gnl|my_center|LOCUS_05090 43759 43577 gene locus_tag LOCUS_05100 43759 43577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073377.1 protein_id gnl|my_center|LOCUS_05100 45587 43950 gene locus_tag LOCUS_05110 gene pgi 45587 43950 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 protein_id gnl|my_center|LOCUS_05110 46576 45623 gene locus_tag LOCUS_05120 gene tal 46576 45623 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH2 protein_id gnl|my_center|LOCUS_05120 46701 46853 gene locus_tag LOCUS_05130 46701 46853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 47925 46825 gene locus_tag LOCUS_05140 47925 46825 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073374.1 protein_id gnl|my_center|LOCUS_05140 50582 48216 gene locus_tag LOCUS_05150 gene xfp 50582 48216 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073372.1 protein_id gnl|my_center|LOCUS_05150 51006 52493 gene locus_tag LOCUS_05160 51006 52493 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073371.1 protein_id gnl|my_center|LOCUS_05160 52608 53384 gene locus_tag LOCUS_05170 52608 53384 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH6 protein_id gnl|my_center|LOCUS_05170 54863 53460 gene locus_tag LOCUS_05180 54863 53460 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_05180 54999 55295 gene locus_tag LOCUS_05190 gene hlyU 54999 55295 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006084975.1 protein_id gnl|my_center|LOCUS_05190 55625 55359 gene locus_tag LOCUS_05200 gene rpsT 55625 55359 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH9 protein_id gnl|my_center|LOCUS_05200 55923 57440 gene locus_tag LOCUS_05210 gene murJ 55923 57440 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_05210 57506 58441 gene locus_tag LOCUS_05220 gene ribF 57506 58441 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI3 protein_id gnl|my_center|LOCUS_05220 58474 61299 gene locus_tag LOCUS_05230 gene ileS 58474 61299 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_05230 61311 61826 gene locus_tag LOCUS_05240 gene lspA 61311 61826 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI5 protein_id gnl|my_center|LOCUS_05240 61832 62254 gene locus_tag LOCUS_05250 gene fkpB 61832 62254 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI6 protein_id gnl|my_center|LOCUS_05250 62256 63209 gene locus_tag LOCUS_05260 gene ispH 62256 63209 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI7 protein_id gnl|my_center|LOCUS_05260 63482 63994 gene locus_tag LOCUS_05270 gene pilV 63482 63994 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073361.1 protein_id gnl|my_center|LOCUS_05270 63999 64958 gene locus_tag LOCUS_05280 gene pilW 63999 64958 CDS product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_05280 64963 65427 gene locus_tag LOCUS_05290 gene pilX 64963 65427 CDS product pilus assembly protein PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073359.1 protein_id gnl|my_center|LOCUS_05290 65664 68999 gene locus_tag LOCUS_05300 gene pilY 65664 68999 CDS product type IV pili system adhesin PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_05300 69008 69403 gene locus_tag LOCUS_05310 gene pilE 69008 69403 CDS product type IV minor pilin protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_05310 69400 69699 gene locus_tag LOCUS_05320 69400 69699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 70148 69741 gene locus_tag LOCUS_05330 70148 69741 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_05330 71948 70200 gene locus_tag LOCUS_05340 71948 70200 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_05340 72830 71964 gene locus_tag LOCUS_05350 72830 71964 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071466.1 protein_id gnl|my_center|LOCUS_05350 76453 72920 gene locus_tag LOCUS_05360 76453 72920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 78067 76709 gene locus_tag LOCUS_05370 gene argW 78067 76709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 protein_id gnl|my_center|LOCUS_05370 79896 78352 gene locus_tag LOCUS_05380 79896 78352 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071593.1 protein_id gnl|my_center|LOCUS_05380 80425 81105 gene locus_tag LOCUS_05390 80425 81105 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071471.1 protein_id gnl|my_center|LOCUS_05390 82049 81186 gene locus_tag LOCUS_05400 82049 81186 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071472.1 protein_id gnl|my_center|LOCUS_05400 83061 82060 gene locus_tag LOCUS_05410 83061 82060 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071473.1 protein_id gnl|my_center|LOCUS_05410 83201 83719 gene locus_tag LOCUS_05420 83201 83719 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071474.1 protein_id gnl|my_center|LOCUS_05420 85505 85014 gene locus_tag LOCUS_05430 85505 85014 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGN7 protein_id gnl|my_center|LOCUS_05430 85620 86990 gene locus_tag LOCUS_05440 85620 86990 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071733.1 protein_id gnl|my_center|LOCUS_05440 88110 87133 gene locus_tag LOCUS_05450 88110 87133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704127.1 protein_id gnl|my_center|LOCUS_05450 88344 88859 gene locus_tag LOCUS_05460 88344 88859 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071734.1 protein_id gnl|my_center|LOCUS_05460 89059 90756 gene locus_tag LOCUS_05470 89059 90756 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071737.1 protein_id gnl|my_center|LOCUS_05470 93966 90850 gene locus_tag LOCUS_05480 93966 90850 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071738.1 protein_id gnl|my_center|LOCUS_05480 94269 94715 gene locus_tag LOCUS_05490 94269 94715 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389455.1 protein_id gnl|my_center|LOCUS_05490 95346 94855 gene locus_tag LOCUS_05500 gene ysnE 95346 94855 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 protein_id gnl|my_center|LOCUS_05500 97259 95646 gene locus_tag LOCUS_05510 gene pfaD 97259 95646 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 protein_id gnl|my_center|LOCUS_05510 103248 97303 gene locus_tag LOCUS_05520 gene pfaC 103248 97303 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071757.1 protein_id gnl|my_center|LOCUS_05520 105538 103256 gene locus_tag LOCUS_05530 105538 103256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 113124 105535 gene locus_tag LOCUS_05540 113124 105535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 113906 113121 gene locus_tag LOCUS_05550 gene pfaR 113906 113121 CDS product transcriptional regulator of eicosapentaenoic acid synthesis PfaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071760.1 protein_id gnl|my_center|LOCUS_05550 114307 114591 gene locus_tag LOCUS_05560 114307 114591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 114638 115405 gene locus_tag LOCUS_05570 gene pfaE 114638 115405 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071761.1 protein_id gnl|my_center|LOCUS_05570 115520 116110 gene locus_tag LOCUS_05580 gene tpx 115520 116110 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073211.1 protein_id gnl|my_center|LOCUS_05580 116817 116176 gene locus_tag LOCUS_05590 116817 116176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073212.1 protein_id gnl|my_center|LOCUS_05590 117181 118197 gene locus_tag LOCUS_05600 gene ybjU 117181 118197 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073208.1 protein_id gnl|my_center|LOCUS_05600 118363 118731 gene locus_tag LOCUS_05610 118363 118731 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071672.1 protein_id gnl|my_center|LOCUS_05610 118966 118769 gene locus_tag LOCUS_05620 118966 118769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071673.1 protein_id gnl|my_center|LOCUS_05620 119228 118977 gene locus_tag LOCUS_05630 119228 118977 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071475.1 protein_id gnl|my_center|LOCUS_05630 119937 119536 gene locus_tag LOCUS_05640 119937 119536 CDS product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 protein_id gnl|my_center|LOCUS_05640 120741 119980 gene locus_tag LOCUS_05650 gene xni 120741 119980 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGP9 protein_id gnl|my_center|LOCUS_05650 122093 120738 gene locus_tag LOCUS_05660 122093 120738 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071722.1 protein_id gnl|my_center|LOCUS_05660 123685 122129 gene locus_tag LOCUS_05670 123685 122129 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071723.1 protein_id gnl|my_center|LOCUS_05670 125988 123844 gene locus_tag LOCUS_05680 125988 123844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071724.1 protein_id gnl|my_center|LOCUS_05680 126118 127932 gene locus_tag LOCUS_05690 126118 127932 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_05690 128964 128053 gene locus_tag LOCUS_05700 gene rdgC 128964 128053 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGP3 protein_id gnl|my_center|LOCUS_05700 129260 130189 gene locus_tag LOCUS_05710 129260 130189 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 protein_id gnl|my_center|LOCUS_05710 130696 131385 gene locus_tag LOCUS_05720 gene phoB 130696 131385 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 protein_id gnl|my_center|LOCUS_05720 131460 132761 gene locus_tag LOCUS_05730 gene phoR 131460 132761 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071728.1 protein_id gnl|my_center|LOCUS_05730 133119 134090 gene locus_tag LOCUS_05740 gene pstS 133119 134090 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_05740 135040 134138 gene locus_tag LOCUS_05750 gene lldR 135040 134138 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073307.1 protein_id gnl|my_center|LOCUS_05750 135265 136218 gene locus_tag LOCUS_05760 135265 136218 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073308.1 protein_id gnl|my_center|LOCUS_05760 136311 137972 gene locus_tag LOCUS_05770 gene recN 136311 137972 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP7 protein_id gnl|my_center|LOCUS_05770 138021 138434 gene locus_tag LOCUS_05780 138021 138434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 139964 138732 gene locus_tag LOCUS_05790 139964 138732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 141557 140094 gene locus_tag LOCUS_05800 141557 140094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490128.1 protein_id gnl|my_center|LOCUS_05800 142148 144310 gene locus_tag LOCUS_05810 142148 144310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 144323 145039 gene locus_tag LOCUS_05820 144323 145039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 145719 145171 gene locus_tag LOCUS_05830 145719 145171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05830 146372 145998 gene locus_tag LOCUS_05840 146372 145998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 146973 146374 gene locus_tag LOCUS_05850 146973 146374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 protein_id gnl|my_center|LOCUS_05850 149728 146963 gene locus_tag LOCUS_05860 gene barA 149728 146963 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ2 protein_id gnl|my_center|LOCUS_05860 149845 151182 gene locus_tag LOCUS_05870 gene rlmD 149845 151182 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ3 protein_id gnl|my_center|LOCUS_05870 151309 153519 gene locus_tag LOCUS_05880 gene relA 151309 153519 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 protein_id gnl|my_center|LOCUS_05880 153643 154449 gene locus_tag LOCUS_05890 153643 154449 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073298.1 protein_id gnl|my_center|LOCUS_05890 154725 154579 gene locus_tag LOCUS_05900 154725 154579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 154724 156247 gene locus_tag LOCUS_05910 gene pyrG 154724 156247 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ9 protein_id gnl|my_center|LOCUS_05910 156399 157694 gene locus_tag LOCUS_05920 gene eno 156399 157694 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR0 protein_id gnl|my_center|LOCUS_05920 157793 158095 gene locus_tag LOCUS_05930 gene ftsB 157793 158095 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_05930 158124 158876 gene locus_tag LOCUS_05940 gene ispD 158124 158876 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR2 protein_id gnl|my_center|LOCUS_05940 158892 159371 gene locus_tag LOCUS_05950 gene ispF 158892 159371 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_05950 159406 160470 gene locus_tag LOCUS_05960 gene truD 159406 160470 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR4 protein_id gnl|my_center|LOCUS_05960 160467 161213 gene locus_tag LOCUS_05970 gene surE 160467 161213 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR5 protein_id gnl|my_center|LOCUS_05970 161210 161845 gene locus_tag LOCUS_05980 gene pcm 161210 161845 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR6 protein_id gnl|my_center|LOCUS_05980 161873 162811 gene locus_tag LOCUS_05990 gene nlpD 161873 162811 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073289.1 protein_id gnl|my_center|LOCUS_05990 162890 163846 gene locus_tag LOCUS_06000 gene rpoS 162890 163846 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR8 protein_id gnl|my_center|LOCUS_06000 166489 163931 gene locus_tag LOCUS_06010 gene mutS 166489 163931 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR9 protein_id gnl|my_center|LOCUS_06010 166806 167870 gene locus_tag LOCUS_06020 gene recA 166806 167870 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS0 protein_id gnl|my_center|LOCUS_06020 167882 168313 gene locus_tag LOCUS_06030 gene recX 167882 168313 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59207 protein_id gnl|my_center|LOCUS_06030 168782 171406 gene locus_tag LOCUS_06040 gene alaS 168782 171406 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS1 protein_id gnl|my_center|LOCUS_06040 171429 172667 gene locus_tag LOCUS_06050 171429 172667 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS2 protein_id gnl|my_center|LOCUS_06050 172784 172981 gene locus_tag LOCUS_06060 gene csrA 172784 172981 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS3 protein_id gnl|my_center|LOCUS_06060 173186 173277 gene locus_tag LOCUS_t00110 173186 173277 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 173296 173372 gene locus_tag LOCUS_t00120 173296 173372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 485 970 gene locus_tag LOCUS_06070 485 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072780.1 protein_id gnl|my_center|LOCUS_06070 1249 2457 gene locus_tag LOCUS_06080 1249 2457 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072779.1 protein_id gnl|my_center|LOCUS_06080 2575 3396 gene locus_tag LOCUS_06090 2575 3396 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754740.1 protein_id gnl|my_center|LOCUS_06090 3432 4052 gene locus_tag LOCUS_06100 3432 4052 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDA2 protein_id gnl|my_center|LOCUS_06100 4188 4021 gene locus_tag LOCUS_06110 4188 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4464 4730 gene locus_tag LOCUS_06120 4464 4730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 protein_id gnl|my_center|LOCUS_06120 4742 6475 gene locus_tag LOCUS_06130 4742 6475 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072775.1 protein_id gnl|my_center|LOCUS_06130 7852 6527 gene locus_tag LOCUS_06140 gene tnpA 7852 6527 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071337.1 protein_id gnl|my_center|LOCUS_06140 8125 9972 gene locus_tag LOCUS_06150 8125 9972 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 protein_id gnl|my_center|LOCUS_06150 9974 10645 gene locus_tag LOCUS_06160 9974 10645 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072773.1 protein_id gnl|my_center|LOCUS_06160 10794 11387 gene locus_tag LOCUS_06170 10794 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072772.1 protein_id gnl|my_center|LOCUS_06170 11453 12064 gene locus_tag LOCUS_06180 11453 12064 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 protein_id gnl|my_center|LOCUS_06180 12291 13229 gene locus_tag LOCUS_06190 gene cheV 12291 13229 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072079.1 protein_id gnl|my_center|LOCUS_06190 13658 13239 gene locus_tag LOCUS_06200 13658 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 13761 13895 gene locus_tag LOCUS_06210 13761 13895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 14301 13942 gene locus_tag LOCUS_06220 14301 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072081.1 protein_id gnl|my_center|LOCUS_06220 14511 15722 gene locus_tag LOCUS_06230 14511 15722 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072082.1 protein_id gnl|my_center|LOCUS_06230 15871 16743 gene locus_tag LOCUS_06240 15871 16743 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_06240 16814 17296 gene locus_tag LOCUS_06250 16814 17296 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_06250 17367 17594 gene locus_tag LOCUS_06260 17367 17594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 18606 17599 gene locus_tag LOCUS_06270 18606 17599 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 protein_id gnl|my_center|LOCUS_06270 18786 19457 gene locus_tag LOCUS_06280 18786 19457 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_06280 19860 21554 gene locus_tag LOCUS_06290 gene ushA 19860 21554 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072087.1 protein_id gnl|my_center|LOCUS_06290 21826 22275 gene locus_tag LOCUS_06300 gene ibpA 21826 22275 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_06300 23708 22389 gene locus_tag LOCUS_06310 gene yuiF 23708 22389 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 protein_id gnl|my_center|LOCUS_06310 24021 24626 gene locus_tag LOCUS_06320 gene tsaA 24021 24626 CDS product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_06320 24758 25774 gene locus_tag LOCUS_06330 24758 25774 CDS product Galanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 protein_id gnl|my_center|LOCUS_06330 26669 25995 gene locus_tag LOCUS_06340 gene rnt 26669 25995 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDJ2 protein_id gnl|my_center|LOCUS_06340 26810 27682 gene locus_tag LOCUS_06350 gene motY 26810 27682 CDS product smf-dependent flagellar motor protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 protein_id gnl|my_center|LOCUS_06350 28252 27755 gene locus_tag LOCUS_06360 gene ilvH 28252 27755 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072288.1 protein_id gnl|my_center|LOCUS_06360 29973 28252 gene locus_tag LOCUS_06370 gene ilvI 29973 28252 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EET7 protein_id gnl|my_center|LOCUS_06370 31690 30458 gene locus_tag LOCUS_06380 31690 30458 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072290.1 protein_id gnl|my_center|LOCUS_06380 31949 33745 gene locus_tag LOCUS_06390 31949 33745 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072293.1 protein_id gnl|my_center|LOCUS_06390 34445 33801 gene locus_tag LOCUS_06400 34445 33801 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_06400 34510 34749 gene locus_tag LOCUS_06410 34510 34749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 34749 35732 gene locus_tag LOCUS_06420 34749 35732 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_06420 36102 37550 gene locus_tag LOCUS_06430 gene phoA 36102 37550 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_06430 37565 39202 gene locus_tag LOCUS_06440 gene phoA 37565 39202 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_06440 39415 39257 gene locus_tag LOCUS_06450 39415 39257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 39476 40333 gene locus_tag LOCUS_06460 39476 40333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 41882 40392 gene locus_tag LOCUS_06470 gene ppx 41882 40392 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072220.1 protein_id gnl|my_center|LOCUS_06470 44001 41899 gene locus_tag LOCUS_06480 gene ppk 44001 41899 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM32 protein_id gnl|my_center|LOCUS_06480 44377 45750 gene locus_tag LOCUS_06490 gene yegD 44377 45750 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_06490 45788 46276 gene locus_tag LOCUS_06500 gene creA 45788 46276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072222.1 protein_id gnl|my_center|LOCUS_06500 47721 46372 gene locus_tag LOCUS_06510 47721 46372 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_06510 47934 48818 gene locus_tag LOCUS_06520 gene queD 47934 48818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_06520 48938 49864 gene locus_tag LOCUS_06530 48938 49864 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_06530 50766 49954 gene locus_tag LOCUS_06540 gene xth 50766 49954 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072940.1 protein_id gnl|my_center|LOCUS_06540 51065 50766 gene locus_tag LOCUS_06550 gene yciL 51065 50766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_06550 51610 51065 gene locus_tag LOCUS_06560 51610 51065 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59365 protein_id gnl|my_center|LOCUS_06560 52143 51706 gene locus_tag LOCUS_06570 52143 51706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072822.1 protein_id gnl|my_center|LOCUS_06570 54695 52554 gene locus_tag LOCUS_06580 gene pta 54695 52554 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED54 protein_id gnl|my_center|LOCUS_06580 55988 54789 gene locus_tag LOCUS_06590 gene ackA 55988 54789 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED55 protein_id gnl|my_center|LOCUS_06590 56149 56592 gene locus_tag LOCUS_06600 56149 56592 CDS product UPF0208 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED56 protein_id gnl|my_center|LOCUS_06600 57336 56596 gene locus_tag LOCUS_06610 gene pflA 57336 56596 CDS product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED57 protein_id gnl|my_center|LOCUS_06610 59676 57394 gene locus_tag LOCUS_06620 gene pflB 59676 57394 CDS product formate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072817.1 protein_id gnl|my_center|LOCUS_06620 60590 59706 gene locus_tag LOCUS_06630 gene focA 60590 59706 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 protein_id gnl|my_center|LOCUS_06630 61463 61675 gene locus_tag LOCUS_06640 61463 61675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 61672 63120 gene locus_tag LOCUS_06650 gene panF 61672 63120 CDS product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 protein_id gnl|my_center|LOCUS_06650 65851 63203 gene locus_tag LOCUS_06660 65851 63203 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 protein_id gnl|my_center|LOCUS_06660 69030 66328 gene locus_tag LOCUS_06670 69030 66328 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 protein_id gnl|my_center|LOCUS_06670 70459 69452 gene locus_tag LOCUS_06680 70459 69452 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072814.1 protein_id gnl|my_center|LOCUS_06680 71621 70551 gene locus_tag LOCUS_06690 71621 70551 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_06690 72901 71933 gene locus_tag LOCUS_06700 gene cysK 72901 71933 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED64 protein_id gnl|my_center|LOCUS_06700 73362 74486 gene locus_tag LOCUS_06710 73362 74486 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072810.1 protein_id gnl|my_center|LOCUS_06710 76617 74587 gene locus_tag LOCUS_06720 gene metG 76617 74587 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX2 protein_id gnl|my_center|LOCUS_06720 76777 77892 gene locus_tag LOCUS_06730 gene apbC 76777 77892 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX3 protein_id gnl|my_center|LOCUS_06730 77965 78543 gene locus_tag LOCUS_06740 gene udk 77965 78543 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX4 protein_id gnl|my_center|LOCUS_06740 78574 79155 gene locus_tag LOCUS_06750 gene dcd 78574 79155 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX5 protein_id gnl|my_center|LOCUS_06750 79164 80003 gene locus_tag LOCUS_06760 gene pabC 79164 80003 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 protein_id gnl|my_center|LOCUS_06760 80000 81007 gene locus_tag LOCUS_06770 gene yceG 80000 81007 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072563.1 protein_id gnl|my_center|LOCUS_06770 81007 81639 gene locus_tag LOCUS_06780 gene tmk 81007 81639 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX8 protein_id gnl|my_center|LOCUS_06780 81665 82576 gene locus_tag LOCUS_06790 gene holB 81665 82576 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072561.1 protein_id gnl|my_center|LOCUS_06790 82587 82913 gene locus_tag LOCUS_06800 82587 82913 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072560.1 protein_id gnl|my_center|LOCUS_06800 82958 83746 gene locus_tag LOCUS_06810 gene ycfH 82958 83746 CDS product DNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072559.1 protein_id gnl|my_center|LOCUS_06810 85509 84106 gene locus_tag LOCUS_06820 gene rsmF 85509 84106 CDS product ribosomal RNA small subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDY2 protein_id gnl|my_center|LOCUS_06820 85581 86807 gene locus_tag LOCUS_06830 85581 86807 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_06830 89491 86870 gene locus_tag LOCUS_06840 89491 86870 CDS product multivalent adhesion molecule 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072556.1 protein_id gnl|my_center|LOCUS_06840 90107 89469 gene locus_tag LOCUS_06850 90107 89469 CDS product PqiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072555.1 protein_id gnl|my_center|LOCUS_06850 90744 90097 gene locus_tag LOCUS_06860 90744 90097 CDS product PqiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072554.1 protein_id gnl|my_center|LOCUS_06860 90941 91228 gene locus_tag LOCUS_06870 gene yebG 90941 91228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072553.1 protein_id gnl|my_center|LOCUS_06870 91242 91700 gene locus_tag LOCUS_06880 gene yebR 91242 91700 CDS product free methionine-R-sulfoxide reductase YebR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072552.1 protein_id gnl|my_center|LOCUS_06880 91964 92620 gene locus_tag LOCUS_06890 gene proQ 91964 92620 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDY8 protein_id gnl|my_center|LOCUS_06890 92651 94714 gene locus_tag LOCUS_06900 gene prc 92651 94714 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072550.1 protein_id gnl|my_center|LOCUS_06900 94839 97424 gene locus_tag LOCUS_06910 gene pepN 94839 97424 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072549.1 protein_id gnl|my_center|LOCUS_06910 97433 97648 gene locus_tag LOCUS_06920 97433 97648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072548.1 protein_id gnl|my_center|LOCUS_06920 97965 100019 gene locus_tag LOCUS_06930 97965 100019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_06930 100033 101400 gene locus_tag LOCUS_06940 100033 101400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_06940 101484 102524 gene locus_tag LOCUS_06950 101484 102524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_06950 102537 104846 gene locus_tag LOCUS_06960 102537 104846 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_06960 105111 109958 gene locus_tag LOCUS_06970 gene gdh 105111 109958 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_06970 110020 111039 gene locus_tag LOCUS_06980 gene pyrD 110020 111039 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDZ8 protein_id gnl|my_center|LOCUS_06980 111307 111759 gene locus_tag LOCUS_06990 gene zapC 111307 111759 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDZ9 protein_id gnl|my_center|LOCUS_06990 112610 111906 gene locus_tag LOCUS_07000 gene hisI 112610 111906 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB6 protein_id gnl|my_center|LOCUS_07000 113465 112692 gene locus_tag LOCUS_07010 gene hisF 113465 112692 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX42 protein_id gnl|my_center|LOCUS_07010 114184 113447 gene locus_tag LOCUS_07020 gene hisA 114184 113447 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB5 protein_id gnl|my_center|LOCUS_07020 114843 114181 gene locus_tag LOCUS_07030 gene hisH 114843 114181 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB4 protein_id gnl|my_center|LOCUS_07030 115910 114843 gene locus_tag LOCUS_07040 gene hisB 115910 114843 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB3 protein_id gnl|my_center|LOCUS_07040 117057 115954 gene locus_tag LOCUS_07050 gene hisC 117057 115954 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB2 protein_id gnl|my_center|LOCUS_07050 118451 117063 gene locus_tag LOCUS_07060 gene hisD 118451 117063 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB1 protein_id gnl|my_center|LOCUS_07060 119351 118455 gene locus_tag LOCUS_07070 gene hisG 119351 118455 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFB0 protein_id gnl|my_center|LOCUS_07070 119906 121846 gene locus_tag LOCUS_07080 119906 121846 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072146.1 protein_id gnl|my_center|LOCUS_07080 122975 121965 gene locus_tag LOCUS_07090 gene hemB 122975 121965 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE03 protein_id gnl|my_center|LOCUS_07090 123562 123128 gene locus_tag LOCUS_07100 123562 123128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 124542 123607 gene locus_tag LOCUS_07110 124542 123607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 126027 124735 gene locus_tag LOCUS_07120 126027 124735 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072061.1 protein_id gnl|my_center|LOCUS_07120 126197 126913 gene locus_tag LOCUS_07130 gene yeaZ 126197 126913 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 protein_id gnl|my_center|LOCUS_07130 126975 127274 gene locus_tag LOCUS_07140 126975 127274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072534.1 protein_id gnl|my_center|LOCUS_07140 127318 127968 gene locus_tag LOCUS_07150 127318 127968 CDS product membrane zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 protein_id gnl|my_center|LOCUS_07150 128095 128940 gene locus_tag LOCUS_07160 128095 128940 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_07160 128962 129855 gene locus_tag LOCUS_07170 128962 129855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072531.1 protein_id gnl|my_center|LOCUS_07170 130058 131731 gene locus_tag LOCUS_07180 gene fadD 130058 131731 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 protein_id gnl|my_center|LOCUS_07180 131803 132912 gene locus_tag LOCUS_07190 gene rnd 131803 132912 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE10 protein_id gnl|my_center|LOCUS_07190 133302 133042 gene locus_tag LOCUS_07200 gene minE 133302 133042 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE12 protein_id gnl|my_center|LOCUS_07200 134115 133306 gene locus_tag LOCUS_07210 gene minD 134115 133306 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE13 protein_id gnl|my_center|LOCUS_07210 134807 134142 gene locus_tag LOCUS_07220 gene minC 134807 134142 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE14 protein_id gnl|my_center|LOCUS_07220 134891 135217 gene locus_tag LOCUS_07230 134891 135217 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE15 protein_id gnl|my_center|LOCUS_07230 135233 136210 gene locus_tag LOCUS_07240 135233 136210 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 protein_id gnl|my_center|LOCUS_07240 136259 136699 gene locus_tag LOCUS_07250 136259 136699 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE17 protein_id gnl|my_center|LOCUS_07250 137299 136787 gene locus_tag LOCUS_07260 gene dsbB 137299 136787 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59346 protein_id gnl|my_center|LOCUS_07260 139032 137443 gene locus_tag LOCUS_07270 gene nhaB 139032 137443 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED79 protein_id gnl|my_center|LOCUS_07270 139337 140056 gene locus_tag LOCUS_07280 gene fadR 139337 140056 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED80 protein_id gnl|my_center|LOCUS_07280 141648 140128 gene locus_tag LOCUS_07290 141648 140128 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072795.1 protein_id gnl|my_center|LOCUS_07290 142929 141661 gene locus_tag LOCUS_07300 142929 141661 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59352 protein_id gnl|my_center|LOCUS_07300 144915 142981 gene locus_tag LOCUS_07310 gene prkA 144915 142981 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072793.1 protein_id gnl|my_center|LOCUS_07310 145766 145182 gene locus_tag LOCUS_07320 gene sodB 145766 145182 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED83 protein_id gnl|my_center|LOCUS_07320 145987 146322 gene locus_tag LOCUS_07330 gene grxD 145987 146322 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED84 protein_id gnl|my_center|LOCUS_07330 146809 146621 gene locus_tag LOCUS_07340 146809 146621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 147007 149559 gene locus_tag LOCUS_07350 147007 149559 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 protein_id gnl|my_center|LOCUS_07350 150022 149612 gene locus_tag LOCUS_07360 gene gloA 150022 149612 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD7 protein_id gnl|my_center|LOCUS_07360 151076 150435 gene locus_tag LOCUS_07370 gene nth 151076 150435 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW8 protein_id gnl|my_center|LOCUS_07370 151781 151086 gene locus_tag LOCUS_07380 gene rnfE 151781 151086 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE76 protein_id gnl|my_center|LOCUS_07380 152413 151778 gene locus_tag LOCUS_07390 gene rnfG 152413 151778 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE77 protein_id gnl|my_center|LOCUS_07390 153484 152432 gene locus_tag LOCUS_07400 gene rnfD 153484 152432 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE78 protein_id gnl|my_center|LOCUS_07400 156176 153486 gene locus_tag LOCUS_07410 gene rnfC 156176 153486 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE79 protein_id gnl|my_center|LOCUS_07410 156739 156170 gene locus_tag LOCUS_07420 gene rnfB 156739 156170 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_07420 157322 156744 gene locus_tag LOCUS_07430 gene rnfA 157322 156744 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE81 protein_id gnl|my_center|LOCUS_07430 159342 157438 gene locus_tag LOCUS_07440 159342 157438 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 protein_id gnl|my_center|LOCUS_07440 159507 159432 gene locus_tag LOCUS_t00130 159507 159432 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 342 64 gene locus_tag LOCUS_07450 342 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 543 992 gene locus_tag LOCUS_07460 543 992 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070600.1 protein_id gnl|my_center|LOCUS_07460 1810 995 gene locus_tag LOCUS_07470 gene murI 1810 995 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK90 protein_id gnl|my_center|LOCUS_07470 1992 3080 gene locus_tag LOCUS_07480 gene trmA 1992 3080 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX51 protein_id gnl|my_center|LOCUS_07480 3263 3472 gene locus_tag LOCUS_07490 3263 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4106 3492 gene locus_tag LOCUS_07500 gene fabR 4106 3492 CDS product DNA-binding transcriptional regulator FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070594.1 protein_id gnl|my_center|LOCUS_07500 4250 5356 gene locus_tag LOCUS_07510 gene oel1 4250 5356 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_07510 5487 6530 gene locus_tag LOCUS_07520 gene selD 5487 6530 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK99 protein_id gnl|my_center|LOCUS_07520 6527 7642 gene locus_tag LOCUS_07530 gene selU 6527 7642 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKA0 protein_id gnl|my_center|LOCUS_07530 9579 7708 gene locus_tag LOCUS_07540 9579 7708 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070590.1 protein_id gnl|my_center|LOCUS_07540 10184 9570 gene locus_tag LOCUS_07550 10184 9570 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070589.1 protein_id gnl|my_center|LOCUS_07550 10876 10439 gene locus_tag LOCUS_07560 10876 10439 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070588.1 protein_id gnl|my_center|LOCUS_07560 11693 10881 gene locus_tag LOCUS_07570 gene cysQ 11693 10881 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 protein_id gnl|my_center|LOCUS_07570 12316 11753 gene locus_tag LOCUS_07580 gene nudE 12316 11753 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 protein_id gnl|my_center|LOCUS_07580 13273 12512 gene locus_tag LOCUS_07590 gene gspN 13273 12512 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 protein_id gnl|my_center|LOCUS_07590 13762 13283 gene locus_tag LOCUS_07600 gene gspM 13762 13283 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC0 protein_id gnl|my_center|LOCUS_07600 14953 13763 gene locus_tag LOCUS_07610 gene gspL 14953 13763 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_07610 15991 15002 gene locus_tag LOCUS_07620 gene gspK 15991 15002 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC2 protein_id gnl|my_center|LOCUS_07620 16722 15991 gene locus_tag LOCUS_07630 gene gspJ 16722 15991 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070569.1 protein_id gnl|my_center|LOCUS_07630 17053 16703 gene locus_tag LOCUS_07640 gene gspI 17053 16703 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070568.1 protein_id gnl|my_center|LOCUS_07640 17645 17073 gene locus_tag LOCUS_07650 gene gspH 17645 17073 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 protein_id gnl|my_center|LOCUS_07650 18081 17647 gene locus_tag LOCUS_07660 gene gspG 18081 17647 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070566.1 protein_id gnl|my_center|LOCUS_07660 19354 18131 gene locus_tag LOCUS_07670 gene gspF 19354 18131 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_07670 20923 19358 gene locus_tag LOCUS_07680 gene gspE 20923 19358 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_07680 23039 20916 gene locus_tag LOCUS_07690 gene gspD 23039 20916 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 protein_id gnl|my_center|LOCUS_07690 23980 23066 gene locus_tag LOCUS_07700 gene gspC 23980 23066 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 protein_id gnl|my_center|LOCUS_07700 24240 24638 gene locus_tag LOCUS_07710 gene hslR 24240 24638 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKD1 protein_id gnl|my_center|LOCUS_07710 24658 25521 gene locus_tag LOCUS_07720 gene hslO 24658 25521 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKD2 protein_id gnl|my_center|LOCUS_07720 25688 27229 gene locus_tag LOCUS_07730 gene pckA 25688 27229 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKD3 protein_id gnl|my_center|LOCUS_07730 27366 27797 gene locus_tag LOCUS_07740 27366 27797 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_07740 28229 27807 gene locus_tag LOCUS_07750 28229 27807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 29197 28229 gene locus_tag LOCUS_07760 gene lafU 29197 28229 CDS product chemotaxis protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03478 protein_id gnl|my_center|LOCUS_07760 30054 29197 gene locus_tag LOCUS_07770 gene lafT 30054 29197 CDS product chemotaxis protein LafT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03477 protein_id gnl|my_center|LOCUS_07770 30792 30070 gene locus_tag LOCUS_07780 30792 30070 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 protein_id gnl|my_center|LOCUS_07780 31249 30803 gene locus_tag LOCUS_07790 31249 30803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 32494 31277 gene locus_tag LOCUS_07800 32494 31277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 32832 32491 gene locus_tag LOCUS_07810 32832 32491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 33205 32825 gene locus_tag LOCUS_07820 33205 32825 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YT5 protein_id gnl|my_center|LOCUS_07820 34554 33217 gene locus_tag LOCUS_07830 gene fliDL 34554 33217 CDS product lateral flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03475 protein_id gnl|my_center|LOCUS_07830 35590 34808 gene locus_tag LOCUS_07840 gene lafA 35590 34808 CDS product lateral flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03473 protein_id gnl|my_center|LOCUS_07840 36667 35687 gene locus_tag LOCUS_07850 36667 35687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 37634 36717 gene locus_tag LOCUS_07860 gene lfgL 37634 36717 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 protein_id gnl|my_center|LOCUS_07860 39015 37645 gene locus_tag LOCUS_07870 gene lfgK 39015 37645 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8E4 protein_id gnl|my_center|LOCUS_07870 39410 39012 gene locus_tag LOCUS_07880 39410 39012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 40531 39410 gene locus_tag LOCUS_07890 gene flgI1 40531 39410 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI2 protein_id gnl|my_center|LOCUS_07890 41193 40543 gene locus_tag LOCUS_07900 gene flgH2 41193 40543 CDS product flagellar L-ring protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI3 protein_id gnl|my_center|LOCUS_07900 41996 41211 gene locus_tag LOCUS_07910 41996 41211 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI4 protein_id gnl|my_center|LOCUS_07910 42747 42016 gene locus_tag LOCUS_07920 42747 42016 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI5 protein_id gnl|my_center|LOCUS_07920 43957 42758 gene locus_tag LOCUS_07930 43957 42758 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JI6 protein_id gnl|my_center|LOCUS_07930 44637 43969 gene locus_tag LOCUS_07940 44637 43969 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YU9 protein_id gnl|my_center|LOCUS_07940 45056 44646 gene locus_tag LOCUS_07950 45056 44646 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YV0 protein_id gnl|my_center|LOCUS_07950 45433 45059 gene locus_tag LOCUS_07960 45433 45059 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YV1 protein_id gnl|my_center|LOCUS_07960 45489 46235 gene locus_tag LOCUS_07970 45489 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 46296 46580 gene locus_tag LOCUS_07980 46296 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 46577 47029 gene locus_tag LOCUS_07990 46577 47029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 47443 47012 gene locus_tag LOCUS_08000 47443 47012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 48681 47440 gene locus_tag LOCUS_08010 48681 47440 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478244.1 protein_id gnl|my_center|LOCUS_08010 49492 48755 gene locus_tag LOCUS_08020 gene fliH 49492 48755 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478070.1 protein_id gnl|my_center|LOCUS_08020 50496 49492 gene locus_tag LOCUS_08030 gene fliG 50496 49492 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478340.1 protein_id gnl|my_center|LOCUS_08030 52156 50489 gene locus_tag LOCUS_08040 52156 50489 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FY4 protein_id gnl|my_center|LOCUS_08040 52501 52166 gene locus_tag LOCUS_08050 52501 52166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 53831 52527 gene locus_tag LOCUS_08060 53831 52527 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462798.1 protein_id gnl|my_center|LOCUS_08060 54690 53842 gene locus_tag LOCUS_08070 54690 53842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 55424 56140 gene locus_tag LOCUS_08080 55424 56140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 56115 56459 gene locus_tag LOCUS_08090 56115 56459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 56434 57192 gene locus_tag LOCUS_08100 gene fliP 56434 57192 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FX8 protein_id gnl|my_center|LOCUS_08100 57197 57466 gene locus_tag LOCUS_08110 57197 57466 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462792.1 protein_id gnl|my_center|LOCUS_08110 57469 58248 gene locus_tag LOCUS_08120 57469 58248 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FX6 protein_id gnl|my_center|LOCUS_08120 58245 59375 gene locus_tag LOCUS_08130 58245 59375 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462787.1 protein_id gnl|my_center|LOCUS_08130 59387 61465 gene locus_tag LOCUS_08140 59387 61465 CDS product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478396.1 protein_id gnl|my_center|LOCUS_08140 61538 62461 gene locus_tag LOCUS_08150 gene pbpG 61538 62461 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 protein_id gnl|my_center|LOCUS_08150 62586 66080 gene locus_tag LOCUS_08160 62586 66080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 66250 67743 gene locus_tag LOCUS_08170 66250 67743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 68385 67987 gene locus_tag LOCUS_08180 68385 67987 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070490.1 protein_id gnl|my_center|LOCUS_08180 70617 68413 gene locus_tag LOCUS_08190 70617 68413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070489.1 protein_id gnl|my_center|LOCUS_08190 72538 70745 gene locus_tag LOCUS_08200 gene icfE 72538 70745 CDS product long-chain-fatty-acid--CoA ligase IcfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070488.1 protein_id gnl|my_center|LOCUS_08200 73176 72793 gene locus_tag LOCUS_08210 73176 72793 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_08210 73308 74750 gene locus_tag LOCUS_08220 73308 74750 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 protein_id gnl|my_center|LOCUS_08220 74747 75481 gene locus_tag LOCUS_08230 gene natA 74747 75481 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 protein_id gnl|my_center|LOCUS_08230 75478 76614 gene locus_tag LOCUS_08240 gene natB 75478 76614 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 protein_id gnl|my_center|LOCUS_08240 77276 76743 gene locus_tag LOCUS_08250 gene mogA 77276 76743 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_08250 78189 77350 gene locus_tag LOCUS_08260 78189 77350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 78721 78206 gene locus_tag LOCUS_08270 gene nlpC 78721 78206 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070475.1 protein_id gnl|my_center|LOCUS_08270 78851 79342 gene locus_tag LOCUS_08280 78851 79342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 79570 80151 gene locus_tag LOCUS_08290 79570 80151 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_08290 80344 87198 gene locus_tag LOCUS_08300 80344 87198 CDS product GlyGly-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070585.1 protein_id gnl|my_center|LOCUS_08300 89378 87282 gene locus_tag LOCUS_08310 89378 87282 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070840.1 protein_id gnl|my_center|LOCUS_08310 89641 90408 gene locus_tag LOCUS_08320 89641 90408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 91858 90512 gene locus_tag LOCUS_08330 gene gor 91858 90512 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074290.1 protein_id gnl|my_center|LOCUS_08330 92511 91987 gene locus_tag LOCUS_08340 92511 91987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074289.1 protein_id gnl|my_center|LOCUS_08340 93299 92592 gene locus_tag LOCUS_08350 93299 92592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074288.1 protein_id gnl|my_center|LOCUS_08350 93618 95657 gene locus_tag LOCUS_08360 gene prlC 93618 95657 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_08360 95772 96302 gene locus_tag LOCUS_08370 95772 96302 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_08370 96964 96311 gene locus_tag LOCUS_08380 gene gst 96964 96311 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074285.1 protein_id gnl|my_center|LOCUS_08380 97962 97057 gene locus_tag LOCUS_08390 97962 97057 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 protein_id gnl|my_center|LOCUS_08390 98082 98951 gene locus_tag LOCUS_08400 98082 98951 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104045.1 protein_id gnl|my_center|LOCUS_08400 99092 99781 gene locus_tag LOCUS_08410 99092 99781 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074284.1 protein_id gnl|my_center|LOCUS_08410 99946 99662 gene locus_tag LOCUS_08420 99946 99662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 102554 100446 gene locus_tag LOCUS_08430 102554 100446 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 protein_id gnl|my_center|LOCUS_08430 103987 102557 gene locus_tag LOCUS_08440 103987 102557 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_08440 104220 105032 gene locus_tag LOCUS_08450 gene tupA 104220 105032 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074305.1 protein_id gnl|my_center|LOCUS_08450 105029 105736 gene locus_tag LOCUS_08460 gene tupB 105029 105736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074306.1 protein_id gnl|my_center|LOCUS_08460 105745 106452 gene locus_tag LOCUS_08470 gene tupC 105745 106452 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 protein_id gnl|my_center|LOCUS_08470 106436 107029 gene locus_tag LOCUS_08480 gene mobA 106436 107029 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 protein_id gnl|my_center|LOCUS_08480 107039 108844 gene locus_tag LOCUS_08490 gene mobB/moeA 107039 108844 CDS product bifunctional molybdopterin-guanine dinucleotide biosynthesis protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074309.1 protein_id gnl|my_center|LOCUS_08490 108853 109839 gene locus_tag LOCUS_08500 gene moaA 108853 109839 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E1 protein_id gnl|my_center|LOCUS_08500 109894 110352 gene locus_tag LOCUS_08510 gene mutM 109894 110352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074311.1 protein_id gnl|my_center|LOCUS_08510 110369 111184 gene locus_tag LOCUS_08520 gene mutM 110369 111184 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D9 protein_id gnl|my_center|LOCUS_08520 112913 111192 gene locus_tag LOCUS_08530 112913 111192 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074280.1 protein_id gnl|my_center|LOCUS_08530 113560 112913 gene locus_tag LOCUS_08540 113560 112913 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074279.1 protein_id gnl|my_center|LOCUS_08540 114389 113589 gene locus_tag LOCUS_08550 114389 113589 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074278.1 protein_id gnl|my_center|LOCUS_08550 116000 114519 gene locus_tag LOCUS_08560 116000 114519 CDS product outer membrane protein in capsule/EPS biosynthesis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 protein_id gnl|my_center|LOCUS_08560 116509 116018 gene locus_tag LOCUS_08570 gene coaD 116509 116018 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_08570 116823 117857 gene locus_tag LOCUS_08580 116823 117857 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44011 protein_id gnl|my_center|LOCUS_08580 117909 118862 gene locus_tag LOCUS_08590 gene hldD 117909 118862 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV3 protein_id gnl|my_center|LOCUS_08590 118888 119748 gene locus_tag LOCUS_08600 118888 119748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 119766 120542 gene locus_tag LOCUS_08610 119766 120542 CDS product lipooligosaccharide biosynthesis protein LpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707882.1 protein_id gnl|my_center|LOCUS_08610 120551 121696 gene locus_tag LOCUS_08620 120551 121696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 122959 121859 gene locus_tag LOCUS_08630 gene wabH 122959 121859 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 protein_id gnl|my_center|LOCUS_08630 124061 122952 gene locus_tag LOCUS_08640 124061 122952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 125226 124180 gene locus_tag LOCUS_08650 gene waaC 125226 124180 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_08650 125312 126028 gene locus_tag LOCUS_08660 gene kdkA 125312 126028 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I7 protein_id gnl|my_center|LOCUS_08660 127285 126014 gene locus_tag LOCUS_08670 gene kdtA 127285 126014 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074267.1 protein_id gnl|my_center|LOCUS_08670 127405 128049 gene locus_tag LOCUS_08680 127405 128049 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 protein_id gnl|my_center|LOCUS_08680 128249 129442 gene locus_tag LOCUS_08690 gene kbl 128249 129442 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J0 protein_id gnl|my_center|LOCUS_08690 129466 130491 gene locus_tag LOCUS_08700 gene tdh 129466 130491 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_08700 130614 130871 gene locus_tag LOCUS_08710 gene glpE 130614 130871 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J2 protein_id gnl|my_center|LOCUS_08710 130875 131708 gene locus_tag LOCUS_08720 gene glpG 130875 131708 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_08720 132474 131821 gene locus_tag LOCUS_08730 gene elbB 132474 131821 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J4 protein_id gnl|my_center|LOCUS_08730 132510 132689 gene locus_tag LOCUS_08740 132510 132689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 132894 135629 gene locus_tag LOCUS_08750 gene polA 132894 135629 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_08750 136963 136286 gene locus_tag LOCUS_08760 gene engB 136963 136286 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J7 protein_id gnl|my_center|LOCUS_08760 137100 137720 gene locus_tag LOCUS_08770 gene cytcB 137100 137720 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_08770 138122 138358 gene locus_tag LOCUS_08780 138122 138358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 138483 139169 gene locus_tag LOCUS_08790 138483 139169 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074313.1 protein_id gnl|my_center|LOCUS_08790 139217 139741 gene locus_tag LOCUS_08800 gene yihI 139217 139741 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D7 protein_id gnl|my_center|LOCUS_08800 139753 140220 gene locus_tag LOCUS_08810 139753 140220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074315.1 protein_id gnl|my_center|LOCUS_08810 140615 141955 gene locus_tag LOCUS_08820 gene hemN 140615 141955 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D5 protein_id gnl|my_center|LOCUS_08820 143014 142019 gene locus_tag LOCUS_08830 gene add 143014 142019 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8D4 protein_id gnl|my_center|LOCUS_08830 143212 144990 gene locus_tag LOCUS_08840 143212 144990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_08840 145058 146071 gene locus_tag LOCUS_08850 gene lypA 145058 146071 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 protein_id gnl|my_center|LOCUS_08850 148478 145986 gene locus_tag LOCUS_08860 148478 145986 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074320.1 protein_id gnl|my_center|LOCUS_08860 148896 148786 gene locus_tag LOCUS_r00010 148896 148786 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence06 59 168 gene locus_tag LOCUS_r00020 59 168 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 738 1103 gene locus_tag LOCUS_08870 738 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1202 2149 gene locus_tag LOCUS_08880 gene corA 1202 2149 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFM9 protein_id gnl|my_center|LOCUS_08880 2485 2174 gene locus_tag LOCUS_08890 2485 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3869 2610 gene locus_tag LOCUS_08900 3869 2610 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072040.1 protein_id gnl|my_center|LOCUS_08900 3984 4682 gene locus_tag LOCUS_08910 3984 4682 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_08910 6035 4686 gene locus_tag LOCUS_08920 gene phoQ 6035 4686 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072042.1 protein_id gnl|my_center|LOCUS_08920 6700 6026 gene locus_tag LOCUS_08930 gene phoP 6700 6026 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072043.1 protein_id gnl|my_center|LOCUS_08930 7291 6956 gene locus_tag LOCUS_08940 7291 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072044.1 protein_id gnl|my_center|LOCUS_08940 8186 7434 gene locus_tag LOCUS_08950 8186 7434 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071069.1 protein_id gnl|my_center|LOCUS_08950 9105 8281 gene locus_tag LOCUS_08960 9105 8281 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071070.1 protein_id gnl|my_center|LOCUS_08960 9254 10060 gene locus_tag LOCUS_08970 gene nadE 9254 10060 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF2 protein_id gnl|my_center|LOCUS_08970 10585 10115 gene locus_tag LOCUS_08980 10585 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072106.1 protein_id gnl|my_center|LOCUS_08980 10676 12136 gene locus_tag LOCUS_08990 10676 12136 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 protein_id gnl|my_center|LOCUS_08990 14270 12102 gene locus_tag LOCUS_09000 14270 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 15582 14554 gene locus_tag LOCUS_09010 15582 14554 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF25 protein_id gnl|my_center|LOCUS_09010 15662 15874 gene locus_tag LOCUS_09020 15662 15874 CDS product UPF0352 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF26 protein_id gnl|my_center|LOCUS_09020 15978 17759 gene locus_tag LOCUS_09030 gene yejM 15978 17759 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072211.1 protein_id gnl|my_center|LOCUS_09030 17918 17994 gene locus_tag LOCUS_t00140 17918 17994 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18858 18124 gene locus_tag LOCUS_09040 18858 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_09040 19500 19775 gene locus_tag LOCUS_09050 19500 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 20688 20029 gene locus_tag LOCUS_09060 gene yheO 20688 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071606.1 protein_id gnl|my_center|LOCUS_09060 22007 20733 gene locus_tag LOCUS_09070 22007 20733 CDS product UPF0597 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIQ4 protein_id gnl|my_center|LOCUS_09070 22339 22004 gene locus_tag LOCUS_09080 22339 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 22464 23660 gene locus_tag LOCUS_09090 22464 23660 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705512.1 protein_id gnl|my_center|LOCUS_09090 24865 23780 gene locus_tag LOCUS_09100 24865 23780 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262583.1 protein_id gnl|my_center|LOCUS_09100 25313 25510 gene locus_tag LOCUS_09110 25313 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 26745 25567 gene locus_tag LOCUS_09120 gene metC 26745 25567 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_09120 29030 26859 gene locus_tag LOCUS_09130 29030 26859 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_09130 29719 29027 gene locus_tag LOCUS_09140 29719 29027 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_09140 29863 30705 gene locus_tag LOCUS_09150 gene pdsO 29863 30705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072226.1 protein_id gnl|my_center|LOCUS_09150 30720 33047 gene locus_tag LOCUS_09160 30720 33047 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 protein_id gnl|my_center|LOCUS_09160 33044 33688 gene locus_tag LOCUS_09170 33044 33688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 34717 33680 gene locus_tag LOCUS_09180 34717 33680 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072229.1 protein_id gnl|my_center|LOCUS_09180 34861 36450 gene locus_tag LOCUS_09190 34861 36450 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072230.1 protein_id gnl|my_center|LOCUS_09190 37401 36508 gene locus_tag LOCUS_09200 37401 36508 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072231.1 protein_id gnl|my_center|LOCUS_09200 38637 37690 gene locus_tag LOCUS_09210 gene rimK 38637 37690 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072232.1 protein_id gnl|my_center|LOCUS_09210 39092 38658 gene locus_tag LOCUS_09220 39092 38658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072233.1 protein_id gnl|my_center|LOCUS_09220 39203 40048 gene locus_tag LOCUS_09230 gene hdtR 39203 40048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_09230 40517 40146 gene locus_tag LOCUS_09240 gene dgkA 40517 40146 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF02 protein_id gnl|my_center|LOCUS_09240 40950 41939 gene locus_tag LOCUS_09250 40950 41939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 41941 42465 gene locus_tag LOCUS_09260 gene ptpA 41941 42465 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072237.1 protein_id gnl|my_center|LOCUS_09260 43538 42597 gene locus_tag LOCUS_09270 gene rbgA 43538 42597 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_09270 44453 43614 gene locus_tag LOCUS_09280 44453 43614 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072539.1 protein_id gnl|my_center|LOCUS_09280 44627 45544 gene locus_tag LOCUS_09290 gene selR 44627 45544 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE02 protein_id gnl|my_center|LOCUS_09290 47160 45601 gene locus_tag LOCUS_09300 47160 45601 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_09300 50761 47300 gene locus_tag LOCUS_09310 50761 47300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 51349 52314 gene locus_tag LOCUS_09320 gene rluC 51349 52314 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 protein_id gnl|my_center|LOCUS_09320 52336 52980 gene locus_tag LOCUS_09330 52336 52980 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770637.1 protein_id gnl|my_center|LOCUS_09330 54029 53076 gene locus_tag LOCUS_09340 54029 53076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 54876 54229 gene locus_tag LOCUS_09350 gene yceF 54876 54229 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58628 protein_id gnl|my_center|LOCUS_09350 55152 55676 gene locus_tag LOCUS_09360 55152 55676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 protein_id gnl|my_center|LOCUS_09360 55693 55863 gene locus_tag LOCUS_09370 gene rpmF 55693 55863 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG9 protein_id gnl|my_center|LOCUS_09370 55879 56907 gene locus_tag LOCUS_09380 gene plsX 55879 56907 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH0 protein_id gnl|my_center|LOCUS_09380 56917 57876 gene locus_tag LOCUS_09390 gene fabH 56917 57876 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH1 protein_id gnl|my_center|LOCUS_09390 58006 58932 gene locus_tag LOCUS_09400 gene fabD 58006 58932 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH2 protein_id gnl|my_center|LOCUS_09400 58943 59689 gene locus_tag LOCUS_09410 gene fabG 58943 59689 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_09410 59853 60086 gene locus_tag LOCUS_09420 gene acpP 59853 60086 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH4 protein_id gnl|my_center|LOCUS_09420 60269 61516 gene locus_tag LOCUS_09430 gene fabF 60269 61516 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH5 protein_id gnl|my_center|LOCUS_09430 61675 62043 gene locus_tag LOCUS_09440 61675 62043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072709.1 protein_id gnl|my_center|LOCUS_09440 62114 62593 gene locus_tag LOCUS_09450 gene yciA 62114 62593 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072708.1 protein_id gnl|my_center|LOCUS_09450 62806 63684 gene locus_tag LOCUS_09460 gene garR 62806 63684 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 protein_id gnl|my_center|LOCUS_09460 64645 63749 gene locus_tag LOCUS_09470 gene cdd 64645 63749 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG1 protein_id gnl|my_center|LOCUS_09470 66132 64735 gene locus_tag LOCUS_09480 gene sbcB 66132 64735 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG2 protein_id gnl|my_center|LOCUS_09480 66617 67525 gene locus_tag LOCUS_09490 66617 67525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 67528 68433 gene locus_tag LOCUS_09500 67528 68433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 68789 68568 gene locus_tag LOCUS_09510 68789 68568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 69043 68786 gene locus_tag LOCUS_09520 69043 68786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 69700 69053 gene locus_tag LOCUS_09530 69700 69053 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095944.1 protein_id gnl|my_center|LOCUS_09530 69993 69697 gene locus_tag LOCUS_09540 69993 69697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 70595 69990 gene locus_tag LOCUS_09550 70595 69990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 70795 70592 gene locus_tag LOCUS_09560 70795 70592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 71261 71028 gene locus_tag LOCUS_09570 71261 71028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 71548 71258 gene locus_tag LOCUS_09580 71548 71258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 71787 71545 gene locus_tag LOCUS_09590 71787 71545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 72155 71784 gene locus_tag LOCUS_09600 72155 71784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 72491 72165 gene locus_tag LOCUS_09610 72491 72165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 72637 72900 gene locus_tag LOCUS_09620 72637 72900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 73000 74886 gene locus_tag LOCUS_09630 73000 74886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 74883 75320 gene locus_tag LOCUS_09640 74883 75320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 76047 75355 gene locus_tag LOCUS_09650 76047 75355 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085982.1 protein_id gnl|my_center|LOCUS_09650 76156 76371 gene locus_tag LOCUS_09660 76156 76371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262504.1 protein_id gnl|my_center|LOCUS_09660 76401 76994 gene locus_tag LOCUS_09670 76401 76994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 77183 77527 gene locus_tag LOCUS_09680 77183 77527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 77524 77751 gene locus_tag LOCUS_09690 77524 77751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 77873 78688 gene locus_tag LOCUS_09700 77873 78688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 78681 79412 gene locus_tag LOCUS_09710 78681 79412 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800010.1 protein_id gnl|my_center|LOCUS_09710 79399 79740 gene locus_tag LOCUS_09720 79399 79740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072888.1 protein_id gnl|my_center|LOCUS_09720 79737 79964 gene locus_tag LOCUS_09730 79737 79964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 79964 81214 gene locus_tag LOCUS_09740 79964 81214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 81272 81499 gene locus_tag LOCUS_09750 81272 81499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 81489 81851 gene locus_tag LOCUS_09760 81489 81851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 81989 83014 gene locus_tag LOCUS_09770 81989 83014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_09770 83778 83566 gene locus_tag LOCUS_09780 83778 83566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 83873 84457 gene locus_tag LOCUS_09790 83873 84457 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ16 protein_id gnl|my_center|LOCUS_09790 84697 84984 gene locus_tag LOCUS_09800 84697 84984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 84965 85219 gene locus_tag LOCUS_09810 84965 85219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 85219 85752 gene locus_tag LOCUS_09820 85219 85752 CDS product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867568.1 protein_id gnl|my_center|LOCUS_09820 85727 87700 gene locus_tag LOCUS_09830 85727 87700 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027256.1 protein_id gnl|my_center|LOCUS_09830 87721 87903 gene locus_tag LOCUS_09840 87721 87903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312972.1 protein_id gnl|my_center|LOCUS_09840 87928 89499 gene locus_tag LOCUS_09850 87928 89499 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985923.1 protein_id gnl|my_center|LOCUS_09850 89408 91480 gene locus_tag LOCUS_09860 89408 91480 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N4Y6 protein_id gnl|my_center|LOCUS_09860 91548 91871 gene locus_tag LOCUS_09870 91548 91871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097065.1 protein_id gnl|my_center|LOCUS_09870 91864 92238 gene locus_tag LOCUS_09880 91864 92238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 92238 92801 gene locus_tag LOCUS_09890 92238 92801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 92810 93235 gene locus_tag LOCUS_09900 92810 93235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 93232 93951 gene locus_tag LOCUS_09910 93232 93951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 94030 97440 gene locus_tag LOCUS_09920 94030 97440 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071004.1 protein_id gnl|my_center|LOCUS_09920 97440 97820 gene locus_tag LOCUS_09930 97440 97820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 97822 100281 gene locus_tag LOCUS_09940 97822 100281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071006.1 protein_id gnl|my_center|LOCUS_09940 100296 101249 gene locus_tag LOCUS_09950 100296 101249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 101227 101538 gene locus_tag LOCUS_09960 101227 101538 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071007.1 protein_id gnl|my_center|LOCUS_09960 102414 103397 gene locus_tag LOCUS_09970 102414 103397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 103397 103609 gene locus_tag LOCUS_09980 103397 103609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 103639 104109 gene locus_tag LOCUS_09990 103639 104109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 104476 104096 gene locus_tag LOCUS_10000 104476 104096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 104595 105029 gene locus_tag LOCUS_10010 gene umuD 104595 105029 CDS product DNA polymerase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 protein_id gnl|my_center|LOCUS_10010 105029 106288 gene locus_tag LOCUS_10020 gene rulB 105029 106288 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 protein_id gnl|my_center|LOCUS_10020 106666 107472 gene locus_tag LOCUS_10030 106666 107472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072722.1 protein_id gnl|my_center|LOCUS_10030 107516 108319 gene locus_tag LOCUS_10040 gene rlmA 107516 108319 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_10040 108573 108782 gene locus_tag LOCUS_10050 gene cspA 108573 108782 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_10050 110324 109419 gene locus_tag LOCUS_10060 110324 109419 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071977.1 protein_id gnl|my_center|LOCUS_10060 111163 110321 gene locus_tag LOCUS_10070 111163 110321 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071978.1 protein_id gnl|my_center|LOCUS_10070 112018 111314 gene locus_tag LOCUS_10080 112018 111314 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU8 protein_id gnl|my_center|LOCUS_10080 113019 112186 gene locus_tag LOCUS_10090 gene yitL 113019 112186 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 protein_id gnl|my_center|LOCUS_10090 113295 116747 gene locus_tag LOCUS_10100 113295 116747 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_10100 117435 116791 gene locus_tag LOCUS_10110 117435 116791 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_10110 119803 117524 gene locus_tag LOCUS_10120 119803 117524 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_10120 120092 121390 gene locus_tag LOCUS_10130 120092 121390 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_10130 121400 122632 gene locus_tag LOCUS_10140 121400 122632 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816T7 protein_id gnl|my_center|LOCUS_10140 122670 123440 gene locus_tag LOCUS_10150 gene hbdH1 122670 123440 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037308.1 protein_id gnl|my_center|LOCUS_10150 123471 124172 gene locus_tag LOCUS_10160 gene dhcA 123471 124172 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_10160 124188 124847 gene locus_tag LOCUS_10170 gene dhcB 124188 124847 CDS product dehydrocarnitine CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_10170 125326 125472 gene locus_tag LOCUS_10180 125326 125472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071981.1 protein_id gnl|my_center|LOCUS_10180 125580 126455 gene locus_tag LOCUS_10190 gene speE 125580 126455 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJM8 protein_id gnl|my_center|LOCUS_10190 126484 128397 gene locus_tag LOCUS_10200 gene speA 126484 128397 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU5 protein_id gnl|my_center|LOCUS_10200 128450 129379 gene locus_tag LOCUS_10210 gene speD 128450 129379 CDS product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 protein_id gnl|my_center|LOCUS_10210 129411 130340 gene locus_tag LOCUS_10220 129411 130340 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998707.1 protein_id gnl|my_center|LOCUS_10220 130462 131100 gene locus_tag LOCUS_10230 gene pdxH 130462 131100 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED71 protein_id gnl|my_center|LOCUS_10230 131375 131160 gene locus_tag LOCUS_10240 131375 131160 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764082.1 protein_id gnl|my_center|LOCUS_10240 131623 132198 gene locus_tag LOCUS_10250 gene yceI 131623 132198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_10250 132297 132686 gene locus_tag LOCUS_10260 132297 132686 CDS product topoisomerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072801.1 protein_id gnl|my_center|LOCUS_10260 132708 133073 gene locus_tag LOCUS_10270 132708 133073 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072800.1 protein_id gnl|my_center|LOCUS_10270 133157 134029 gene locus_tag LOCUS_10280 133157 134029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 136815 134194 gene locus_tag LOCUS_10290 136815 134194 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072799.1 protein_id gnl|my_center|LOCUS_10290 137310 137053 gene locus_tag LOCUS_10300 gene grxA 137310 137053 CDS product glutaredoxin, GrxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072684.1 protein_id gnl|my_center|LOCUS_10300 139190 137361 gene locus_tag LOCUS_10310 139190 137361 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072683.1 protein_id gnl|my_center|LOCUS_10310 139499 140479 gene locus_tag LOCUS_10320 gene pheS 139499 140479 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFA0 protein_id gnl|my_center|LOCUS_10320 140495 142882 gene locus_tag LOCUS_10330 gene pheT 140495 142882 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF99 protein_id gnl|my_center|LOCUS_10330 142886 143182 gene locus_tag LOCUS_10340 gene ihfA 142886 143182 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF98 protein_id gnl|my_center|LOCUS_10340 143325 144278 gene locus_tag LOCUS_10350 gene lpxM 143325 144278 CDS product lipid A biosynthesis myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF97 protein_id gnl|my_center|LOCUS_10350 144728 144652 gene locus_tag LOCUS_t00150 144728 144652 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 144853 144777 gene locus_tag LOCUS_t00160 144853 144777 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 34 978 gene locus_tag LOCUS_10360 34 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 protein_id gnl|my_center|LOCUS_10360 975 1478 gene locus_tag LOCUS_10370 975 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072989.1 protein_id gnl|my_center|LOCUS_10370 1472 2461 gene locus_tag LOCUS_10380 gene batA 1472 2461 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_10380 2458 4491 gene locus_tag LOCUS_10390 gene batB 2458 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_10390 4485 6104 gene locus_tag LOCUS_10400 gene batD 4485 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 protein_id gnl|my_center|LOCUS_10400 6548 7111 gene locus_tag LOCUS_10410 6548 7111 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECN9 protein_id gnl|my_center|LOCUS_10410 7104 7808 gene locus_tag LOCUS_10420 7104 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072994.1 protein_id gnl|my_center|LOCUS_10420 7946 9397 gene locus_tag LOCUS_10430 7946 9397 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762940.1 protein_id gnl|my_center|LOCUS_10430 9764 11050 gene locus_tag LOCUS_10440 9764 11050 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072995.1 protein_id gnl|my_center|LOCUS_10440 11446 12495 gene locus_tag LOCUS_10450 11446 12495 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_10450 12505 15750 gene locus_tag LOCUS_10460 12505 15750 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_10460 15752 15970 gene locus_tag LOCUS_10470 15752 15970 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_10470 15984 16367 gene locus_tag LOCUS_10480 15984 16367 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073001.1 protein_id gnl|my_center|LOCUS_10480 16595 16936 gene locus_tag LOCUS_10490 16595 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072748.1 protein_id gnl|my_center|LOCUS_10490 17080 17538 gene locus_tag LOCUS_10500 17080 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 18378 17545 gene locus_tag LOCUS_10510 18378 17545 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072750.1 protein_id gnl|my_center|LOCUS_10510 19030 18413 gene locus_tag LOCUS_10520 gene ribA 19030 18413 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDD1 protein_id gnl|my_center|LOCUS_10520 19555 19199 gene locus_tag LOCUS_10530 19555 19199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072752.1 protein_id gnl|my_center|LOCUS_10530 20180 19695 gene locus_tag LOCUS_10540 gene nrdG 20180 19695 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDC9 protein_id gnl|my_center|LOCUS_10540 22382 20265 gene locus_tag LOCUS_10550 gene nrdD 22382 20265 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072754.1 protein_id gnl|my_center|LOCUS_10550 23347 22607 gene locus_tag LOCUS_10560 23347 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072755.1 protein_id gnl|my_center|LOCUS_10560 24448 23501 gene locus_tag LOCUS_10570 24448 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 protein_id gnl|my_center|LOCUS_10570 24681 26036 gene locus_tag LOCUS_10580 24681 26036 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 protein_id gnl|my_center|LOCUS_10580 26084 26521 gene locus_tag LOCUS_10590 26084 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072758.1 protein_id gnl|my_center|LOCUS_10590 26526 27035 gene locus_tag LOCUS_10600 26526 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072759.1 protein_id gnl|my_center|LOCUS_10600 27341 27745 gene locus_tag LOCUS_10610 27341 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072760.1 protein_id gnl|my_center|LOCUS_10610 28633 27782 gene locus_tag LOCUS_10620 28633 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106252.1 protein_id gnl|my_center|LOCUS_10620 29999 28755 gene locus_tag LOCUS_10630 29999 28755 CDS product subfamily M23B unassigned peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072761.1 protein_id gnl|my_center|LOCUS_10630 33402 30208 gene locus_tag LOCUS_10640 gene sbcC 33402 30208 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB9 protein_id gnl|my_center|LOCUS_10640 34541 33399 gene locus_tag LOCUS_10650 gene sbcD 34541 33399 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB8 protein_id gnl|my_center|LOCUS_10650 35439 34666 gene locus_tag LOCUS_10660 gene yfcA 35439 34666 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB6 protein_id gnl|my_center|LOCUS_10660 35562 36449 gene locus_tag LOCUS_10670 35562 36449 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072765.1 protein_id gnl|my_center|LOCUS_10670 37013 36627 gene locus_tag LOCUS_10680 37013 36627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 protein_id gnl|my_center|LOCUS_10680 37251 37030 gene locus_tag LOCUS_10690 37251 37030 CDS product S4 RNA-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 protein_id gnl|my_center|LOCUS_10690 37872 37339 gene locus_tag LOCUS_10700 gene rimJ 37872 37339 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071953.1 protein_id gnl|my_center|LOCUS_10700 38170 37892 gene locus_tag LOCUS_10710 gene ppiC 38170 37892 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071952.1 protein_id gnl|my_center|LOCUS_10710 40197 38362 gene locus_tag LOCUS_10720 40197 38362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_10720 40277 40786 gene locus_tag LOCUS_10730 40277 40786 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071950.1 protein_id gnl|my_center|LOCUS_10730 42085 40835 gene locus_tag LOCUS_10740 42085 40835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071949.1 protein_id gnl|my_center|LOCUS_10740 42707 42087 gene locus_tag LOCUS_10750 gene tonB2 42707 42087 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_10750 43113 42709 gene locus_tag LOCUS_10760 gene exbD 43113 42709 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_10760 43654 43127 gene locus_tag LOCUS_10770 gene exbB 43654 43127 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_10770 45009 43654 gene locus_tag LOCUS_10780 gene ttpC 45009 43654 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_10780 45791 45009 gene locus_tag LOCUS_10790 45791 45009 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071944.1 protein_id gnl|my_center|LOCUS_10790 49201 46448 gene locus_tag LOCUS_10800 gene btuB 49201 46448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_10800 50820 49621 gene locus_tag LOCUS_10810 50820 49621 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 protein_id gnl|my_center|LOCUS_10810 53403 51034 gene locus_tag LOCUS_10820 gene polB 53403 51034 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ4 protein_id gnl|my_center|LOCUS_10820 53490 55562 gene locus_tag LOCUS_10830 gene dinG 53490 55562 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 protein_id gnl|my_center|LOCUS_10830 55584 56357 gene locus_tag LOCUS_10840 55584 56357 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ6 protein_id gnl|my_center|LOCUS_10840 56354 57016 gene locus_tag LOCUS_10850 56354 57016 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071938.1 protein_id gnl|my_center|LOCUS_10850 57026 57721 gene locus_tag LOCUS_10860 57026 57721 CDS product UPF0319 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ8 protein_id gnl|my_center|LOCUS_10860 57725 58630 gene locus_tag LOCUS_10870 57725 58630 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071936.1 protein_id gnl|my_center|LOCUS_10870 58693 58983 gene locus_tag LOCUS_10880 gene comFB 58693 58983 CDS product competence protein ComFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071935.1 protein_id gnl|my_center|LOCUS_10880 60229 59645 gene locus_tag LOCUS_10890 60229 59645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 60560 61132 gene locus_tag LOCUS_10900 60560 61132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 61431 61195 gene locus_tag LOCUS_10910 61431 61195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 62291 62052 gene locus_tag LOCUS_10920 62291 62052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 62897 62571 gene locus_tag LOCUS_10930 62897 62571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 63226 63035 gene locus_tag LOCUS_10940 63226 63035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 63452 63234 gene locus_tag LOCUS_10950 63452 63234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 64891 63554 gene locus_tag LOCUS_10960 64891 63554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 65414 65106 gene locus_tag LOCUS_10970 gene comEA 65414 65106 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071934.1 protein_id gnl|my_center|LOCUS_10970 65787 67181 gene locus_tag LOCUS_10980 65787 67181 CDS product transporter NadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 protein_id gnl|my_center|LOCUS_10980 68423 67230 gene locus_tag LOCUS_10990 gene mdeA 68423 67230 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_10990 69686 68553 gene locus_tag LOCUS_11000 69686 68553 CDS product UPF0283 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG03 protein_id gnl|my_center|LOCUS_11000 71126 69690 gene locus_tag LOCUS_11010 gene ycjX 71126 69690 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071931.1 protein_id gnl|my_center|LOCUS_11010 71570 71181 gene locus_tag LOCUS_11020 gene pspC 71570 71181 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_11020 71796 71563 gene locus_tag LOCUS_11030 gene pspB 71796 71563 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_11030 72500 71817 gene locus_tag LOCUS_11040 gene pspA 72500 71817 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_11040 72680 73759 gene locus_tag LOCUS_11050 gene pspF 72680 73759 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_11050 73986 75590 gene locus_tag LOCUS_11060 gene sapA 73986 75590 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071926.1 protein_id gnl|my_center|LOCUS_11060 75587 76621 gene locus_tag LOCUS_11070 gene sapB 75587 76621 CDS product antimicrobial peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071925.1 protein_id gnl|my_center|LOCUS_11070 76608 77498 gene locus_tag LOCUS_11080 gene sapC 76608 77498 CDS product antimicrobial peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071924.1 protein_id gnl|my_center|LOCUS_11080 77501 78508 gene locus_tag LOCUS_11090 gene sapD 77501 78508 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071923.1 protein_id gnl|my_center|LOCUS_11090 78489 79274 gene locus_tag LOCUS_11100 gene sapF 78489 79274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 protein_id gnl|my_center|LOCUS_11100 79391 80593 gene locus_tag LOCUS_11110 gene fabV 79391 80593 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG14 protein_id gnl|my_center|LOCUS_11110 82137 80758 gene locus_tag LOCUS_11120 gene cysS 82137 80758 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG22 protein_id gnl|my_center|LOCUS_11120 82282 82776 gene locus_tag LOCUS_11130 gene ppiB 82282 82776 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_11130 82787 83503 gene locus_tag LOCUS_11140 gene lpxH 82787 83503 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG24 protein_id gnl|my_center|LOCUS_11140 84437 83673 gene locus_tag LOCUS_11150 gene miaE 84437 83673 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071910.1 protein_id gnl|my_center|LOCUS_11150 84625 85221 gene locus_tag LOCUS_11160 84625 85221 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 protein_id gnl|my_center|LOCUS_11160 86952 85282 gene locus_tag LOCUS_11170 gene glnS 86952 85282 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG26 protein_id gnl|my_center|LOCUS_11170 89410 87116 gene locus_tag LOCUS_11180 gene feoB 89410 87116 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG28 protein_id gnl|my_center|LOCUS_11180 89642 89403 gene locus_tag LOCUS_11190 gene feoA 89642 89403 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071906.1 protein_id gnl|my_center|LOCUS_11190 90150 91055 gene locus_tag LOCUS_11200 gene mtrD 90150 91055 CDS product respiratory system periplasmic decaheme cytochrome c component MtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071905.1 protein_id gnl|my_center|LOCUS_11200 91066 93177 gene locus_tag LOCUS_11210 gene mtrE 91066 93177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071904.1 protein_id gnl|my_center|LOCUS_11210 93197 95128 gene locus_tag LOCUS_11220 gene mtrF 93197 95128 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 protein_id gnl|my_center|LOCUS_11220 95040 95249 gene locus_tag LOCUS_11230 95040 95249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 95227 97410 gene locus_tag LOCUS_11240 gene omcA 95227 97410 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 protein_id gnl|my_center|LOCUS_11240 98127 100259 gene locus_tag LOCUS_11250 gene omcA 98127 100259 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 protein_id gnl|my_center|LOCUS_11250 100571 102550 gene locus_tag LOCUS_11260 gene mtrC 100571 102550 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071901.1 protein_id gnl|my_center|LOCUS_11260 102618 103607 gene locus_tag LOCUS_11270 gene mtrA 102618 103607 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_11270 103620 105707 gene locus_tag LOCUS_11280 gene mtrB 103620 105707 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 protein_id gnl|my_center|LOCUS_11280 105896 106984 gene locus_tag LOCUS_11290 105896 106984 CDS product peptidase M35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706525.1 protein_id gnl|my_center|LOCUS_11290 107184 107762 gene locus_tag LOCUS_11300 107184 107762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence08 87 767 gene locus_tag LOCUS_11310 gene mtnC 87 767 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKK8 protein_id gnl|my_center|LOCUS_11310 2652 898 gene locus_tag LOCUS_11320 gene urdA 2652 898 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVD0 protein_id gnl|my_center|LOCUS_11320 3459 2695 gene locus_tag LOCUS_11330 3459 2695 CDS product nucleoside-specific porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074217.1 protein_id gnl|my_center|LOCUS_11330 4949 3738 gene locus_tag LOCUS_11340 4949 3738 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074218.1 protein_id gnl|my_center|LOCUS_11340 5613 4951 gene locus_tag LOCUS_11350 5613 4951 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074219.1 protein_id gnl|my_center|LOCUS_11350 6355 5615 gene locus_tag LOCUS_11360 6355 5615 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074220.1 protein_id gnl|my_center|LOCUS_11360 8437 6821 gene locus_tag LOCUS_11370 8437 6821 CDS product phenylalanine/histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072955.1 protein_id gnl|my_center|LOCUS_11370 8904 10724 gene locus_tag LOCUS_11380 8904 10724 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_11380 10757 11173 gene locus_tag LOCUS_11390 gene gfaA 10757 11173 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 protein_id gnl|my_center|LOCUS_11390 12586 11249 gene locus_tag LOCUS_11400 12586 11249 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_11400 14426 12840 gene locus_tag LOCUS_11410 14426 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 15833 14853 gene locus_tag LOCUS_11420 gene fdhC 15833 14853 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074134.1 protein_id gnl|my_center|LOCUS_11420 16456 15887 gene locus_tag LOCUS_11430 gene fdhB 16456 15887 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074133.1 protein_id gnl|my_center|LOCUS_11430 19338 16486 gene locus_tag LOCUS_11440 gene fdhA 19338 16486 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074132.1 protein_id gnl|my_center|LOCUS_11440 19554 19357 gene locus_tag LOCUS_11450 gene fdhX 19554 19357 CDS product Fnr-inducible formate dehydrogenase accessory protein FdhX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074131.1 protein_id gnl|my_center|LOCUS_11450 20925 19927 gene locus_tag LOCUS_11460 gene fdhC 20925 19927 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074130.1 protein_id gnl|my_center|LOCUS_11460 21567 20971 gene locus_tag LOCUS_11470 gene fdhB 21567 20971 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074129.1 protein_id gnl|my_center|LOCUS_11470 24444 21595 gene locus_tag LOCUS_11480 gene fdhA 24444 21595 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074128.1 protein_id gnl|my_center|LOCUS_11480 24660 24463 gene locus_tag LOCUS_11490 gene fdhX 24660 24463 CDS product formate dehydrogenase accessory protein FdhX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074127.1 protein_id gnl|my_center|LOCUS_11490 25392 24736 gene locus_tag LOCUS_11500 gene fdhT 25392 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074126.1 protein_id gnl|my_center|LOCUS_11500 27079 25403 gene locus_tag LOCUS_11510 27079 25403 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074125.1 protein_id gnl|my_center|LOCUS_11510 27844 27218 gene locus_tag LOCUS_11520 27844 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074124.1 protein_id gnl|my_center|LOCUS_11520 28302 27844 gene locus_tag LOCUS_11530 28302 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074123.1 protein_id gnl|my_center|LOCUS_11530 28578 29408 gene locus_tag LOCUS_11540 gene fdhD 28578 29408 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Z7 protein_id gnl|my_center|LOCUS_11540 29433 30338 gene locus_tag LOCUS_11550 29433 30338 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074121.1 protein_id gnl|my_center|LOCUS_11550 31460 30381 gene locus_tag LOCUS_11560 gene rlmF 31460 30381 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_11560 31893 31453 gene locus_tag LOCUS_11570 31893 31453 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 protein_id gnl|my_center|LOCUS_11570 31966 32544 gene locus_tag LOCUS_11580 gene ubiC 31966 32544 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKG2 protein_id gnl|my_center|LOCUS_11580 35433 32614 gene locus_tag LOCUS_11590 gene prtV 35433 32614 CDS product peptidase M6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070535.1 protein_id gnl|my_center|LOCUS_11590 35717 35430 gene locus_tag LOCUS_11600 35717 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 37947 35818 gene locus_tag LOCUS_11610 37947 35818 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_11610 38567 37980 gene locus_tag LOCUS_11620 gene yhgN 38567 37980 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKG4 protein_id gnl|my_center|LOCUS_11620 38755 40419 gene locus_tag LOCUS_11630 38755 40419 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070533.1 protein_id gnl|my_center|LOCUS_11630 40498 41277 gene locus_tag LOCUS_11640 40498 41277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 protein_id gnl|my_center|LOCUS_11640 41809 41240 gene locus_tag LOCUS_11650 41809 41240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_11650 42297 41872 gene locus_tag LOCUS_11660 42297 41872 CDS product periplasmic L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_11660 42521 43240 gene locus_tag LOCUS_11670 42521 43240 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_11670 43305 43925 gene locus_tag LOCUS_11680 43305 43925 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 protein_id gnl|my_center|LOCUS_11680 45186 43915 gene locus_tag LOCUS_11690 gene ybdG 45186 43915 CDS product small conductance mechanosensitive ion channel protein YbdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 protein_id gnl|my_center|LOCUS_11690 45656 45315 gene locus_tag LOCUS_11700 45656 45315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 45900 45622 gene locus_tag LOCUS_11710 45900 45622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 46077 46760 gene locus_tag LOCUS_11720 46077 46760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070522.1 protein_id gnl|my_center|LOCUS_11720 48421 46880 gene locus_tag LOCUS_11730 gene hutH 48421 46880 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ4 protein_id gnl|my_center|LOCUS_11730 50091 48421 gene locus_tag LOCUS_11740 gene hutU 50091 48421 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ5 protein_id gnl|my_center|LOCUS_11740 50861 50139 gene locus_tag LOCUS_11750 gene hutC 50861 50139 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 protein_id gnl|my_center|LOCUS_11750 51007 52233 gene locus_tag LOCUS_11760 gene hutI 51007 52233 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ7 protein_id gnl|my_center|LOCUS_11760 52609 53379 gene locus_tag LOCUS_11770 52609 53379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 53391 53888 gene locus_tag LOCUS_11780 53391 53888 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082901.1 protein_id gnl|my_center|LOCUS_11780 53896 55020 gene locus_tag LOCUS_11790 53896 55020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 55740 55045 gene locus_tag LOCUS_11800 55740 55045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 56996 56724 gene locus_tag LOCUS_11810 56996 56724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 58414 57281 gene locus_tag LOCUS_11820 58414 57281 CDS product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E533 protein_id gnl|my_center|LOCUS_11820 60825 58639 gene locus_tag LOCUS_11830 gene ycaO 60825 58639 CDS product protein involved in RimO-mediated beta-methylthiolation of ribosomal protein S12 YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 protein_id gnl|my_center|LOCUS_11830 61970 61059 gene locus_tag LOCUS_11840 61970 61059 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 protein_id gnl|my_center|LOCUS_11840 62416 62012 gene locus_tag LOCUS_11850 62416 62012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 64211 62613 gene locus_tag LOCUS_11860 64211 62613 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_11860 64840 65409 gene locus_tag LOCUS_11870 64840 65409 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 protein_id gnl|my_center|LOCUS_11870 65431 66465 gene locus_tag LOCUS_11880 65431 66465 CDS product Galanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 protein_id gnl|my_center|LOCUS_11880 66495 67331 gene locus_tag LOCUS_11890 66495 67331 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074254.1 protein_id gnl|my_center|LOCUS_11890 67357 67788 gene locus_tag LOCUS_11900 67357 67788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 68772 67915 gene locus_tag LOCUS_11910 gene yhiR 68772 67915 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8K5 protein_id gnl|my_center|LOCUS_11910 68904 69662 gene locus_tag LOCUS_11920 gene rsmJ 68904 69662 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8K6 protein_id gnl|my_center|LOCUS_11920 69777 71585 gene locus_tag LOCUS_11930 69777 71585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 72586 71636 gene locus_tag LOCUS_11940 72586 71636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 73024 73605 gene locus_tag LOCUS_11950 73024 73605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_11950 73619 74092 gene locus_tag LOCUS_11960 73619 74092 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 protein_id gnl|my_center|LOCUS_11960 76025 74100 gene locus_tag LOCUS_11970 76025 74100 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074229.1 protein_id gnl|my_center|LOCUS_11970 77422 76106 gene locus_tag LOCUS_11980 gene envZ 77422 76106 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074228.1 protein_id gnl|my_center|LOCUS_11980 78144 77419 gene locus_tag LOCUS_11990 gene ompR 78144 77419 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_11990 79368 78280 gene locus_tag LOCUS_12000 gene modC 79368 78280 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAN3 protein_id gnl|my_center|LOCUS_12000 80060 79362 gene locus_tag LOCUS_12010 gene modB 80060 79362 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073622.1 protein_id gnl|my_center|LOCUS_12010 80838 80071 gene locus_tag LOCUS_12020 gene modA 80838 80071 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073621.1 protein_id gnl|my_center|LOCUS_12020 80997 81782 gene locus_tag LOCUS_12030 gene modE 80997 81782 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073620.1 protein_id gnl|my_center|LOCUS_12030 81909 82403 gene locus_tag LOCUS_12040 gene greB 81909 82403 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8N1 protein_id gnl|my_center|LOCUS_12040 82533 82838 gene locus_tag LOCUS_12050 82533 82838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 82848 83078 gene locus_tag LOCUS_12060 82848 83078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 83357 83118 gene locus_tag LOCUS_12070 83357 83118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 83631 84605 gene locus_tag LOCUS_12080 83631 84605 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074196.1 protein_id gnl|my_center|LOCUS_12080 85400 84612 gene locus_tag LOCUS_12090 85400 84612 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074197.1 protein_id gnl|my_center|LOCUS_12090 85869 85796 gene locus_tag LOCUS_t00170 85869 85796 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 87211 85967 gene locus_tag LOCUS_12100 gene mtr 87211 85967 CDS product high affinity tryptophan transporter Mtr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074198.1 protein_id gnl|my_center|LOCUS_12100 89580 87211 gene locus_tag LOCUS_12110 gene plsB 89580 87211 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q9 protein_id gnl|my_center|LOCUS_12110 89890 90510 gene locus_tag LOCUS_12120 gene lexA 89890 90510 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q8 protein_id gnl|my_center|LOCUS_12120 90507 90998 gene locus_tag LOCUS_12130 gene sulA 90507 90998 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q7 protein_id gnl|my_center|LOCUS_12130 91456 92586 gene locus_tag LOCUS_12140 91456 92586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 92597 94207 gene locus_tag LOCUS_12150 gene coxA 92597 94207 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_12150 94209 94772 gene locus_tag LOCUS_12160 gene ctaG 94209 94772 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_12160 94769 95644 gene locus_tag LOCUS_12170 gene coxC 94769 95644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_12170 95859 95641 gene locus_tag LOCUS_12180 95859 95641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074206.1 protein_id gnl|my_center|LOCUS_12180 95831 96577 gene locus_tag LOCUS_12190 95831 96577 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q0 protein_id gnl|my_center|LOCUS_12190 96638 97180 gene locus_tag LOCUS_12200 96638 97180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 protein_id gnl|my_center|LOCUS_12200 97180 98163 gene locus_tag LOCUS_12210 gene ctaA 97180 98163 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_12210 98177 99082 gene locus_tag LOCUS_12220 gene cyoE 98177 99082 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P7 protein_id gnl|my_center|LOCUS_12220 99086 99733 gene locus_tag LOCUS_12230 gene senC 99086 99733 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 protein_id gnl|my_center|LOCUS_12230 99838 100155 gene locus_tag LOCUS_12240 99838 100155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 100133 100495 gene locus_tag LOCUS_12250 gene cheY 100133 100495 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_12250 100517 102598 gene locus_tag LOCUS_12260 100517 102598 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_12260 102611 103162 gene locus_tag LOCUS_12270 gene cheW 102611 103162 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A966 protein_id gnl|my_center|LOCUS_12270 >Feature sequence09 375 839 gene locus_tag LOCUS_12280 375 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1236 1796 gene locus_tag LOCUS_12290 1236 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 2233 2454 gene locus_tag LOCUS_12300 2233 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12300 2554 2886 gene locus_tag LOCUS_12310 2554 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12310 2883 3191 gene locus_tag LOCUS_12320 2883 3191 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071888.1 protein_id gnl|my_center|LOCUS_12320 3219 3608 gene locus_tag LOCUS_12330 3219 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4387 3680 gene locus_tag LOCUS_12340 4387 3680 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 protein_id gnl|my_center|LOCUS_12340 4999 4616 gene locus_tag LOCUS_12350 4999 4616 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071885.1 protein_id gnl|my_center|LOCUS_12350 6952 5231 gene locus_tag LOCUS_12360 6952 5231 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071884.1 protein_id gnl|my_center|LOCUS_12360 7486 7181 gene locus_tag LOCUS_12370 7486 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071883.1 protein_id gnl|my_center|LOCUS_12370 7922 7728 gene locus_tag LOCUS_12380 7922 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 9348 8266 gene locus_tag LOCUS_12390 gene oleD 9348 8266 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 protein_id gnl|my_center|LOCUS_12390 11317 9461 gene locus_tag LOCUS_12400 gene oleC 11317 9461 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071876.1 protein_id gnl|my_center|LOCUS_12400 12305 11319 gene locus_tag LOCUS_12410 gene oleB 12305 11319 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_12410 13443 12394 gene locus_tag LOCUS_12420 gene oleA 13443 12394 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_12420 14898 13639 gene locus_tag LOCUS_12430 14898 13639 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071873.1 protein_id gnl|my_center|LOCUS_12430 15438 15698 gene locus_tag LOCUS_12440 15438 15698 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071872.1 protein_id gnl|my_center|LOCUS_12440 17272 15788 gene locus_tag LOCUS_12450 17272 15788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071496.1 protein_id gnl|my_center|LOCUS_12450 18035 17676 gene locus_tag LOCUS_12460 18035 17676 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_12460 20045 18060 gene locus_tag LOCUS_12470 20045 18060 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606001.1 protein_id gnl|my_center|LOCUS_12470 20991 20392 gene locus_tag LOCUS_12480 20991 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071870.1 protein_id gnl|my_center|LOCUS_12480 21181 21564 gene locus_tag LOCUS_12490 21181 21564 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071869.1 protein_id gnl|my_center|LOCUS_12490 22423 21719 gene locus_tag LOCUS_12500 gene phoU 22423 21719 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG81 protein_id gnl|my_center|LOCUS_12500 23272 22454 gene locus_tag LOCUS_12510 gene pstB1 23272 22454 CDS product phosphate import ATP-binding protein PstB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG82 protein_id gnl|my_center|LOCUS_12510 24960 23305 gene locus_tag LOCUS_12520 gene pstA 24960 23305 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG83 protein_id gnl|my_center|LOCUS_12520 27281 25023 gene locus_tag LOCUS_12530 gene pstC 27281 25023 CDS product ABC high affinity phosphate uptake system permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_12530 27457 27960 gene locus_tag LOCUS_12540 27457 27960 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071861.1 protein_id gnl|my_center|LOCUS_12540 28091 28909 gene locus_tag LOCUS_12550 28091 28909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071859.1 protein_id gnl|my_center|LOCUS_12550 29029 29598 gene locus_tag LOCUS_12560 29029 29598 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_12560 30649 29678 gene locus_tag LOCUS_12570 30649 29678 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 protein_id gnl|my_center|LOCUS_12570 31064 32743 gene locus_tag LOCUS_12580 gene cstA 31064 32743 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_12580 32743 33015 gene locus_tag LOCUS_12590 32743 33015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 33042 34049 gene locus_tag LOCUS_12600 33042 34049 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_12600 36143 34194 gene locus_tag LOCUS_12610 36143 34194 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 protein_id gnl|my_center|LOCUS_12610 38111 36543 gene locus_tag LOCUS_12620 gene ybiT 38111 36543 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071838.1 protein_id gnl|my_center|LOCUS_12620 38726 38340 gene locus_tag LOCUS_12630 38726 38340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 42041 38991 gene locus_tag LOCUS_12640 42041 38991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 42232 42630 gene locus_tag LOCUS_12650 gene cueR 42232 42630 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071836.1 protein_id gnl|my_center|LOCUS_12650 44703 42634 gene locus_tag LOCUS_12660 44703 42634 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071835.1 protein_id gnl|my_center|LOCUS_12660 44992 44771 gene locus_tag LOCUS_12670 44992 44771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071834.1 protein_id gnl|my_center|LOCUS_12670 46117 45146 gene locus_tag LOCUS_12680 46117 45146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 46945 46190 gene locus_tag LOCUS_12690 gene ivdG 46945 46190 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 protein_id gnl|my_center|LOCUS_12690 47855 46956 gene locus_tag LOCUS_12700 gene ivdF 47855 46956 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC2 protein_id gnl|my_center|LOCUS_12700 49009 47897 gene locus_tag LOCUS_12710 gene ivdE 49009 47897 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_12710 49796 49023 gene locus_tag LOCUS_12720 gene ivdD 49796 49023 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 protein_id gnl|my_center|LOCUS_12720 50991 49834 gene locus_tag LOCUS_12730 gene ivdC 50991 49834 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_12730 52608 51115 gene locus_tag LOCUS_12740 gene ivdB 52608 51115 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 protein_id gnl|my_center|LOCUS_12740 53915 52734 gene locus_tag LOCUS_12750 gene ivdA 53915 52734 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_12750 55251 54307 gene locus_tag LOCUS_12760 gene metA 55251 54307 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC8 protein_id gnl|my_center|LOCUS_12760 55716 55303 gene locus_tag LOCUS_12770 55716 55303 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071825.1 protein_id gnl|my_center|LOCUS_12770 55816 56586 gene locus_tag LOCUS_12780 55816 56586 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071824.1 protein_id gnl|my_center|LOCUS_12780 57556 56591 gene locus_tag LOCUS_12790 gene yidZ 57556 56591 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073741.1 protein_id gnl|my_center|LOCUS_12790 58757 57525 gene locus_tag LOCUS_12800 gene mdtL 58757 57525 CDS product multidrug resistance protein MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA87 protein_id gnl|my_center|LOCUS_12800 59591 58914 gene locus_tag LOCUS_12810 gene ompW 59591 58914 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071823.1 protein_id gnl|my_center|LOCUS_12810 60681 60076 gene locus_tag LOCUS_12820 60681 60076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071822.1 protein_id gnl|my_center|LOCUS_12820 62010 60871 gene locus_tag LOCUS_12830 gene cydB 62010 60871 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073166.1 protein_id gnl|my_center|LOCUS_12830 63601 62027 gene locus_tag LOCUS_12840 gene cydA 63601 62027 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 protein_id gnl|my_center|LOCUS_12840 68660 64779 gene locus_tag LOCUS_12850 gene purL 68660 64779 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC57 protein_id gnl|my_center|LOCUS_12850 68951 70399 gene locus_tag LOCUS_12860 gene mltF 68951 70399 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC56 protein_id gnl|my_center|LOCUS_12860 70657 70490 gene locus_tag LOCUS_12870 70657 70490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 71165 70644 gene locus_tag LOCUS_12880 gene tadA 71165 70644 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC53 protein_id gnl|my_center|LOCUS_12880 72766 71510 gene locus_tag LOCUS_12890 gene purA 72766 71510 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5Y9 protein_id gnl|my_center|LOCUS_12890 73005 73892 gene locus_tag LOCUS_12900 73005 73892 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261694.1 protein_id gnl|my_center|LOCUS_12900 74414 73992 gene locus_tag LOCUS_12910 74414 73992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_12910 75608 74520 gene locus_tag LOCUS_12920 gene sye2 75608 74520 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072429.1 protein_id gnl|my_center|LOCUS_12920 76595 75618 gene locus_tag LOCUS_12930 gene sye1 76595 75618 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072430.1 protein_id gnl|my_center|LOCUS_12930 77854 76973 gene locus_tag LOCUS_12940 gene yafC 77854 76973 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 protein_id gnl|my_center|LOCUS_12940 80478 78193 gene locus_tag LOCUS_12950 80478 78193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384050.1 protein_id gnl|my_center|LOCUS_12950 81120 80845 gene locus_tag LOCUS_12960 81120 80845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 82972 81395 gene locus_tag LOCUS_12970 gene guaA 82972 81395 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC52 protein_id gnl|my_center|LOCUS_12970 84542 83076 gene locus_tag LOCUS_12980 gene guaB 84542 83076 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC51 protein_id gnl|my_center|LOCUS_12980 84660 86003 gene locus_tag LOCUS_12990 gene xseA 84660 86003 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC50 protein_id gnl|my_center|LOCUS_12990 87656 86190 gene locus_tag LOCUS_13000 gene der 87656 86190 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC36 protein_id gnl|my_center|LOCUS_13000 88923 87736 gene locus_tag LOCUS_13010 gene bamB 88923 87736 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC35 protein_id gnl|my_center|LOCUS_13010 89559 88933 gene locus_tag LOCUS_13020 89559 88933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073186.1 protein_id gnl|my_center|LOCUS_13020 90849 89572 gene locus_tag LOCUS_13030 gene hisS 90849 89572 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC33 protein_id gnl|my_center|LOCUS_13030 92079 90967 gene locus_tag LOCUS_13040 gene ispG 92079 90967 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC32 protein_id gnl|my_center|LOCUS_13040 93105 92143 gene locus_tag LOCUS_13050 gene rodZ 93105 92143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073189.1 protein_id gnl|my_center|LOCUS_13050 93890 93105 gene locus_tag LOCUS_13060 gene pilF 93890 93105 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_13060 95044 93923 gene locus_tag LOCUS_13070 gene rlmN 95044 93923 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC29 protein_id gnl|my_center|LOCUS_13070 95247 96323 gene locus_tag LOCUS_13080 95247 96323 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073192.1 protein_id gnl|my_center|LOCUS_13080 96461 98206 gene locus_tag LOCUS_13090 96461 98206 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073193.1 protein_id gnl|my_center|LOCUS_13090 98568 98329 gene locus_tag LOCUS_13100 98568 98329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 98809 98459 gene locus_tag LOCUS_13110 98809 98459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 98790 99104 gene locus_tag LOCUS_13120 98790 99104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 99689 99180 gene locus_tag LOCUS_13130 99689 99180 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073196.1 protein_id gnl|my_center|LOCUS_13130 100218 99697 gene locus_tag LOCUS_13140 100218 99697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 100643 100344 gene locus_tag LOCUS_13150 gene nrfJ 100643 100344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073198.1 protein_id gnl|my_center|LOCUS_13150 100947 100732 gene locus_tag LOCUS_13160 100947 100732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence10 180 1403 gene locus_tag LOCUS_13170 gene argG 180 1403 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK28 protein_id gnl|my_center|LOCUS_13170 1469 2836 gene locus_tag LOCUS_13180 gene argH 1469 2836 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK27 protein_id gnl|my_center|LOCUS_13180 5455 2921 gene locus_tag LOCUS_13190 gene mcrA 5455 2921 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 protein_id gnl|my_center|LOCUS_13190 5638 6717 gene locus_tag LOCUS_13200 gene pilM 5638 6717 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 protein_id gnl|my_center|LOCUS_13200 6705 7292 gene locus_tag LOCUS_13210 gene pilN 6705 7292 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070654.1 protein_id gnl|my_center|LOCUS_13210 7289 7909 gene locus_tag LOCUS_13220 gene pilO 7289 7909 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070655.1 protein_id gnl|my_center|LOCUS_13220 7906 8421 gene locus_tag LOCUS_13230 gene pilP 7906 8421 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070656.1 protein_id gnl|my_center|LOCUS_13230 8443 10497 gene locus_tag LOCUS_13240 gene pilQ 8443 10497 CDS product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070657.1 protein_id gnl|my_center|LOCUS_13240 10829 11344 gene locus_tag LOCUS_13250 gene aroK 10829 11344 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK20 protein_id gnl|my_center|LOCUS_13250 11353 12429 gene locus_tag LOCUS_13260 gene aroB 11353 12429 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK19 protein_id gnl|my_center|LOCUS_13260 12446 13915 gene locus_tag LOCUS_13270 gene damX 12446 13915 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070660.1 protein_id gnl|my_center|LOCUS_13270 13964 14803 gene locus_tag LOCUS_13280 gene dam 13964 14803 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK17 protein_id gnl|my_center|LOCUS_13280 15013 14825 gene locus_tag LOCUS_13290 15013 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 15364 15014 gene locus_tag LOCUS_13300 15364 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070663.1 protein_id gnl|my_center|LOCUS_13300 15557 16225 gene locus_tag LOCUS_13310 gene rpe 15557 16225 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK14 protein_id gnl|my_center|LOCUS_13310 16229 16915 gene locus_tag LOCUS_13320 gene gph 16229 16915 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_13320 16915 17928 gene locus_tag LOCUS_13330 gene trpS 16915 17928 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK12 protein_id gnl|my_center|LOCUS_13330 18876 17986 gene locus_tag LOCUS_13340 18876 17986 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070667.1 protein_id gnl|my_center|LOCUS_13340 18999 19874 gene locus_tag LOCUS_13350 18999 19874 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070668.1 protein_id gnl|my_center|LOCUS_13350 20479 19910 gene locus_tag LOCUS_13360 20479 19910 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 protein_id gnl|my_center|LOCUS_13360 21069 20476 gene locus_tag LOCUS_13370 gene gmhA 21069 20476 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK08 protein_id gnl|my_center|LOCUS_13370 21492 21166 gene locus_tag LOCUS_13380 21492 21166 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK07 protein_id gnl|my_center|LOCUS_13380 23330 21501 gene locus_tag LOCUS_13390 gene lppC 23330 21501 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070672.1 protein_id gnl|my_center|LOCUS_13390 23419 24261 gene locus_tag LOCUS_13400 gene rsmI 23419 24261 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK05 protein_id gnl|my_center|LOCUS_13400 24965 24738 gene locus_tag LOCUS_13410 24965 24738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 26683 25034 gene locus_tag LOCUS_13420 26683 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_13420 28060 26840 gene locus_tag LOCUS_13430 28060 26840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_13430 28276 28680 gene locus_tag LOCUS_13440 28276 28680 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_13440 28856 31204 gene locus_tag LOCUS_13450 28856 31204 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJZ5 protein_id gnl|my_center|LOCUS_13450 34005 31297 gene locus_tag LOCUS_13460 34005 31297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_13460 35430 34276 gene locus_tag LOCUS_13470 35430 34276 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070680.1 protein_id gnl|my_center|LOCUS_13470 36825 35506 gene locus_tag LOCUS_13480 gene potE 36825 35506 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070681.1 protein_id gnl|my_center|LOCUS_13480 39049 36884 gene locus_tag LOCUS_13490 gene speF 39049 36884 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070682.1 protein_id gnl|my_center|LOCUS_13490 39921 40247 gene locus_tag LOCUS_13500 39921 40247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_13500 42250 40352 gene locus_tag LOCUS_13510 42250 40352 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883104.1 protein_id gnl|my_center|LOCUS_13510 43386 42328 gene locus_tag LOCUS_13520 gene ompU 43386 42328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261250.1 protein_id gnl|my_center|LOCUS_13520 44459 43494 gene locus_tag LOCUS_13530 gene fdhC 44459 43494 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074134.1 protein_id gnl|my_center|LOCUS_13530 45101 44478 gene locus_tag LOCUS_13540 45101 44478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 45646 45098 gene locus_tag LOCUS_13550 45646 45098 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461960.1 protein_id gnl|my_center|LOCUS_13550 47859 45658 gene locus_tag LOCUS_13560 47859 45658 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461961.1 protein_id gnl|my_center|LOCUS_13560 49420 47978 gene locus_tag LOCUS_13570 49420 47978 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356995.1 protein_id gnl|my_center|LOCUS_13570 49597 49430 gene locus_tag LOCUS_13580 49597 49430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 50593 49631 gene locus_tag LOCUS_13590 50593 49631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 50929 51501 gene locus_tag LOCUS_13600 50929 51501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_13600 52125 51547 gene locus_tag LOCUS_13610 52125 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_13610 54409 52349 gene locus_tag LOCUS_13620 54409 52349 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181435.1 protein_id gnl|my_center|LOCUS_13620 55329 54478 gene locus_tag LOCUS_13630 55329 54478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070690.1 protein_id gnl|my_center|LOCUS_13630 55773 55387 gene locus_tag LOCUS_13640 55773 55387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 protein_id gnl|my_center|LOCUS_13640 56272 55913 gene locus_tag LOCUS_13650 gene ychN 56272 55913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_13650 56544 57380 gene locus_tag LOCUS_13660 56544 57380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070693.1 protein_id gnl|my_center|LOCUS_13660 57500 57832 gene locus_tag LOCUS_13670 57500 57832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 57838 59310 gene locus_tag LOCUS_13680 57838 59310 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX6 protein_id gnl|my_center|LOCUS_13680 59327 59620 gene locus_tag LOCUS_13690 59327 59620 CDS product DUF3630 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070696.1 protein_id gnl|my_center|LOCUS_13690 59617 60618 gene locus_tag LOCUS_13700 gene rdoA 59617 60618 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX4 protein_id gnl|my_center|LOCUS_13700 60783 61394 gene locus_tag LOCUS_13710 gene dsbA 60783 61394 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX3 protein_id gnl|my_center|LOCUS_13710 61737 61949 gene locus_tag LOCUS_13720 61737 61949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070699.1 protein_id gnl|my_center|LOCUS_13720 62155 61952 gene locus_tag LOCUS_13730 gene zapB 62155 61952 CDS product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX1 protein_id gnl|my_center|LOCUS_13730 62358 62705 gene locus_tag LOCUS_13740 62358 62705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 protein_id gnl|my_center|LOCUS_13740 62980 62702 gene locus_tag LOCUS_13750 gene rofA 62980 62702 CDS product transcriptional antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070704.1 protein_id gnl|my_center|LOCUS_13750 63804 63250 gene locus_tag LOCUS_13760 63804 63250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 64040 65398 gene locus_tag LOCUS_13770 64040 65398 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 protein_id gnl|my_center|LOCUS_13770 65528 66619 gene locus_tag LOCUS_13780 gene ilvE 65528 66619 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070705.1 protein_id gnl|my_center|LOCUS_13780 67739 66690 gene locus_tag LOCUS_13790 67739 66690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071615.1 protein_id gnl|my_center|LOCUS_13790 68535 67795 gene locus_tag LOCUS_13800 68535 67795 CDS product periplasmic RmlC-type Cupin domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071614.1 protein_id gnl|my_center|LOCUS_13800 69685 68549 gene locus_tag LOCUS_13810 69685 68549 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_13810 70080 69712 gene locus_tag LOCUS_13820 70080 69712 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071617.1 protein_id gnl|my_center|LOCUS_13820 71610 70087 gene locus_tag LOCUS_13830 71610 70087 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071618.1 protein_id gnl|my_center|LOCUS_13830 71912 72676 gene locus_tag LOCUS_13840 71912 72676 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071619.1 protein_id gnl|my_center|LOCUS_13840 76948 72692 gene locus_tag LOCUS_13850 76948 72692 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_13850 76838 77101 gene locus_tag LOCUS_13860 76838 77101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 78551 77352 gene locus_tag LOCUS_13870 78551 77352 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_13870 81228 78637 gene locus_tag LOCUS_13880 81228 78637 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_13880 82456 81332 gene locus_tag LOCUS_13890 gene prpC 82456 81332 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_13890 83512 82637 gene locus_tag LOCUS_13900 gene prpB 83512 82637 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW1 protein_id gnl|my_center|LOCUS_13900 84250 83525 gene locus_tag LOCUS_13910 gene prpR 84250 83525 CDS product methycitrate-responsive transcriptional regulator of methylisocitrate utilization PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070711.1 protein_id gnl|my_center|LOCUS_13910 84417 84289 gene locus_tag LOCUS_13920 84417 84289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 84667 85164 gene locus_tag LOCUS_13930 84667 85164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112945.1 protein_id gnl|my_center|LOCUS_13930 86176 85238 gene locus_tag LOCUS_13940 86176 85238 CDS product phospholipid/glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070712.1 protein_id gnl|my_center|LOCUS_13940 87072 86176 gene locus_tag LOCUS_13950 87072 86176 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 protein_id gnl|my_center|LOCUS_13950 88389 87547 gene locus_tag LOCUS_13960 88389 87547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 89132 88413 gene locus_tag LOCUS_13970 89132 88413 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_13970 89400 89143 gene locus_tag LOCUS_13980 gene yjhX2 89400 89143 CDS product UPF0386 protein YjhX 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF41 protein_id gnl|my_center|LOCUS_13980 89982 91883 gene locus_tag LOCUS_13990 89982 91883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 91883 92839 gene locus_tag LOCUS_14000 91883 92839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687768.1 protein_id gnl|my_center|LOCUS_14000 96229 93218 gene locus_tag LOCUS_14010 96229 93218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 97325 96462 gene locus_tag LOCUS_14020 97325 96462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073931.1 protein_id gnl|my_center|LOCUS_14020 97506 98219 gene locus_tag LOCUS_14030 gene rph 97506 98219 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L4 protein_id gnl|my_center|LOCUS_14030 98325 98966 gene locus_tag LOCUS_14040 gene pyrE 98325 98966 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L5 protein_id gnl|my_center|LOCUS_14040 99695 99069 gene locus_tag LOCUS_14050 gene folE 99695 99069 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L6 protein_id gnl|my_center|LOCUS_14050 101882 99912 gene locus_tag LOCUS_14060 101882 99912 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence11 203 1087 gene locus_tag LOCUS_14070 203 1087 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895522.1 protein_id gnl|my_center|LOCUS_14070 1571 1056 gene locus_tag LOCUS_14080 1571 1056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074064.1 protein_id gnl|my_center|LOCUS_14080 1810 1568 gene locus_tag LOCUS_14090 1810 1568 CDS product Rad51 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074138.1 protein_id gnl|my_center|LOCUS_14090 2353 1871 gene locus_tag LOCUS_14100 2353 1871 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103516.1 protein_id gnl|my_center|LOCUS_14100 2949 2353 gene locus_tag LOCUS_14110 2949 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074063.1 protein_id gnl|my_center|LOCUS_14110 3872 2946 gene locus_tag LOCUS_14120 3872 2946 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331553.1 protein_id gnl|my_center|LOCUS_14120 4185 3952 gene locus_tag LOCUS_14130 4185 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4607 4212 gene locus_tag LOCUS_14140 4607 4212 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_14140 5441 4635 gene locus_tag LOCUS_14150 5441 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6104 5445 gene locus_tag LOCUS_14160 6104 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070540.1 protein_id gnl|my_center|LOCUS_14160 7140 6388 gene locus_tag LOCUS_14170 gene moeB 7140 6388 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070541.1 protein_id gnl|my_center|LOCUS_14170 8392 7148 gene locus_tag LOCUS_14180 gene moeA 8392 7148 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070542.1 protein_id gnl|my_center|LOCUS_14180 8282 8539 gene locus_tag LOCUS_14190 8282 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8667 9191 gene locus_tag LOCUS_14200 gene ftn 8667 9191 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF4 protein_id gnl|my_center|LOCUS_14200 12489 9268 gene locus_tag LOCUS_14210 12489 9268 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070544.1 protein_id gnl|my_center|LOCUS_14210 13393 12740 gene locus_tag LOCUS_14220 gene ribB 13393 12740 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF2 protein_id gnl|my_center|LOCUS_14220 13980 16052 gene locus_tag LOCUS_14230 gene ptrB 13980 16052 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070546.1 protein_id gnl|my_center|LOCUS_14230 16049 16324 gene locus_tag LOCUS_14240 16049 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 16437 16628 gene locus_tag LOCUS_14250 16437 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16755 17549 gene locus_tag LOCUS_14260 16755 17549 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_14260 18779 17622 gene locus_tag LOCUS_14270 18779 17622 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939476.1 protein_id gnl|my_center|LOCUS_14270 18973 19842 gene locus_tag LOCUS_14280 gene yqhC 18973 19842 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262232.1 protein_id gnl|my_center|LOCUS_14280 20391 19846 gene locus_tag LOCUS_14290 20391 19846 CDS product PilD processed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073854.1 protein_id gnl|my_center|LOCUS_14290 20695 21036 gene locus_tag LOCUS_14300 20695 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 22687 21131 gene locus_tag LOCUS_14310 22687 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 24608 23082 gene locus_tag LOCUS_14320 24608 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073836.1 protein_id gnl|my_center|LOCUS_14320 25094 24774 gene locus_tag LOCUS_14330 25094 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 25436 25263 gene locus_tag LOCUS_14340 25436 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 25768 26676 gene locus_tag LOCUS_14350 25768 26676 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074142.1 protein_id gnl|my_center|LOCUS_14350 27917 26751 gene locus_tag LOCUS_14360 27917 26751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070805.1 protein_id gnl|my_center|LOCUS_14360 28261 29109 gene locus_tag LOCUS_14370 28261 29109 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074090.1 protein_id gnl|my_center|LOCUS_14370 29408 30112 gene locus_tag LOCUS_14380 gene yiiM 29408 30112 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074088.1 protein_id gnl|my_center|LOCUS_14380 30131 30466 gene locus_tag LOCUS_14390 30131 30466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_14390 30514 30996 gene locus_tag LOCUS_14400 30514 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 31289 30987 gene locus_tag LOCUS_14410 31289 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074186.1 protein_id gnl|my_center|LOCUS_14410 31873 31286 gene locus_tag LOCUS_14420 gene rsmD 31873 31286 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S4 protein_id gnl|my_center|LOCUS_14420 32099 33703 gene locus_tag LOCUS_14430 32099 33703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 33707 34399 gene locus_tag LOCUS_14440 gene ftsE 33707 34399 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 protein_id gnl|my_center|LOCUS_14440 34403 35368 gene locus_tag LOCUS_14450 gene ftsX 34403 35368 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_14450 35539 36396 gene locus_tag LOCUS_14460 gene rpoH 35539 36396 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S8 protein_id gnl|my_center|LOCUS_14460 36724 38883 gene locus_tag LOCUS_14470 36724 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074434.1 protein_id gnl|my_center|LOCUS_14470 38894 40822 gene locus_tag LOCUS_14480 38894 40822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074435.1 protein_id gnl|my_center|LOCUS_14480 42264 40831 gene locus_tag LOCUS_14490 gene menE 42264 40831 CDS product 2-succinylbenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074179.1 protein_id gnl|my_center|LOCUS_14490 43361 42318 gene locus_tag LOCUS_14500 gene menC 43361 42318 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8T2 protein_id gnl|my_center|LOCUS_14500 43771 43361 gene locus_tag LOCUS_14510 43771 43361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 43826 44101 gene locus_tag LOCUS_14520 43826 44101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 45870 44149 gene locus_tag LOCUS_14530 gene menD 45870 44149 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8T4 protein_id gnl|my_center|LOCUS_14530 46978 46019 gene locus_tag LOCUS_14540 46978 46019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071812.1 protein_id gnl|my_center|LOCUS_14540 47383 47850 gene locus_tag LOCUS_14550 47383 47850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 47929 48390 gene locus_tag LOCUS_14560 47929 48390 CDS product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706296.1 protein_id gnl|my_center|LOCUS_14560 48403 49086 gene locus_tag LOCUS_14570 gene nfrC 48403 49086 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262126.1 protein_id gnl|my_center|LOCUS_14570 49083 50024 gene locus_tag LOCUS_14580 gene nrfD 49083 50024 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 protein_id gnl|my_center|LOCUS_14580 50047 50337 gene locus_tag LOCUS_14590 gene cctA 50047 50337 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072671.1 protein_id gnl|my_center|LOCUS_14590 50956 50531 gene locus_tag LOCUS_14600 50956 50531 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074172.1 protein_id gnl|my_center|LOCUS_14600 51145 52362 gene locus_tag LOCUS_14610 gene yjeH 51145 52362 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074171.1 protein_id gnl|my_center|LOCUS_14610 52828 52373 gene locus_tag LOCUS_14620 52828 52373 CDS product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_14620 53505 52975 gene locus_tag LOCUS_14630 53505 52975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074167.1 protein_id gnl|my_center|LOCUS_14630 53692 54396 gene locus_tag LOCUS_14640 53692 54396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074166.1 protein_id gnl|my_center|LOCUS_14640 54421 55833 gene locus_tag LOCUS_14650 54421 55833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074165.1 protein_id gnl|my_center|LOCUS_14650 56129 55830 gene locus_tag LOCUS_14660 56129 55830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 56454 58325 gene locus_tag LOCUS_14670 56454 58325 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707132.1 protein_id gnl|my_center|LOCUS_14670 59324 58350 gene locus_tag LOCUS_14680 59324 58350 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074162.1 protein_id gnl|my_center|LOCUS_14680 59423 60628 gene locus_tag LOCUS_14690 59423 60628 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074161.1 protein_id gnl|my_center|LOCUS_14690 60828 61424 gene locus_tag LOCUS_14700 60828 61424 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 protein_id gnl|my_center|LOCUS_14700 63733 61640 gene locus_tag LOCUS_14710 63733 61640 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074159.1 protein_id gnl|my_center|LOCUS_14710 63947 64300 gene locus_tag LOCUS_14720 63947 64300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 64427 65755 gene locus_tag LOCUS_14730 64427 65755 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_14730 65752 67185 gene locus_tag LOCUS_14740 65752 67185 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_14740 68231 67254 gene locus_tag LOCUS_14750 68231 67254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 68538 69101 gene locus_tag LOCUS_14760 68538 69101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 69133 69597 gene locus_tag LOCUS_14770 69133 69597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074149.1 protein_id gnl|my_center|LOCUS_14770 70063 69599 gene locus_tag LOCUS_14780 gene trmL 70063 69599 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8X2 protein_id gnl|my_center|LOCUS_14780 73057 70193 gene locus_tag LOCUS_14790 gene btuB 73057 70193 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_14790 74774 73254 gene locus_tag LOCUS_14800 gene exaC 74774 73254 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_14800 75023 76819 gene locus_tag LOCUS_14810 75023 76819 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074107.1 protein_id gnl|my_center|LOCUS_14810 77028 78011 gene locus_tag LOCUS_14820 77028 78011 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481249.1 protein_id gnl|my_center|LOCUS_14820 78426 79946 gene locus_tag LOCUS_14830 78426 79946 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_14830 79973 80326 gene locus_tag LOCUS_14840 79973 80326 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073430.1 protein_id gnl|my_center|LOCUS_14840 80602 81846 gene locus_tag LOCUS_14850 80602 81846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 82813 81959 gene locus_tag LOCUS_14860 82813 81959 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971851.1 protein_id gnl|my_center|LOCUS_14860 82927 83610 gene locus_tag LOCUS_14870 82927 83610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 84955 83588 gene locus_tag LOCUS_14880 gene cpxA 84955 83588 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 protein_id gnl|my_center|LOCUS_14880 85641 84955 gene locus_tag LOCUS_14890 gene cpxR 85641 84955 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_14890 85850 86470 gene locus_tag LOCUS_14900 85850 86470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 86516 87385 gene locus_tag LOCUS_14910 gene fieF 86516 87385 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 protein_id gnl|my_center|LOCUS_14910 87397 87729 gene locus_tag LOCUS_14920 87397 87729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 89184 87781 gene locus_tag LOCUS_14930 gene glnG 89184 87781 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074101.1 protein_id gnl|my_center|LOCUS_14930 90259 89201 gene locus_tag LOCUS_14940 gene glnL 90259 89201 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074100.1 protein_id gnl|my_center|LOCUS_14940 90920 90375 gene locus_tag LOCUS_14950 90920 90375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_14950 92149 90992 gene locus_tag LOCUS_14960 92149 90992 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_14960 94141 92162 gene locus_tag LOCUS_14970 94141 92162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 95122 94265 gene locus_tag LOCUS_14980 95122 94265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074144.1 protein_id gnl|my_center|LOCUS_14980 96363 95245 gene locus_tag LOCUS_14990 96363 95245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 96590 97513 gene locus_tag LOCUS_15000 96590 97513 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812774.1 protein_id gnl|my_center|LOCUS_15000 97523 98020 gene locus_tag LOCUS_15010 97523 98020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 99525 98116 gene locus_tag LOCUS_15020 gene glnA 99525 98116 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E976 protein_id gnl|my_center|LOCUS_15020 99982 101796 gene locus_tag LOCUS_15030 gene bipA 99982 101796 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence12 504 797 gene locus_tag LOCUS_15040 504 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2210 855 gene locus_tag LOCUS_15050 2210 855 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS2 protein_id gnl|my_center|LOCUS_15050 2904 2233 gene locus_tag LOCUS_15060 2904 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3457 4509 gene locus_tag LOCUS_15070 3457 4509 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071380.1 protein_id gnl|my_center|LOCUS_15070 4676 5416 gene locus_tag LOCUS_15080 4676 5416 CDS product sporulation-control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462606.1 protein_id gnl|my_center|LOCUS_15080 5483 5908 gene locus_tag LOCUS_15090 gene trxC 5483 5908 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_15090 5905 6192 gene locus_tag LOCUS_15100 5905 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 6158 6526 gene locus_tag LOCUS_15110 6158 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 6687 7403 gene locus_tag LOCUS_15120 gene mtgA 6687 7403 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB02 protein_id gnl|my_center|LOCUS_15120 9138 7387 gene locus_tag LOCUS_15130 9138 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11432 9405 gene locus_tag LOCUS_15140 11432 9405 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_15140 11749 13116 gene locus_tag LOCUS_15150 11749 13116 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480760.1 protein_id gnl|my_center|LOCUS_15150 13444 15135 gene locus_tag LOCUS_15160 13444 15135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479209.1 protein_id gnl|my_center|LOCUS_15160 15521 15147 gene locus_tag LOCUS_15170 15521 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073568.1 protein_id gnl|my_center|LOCUS_15170 17457 15532 gene locus_tag LOCUS_15180 gene ydcP 17457 15532 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073569.1 protein_id gnl|my_center|LOCUS_15180 17710 18234 gene locus_tag LOCUS_15190 17710 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 18595 18338 gene locus_tag LOCUS_15200 18595 18338 CDS product DUF2999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071035.1 protein_id gnl|my_center|LOCUS_15200 19424 18813 gene locus_tag LOCUS_15210 19424 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 19997 19428 gene locus_tag LOCUS_15220 19997 19428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669402.1 protein_id gnl|my_center|LOCUS_15220 20376 21260 gene locus_tag LOCUS_15230 20376 21260 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479816.1 protein_id gnl|my_center|LOCUS_15230 21367 22476 gene locus_tag LOCUS_15240 21367 22476 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106260.1 protein_id gnl|my_center|LOCUS_15240 22473 25571 gene locus_tag LOCUS_15250 22473 25571 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479778.1 protein_id gnl|my_center|LOCUS_15250 25571 27046 gene locus_tag LOCUS_15260 25571 27046 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479783.1 protein_id gnl|my_center|LOCUS_15260 27152 28459 gene locus_tag LOCUS_15270 27152 28459 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 protein_id gnl|my_center|LOCUS_15270 28473 30125 gene locus_tag LOCUS_15280 28473 30125 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 protein_id gnl|my_center|LOCUS_15280 30127 30729 gene locus_tag LOCUS_15290 30127 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805968.1 protein_id gnl|my_center|LOCUS_15290 32303 30918 gene locus_tag LOCUS_15300 gene dbpA 32303 30918 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_15300 33944 32445 gene locus_tag LOCUS_15310 gene rhlE 33944 32445 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 protein_id gnl|my_center|LOCUS_15310 34168 35214 gene locus_tag LOCUS_15320 34168 35214 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073557.1 protein_id gnl|my_center|LOCUS_15320 35569 37458 gene locus_tag LOCUS_15330 gene cydD 35569 37458 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073555.1 protein_id gnl|my_center|LOCUS_15330 37460 39205 gene locus_tag LOCUS_15340 gene cydC 37460 39205 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073554.1 protein_id gnl|my_center|LOCUS_15340 39397 39687 gene locus_tag LOCUS_15350 39397 39687 CDS product UPF0251 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV3 protein_id gnl|my_center|LOCUS_15350 39684 40208 gene locus_tag LOCUS_15360 39684 40208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071039.1 protein_id gnl|my_center|LOCUS_15360 41571 40279 gene locus_tag LOCUS_15370 41571 40279 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074230.1 protein_id gnl|my_center|LOCUS_15370 41969 42226 gene locus_tag LOCUS_15380 41969 42226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 42460 43689 gene locus_tag LOCUS_15390 42460 43689 CDS product amino acid:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070556.1 protein_id gnl|my_center|LOCUS_15390 45205 43889 gene locus_tag LOCUS_15400 gene phoA 45205 43889 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071122.1 protein_id gnl|my_center|LOCUS_15400 46172 45213 gene locus_tag LOCUS_15410 gene gshB 46172 45213 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK8 protein_id gnl|my_center|LOCUS_15410 46947 46216 gene locus_tag LOCUS_15420 gene rsmE 46947 46216 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK7 protein_id gnl|my_center|LOCUS_15420 47706 46966 gene locus_tag LOCUS_15430 gene endA 47706 46966 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071125.1 protein_id gnl|my_center|LOCUS_15430 48386 47817 gene locus_tag LOCUS_15440 gene sprT 48386 47817 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK5 protein_id gnl|my_center|LOCUS_15440 49606 48458 gene locus_tag LOCUS_15450 49606 48458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071127.1 protein_id gnl|my_center|LOCUS_15450 49797 50666 gene locus_tag LOCUS_15460 gene blaA 49797 50666 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_15460 51676 50765 gene locus_tag LOCUS_15470 51676 50765 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 protein_id gnl|my_center|LOCUS_15470 51798 56351 gene locus_tag LOCUS_15480 gene accADCB 51798 56351 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071130.1 protein_id gnl|my_center|LOCUS_15480 56496 57896 gene locus_tag LOCUS_15490 56496 57896 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071131.1 protein_id gnl|my_center|LOCUS_15490 58190 60280 gene locus_tag LOCUS_15500 gene fusA2 58190 60280 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 protein_id gnl|my_center|LOCUS_15500 61320 60604 gene locus_tag LOCUS_15510 gene arcA 61320 60604 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644695.1 protein_id gnl|my_center|LOCUS_15510 61879 62310 gene locus_tag LOCUS_15520 61879 62310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073718.1 protein_id gnl|my_center|LOCUS_15520 62710 64077 gene locus_tag LOCUS_15530 gene lysC 62710 64077 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC1 protein_id gnl|my_center|LOCUS_15530 64067 65173 gene locus_tag LOCUS_15540 gene dapA 64067 65173 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 protein_id gnl|my_center|LOCUS_15540 65717 65223 gene locus_tag LOCUS_15550 gene asnC 65717 65223 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073571.1 protein_id gnl|my_center|LOCUS_15550 66470 65793 gene locus_tag LOCUS_15560 gene rluA 66470 65793 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSW3 protein_id gnl|my_center|LOCUS_15560 66679 68787 gene locus_tag LOCUS_15570 66679 68787 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_15570 68976 69164 gene locus_tag LOCUS_15580 68976 69164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 69659 69369 gene locus_tag LOCUS_15590 69659 69369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071248.1 protein_id gnl|my_center|LOCUS_15590 70211 69693 gene locus_tag LOCUS_15600 70211 69693 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_15600 70603 70208 gene locus_tag LOCUS_15610 70603 70208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071246.1 protein_id gnl|my_center|LOCUS_15610 71010 72794 gene locus_tag LOCUS_15620 71010 72794 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P83223 protein_id gnl|my_center|LOCUS_15620 73070 72876 gene locus_tag LOCUS_15630 73070 72876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 72993 73982 gene locus_tag LOCUS_15640 gene ldhA 72993 73982 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071244.1 protein_id gnl|my_center|LOCUS_15640 74162 74899 gene locus_tag LOCUS_15650 74162 74899 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121775.1 protein_id gnl|my_center|LOCUS_15650 75441 74896 gene locus_tag LOCUS_15660 75441 74896 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_15660 75535 76278 gene locus_tag LOCUS_15670 75535 76278 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071239.1 protein_id gnl|my_center|LOCUS_15670 76368 77906 gene locus_tag LOCUS_15680 gene pepA1 76368 77906 CDS product putative cytosol aminopeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI85 protein_id gnl|my_center|LOCUS_15680 78096 78665 gene locus_tag LOCUS_15690 gene ahpC 78096 78665 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_15690 78770 80329 gene locus_tag LOCUS_15700 gene ahpF 78770 80329 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071236.1 protein_id gnl|my_center|LOCUS_15700 80763 80434 gene locus_tag LOCUS_15710 80763 80434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071207.1 protein_id gnl|my_center|LOCUS_15710 81381 80845 gene locus_tag LOCUS_15720 81381 80845 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071206.1 protein_id gnl|my_center|LOCUS_15720 81520 82470 gene locus_tag LOCUS_15730 81520 82470 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071205.1 protein_id gnl|my_center|LOCUS_15730 83103 83522 gene locus_tag LOCUS_15740 83103 83522 CDS product heat-shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071203.1 protein_id gnl|my_center|LOCUS_15740 83858 83658 gene locus_tag LOCUS_15750 83858 83658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 85406 84006 gene locus_tag LOCUS_15760 85406 84006 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071250.1 protein_id gnl|my_center|LOCUS_15760 85695 87587 gene locus_tag LOCUS_15770 85695 87587 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071312.1 protein_id gnl|my_center|LOCUS_15770 88149 87730 gene locus_tag LOCUS_15780 88149 87730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 88688 89137 gene locus_tag LOCUS_15790 gene ohrR 88688 89137 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071252.1 protein_id gnl|my_center|LOCUS_15790 89151 90338 gene locus_tag LOCUS_15800 gene glpD 89151 90338 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_15800 90472 91545 gene locus_tag LOCUS_15810 gene rlmC 90472 91545 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI67 protein_id gnl|my_center|LOCUS_15810 91709 92893 gene locus_tag LOCUS_15820 91709 92893 CDS product chromate efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071255.1 protein_id gnl|my_center|LOCUS_15820 92980 94653 gene locus_tag LOCUS_15830 92980 94653 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071256.1 protein_id gnl|my_center|LOCUS_15830 98994 94747 gene locus_tag LOCUS_15840 98994 94747 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071257.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence13 3053 1482 gene locus_tag LOCUS_15850 3053 1482 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_15850 5590 4142 gene locus_tag LOCUS_15860 gene tldD 5590 4142 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073795.1 protein_id gnl|my_center|LOCUS_15860 6472 5627 gene locus_tag LOCUS_15870 6472 5627 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073796.1 protein_id gnl|my_center|LOCUS_15870 10706 6396 gene locus_tag LOCUS_15880 10706 6396 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073797.1 protein_id gnl|my_center|LOCUS_15880 12172 10706 gene locus_tag LOCUS_15890 gene rng 12172 10706 CDS product ribonuclease G Rng inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073798.1 protein_id gnl|my_center|LOCUS_15890 12906 12304 gene locus_tag LOCUS_15900 12906 12304 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA14 protein_id gnl|my_center|LOCUS_15900 13396 12908 gene locus_tag LOCUS_15910 gene mreD 13396 12908 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA13 protein_id gnl|my_center|LOCUS_15910 14211 13393 gene locus_tag LOCUS_15920 14211 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 15363 14314 gene locus_tag LOCUS_15930 gene mreB 15363 14314 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_15930 17014 15572 gene locus_tag LOCUS_15940 17014 15572 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG1 protein_id gnl|my_center|LOCUS_15940 20587 17135 gene locus_tag LOCUS_15950 gene mshQ 20587 17135 CDS product MSHA biogenesis protein MshQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073802.1 protein_id gnl|my_center|LOCUS_15950 21053 20580 gene locus_tag LOCUS_15960 gene mshP 21053 20580 CDS product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073803.1 protein_id gnl|my_center|LOCUS_15960 21879 21043 gene locus_tag LOCUS_15970 gene mshO 21879 21043 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_15970 22379 21879 gene locus_tag LOCUS_15980 gene mshD 22379 21879 CDS product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_15980 22836 22369 gene locus_tag LOCUS_15990 gene mshC 22836 22369 CDS product MSHA biogenesis protein MshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073806.1 protein_id gnl|my_center|LOCUS_15990 23460 22945 gene locus_tag LOCUS_16000 23460 22945 CDS product pilin structural protein V10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073556.1 protein_id gnl|my_center|LOCUS_16000 23982 23476 gene locus_tag LOCUS_16010 23982 23476 CDS product PilD processed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071407.1 protein_id gnl|my_center|LOCUS_16010 24619 24017 gene locus_tag LOCUS_16020 gene mshB 24619 24017 CDS product MSHA biogenesis protein MshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073808.1 protein_id gnl|my_center|LOCUS_16020 25179 24685 gene locus_tag LOCUS_16030 gene mshF 25179 24685 CDS product MSHA biogenesis protein MshF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073809.1 protein_id gnl|my_center|LOCUS_16030 26399 25179 gene locus_tag LOCUS_16040 gene mshG 26399 25179 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_16040 28156 26402 gene locus_tag LOCUS_16050 gene mshE 28156 26402 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_16050 29481 28153 gene locus_tag LOCUS_16060 gene mshN 29481 28153 CDS product MSHA biogenesis protein MshN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073812.1 protein_id gnl|my_center|LOCUS_16060 30389 29478 gene locus_tag LOCUS_16070 gene mshM 30389 29478 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_16070 32122 30398 gene locus_tag LOCUS_16080 gene mshL 32122 30398 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_16080 32448 32122 gene locus_tag LOCUS_16090 gene mshK 32448 32122 CDS product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073815.1 protein_id gnl|my_center|LOCUS_16090 33028 32429 gene locus_tag LOCUS_16100 gene mshJ 33028 32429 CDS product MSHA biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073816.1 protein_id gnl|my_center|LOCUS_16100 33684 33085 gene locus_tag LOCUS_16110 gene mshI2 33684 33085 CDS product MSHA biogenesis protein MshI2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073817.1 protein_id gnl|my_center|LOCUS_16110 34565 33681 gene locus_tag LOCUS_16120 gene mshI1 34565 33681 CDS product MSHA biogenesis protein MshI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073818.1 protein_id gnl|my_center|LOCUS_16120 36670 34757 gene locus_tag LOCUS_16130 gene mshH 36670 34757 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073819.1 protein_id gnl|my_center|LOCUS_16130 38148 36901 gene locus_tag LOCUS_16140 gene maeB 38148 36901 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073820.1 protein_id gnl|my_center|LOCUS_16140 39161 38325 gene locus_tag LOCUS_16150 39161 38325 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_16150 39903 39241 gene locus_tag LOCUS_16160 39903 39241 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070853.1 protein_id gnl|my_center|LOCUS_16160 40409 39900 gene locus_tag LOCUS_16170 40409 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070852.1 protein_id gnl|my_center|LOCUS_16170 40564 42102 gene locus_tag LOCUS_16180 gene ubiD 40564 42102 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJG1 protein_id gnl|my_center|LOCUS_16180 42170 42868 gene locus_tag LOCUS_16190 gene fre 42170 42868 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070849.1 protein_id gnl|my_center|LOCUS_16190 43025 43405 gene locus_tag LOCUS_16200 43025 43405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_16200 44543 43449 gene locus_tag LOCUS_16210 44543 43449 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 protein_id gnl|my_center|LOCUS_16210 45065 44553 gene locus_tag LOCUS_16220 45065 44553 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073878.1 protein_id gnl|my_center|LOCUS_16220 45429 45187 gene locus_tag LOCUS_16230 45429 45187 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073879.1 protein_id gnl|my_center|LOCUS_16230 45764 46249 gene locus_tag LOCUS_16240 gene rraA 45764 46249 CDS product regulator of ribonuclease activity A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R9 protein_id gnl|my_center|LOCUS_16240 46358 47380 gene locus_tag LOCUS_16250 gene hutG 46358 47380 CDS product formimidoylglutamase HutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073881.1 protein_id gnl|my_center|LOCUS_16250 47652 48407 gene locus_tag LOCUS_16260 gene ubiE 47652 48407 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R7 protein_id gnl|my_center|LOCUS_16260 48409 49041 gene locus_tag LOCUS_16270 gene yigP 48409 49041 CDS product DUF1243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073883.1 protein_id gnl|my_center|LOCUS_16270 49038 50687 gene locus_tag LOCUS_16280 gene ubiB 49038 50687 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R5 protein_id gnl|my_center|LOCUS_16280 50747 50992 gene locus_tag LOCUS_16290 gene tatA 50747 50992 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R4 protein_id gnl|my_center|LOCUS_16290 50999 51403 gene locus_tag LOCUS_16300 gene tatB 50999 51403 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R3 protein_id gnl|my_center|LOCUS_16300 51414 52169 gene locus_tag LOCUS_16310 gene tatC 51414 52169 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R2 protein_id gnl|my_center|LOCUS_16310 52218 52730 gene locus_tag LOCUS_16320 52218 52730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 protein_id gnl|my_center|LOCUS_16320 52727 53530 gene locus_tag LOCUS_16330 gene tatD 52727 53530 CDS product DNase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073889.1 protein_id gnl|my_center|LOCUS_16330 53523 55424 gene locus_tag LOCUS_16340 53523 55424 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_16340 55421 56431 gene locus_tag LOCUS_16350 gene hemB 55421 56431 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_16350 56625 57164 gene locus_tag LOCUS_16360 56625 57164 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_16360 58186 57257 gene locus_tag LOCUS_16370 gene gppA 58186 57257 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070768.1 protein_id gnl|my_center|LOCUS_16370 59500 58187 gene locus_tag LOCUS_16380 gene rhlB 59500 58187 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ5 protein_id gnl|my_center|LOCUS_16380 59630 59980 gene locus_tag LOCUS_16390 gene trxA 59630 59980 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ6 protein_id gnl|my_center|LOCUS_16390 60194 61459 gene locus_tag LOCUS_16400 gene rho 60194 61459 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ7 protein_id gnl|my_center|LOCUS_16400 62480 61533 gene locus_tag LOCUS_16410 62480 61533 CDS product stomatin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073827.1 protein_id gnl|my_center|LOCUS_16410 63403 62477 gene locus_tag LOCUS_16420 63403 62477 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073828.1 protein_id gnl|my_center|LOCUS_16420 63887 63426 gene locus_tag LOCUS_16430 63887 63426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073829.1 protein_id gnl|my_center|LOCUS_16430 64302 65054 gene locus_tag LOCUS_16440 64302 65054 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073830.1 protein_id gnl|my_center|LOCUS_16440 65870 65112 gene locus_tag LOCUS_16450 gene udp 65870 65112 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9X9 protein_id gnl|my_center|LOCUS_16450 66177 66389 gene locus_tag LOCUS_16460 66177 66389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073832.1 protein_id gnl|my_center|LOCUS_16460 67638 66463 gene locus_tag LOCUS_16470 gene speC 67638 66463 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073834.1 protein_id gnl|my_center|LOCUS_16470 68050 68829 gene locus_tag LOCUS_16480 68050 68829 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_16480 69340 68849 gene locus_tag LOCUS_16490 69340 68849 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 protein_id gnl|my_center|LOCUS_16490 69464 70309 gene locus_tag LOCUS_16500 69464 70309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 71188 70310 gene locus_tag LOCUS_16510 71188 70310 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_16510 71395 71646 gene locus_tag LOCUS_16520 71395 71646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 72022 71705 gene locus_tag LOCUS_16530 72022 71705 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070868.1 protein_id gnl|my_center|LOCUS_16530 72490 72023 gene locus_tag LOCUS_16540 72490 72023 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 protein_id gnl|my_center|LOCUS_16540 73151 74125 gene locus_tag LOCUS_16550 73151 74125 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070865.1 protein_id gnl|my_center|LOCUS_16550 74345 74740 gene locus_tag LOCUS_16560 74345 74740 CDS product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071338.1 protein_id gnl|my_center|LOCUS_16560 76163 75360 gene locus_tag LOCUS_16570 76163 75360 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071336.1 protein_id gnl|my_center|LOCUS_16570 76300 77187 gene locus_tag LOCUS_16580 76300 77187 CDS product multidrug DMT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071335.1 protein_id gnl|my_center|LOCUS_16580 77616 77747 gene locus_tag LOCUS_16590 77616 77747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 79168 77831 gene locus_tag LOCUS_16600 79168 77831 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070800.1 protein_id gnl|my_center|LOCUS_16600 79653 79162 gene locus_tag LOCUS_16610 gene zntR 79653 79162 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 protein_id gnl|my_center|LOCUS_16610 79930 81519 gene locus_tag LOCUS_16620 gene purH 79930 81519 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM1 protein_id gnl|my_center|LOCUS_16620 81654 82949 gene locus_tag LOCUS_16630 gene purD 81654 82949 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM2 protein_id gnl|my_center|LOCUS_16630 83795 83067 gene locus_tag LOCUS_16640 gene frdB 83795 83067 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070759.1 protein_id gnl|my_center|LOCUS_16640 85819 83792 gene locus_tag LOCUS_16650 gene frdA 85819 83792 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 protein_id gnl|my_center|LOCUS_16650 86550 85885 gene locus_tag LOCUS_16660 gene frdC 86550 85885 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070757.1 protein_id gnl|my_center|LOCUS_16660 87565 86681 gene locus_tag LOCUS_16670 gene frdC 87565 86681 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070756.1 protein_id gnl|my_center|LOCUS_16670 87758 88639 gene locus_tag LOCUS_16680 gene prmA 87758 88639 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_16680 88792 89763 gene locus_tag LOCUS_16690 gene dusB 88792 89763 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR8 protein_id gnl|my_center|LOCUS_16690 89778 90083 gene locus_tag LOCUS_16700 gene fis 89778 90083 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR9 protein_id gnl|my_center|LOCUS_16700 90454 96024 gene locus_tag LOCUS_16710 90454 96024 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070479.1 protein_id gnl|my_center|LOCUS_16710 96021 98306 gene locus_tag LOCUS_16720 gene pbpC 96021 98306 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 protein_id gnl|my_center|LOCUS_16720 98425 >99230 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgggcggcagtgaac >Feature sequence14 629 204 gene locus_tag LOCUS_16730 gene rimP 629 204 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL7 protein_id gnl|my_center|LOCUS_16730 910 834 gene locus_tag LOCUS_t00180 910 834 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1079 993 gene locus_tag LOCUS_t00190 1079 993 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1395 1090 gene locus_tag LOCUS_16740 gene secG 1395 1090 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071431.1 protein_id gnl|my_center|LOCUS_16740 2179 1397 gene locus_tag LOCUS_16750 gene tpiA 2179 1397 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL9 protein_id gnl|my_center|LOCUS_16750 3639 2362 gene locus_tag LOCUS_16760 gene glmM 3639 2362 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM0 protein_id gnl|my_center|LOCUS_16760 4633 3797 gene locus_tag LOCUS_16770 gene folP 4633 3797 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_16770 6702 4747 gene locus_tag LOCUS_16780 gene ftsH 6702 4747 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM2 protein_id gnl|my_center|LOCUS_16780 7385 6756 gene locus_tag LOCUS_16790 gene rlmE 7385 6756 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM3 protein_id gnl|my_center|LOCUS_16790 7476 7775 gene locus_tag LOCUS_16800 gene yhbY 7476 7775 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 protein_id gnl|my_center|LOCUS_16800 8787 7891 gene locus_tag LOCUS_16810 gene secF2 8787 7891 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6H7 protein_id gnl|my_center|LOCUS_16810 10627 8792 gene locus_tag LOCUS_16820 gene secD 10627 8792 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM6 protein_id gnl|my_center|LOCUS_16820 11313 10747 gene locus_tag LOCUS_16830 11313 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 11897 11421 gene locus_tag LOCUS_16840 gene greA 11897 11421 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM8 protein_id gnl|my_center|LOCUS_16840 15087 12142 gene locus_tag LOCUS_16850 15087 12142 CDS product nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882363.1 protein_id gnl|my_center|LOCUS_16850 18588 15367 gene locus_tag LOCUS_16860 gene carB 18588 15367 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS5 protein_id gnl|my_center|LOCUS_16860 19655 18612 gene locus_tag LOCUS_16870 gene carA 19655 18612 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS6 protein_id gnl|my_center|LOCUS_16870 20722 19949 gene locus_tag LOCUS_16880 gene dapB 20722 19949 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS7 protein_id gnl|my_center|LOCUS_16880 21444 20827 gene locus_tag LOCUS_16890 gene fklB 21444 20827 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_16890 22398 21604 gene locus_tag LOCUS_16900 22398 21604 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 protein_id gnl|my_center|LOCUS_16900 23778 22648 gene locus_tag LOCUS_16910 gene dnaJ 23778 22648 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT6 protein_id gnl|my_center|LOCUS_16910 25782 23869 gene locus_tag LOCUS_16920 gene dnaK 25782 23869 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT7 protein_id gnl|my_center|LOCUS_16920 26084 26986 gene locus_tag LOCUS_16930 26084 26986 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071366.1 protein_id gnl|my_center|LOCUS_16930 27769 27257 gene locus_tag LOCUS_16940 gene blc 27769 27257 CDS product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08790 protein_id gnl|my_center|LOCUS_16940 28711 27797 gene locus_tag LOCUS_16950 28711 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707324.1 protein_id gnl|my_center|LOCUS_16950 29100 28867 gene locus_tag LOCUS_16960 29100 28867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 30694 30320 gene locus_tag LOCUS_16970 30694 30320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105960.1 protein_id gnl|my_center|LOCUS_16970 31199 30801 gene locus_tag LOCUS_16980 31199 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 31527 31270 gene locus_tag LOCUS_16990 31527 31270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 32015 31662 gene locus_tag LOCUS_17000 32015 31662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 32920 33213 gene locus_tag LOCUS_17010 32920 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073494.1 protein_id gnl|my_center|LOCUS_17010 33636 34109 gene locus_tag LOCUS_17020 gene ybaK 33636 34109 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT9 protein_id gnl|my_center|LOCUS_17020 35452 34193 gene locus_tag LOCUS_17030 gene proA 35452 34193 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU1 protein_id gnl|my_center|LOCUS_17030 36567 35449 gene locus_tag LOCUS_17040 gene proB 36567 35449 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU2 protein_id gnl|my_center|LOCUS_17040 36475 36717 gene locus_tag LOCUS_17050 36475 36717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 38048 36756 gene locus_tag LOCUS_17060 38048 36756 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071361.1 protein_id gnl|my_center|LOCUS_17060 40787 39261 gene locus_tag LOCUS_17070 40787 39261 CDS product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071359.1 protein_id gnl|my_center|LOCUS_17070 40999 42459 gene locus_tag LOCUS_17080 gene pepD 40999 42459 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071358.1 protein_id gnl|my_center|LOCUS_17080 43183 42689 gene locus_tag LOCUS_17090 gene dps 43183 42689 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_17090 44761 43490 gene locus_tag LOCUS_17100 gene puuE 44761 43490 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071495.1 protein_id gnl|my_center|LOCUS_17100 46251 44809 gene locus_tag LOCUS_17110 gene puuC 46251 44809 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071494.1 protein_id gnl|my_center|LOCUS_17110 47584 46298 gene locus_tag LOCUS_17120 gene puuB 47584 46298 CDS product gamma-glutamylputrescine oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071493.1 protein_id gnl|my_center|LOCUS_17120 48564 47749 gene locus_tag LOCUS_17130 gene potI 48564 47749 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 protein_id gnl|my_center|LOCUS_17130 49460 48561 gene locus_tag LOCUS_17140 gene potH 49460 48561 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071491.1 protein_id gnl|my_center|LOCUS_17140 50593 49457 gene locus_tag LOCUS_17150 gene potG 50593 49457 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHF2 protein_id gnl|my_center|LOCUS_17150 51809 50712 gene locus_tag LOCUS_17160 gene potF 51809 50712 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHF3 protein_id gnl|my_center|LOCUS_17160 53338 51965 gene locus_tag LOCUS_17170 gene spuC 53338 51965 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 protein_id gnl|my_center|LOCUS_17170 54698 53349 gene locus_tag LOCUS_17180 gene puuA 54698 53349 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071488.1 protein_id gnl|my_center|LOCUS_17180 55464 54700 gene locus_tag LOCUS_17190 gene puuD 55464 54700 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071487.1 protein_id gnl|my_center|LOCUS_17190 56382 55834 gene locus_tag LOCUS_17200 gene puuR 56382 55834 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071486.1 protein_id gnl|my_center|LOCUS_17200 56592 57899 gene locus_tag LOCUS_17210 56592 57899 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071485.1 protein_id gnl|my_center|LOCUS_17210 57987 58208 gene locus_tag LOCUS_17220 57987 58208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 59759 58263 gene locus_tag LOCUS_17230 gene gabD 59759 58263 CDS product gamma-glutamyl-gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073337.1 protein_id gnl|my_center|LOCUS_17230 60015 61352 gene locus_tag LOCUS_17240 gene aptA 60015 61352 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073338.1 protein_id gnl|my_center|LOCUS_17240 61369 62853 gene locus_tag LOCUS_17250 gene mmsA-1 61369 62853 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_17250 62872 63234 gene locus_tag LOCUS_17260 62872 63234 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073340.1 protein_id gnl|my_center|LOCUS_17260 63339 64076 gene locus_tag LOCUS_17270 63339 64076 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_17270 64389 64207 gene locus_tag LOCUS_17280 64389 64207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073240.1 protein_id gnl|my_center|LOCUS_17280 64598 64939 gene locus_tag LOCUS_17290 64598 64939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073241.1 protein_id gnl|my_center|LOCUS_17290 65173 64940 gene locus_tag LOCUS_17300 65173 64940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 66184 65585 gene locus_tag LOCUS_17310 66184 65585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_17310 66867 66172 gene locus_tag LOCUS_17320 66867 66172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 67521 66880 gene locus_tag LOCUS_17330 67521 66880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 68784 67525 gene locus_tag LOCUS_17340 gene cfaS 68784 67525 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_17340 69734 68943 gene locus_tag LOCUS_17350 69734 68943 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073247.1 protein_id gnl|my_center|LOCUS_17350 71002 69731 gene locus_tag LOCUS_17360 71002 69731 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 protein_id gnl|my_center|LOCUS_17360 71748 70999 gene locus_tag LOCUS_17370 71748 70999 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073249.1 protein_id gnl|my_center|LOCUS_17370 72239 71745 gene locus_tag LOCUS_17380 72239 71745 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 protein_id gnl|my_center|LOCUS_17380 73778 72267 gene locus_tag LOCUS_17390 gene phrB 73778 72267 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073251.1 protein_id gnl|my_center|LOCUS_17390 74751 73780 gene locus_tag LOCUS_17400 74751 73780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 75697 74741 gene locus_tag LOCUS_17410 75697 74741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073253.1 protein_id gnl|my_center|LOCUS_17410 76918 75998 gene locus_tag LOCUS_17420 76918 75998 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_17420 77264 77758 gene locus_tag LOCUS_17430 77264 77758 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098177.1 protein_id gnl|my_center|LOCUS_17430 77857 79023 gene locus_tag LOCUS_17440 77857 79023 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071602.1 protein_id gnl|my_center|LOCUS_17440 79020 79649 gene locus_tag LOCUS_17450 79020 79649 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_17450 80254 79694 gene locus_tag LOCUS_17460 80254 79694 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 protein_id gnl|my_center|LOCUS_17460 80371 80919 gene locus_tag LOCUS_17470 80371 80919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 protein_id gnl|my_center|LOCUS_17470 82216 80906 gene locus_tag LOCUS_17480 gene atoE 82216 80906 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_17480 82686 83156 gene locus_tag LOCUS_17490 gene fklB 82686 83156 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH40 protein_id gnl|my_center|LOCUS_17490 84429 83212 gene locus_tag LOCUS_17500 84429 83212 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_17500 84563 84883 gene locus_tag LOCUS_17510 84563 84883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073989.1 protein_id gnl|my_center|LOCUS_17510 85691 84915 gene locus_tag LOCUS_17520 85691 84915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071596.1 protein_id gnl|my_center|LOCUS_17520 86966 85776 gene locus_tag LOCUS_17530 86966 85776 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_17530 87083 87346 gene locus_tag LOCUS_17540 87083 87346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 87487 89295 gene locus_tag LOCUS_17550 gene ampP 87487 89295 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 protein_id gnl|my_center|LOCUS_17550 89431 89697 gene locus_tag LOCUS_17560 89431 89697 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ4 protein_id gnl|my_center|LOCUS_17560 89829 90494 gene locus_tag LOCUS_17570 gene lipB 89829 90494 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_17570 90487 91452 gene locus_tag LOCUS_17580 gene lipA 90487 91452 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ6 protein_id gnl|my_center|LOCUS_17580 92061 91603 gene locus_tag LOCUS_17590 gene rimI 92061 91603 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ7 protein_id gnl|my_center|LOCUS_17590 92393 92058 gene locus_tag LOCUS_17600 92393 92058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 92664 93134 gene locus_tag LOCUS_17610 gene dpsA 92664 93134 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071389.1 protein_id gnl|my_center|LOCUS_17610 93488 93412 gene locus_tag LOCUS_t00200 93488 93412 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 287 201 gene locus_tag LOCUS_t00210 287 201 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2007 418 gene locus_tag LOCUS_17620 2007 418 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073637.1 protein_id gnl|my_center|LOCUS_17620 3108 2497 gene locus_tag LOCUS_17630 3108 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073639.1 protein_id gnl|my_center|LOCUS_17630 3270 4901 gene locus_tag LOCUS_17640 3270 4901 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073640.1 protein_id gnl|my_center|LOCUS_17640 6158 4929 gene locus_tag LOCUS_17650 gene pepT 6158 4929 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GX2 protein_id gnl|my_center|LOCUS_17650 7118 6285 gene locus_tag LOCUS_17660 7118 6285 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 protein_id gnl|my_center|LOCUS_17660 7670 8728 gene locus_tag LOCUS_17670 gene omp35 7670 8728 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 protein_id gnl|my_center|LOCUS_17670 9498 8842 gene locus_tag LOCUS_17680 gene tpm 9498 8842 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ86 protein_id gnl|my_center|LOCUS_17680 9983 9636 gene locus_tag LOCUS_17690 9983 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070917.1 protein_id gnl|my_center|LOCUS_17690 10212 12020 gene locus_tag LOCUS_17700 10212 12020 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 protein_id gnl|my_center|LOCUS_17700 14800 12017 gene locus_tag LOCUS_17710 14800 12017 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073743.1 protein_id gnl|my_center|LOCUS_17710 17325 14920 gene locus_tag LOCUS_17720 17325 14920 CDS product periplasmic metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 protein_id gnl|my_center|LOCUS_17720 21078 17386 gene locus_tag LOCUS_17730 21078 17386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 22620 21226 gene locus_tag LOCUS_17740 22620 21226 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070914.1 protein_id gnl|my_center|LOCUS_17740 22962 25868 gene locus_tag LOCUS_17750 gene rapA 22962 25868 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ93 protein_id gnl|my_center|LOCUS_17750 26118 27125 gene locus_tag LOCUS_17760 26118 27125 CDS product DUF3530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070912.1 protein_id gnl|my_center|LOCUS_17760 27704 27201 gene locus_tag LOCUS_17770 27704 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_17770 28600 27797 gene locus_tag LOCUS_17780 28600 27797 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 protein_id gnl|my_center|LOCUS_17780 28969 29964 gene locus_tag LOCUS_17790 gene cheC 28969 29964 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_17790 29979 30935 gene locus_tag LOCUS_17800 29979 30935 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_17800 31894 31091 gene locus_tag LOCUS_17810 31894 31091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070955.1 protein_id gnl|my_center|LOCUS_17810 32230 32865 gene locus_tag LOCUS_17820 gene crp 32230 32865 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 protein_id gnl|my_center|LOCUS_17820 32950 33297 gene locus_tag LOCUS_17830 32950 33297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070953.1 protein_id gnl|my_center|LOCUS_17830 33278 33952 gene locus_tag LOCUS_17840 33278 33952 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070952.1 protein_id gnl|my_center|LOCUS_17840 33952 35283 gene locus_tag LOCUS_17850 33952 35283 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070951.1 protein_id gnl|my_center|LOCUS_17850 38848 35390 gene locus_tag LOCUS_17860 38848 35390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070764.1 protein_id gnl|my_center|LOCUS_17860 39657 38872 gene locus_tag LOCUS_17870 39657 38872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070763.1 protein_id gnl|my_center|LOCUS_17870 41343 40543 gene locus_tag LOCUS_17880 41343 40543 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_17880 42887 41427 gene locus_tag LOCUS_17890 gene astD 42887 41427 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ54 protein_id gnl|my_center|LOCUS_17890 43935 42898 gene locus_tag LOCUS_17900 gene astA 43935 42898 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ55 protein_id gnl|my_center|LOCUS_17900 45236 44019 gene locus_tag LOCUS_17910 gene argD 45236 44019 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59320 protein_id gnl|my_center|LOCUS_17910 46448 45543 gene locus_tag LOCUS_17920 46448 45543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070946.1 protein_id gnl|my_center|LOCUS_17920 47628 46486 gene locus_tag LOCUS_17930 47628 46486 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070945.1 protein_id gnl|my_center|LOCUS_17930 50247 47767 gene locus_tag LOCUS_17940 50247 47767 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_17940 51021 50449 gene locus_tag LOCUS_17950 gene pabA 51021 50449 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070943.1 protein_id gnl|my_center|LOCUS_17950 52595 51216 gene locus_tag LOCUS_17960 52595 51216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 53260 52592 gene locus_tag LOCUS_17970 53260 52592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 53665 53264 gene locus_tag LOCUS_17980 53665 53264 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_17980 54066 53662 gene locus_tag LOCUS_17990 54066 53662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 55318 54059 gene locus_tag LOCUS_18000 55318 54059 CDS product biopolymer transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_18000 56088 55315 gene locus_tag LOCUS_18010 56088 55315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 57767 56085 gene locus_tag LOCUS_18020 57767 56085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815399.1 protein_id gnl|my_center|LOCUS_18020 60610 57809 gene locus_tag LOCUS_18030 gene pqqL 60610 57809 CDS product putative zinc protease PqqL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45181 protein_id gnl|my_center|LOCUS_18030 63101 60675 gene locus_tag LOCUS_18040 63101 60675 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815398.1 protein_id gnl|my_center|LOCUS_18040 64079 63678 gene locus_tag LOCUS_18050 64079 63678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_18050 66116 64161 gene locus_tag LOCUS_18060 gene yeaV 66116 64161 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 protein_id gnl|my_center|LOCUS_18060 67540 66509 gene locus_tag LOCUS_18070 67540 66509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 67756 67544 gene locus_tag LOCUS_18080 67756 67544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 69711 67807 gene locus_tag LOCUS_18090 69711 67807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 71658 69769 gene locus_tag LOCUS_18100 71658 69769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 73426 71663 gene locus_tag LOCUS_18110 73426 71663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 74473 73994 gene locus_tag LOCUS_18120 74473 73994 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867778.1 protein_id gnl|my_center|LOCUS_18120 75311 74553 gene locus_tag LOCUS_18130 75311 74553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706560.1 protein_id gnl|my_center|LOCUS_18130 75839 76495 gene locus_tag LOCUS_18140 75839 76495 CDS product Qnr family quinolone resistance pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 protein_id gnl|my_center|LOCUS_18140 76648 76929 gene locus_tag LOCUS_18150 76648 76929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 76977 77411 gene locus_tag LOCUS_18160 76977 77411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 77720 78040 gene locus_tag LOCUS_18170 77720 78040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 78760 80289 gene locus_tag LOCUS_18180 78760 80289 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460454.1 protein_id gnl|my_center|LOCUS_18180 80347 81537 gene locus_tag LOCUS_18190 80347 81537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_18190 82178 83758 gene locus_tag LOCUS_18200 gene mphR 82178 83758 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_18200 84800 83844 gene locus_tag LOCUS_18210 84800 83844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 86135 84858 gene locus_tag LOCUS_18220 gene hipA 86135 84858 CDS product serine/threonine-protein kinase HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIX3 protein_id gnl|my_center|LOCUS_18220 86398 86162 gene locus_tag LOCUS_18230 gene hipB 86398 86162 CDS product antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIX4 protein_id gnl|my_center|LOCUS_18230 87293 86607 gene locus_tag LOCUS_18240 87293 86607 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071867.1 protein_id gnl|my_center|LOCUS_18240 88193 90340 gene locus_tag LOCUS_18250 88193 90340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 90343 91224 gene locus_tag LOCUS_18260 90343 91224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence16 951 745 gene locus_tag LOCUS_18270 951 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 966 1535 gene locus_tag LOCUS_18280 gene yaaH 966 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073408.1 protein_id gnl|my_center|LOCUS_18280 2334 1795 gene locus_tag LOCUS_18290 2334 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6747 3013 gene locus_tag LOCUS_18300 gene metH 6747 3013 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071290.1 protein_id gnl|my_center|LOCUS_18300 6974 7747 gene locus_tag LOCUS_18310 6974 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_18310 8079 8987 gene locus_tag LOCUS_18320 gene btuD 8079 8987 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_18320 8984 10054 gene locus_tag LOCUS_18330 gene btuC 8984 10054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_18330 10072 11136 gene locus_tag LOCUS_18340 gene cobT 10072 11136 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI18 protein_id gnl|my_center|LOCUS_18340 11136 11912 gene locus_tag LOCUS_18350 gene cobS 11136 11912 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI17 protein_id gnl|my_center|LOCUS_18350 11909 12505 gene locus_tag LOCUS_18360 gene cobU 11909 12505 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 protein_id gnl|my_center|LOCUS_18360 12502 14205 gene locus_tag LOCUS_18370 gene cobQ 12502 14205 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI15 protein_id gnl|my_center|LOCUS_18370 14195 14809 gene locus_tag LOCUS_18380 gene cobO 14195 14809 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_18380 15656 15946 gene locus_tag LOCUS_18390 15656 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 16140 16496 gene locus_tag LOCUS_18400 16140 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 18070 16799 gene locus_tag LOCUS_18410 18070 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 19053 18487 gene locus_tag LOCUS_18420 19053 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105832.1 protein_id gnl|my_center|LOCUS_18420 20801 19128 gene locus_tag LOCUS_18430 20801 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 23165 20814 gene locus_tag LOCUS_18440 23165 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 24582 23176 gene locus_tag LOCUS_18450 24582 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 24846 25727 gene locus_tag LOCUS_18460 gene btuF 24846 25727 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_18460 26002 26424 gene locus_tag LOCUS_18470 gene csgE 26002 26424 CDS product curli production assembly protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073482.1 protein_id gnl|my_center|LOCUS_18470 26437 26829 gene locus_tag LOCUS_18480 gene csgF 26437 26829 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_18480 26826 27611 gene locus_tag LOCUS_18490 gene csgG 26826 27611 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073480.1 protein_id gnl|my_center|LOCUS_18490 28411 27797 gene locus_tag LOCUS_18500 gene calR 28411 27797 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073479.1 protein_id gnl|my_center|LOCUS_18500 29856 28408 gene locus_tag LOCUS_18510 gene calB 29856 28408 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB51 protein_id gnl|my_center|LOCUS_18510 30056 30439 gene locus_tag LOCUS_18520 30056 30439 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_18520 31735 30491 gene locus_tag LOCUS_18530 31735 30491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 31825 32256 gene locus_tag LOCUS_18540 31825 32256 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 protein_id gnl|my_center|LOCUS_18540 32845 32282 gene locus_tag LOCUS_18550 32845 32282 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_18550 34358 32871 gene locus_tag LOCUS_18560 34358 32871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 34903 34355 gene locus_tag LOCUS_18570 34903 34355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 35187 35492 gene locus_tag LOCUS_18580 35187 35492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073474.1 protein_id gnl|my_center|LOCUS_18580 35974 35636 gene locus_tag LOCUS_18590 35974 35636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 protein_id gnl|my_center|LOCUS_18590 36216 38018 gene locus_tag LOCUS_18600 36216 38018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073461.1 protein_id gnl|my_center|LOCUS_18600 38770 38021 gene locus_tag LOCUS_18610 38770 38021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 39360 38767 gene locus_tag LOCUS_18620 39360 38767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 40566 39367 gene locus_tag LOCUS_18630 40566 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_18630 40966 41694 gene locus_tag LOCUS_18640 40966 41694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 protein_id gnl|my_center|LOCUS_18640 43640 41697 gene locus_tag LOCUS_18650 43640 41697 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477247.1 protein_id gnl|my_center|LOCUS_18650 45512 43914 gene locus_tag LOCUS_18660 45512 43914 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706466.1 protein_id gnl|my_center|LOCUS_18660 46062 46676 gene locus_tag LOCUS_18670 46062 46676 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 protein_id gnl|my_center|LOCUS_18670 46702 48471 gene locus_tag LOCUS_18680 46702 48471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_18680 48471 49856 gene locus_tag LOCUS_18690 48471 49856 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_18690 49849 50277 gene locus_tag LOCUS_18700 49849 50277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113328.1 protein_id gnl|my_center|LOCUS_18700 50297 50935 gene locus_tag LOCUS_18710 50297 50935 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 protein_id gnl|my_center|LOCUS_18710 50932 51855 gene locus_tag LOCUS_18720 gene cdsA-2 50932 51855 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 protein_id gnl|my_center|LOCUS_18720 51955 52812 gene locus_tag LOCUS_18730 51955 52812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071178.1 protein_id gnl|my_center|LOCUS_18730 53166 55526 gene locus_tag LOCUS_18740 53166 55526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45182 protein_id gnl|my_center|LOCUS_18740 55595 58384 gene locus_tag LOCUS_18750 gene pqqL 55595 58384 CDS product putative zinc protease PqqL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45181 protein_id gnl|my_center|LOCUS_18750 59546 58461 gene locus_tag LOCUS_18760 59546 58461 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071117.1 protein_id gnl|my_center|LOCUS_18760 59966 59604 gene locus_tag LOCUS_18770 59966 59604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071118.1 protein_id gnl|my_center|LOCUS_18770 61740 60070 gene locus_tag LOCUS_18780 61740 60070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071119.1 protein_id gnl|my_center|LOCUS_18780 63080 62043 gene locus_tag LOCUS_18790 gene rsmC 63080 62043 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIL1 protein_id gnl|my_center|LOCUS_18790 66381 63205 gene locus_tag LOCUS_18800 gene putA 66381 63205 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAW7 protein_id gnl|my_center|LOCUS_18800 67229 66651 gene locus_tag LOCUS_18810 67229 66651 CDS product SH3 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073548.1 protein_id gnl|my_center|LOCUS_18810 68625 67357 gene locus_tag LOCUS_18820 68625 67357 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_18820 69333 68653 gene locus_tag LOCUS_18830 69333 68653 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 protein_id gnl|my_center|LOCUS_18830 69566 71050 gene locus_tag LOCUS_18840 gene ygiF 69566 71050 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073545.1 protein_id gnl|my_center|LOCUS_18840 71928 71128 gene locus_tag LOCUS_18850 gene kvaP 71928 71128 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 protein_id gnl|my_center|LOCUS_18850 72326 72000 gene locus_tag LOCUS_18860 72326 72000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 protein_id gnl|my_center|LOCUS_18860 72983 72333 gene locus_tag LOCUS_18870 72983 72333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073542.1 protein_id gnl|my_center|LOCUS_18870 73679 72990 gene locus_tag LOCUS_18880 73679 72990 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_18880 74104 73691 gene locus_tag LOCUS_18890 74104 73691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_18890 75911 74184 gene locus_tag LOCUS_18900 gene speE 75911 74184 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX8 protein_id gnl|my_center|LOCUS_18900 76815 75916 gene locus_tag LOCUS_18910 76815 75916 CDS product ATP synthase F0 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_18910 77797 76847 gene locus_tag LOCUS_18920 77797 76847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_18920 78034 80889 gene locus_tag LOCUS_18930 gene glnE 78034 80889 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAY1 protein_id gnl|my_center|LOCUS_18930 82069 80951 gene locus_tag LOCUS_18940 82069 80951 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073533.1 protein_id gnl|my_center|LOCUS_18940 82254 82595 gene locus_tag LOCUS_18950 gene fklB 82254 82595 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJL0 protein_id gnl|my_center|LOCUS_18950 82696 83517 gene locus_tag LOCUS_18960 gene argE 82696 83517 CDS product N-acetyl-L-ornithine deacetylase ArgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073531.1 protein_id gnl|my_center|LOCUS_18960 84496 83582 gene locus_tag LOCUS_18970 gene ybiS 84496 83582 CDS product transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073530.1 protein_id gnl|my_center|LOCUS_18970 85137 86861 gene locus_tag LOCUS_18980 gene nhaP2 85137 86861 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ0 protein_id gnl|my_center|LOCUS_18980 87843 86920 gene locus_tag LOCUS_18990 gene lpxL 87843 86920 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ1 protein_id gnl|my_center|LOCUS_18990 87950 89380 gene locus_tag LOCUS_19000 gene hldE 87950 89380 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ2 protein_id gnl|my_center|LOCUS_19000 89380 90216 gene locus_tag LOCUS_19010 89380 90216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073526.1 protein_id gnl|my_center|LOCUS_19010 90364 90843 gene locus_tag LOCUS_19020 90364 90843 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073525.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence17 <1 1977 gene locus_tag LOCUS_19030 <1 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KUR9:LPS-assembly protein LptD 2028 3320 gene locus_tag LOCUS_19040 gene surA 2028 3320 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST4 protein_id gnl|my_center|LOCUS_19040 3310 4305 gene locus_tag LOCUS_19050 gene pdxA 3310 4305 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS1 protein_id gnl|my_center|LOCUS_19050 4313 5119 gene locus_tag LOCUS_19060 gene rsmA 4313 5119 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E865 protein_id gnl|my_center|LOCUS_19060 5190 5570 gene locus_tag LOCUS_19070 gene apaG 5190 5570 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST7 protein_id gnl|my_center|LOCUS_19070 5622 6431 gene locus_tag LOCUS_19080 gene apaH 5622 6431 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST8 protein_id gnl|my_center|LOCUS_19080 6972 6490 gene locus_tag LOCUS_19090 6972 6490 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST9 protein_id gnl|my_center|LOCUS_19090 7486 7013 gene locus_tag LOCUS_19100 7486 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105638.1 protein_id gnl|my_center|LOCUS_19100 8250 7486 gene locus_tag LOCUS_19110 8250 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883263.1 protein_id gnl|my_center|LOCUS_19110 9550 8378 gene locus_tag LOCUS_19120 gene obg 9550 8378 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU2 protein_id gnl|my_center|LOCUS_19120 10030 9773 gene locus_tag LOCUS_19130 gene rpmA 10030 9773 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU3 protein_id gnl|my_center|LOCUS_19130 10356 10045 gene locus_tag LOCUS_19140 gene rplU 10356 10045 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB80 protein_id gnl|my_center|LOCUS_19140 10630 11601 gene locus_tag LOCUS_19150 gene ispB 10630 11601 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_19150 14288 11715 gene locus_tag LOCUS_19160 gene clpB 14288 11715 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE6 protein_id gnl|my_center|LOCUS_19160 15098 14385 gene locus_tag LOCUS_19170 gene yfiH 15098 14385 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE5 protein_id gnl|my_center|LOCUS_19170 16074 15100 gene locus_tag LOCUS_19180 gene rluD 16074 15100 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU17 protein_id gnl|my_center|LOCUS_19180 16197 16958 gene locus_tag LOCUS_19190 gene bamD 16197 16958 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBE4 protein_id gnl|my_center|LOCUS_19190 17228 17303 gene locus_tag LOCUS_t00220 17228 17303 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 17356 17442 gene locus_tag LOCUS_t00230 17356 17442 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17483 17569 gene locus_tag LOCUS_t00240 17483 17569 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17603 17689 gene locus_tag LOCUS_t00250 17603 17689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17858 19480 gene locus_tag LOCUS_19200 17858 19480 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073402.1 protein_id gnl|my_center|LOCUS_19200 21550 19688 gene locus_tag LOCUS_19210 21550 19688 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 protein_id gnl|my_center|LOCUS_19210 22139 22696 gene locus_tag LOCUS_19220 22139 22696 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_19220 22693 23214 gene locus_tag LOCUS_19230 22693 23214 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073604.1 protein_id gnl|my_center|LOCUS_19230 23211 24149 gene locus_tag LOCUS_19240 23211 24149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 protein_id gnl|my_center|LOCUS_19240 24889 24197 gene locus_tag LOCUS_19250 gene rsuA 24889 24197 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW18 protein_id gnl|my_center|LOCUS_19250 25179 27278 gene locus_tag LOCUS_19260 gene pepO 25179 27278 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_19260 27409 28203 gene locus_tag LOCUS_19270 gene relV 27409 28203 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073608.1 protein_id gnl|my_center|LOCUS_19270 28272 28676 gene locus_tag LOCUS_19280 28272 28676 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073609.1 protein_id gnl|my_center|LOCUS_19280 28737 29240 gene locus_tag LOCUS_19290 28737 29240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073610.1 protein_id gnl|my_center|LOCUS_19290 29912 29286 gene locus_tag LOCUS_19300 29912 29286 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_19300 32690 30156 gene locus_tag LOCUS_19310 32690 30156 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072815.1 protein_id gnl|my_center|LOCUS_19310 32905 33450 gene locus_tag LOCUS_19320 32905 33450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073611.1 protein_id gnl|my_center|LOCUS_19320 33447 34727 gene locus_tag LOCUS_19330 33447 34727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_19330 34737 35900 gene locus_tag LOCUS_19340 34737 35900 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071194.1 protein_id gnl|my_center|LOCUS_19340 36005 36469 gene locus_tag LOCUS_19350 36005 36469 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_19350 36695 38383 gene locus_tag LOCUS_19360 gene maeA 36695 38383 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAP2 protein_id gnl|my_center|LOCUS_19360 38872 38435 gene locus_tag LOCUS_19370 38872 38435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073615.1 protein_id gnl|my_center|LOCUS_19370 39108 40979 gene locus_tag LOCUS_19380 39108 40979 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 protein_id gnl|my_center|LOCUS_19380 41825 41004 gene locus_tag LOCUS_19390 41825 41004 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073618.1 protein_id gnl|my_center|LOCUS_19390 41950 43131 gene locus_tag LOCUS_19400 gene queG 41950 43131 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAN7 protein_id gnl|my_center|LOCUS_19400 43343 43134 gene locus_tag LOCUS_19410 43343 43134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_19410 43481 43807 gene locus_tag LOCUS_19420 43481 43807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 46136 43866 gene locus_tag LOCUS_19430 gene metE 46136 43866 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIM0 protein_id gnl|my_center|LOCUS_19430 46302 47204 gene locus_tag LOCUS_19440 gene metR 46302 47204 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071111.1 protein_id gnl|my_center|LOCUS_19440 47975 47253 gene locus_tag LOCUS_19450 47975 47253 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071110.1 protein_id gnl|my_center|LOCUS_19450 48740 48120 gene locus_tag LOCUS_19460 48740 48120 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_19460 50831 48882 gene locus_tag LOCUS_19470 gene btuB 50831 48882 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_19470 51613 51266 gene locus_tag LOCUS_19480 51613 51266 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_19480 53150 51885 gene locus_tag LOCUS_19490 53150 51885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 53298 54236 gene locus_tag LOCUS_19500 gene rihA 53298 54236 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIM7 protein_id gnl|my_center|LOCUS_19500 54240 55145 gene locus_tag LOCUS_19510 gene rbsK 54240 55145 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIM8 protein_id gnl|my_center|LOCUS_19510 55735 55214 gene locus_tag LOCUS_19520 55735 55214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120754.1 protein_id gnl|my_center|LOCUS_19520 55944 56411 gene locus_tag LOCUS_19530 gene azu 55944 56411 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CVD5 protein_id gnl|my_center|LOCUS_19530 56829 57065 gene locus_tag LOCUS_19540 56829 57065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 57762 57187 gene locus_tag LOCUS_19550 57762 57187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 57923 58849 gene locus_tag LOCUS_19560 57923 58849 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074143.1 protein_id gnl|my_center|LOCUS_19560 60937 59021 gene locus_tag LOCUS_19570 gene mtrF 60937 59021 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 protein_id gnl|my_center|LOCUS_19570 62848 61577 gene locus_tag LOCUS_19580 62848 61577 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729845.1 protein_id gnl|my_center|LOCUS_19580 62962 63285 gene locus_tag LOCUS_19590 62962 63285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 63820 63437 gene locus_tag LOCUS_19600 63820 63437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 64254 63913 gene locus_tag LOCUS_19610 64254 63913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722102.1 protein_id gnl|my_center|LOCUS_19610 67681 64793 gene locus_tag LOCUS_19620 gene gcvP 67681 64793 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ6 protein_id gnl|my_center|LOCUS_19620 68181 67792 gene locus_tag LOCUS_19630 gene gcvH 68181 67792 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_19630 69299 68205 gene locus_tag LOCUS_19640 gene gcvT 69299 68205 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ8 protein_id gnl|my_center|LOCUS_19640 70760 69549 gene locus_tag LOCUS_19650 gene visC 70760 69549 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071081.1 protein_id gnl|my_center|LOCUS_19650 72034 70763 gene locus_tag LOCUS_19660 gene ubiH 72034 70763 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071080.1 protein_id gnl|my_center|LOCUS_19660 72694 72101 gene locus_tag LOCUS_19670 72694 72101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071079.1 protein_id gnl|my_center|LOCUS_19670 72948 73256 gene locus_tag LOCUS_19680 gene zapA 72948 73256 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR2 protein_id gnl|my_center|LOCUS_19680 73380 74141 gene locus_tag LOCUS_19690 gene ygfA 73380 74141 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR3 protein_id gnl|my_center|LOCUS_19690 74192 74650 gene locus_tag LOCUS_19700 74192 74650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 74863 75384 gene locus_tag LOCUS_19710 74863 75384 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRQ3 protein_id gnl|my_center|LOCUS_19710 76413 75460 gene locus_tag LOCUS_19720 76413 75460 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071383.1 protein_id gnl|my_center|LOCUS_19720 76703 77359 gene locus_tag LOCUS_19730 gene rpiA 76703 77359 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHR7 protein_id gnl|my_center|LOCUS_19730 77768 77454 gene locus_tag LOCUS_19740 77768 77454 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_19740 79591 77867 gene locus_tag LOCUS_19750 gene recJ 79591 77867 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071232.1 protein_id gnl|my_center|LOCUS_19750 80405 79677 gene locus_tag LOCUS_19760 gene dsbC 80405 79677 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_19760 81442 80528 gene locus_tag LOCUS_19770 gene xerD 81442 80528 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ8 protein_id gnl|my_center|LOCUS_19770 83021 81612 gene locus_tag LOCUS_19780 gene brnQ 83021 81612 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI94 protein_id gnl|my_center|LOCUS_19780 83599 84330 gene locus_tag LOCUS_19790 83599 84330 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI95 protein_id gnl|my_center|LOCUS_19790 84449 85729 gene locus_tag LOCUS_19800 gene srmB 84449 85729 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI96 protein_id gnl|my_center|LOCUS_19800 85996 87225 gene locus_tag LOCUS_19810 85996 87225 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence18 549 310 gene locus_tag LOCUS_19820 549 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 991 665 gene locus_tag LOCUS_19830 991 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2704 998 gene locus_tag LOCUS_19840 2704 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2980 2717 gene locus_tag LOCUS_19850 2980 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3309 5216 gene locus_tag LOCUS_19860 gene yheS 3309 5216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071174.1 protein_id gnl|my_center|LOCUS_19860 5261 5713 gene locus_tag LOCUS_19870 5261 5713 CDS product DUF2390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071173.1 protein_id gnl|my_center|LOCUS_19870 7220 5673 gene locus_tag LOCUS_19880 7220 5673 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_19880 7812 7306 gene locus_tag LOCUS_19890 7812 7306 CDS product TAT leader-containing periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071170.1 protein_id gnl|my_center|LOCUS_19890 7923 8912 gene locus_tag LOCUS_19900 gene yheT 7923 8912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_19900 8896 9153 gene locus_tag LOCUS_19910 8896 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071168.1 protein_id gnl|my_center|LOCUS_19910 9248 10135 gene locus_tag LOCUS_19920 9248 10135 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG1 protein_id gnl|my_center|LOCUS_19920 12032 10773 gene locus_tag LOCUS_19930 gene murA 12032 10773 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAF7 protein_id gnl|my_center|LOCUS_19930 12299 12042 gene locus_tag LOCUS_19940 gene yrbA 12299 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073688.1 protein_id gnl|my_center|LOCUS_19940 12594 12307 gene locus_tag LOCUS_19950 gene mlaB 12594 12307 CDS product ABC phospholipid uptake (salvage) system anti-anti-sigma factor MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073689.1 protein_id gnl|my_center|LOCUS_19950 13247 12591 gene locus_tag LOCUS_19960 gene mlaC 13247 12591 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 protein_id gnl|my_center|LOCUS_19960 13731 13258 gene locus_tag LOCUS_19970 gene mlaD 13731 13258 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 protein_id gnl|my_center|LOCUS_19970 14560 13775 gene locus_tag LOCUS_19980 gene mlaE 14560 13775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073692.1 protein_id gnl|my_center|LOCUS_19980 15374 14547 gene locus_tag LOCUS_19990 gene mlaF 15374 14547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_19990 15627 16622 gene locus_tag LOCUS_20000 15627 16622 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_20000 16653 17630 gene locus_tag LOCUS_20010 gene kdsD 16653 17630 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAF0 protein_id gnl|my_center|LOCUS_20010 17630 18181 gene locus_tag LOCUS_20020 gene kdsC 17630 18181 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_20020 18178 18738 gene locus_tag LOCUS_20030 gene lptC 18178 18738 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE8 protein_id gnl|my_center|LOCUS_20030 18725 19258 gene locus_tag LOCUS_20040 gene lptA 18725 19258 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE7 protein_id gnl|my_center|LOCUS_20040 19255 19983 gene locus_tag LOCUS_20050 gene lptB 19255 19983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_20050 20079 21539 gene locus_tag LOCUS_20060 gene rpoN 20079 21539 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE5 protein_id gnl|my_center|LOCUS_20060 21571 21858 gene locus_tag LOCUS_20070 gene yhbH 21571 21858 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 protein_id gnl|my_center|LOCUS_20070 21861 22304 gene locus_tag LOCUS_20080 gene ptsN 21861 22304 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073701.1 protein_id gnl|my_center|LOCUS_20080 22301 23155 gene locus_tag LOCUS_20090 22301 23155 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE2 protein_id gnl|my_center|LOCUS_20090 23142 23417 gene locus_tag LOCUS_20100 gene ptsO 23142 23417 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_20100 23501 24865 gene locus_tag LOCUS_20110 23501 24865 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_20110 25413 25009 gene locus_tag LOCUS_20120 25413 25009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 26329 25538 gene locus_tag LOCUS_20130 26329 25538 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 protein_id gnl|my_center|LOCUS_20130 27181 26519 gene locus_tag LOCUS_20140 gene yiaD 27181 26519 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_20140 27690 27923 gene locus_tag LOCUS_20150 27690 27923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 29019 28039 gene locus_tag LOCUS_20160 29019 28039 CDS product catalase-related peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YW9 protein_id gnl|my_center|LOCUS_20160 29158 30549 gene locus_tag LOCUS_20170 gene fumC 29158 30549 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_20170 30650 31198 gene locus_tag LOCUS_20180 30650 31198 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073709.1 protein_id gnl|my_center|LOCUS_20180 32284 32844 gene locus_tag LOCUS_20190 32284 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 32930 33823 gene locus_tag LOCUS_20200 32930 33823 CDS product chloramphenicol-sensitive protein RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481255.1 protein_id gnl|my_center|LOCUS_20200 34519 33809 gene locus_tag LOCUS_20210 34519 33809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_20210 35349 34612 gene locus_tag LOCUS_20220 35349 34612 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480164.1 protein_id gnl|my_center|LOCUS_20220 35888 35361 gene locus_tag LOCUS_20230 35888 35361 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703426.1 protein_id gnl|my_center|LOCUS_20230 37972 35885 gene locus_tag LOCUS_20240 37972 35885 CDS product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 protein_id gnl|my_center|LOCUS_20240 38439 38035 gene locus_tag LOCUS_20250 38439 38035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 38596 39279 gene locus_tag LOCUS_20260 gene deoR 38596 39279 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072661.1 protein_id gnl|my_center|LOCUS_20260 40482 39310 gene locus_tag LOCUS_20270 gene deoT 40482 39310 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072662.1 protein_id gnl|my_center|LOCUS_20270 41206 40508 gene locus_tag LOCUS_20280 gene deoD-1 41206 40508 CDS product purine nucleoside phosphorylase DeoD-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML3 protein_id gnl|my_center|LOCUS_20280 42548 41364 gene locus_tag LOCUS_20290 gene ycaQ 42548 41364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_20290 42774 44333 gene locus_tag LOCUS_20300 42774 44333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070418.1 protein_id gnl|my_center|LOCUS_20300 45451 45996 gene locus_tag LOCUS_20310 45451 45996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 46238 46735 gene locus_tag LOCUS_20320 46238 46735 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 protein_id gnl|my_center|LOCUS_20320 46746 47486 gene locus_tag LOCUS_20330 46746 47486 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073830.1 protein_id gnl|my_center|LOCUS_20330 48466 47657 gene locus_tag LOCUS_20340 48466 47657 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071303.1 protein_id gnl|my_center|LOCUS_20340 48803 49420 gene locus_tag LOCUS_20350 48803 49420 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454893.1 protein_id gnl|my_center|LOCUS_20350 49674 49390 gene locus_tag LOCUS_20360 49674 49390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 50617 49685 gene locus_tag LOCUS_20370 50617 49685 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071842.1 protein_id gnl|my_center|LOCUS_20370 51672 50932 gene locus_tag LOCUS_20380 51672 50932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 52160 51807 gene locus_tag LOCUS_20390 52160 51807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071844.1 protein_id gnl|my_center|LOCUS_20390 55435 52181 gene locus_tag LOCUS_20400 55435 52181 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071845.1 protein_id gnl|my_center|LOCUS_20400 56817 55531 gene locus_tag LOCUS_20410 56817 55531 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 protein_id gnl|my_center|LOCUS_20410 57242 59962 gene locus_tag LOCUS_20420 57242 59962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 60139 62853 gene locus_tag LOCUS_20430 60139 62853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 63554 63102 gene locus_tag LOCUS_20440 gene sspB 63554 63102 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070942.1 protein_id gnl|my_center|LOCUS_20440 64183 63554 gene locus_tag LOCUS_20450 gene sspA 64183 63554 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_20450 64980 64279 gene locus_tag LOCUS_20460 gene petC 64980 64279 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_20460 66194 64977 gene locus_tag LOCUS_20470 gene petB 66194 64977 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ63 protein_id gnl|my_center|LOCUS_20470 66784 66194 gene locus_tag LOCUS_20480 gene petA 66784 66194 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ64 protein_id gnl|my_center|LOCUS_20480 68086 67163 gene locus_tag LOCUS_20490 gene hflC 68086 67163 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ66 protein_id gnl|my_center|LOCUS_20490 69229 68090 gene locus_tag LOCUS_20500 gene hflK 69229 68090 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070936.1 protein_id gnl|my_center|LOCUS_20500 70572 69265 gene locus_tag LOCUS_20510 gene hflX 70572 69265 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ68 protein_id gnl|my_center|LOCUS_20510 70869 70594 gene locus_tag LOCUS_20520 gene hfq 70869 70594 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ69 protein_id gnl|my_center|LOCUS_20520 71817 70957 gene locus_tag LOCUS_20530 gene miaA 71817 70957 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX50 protein_id gnl|my_center|LOCUS_20530 73738 71876 gene locus_tag LOCUS_20540 gene mutL 73738 71876 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ70 protein_id gnl|my_center|LOCUS_20540 75071 73746 gene locus_tag LOCUS_20550 gene amiB 75071 73746 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 protein_id gnl|my_center|LOCUS_20550 75540 75055 gene locus_tag LOCUS_20560 gene yjeE 75540 75055 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_20560 77060 75579 gene locus_tag LOCUS_20570 gene yjeF 77060 75579 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ73 protein_id gnl|my_center|LOCUS_20570 77830 77375 gene locus_tag LOCUS_20580 77830 77375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070928.1 protein_id gnl|my_center|LOCUS_20580 78109 78034 gene locus_tag LOCUS_t00260 78109 78034 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 78387 78312 gene locus_tag LOCUS_t00270 78387 78312 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 1250 75 gene locus_tag LOCUS_20590 gene nhaA 1250 75 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH93 protein_id gnl|my_center|LOCUS_20590 2161 1367 gene locus_tag LOCUS_20600 gene thyA 2161 1367 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH94 protein_id gnl|my_center|LOCUS_20600 2988 2161 gene locus_tag LOCUS_20610 gene lgt 2988 2161 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH95 protein_id gnl|my_center|LOCUS_20610 3826 3026 gene locus_tag LOCUS_20620 3826 3026 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH96 protein_id gnl|my_center|LOCUS_20620 6110 3876 gene locus_tag LOCUS_20630 gene ptsP 6110 3876 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071541.1 protein_id gnl|my_center|LOCUS_20630 6660 6136 gene locus_tag LOCUS_20640 gene rppH 6660 6136 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH98 protein_id gnl|my_center|LOCUS_20640 7313 8032 gene locus_tag LOCUS_20650 gene mutH 7313 8032 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH99 protein_id gnl|my_center|LOCUS_20650 8216 9238 gene locus_tag LOCUS_20660 gene cyaC 8216 9238 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071538.1 protein_id gnl|my_center|LOCUS_20660 10192 9287 gene locus_tag LOCUS_20670 gene oxyR 10192 9287 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 protein_id gnl|my_center|LOCUS_20670 10799 10434 gene locus_tag LOCUS_20680 gene hptA 10799 10434 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071536.1 protein_id gnl|my_center|LOCUS_20680 11868 10948 gene locus_tag LOCUS_20690 gene yhcC 11868 10948 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071535.1 protein_id gnl|my_center|LOCUS_20690 12369 16817 gene locus_tag LOCUS_20700 gene gltB 12369 16817 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071534.1 protein_id gnl|my_center|LOCUS_20700 16824 18230 gene locus_tag LOCUS_20710 gene gltD 16824 18230 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071533.1 protein_id gnl|my_center|LOCUS_20710 18449 19141 gene locus_tag LOCUS_20720 gene mtnN 18449 19141 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHA7 protein_id gnl|my_center|LOCUS_20720 19161 20150 gene locus_tag LOCUS_20730 gene cobD 19161 20150 CDS product cobalamin biosynthesis protein CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071531.1 protein_id gnl|my_center|LOCUS_20730 20209 20595 gene locus_tag LOCUS_20740 20209 20595 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_20740 20909 21388 gene locus_tag LOCUS_20750 20909 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071528.1 protein_id gnl|my_center|LOCUS_20750 21488 21919 gene locus_tag LOCUS_20760 21488 21919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071527.1 protein_id gnl|my_center|LOCUS_20760 23219 22023 gene locus_tag LOCUS_20770 gene tyrS 23219 22023 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_20770 23395 24744 gene locus_tag LOCUS_20780 23395 24744 CDS product family M23 zinc metallopeptidase with OapA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_20780 24758 25867 gene locus_tag LOCUS_20790 gene anmK 24758 25867 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_20790 26132 26830 gene locus_tag LOCUS_20800 gene aqpZ 26132 26830 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC1 protein_id gnl|my_center|LOCUS_20800 26957 27334 gene locus_tag LOCUS_20810 26957 27334 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071519.1 protein_id gnl|my_center|LOCUS_20810 27378 27797 gene locus_tag LOCUS_20820 27378 27797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071518.1 protein_id gnl|my_center|LOCUS_20820 28210 27860 gene locus_tag LOCUS_20830 gene erpA 28210 27860 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC4 protein_id gnl|my_center|LOCUS_20830 29006 28203 gene locus_tag LOCUS_20840 29006 28203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071516.1 protein_id gnl|my_center|LOCUS_20840 29137 30789 gene locus_tag LOCUS_20850 29137 30789 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_20850 30863 31933 gene locus_tag LOCUS_20860 gene pyrB 30863 31933 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_20860 31963 33246 gene locus_tag LOCUS_20870 gene hemL 31963 33246 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC8 protein_id gnl|my_center|LOCUS_20870 33723 34973 gene locus_tag LOCUS_20880 33723 34973 CDS product Na+/H+ antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 protein_id gnl|my_center|LOCUS_20880 36179 35040 gene locus_tag LOCUS_20890 gene gspB 36179 35040 CDS product general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071511.1 protein_id gnl|my_center|LOCUS_20890 37834 36179 gene locus_tag LOCUS_20900 gene gspA 37834 36179 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_20900 38001 39242 gene locus_tag LOCUS_20910 gene cca 38001 39242 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW05 protein_id gnl|my_center|LOCUS_20910 39471 39737 gene locus_tag LOCUS_20920 gene lpp 39471 39737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071508.1 protein_id gnl|my_center|LOCUS_20920 40679 39870 gene locus_tag LOCUS_20930 40679 39870 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071507.1 protein_id gnl|my_center|LOCUS_20930 41487 40681 gene locus_tag LOCUS_20940 gene uppP1 41487 40681 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_20940 42002 41505 gene locus_tag LOCUS_20950 42002 41505 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_20950 42450 42010 gene locus_tag LOCUS_20960 gene folB 42450 42010 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD5 protein_id gnl|my_center|LOCUS_20960 42626 43231 gene locus_tag LOCUS_20970 gene plsY 42626 43231 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59251 protein_id gnl|my_center|LOCUS_20970 44346 43330 gene locus_tag LOCUS_20980 gene tsaD 44346 43330 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD6 protein_id gnl|my_center|LOCUS_20980 44548 44763 gene locus_tag LOCUS_20990 gene rpsU 44548 44763 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD7 protein_id gnl|my_center|LOCUS_20990 44770 45213 gene locus_tag LOCUS_21000 44770 45213 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071501.1 protein_id gnl|my_center|LOCUS_21000 45510 47021 gene locus_tag LOCUS_21010 gene dnaG 45510 47021 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD9 protein_id gnl|my_center|LOCUS_21010 47155 49002 gene locus_tag LOCUS_21020 gene rpoD 47155 49002 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHE1 protein_id gnl|my_center|LOCUS_21020 49183 49259 gene locus_tag LOCUS_t00280 49183 49259 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50560 49652 gene locus_tag LOCUS_21030 50560 49652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 52491 51022 gene locus_tag LOCUS_21040 52491 51022 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707007.1 protein_id gnl|my_center|LOCUS_21040 53821 52745 gene locus_tag LOCUS_21050 gene dinB 53821 52745 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU9 protein_id gnl|my_center|LOCUS_21050 54782 54315 gene locus_tag LOCUS_21060 gene brf1 54782 54315 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_21060 55266 54793 gene locus_tag LOCUS_21070 gene brf2 55266 54793 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_21070 56408 55428 gene locus_tag LOCUS_21080 56408 55428 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998604.1 protein_id gnl|my_center|LOCUS_21080 56732 56508 gene locus_tag LOCUS_21090 56732 56508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071354.1 protein_id gnl|my_center|LOCUS_21090 57780 56749 gene locus_tag LOCUS_21100 gene apbE 57780 56749 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV3 protein_id gnl|my_center|LOCUS_21100 59099 57843 gene locus_tag LOCUS_21110 gene nqrF 59099 57843 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV4 protein_id gnl|my_center|LOCUS_21110 59753 59145 gene locus_tag LOCUS_21120 gene nqrE 59753 59145 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV5 protein_id gnl|my_center|LOCUS_21120 60391 59759 gene locus_tag LOCUS_21130 gene nqrD 60391 59759 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_21130 61176 60391 gene locus_tag LOCUS_21140 gene nqrC 61176 60391 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV7 protein_id gnl|my_center|LOCUS_21140 62368 61169 gene locus_tag LOCUS_21150 gene nqrB 62368 61169 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV8 protein_id gnl|my_center|LOCUS_21150 63729 62365 gene locus_tag LOCUS_21160 gene nqrA 63729 62365 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV9 protein_id gnl|my_center|LOCUS_21160 63729 63893 gene locus_tag LOCUS_21170 63729 63893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 65975 64068 gene locus_tag LOCUS_21180 65975 64068 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071346.1 protein_id gnl|my_center|LOCUS_21180 66755 66246 gene locus_tag LOCUS_21190 gene luxS 66755 66246 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHW1 protein_id gnl|my_center|LOCUS_21190 67179 66880 gene locus_tag LOCUS_21200 gene bolA 67179 66880 CDS product global transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071343.1 protein_id gnl|my_center|LOCUS_21200 67821 67255 gene locus_tag LOCUS_21210 67821 67255 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071342.1 protein_id gnl|my_center|LOCUS_21210 68093 69223 gene locus_tag LOCUS_21220 gene rlmG 68093 69223 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHW5 protein_id gnl|my_center|LOCUS_21220 70172 69330 gene locus_tag LOCUS_21230 70172 69330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence20 528 67 gene locus_tag LOCUS_21240 528 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098815.1 protein_id gnl|my_center|LOCUS_21240 3720 631 gene locus_tag LOCUS_21250 3720 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071340.1 protein_id gnl|my_center|LOCUS_21250 3973 5355 gene locus_tag LOCUS_21260 gene mpl 3973 5355 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT7 protein_id gnl|my_center|LOCUS_21260 5352 5993 gene locus_tag LOCUS_21270 gene ubiX 5352 5993 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT8 protein_id gnl|my_center|LOCUS_21270 6001 6531 gene locus_tag LOCUS_21280 gene hprT 6001 6531 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073575.1 protein_id gnl|my_center|LOCUS_21280 6658 7596 gene locus_tag LOCUS_21290 6658 7596 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073574.1 protein_id gnl|my_center|LOCUS_21290 7593 8363 gene locus_tag LOCUS_21300 7593 8363 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAU1 protein_id gnl|my_center|LOCUS_21300 8871 8365 gene locus_tag LOCUS_21310 8871 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071158.1 protein_id gnl|my_center|LOCUS_21310 9878 9033 gene locus_tag LOCUS_21320 gene panC 9878 9033 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH0 protein_id gnl|my_center|LOCUS_21320 10694 9900 gene locus_tag LOCUS_21330 gene panB 10694 9900 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_21330 11260 10772 gene locus_tag LOCUS_21340 gene folK 11260 10772 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071161.1 protein_id gnl|my_center|LOCUS_21340 12647 11262 gene locus_tag LOCUS_21350 gene pcnB 12647 11262 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG7 protein_id gnl|my_center|LOCUS_21350 13630 12761 gene locus_tag LOCUS_21360 gene gluQ 13630 12761 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG6 protein_id gnl|my_center|LOCUS_21360 14142 13699 gene locus_tag LOCUS_21370 gene dksA 14142 13699 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG5 protein_id gnl|my_center|LOCUS_21370 15015 14311 gene locus_tag LOCUS_21380 gene sfsA 15015 14311 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG4 protein_id gnl|my_center|LOCUS_21380 15178 16455 gene locus_tag LOCUS_21390 gene pepB 15178 16455 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071165.1 protein_id gnl|my_center|LOCUS_21390 16548 17006 gene locus_tag LOCUS_21400 16548 17006 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071166.1 protein_id gnl|my_center|LOCUS_21400 17556 17008 gene locus_tag LOCUS_21410 gene ligT 17556 17008 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ46 protein_id gnl|my_center|LOCUS_21410 17700 19871 gene locus_tag LOCUS_21420 17700 19871 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070957.1 protein_id gnl|my_center|LOCUS_21420 19936 22491 gene locus_tag LOCUS_21430 gene hrpB 19936 22491 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070959.1 protein_id gnl|my_center|LOCUS_21430 22644 24833 gene locus_tag LOCUS_21440 gene mrcB 22644 24833 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ40 protein_id gnl|my_center|LOCUS_21440 25671 24934 gene locus_tag LOCUS_21450 25671 24934 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073507.1 protein_id gnl|my_center|LOCUS_21450 26453 25812 gene locus_tag LOCUS_21460 26453 25812 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073506.1 protein_id gnl|my_center|LOCUS_21460 27236 26583 gene locus_tag LOCUS_21470 gene nfnB 27236 26583 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073505.1 protein_id gnl|my_center|LOCUS_21470 27420 27782 gene locus_tag LOCUS_21480 27420 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 27796 28566 gene locus_tag LOCUS_21490 27796 28566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_21490 29355 28630 gene locus_tag LOCUS_21500 gene artM 29355 28630 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071300.1 protein_id gnl|my_center|LOCUS_21500 30025 29348 gene locus_tag LOCUS_21510 gene artQ 30025 29348 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_21510 30757 30032 gene locus_tag LOCUS_21520 gene artI 30757 30032 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_21520 31174 31740 gene locus_tag LOCUS_21530 31174 31740 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_21530 32052 31840 gene locus_tag LOCUS_21540 32052 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 34832 32187 gene locus_tag LOCUS_21550 34832 32187 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 protein_id gnl|my_center|LOCUS_21550 35638 35045 gene locus_tag LOCUS_21560 35638 35045 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071314.1 protein_id gnl|my_center|LOCUS_21560 37016 35661 gene locus_tag LOCUS_21570 37016 35661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_21570 37501 37013 gene locus_tag LOCUS_21580 gene def2 37501 37013 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHZ2 protein_id gnl|my_center|LOCUS_21580 37737 37525 gene locus_tag LOCUS_21590 gene slyX 37737 37525 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHZ1 protein_id gnl|my_center|LOCUS_21590 38622 37741 gene locus_tag LOCUS_21600 38622 37741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071318.1 protein_id gnl|my_center|LOCUS_21600 38920 39696 gene locus_tag LOCUS_21610 gene fklB 38920 39696 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 protein_id gnl|my_center|LOCUS_21610 40755 39787 gene locus_tag LOCUS_21620 40755 39787 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_21620 41159 41533 gene locus_tag LOCUS_21630 41159 41533 CDS product UPF0231 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC4 protein_id gnl|my_center|LOCUS_21630 42218 41589 gene locus_tag LOCUS_21640 gene narP 42218 41589 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073713.1 protein_id gnl|my_center|LOCUS_21640 43935 42211 gene locus_tag LOCUS_21650 gene narQ 43935 42211 CDS product two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073712.1 protein_id gnl|my_center|LOCUS_21650 44235 45638 gene locus_tag LOCUS_21660 gene nrfA 44235 45638 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC7 protein_id gnl|my_center|LOCUS_21660 46273 45731 gene locus_tag LOCUS_21670 46273 45731 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071067.1 protein_id gnl|my_center|LOCUS_21670 46518 46913 gene locus_tag LOCUS_21680 gene glnK 46518 46913 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071066.1 protein_id gnl|my_center|LOCUS_21680 46924 48174 gene locus_tag LOCUS_21690 46924 48174 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_21690 48463 48834 gene locus_tag LOCUS_21700 48463 48834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071064.1 protein_id gnl|my_center|LOCUS_21700 48926 50155 gene locus_tag LOCUS_21710 48926 50155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 protein_id gnl|my_center|LOCUS_21710 51585 50296 gene locus_tag LOCUS_21720 51585 50296 CDS product DUF4785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071846.1 protein_id gnl|my_center|LOCUS_21720 52453 51596 gene locus_tag LOCUS_21730 52453 51596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071847.1 protein_id gnl|my_center|LOCUS_21730 53016 54071 gene locus_tag LOCUS_21740 gene aroG 53016 54071 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIS9 protein_id gnl|my_center|LOCUS_21740 54283 54110 gene locus_tag LOCUS_21750 54283 54110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071061.1 protein_id gnl|my_center|LOCUS_21750 54603 56408 gene locus_tag LOCUS_21760 gene atmA 54603 56408 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_21760 56470 56739 gene locus_tag LOCUS_21770 56470 56739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 56969 56751 gene locus_tag LOCUS_21780 56969 56751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071058.1 protein_id gnl|my_center|LOCUS_21780 58571 57081 gene locus_tag LOCUS_21790 gene glsF 58571 57081 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_21790 59087 58581 gene locus_tag LOCUS_21800 59087 58581 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_21800 59224 59802 gene locus_tag LOCUS_21810 59224 59802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071055.1 protein_id gnl|my_center|LOCUS_21810 59917 60666 gene locus_tag LOCUS_21820 gene fpr 59917 60666 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071054.1 protein_id gnl|my_center|LOCUS_21820 60680 61270 gene locus_tag LOCUS_21830 60680 61270 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071053.1 protein_id gnl|my_center|LOCUS_21830 61687 61232 gene locus_tag LOCUS_21840 61687 61232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 61900 62916 gene locus_tag LOCUS_21850 gene fbpA 61900 62916 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071051.1 protein_id gnl|my_center|LOCUS_21850 63013 64587 gene locus_tag LOCUS_21860 gene fbpB 63013 64587 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071050.1 protein_id gnl|my_center|LOCUS_21860 64587 65627 gene locus_tag LOCUS_21870 gene fbpC 64587 65627 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071049.1 protein_id gnl|my_center|LOCUS_21870 65906 67543 gene locus_tag LOCUS_21880 gene ggtB 65906 67543 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_21880 67657 68577 gene locus_tag LOCUS_21890 67657 68577 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence21 715 1050 gene locus_tag LOCUS_21900 gene arsR 715 1050 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 protein_id gnl|my_center|LOCUS_21900 1116 2150 gene locus_tag LOCUS_21910 1116 2150 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_21910 2152 3165 gene locus_tag LOCUS_21920 gene gapA 2152 3165 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_21920 3177 4421 gene locus_tag LOCUS_21930 3177 4421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880869.1 protein_id gnl|my_center|LOCUS_21930 4545 5999 gene locus_tag LOCUS_21940 4545 5999 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070880.1 protein_id gnl|my_center|LOCUS_21940 6113 6598 gene locus_tag LOCUS_21950 6113 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6915 6676 gene locus_tag LOCUS_21960 6915 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 7410 7009 gene locus_tag LOCUS_21970 7410 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7645 8217 gene locus_tag LOCUS_21980 7645 8217 CDS product potassium-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_21980 9146 8205 gene locus_tag LOCUS_21990 9146 8205 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 protein_id gnl|my_center|LOCUS_21990 9239 10201 gene locus_tag LOCUS_22000 9239 10201 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 protein_id gnl|my_center|LOCUS_22000 10332 11687 gene locus_tag LOCUS_22010 10332 11687 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_22010 13091 11739 gene locus_tag LOCUS_22020 13091 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070881.1 protein_id gnl|my_center|LOCUS_22020 13313 14278 gene locus_tag LOCUS_22030 13313 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 14496 14314 gene locus_tag LOCUS_22040 14496 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070882.1 protein_id gnl|my_center|LOCUS_22040 14798 16933 gene locus_tag LOCUS_22050 14798 16933 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070883.1 protein_id gnl|my_center|LOCUS_22050 16930 17361 gene locus_tag LOCUS_22060 16930 17361 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 protein_id gnl|my_center|LOCUS_22060 17374 19101 gene locus_tag LOCUS_22070 17374 19101 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_22070 19183 20088 gene locus_tag LOCUS_22080 gene rimK1 19183 20088 CDS product putative alpha-L-glutamate ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC1 protein_id gnl|my_center|LOCUS_22080 20804 20112 gene locus_tag LOCUS_22090 20804 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_22090 21343 21071 gene locus_tag LOCUS_22100 21343 21071 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070888.1 protein_id gnl|my_center|LOCUS_22100 21911 21516 gene locus_tag LOCUS_22110 21911 21516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070890.1 protein_id gnl|my_center|LOCUS_22110 22031 22540 gene locus_tag LOCUS_22120 22031 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070891.1 protein_id gnl|my_center|LOCUS_22120 22852 22547 gene locus_tag LOCUS_22130 22852 22547 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070893.1 protein_id gnl|my_center|LOCUS_22130 23135 23659 gene locus_tag LOCUS_22140 23135 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_22140 25386 23656 gene locus_tag LOCUS_22150 25386 23656 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 protein_id gnl|my_center|LOCUS_22150 25818 25507 gene locus_tag LOCUS_22160 25818 25507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070896.1 protein_id gnl|my_center|LOCUS_22160 25866 26753 gene locus_tag LOCUS_22170 gene gumN 25866 26753 CDS product protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070897.1 protein_id gnl|my_center|LOCUS_22170 26799 27434 gene locus_tag LOCUS_22180 gene cheD 26799 27434 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VST8 protein_id gnl|my_center|LOCUS_22180 28219 27395 gene locus_tag LOCUS_22190 gene smtA 28219 27395 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA9 protein_id gnl|my_center|LOCUS_22190 28362 29222 gene locus_tag LOCUS_22200 28362 29222 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070899.1 protein_id gnl|my_center|LOCUS_22200 29455 31161 gene locus_tag LOCUS_22210 gene fhs 29455 31161 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA7 protein_id gnl|my_center|LOCUS_22210 32841 31222 gene locus_tag LOCUS_22220 32841 31222 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263910.1 protein_id gnl|my_center|LOCUS_22220 33164 33358 gene locus_tag LOCUS_22230 33164 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 33488 33363 gene locus_tag LOCUS_22240 33488 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 33715 34014 gene locus_tag LOCUS_22250 33715 34014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 34096 35307 gene locus_tag LOCUS_22260 34096 35307 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_22260 35291 36199 gene locus_tag LOCUS_22270 gene znuA 35291 36199 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_22270 36196 36963 gene locus_tag LOCUS_22280 gene znuB 36196 36963 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_22280 37102 37845 gene locus_tag LOCUS_22290 gene plsC 37102 37845 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA1 protein_id gnl|my_center|LOCUS_22290 37877 38266 gene locus_tag LOCUS_22300 gene rraB 37877 38266 CDS product regulator of ribonuclease activity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA0 protein_id gnl|my_center|LOCUS_22300 39419 38343 gene locus_tag LOCUS_22310 gene degS 39419 38343 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073685.1 protein_id gnl|my_center|LOCUS_22310 40945 39590 gene locus_tag LOCUS_22320 gene degQ 40945 39590 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 protein_id gnl|my_center|LOCUS_22320 41441 41088 gene locus_tag LOCUS_22330 41441 41088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 41658 42752 gene locus_tag LOCUS_22340 gene zapE 41658 42752 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG1 protein_id gnl|my_center|LOCUS_22340 43051 43479 gene locus_tag LOCUS_22350 gene rplM 43051 43479 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG2 protein_id gnl|my_center|LOCUS_22350 43494 43886 gene locus_tag LOCUS_22360 gene rpsI 43494 43886 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_22360 43999 44187 gene locus_tag LOCUS_22370 gene yjeT 43999 44187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073681.1 protein_id gnl|my_center|LOCUS_22370 44253 45548 gene locus_tag LOCUS_22380 gene purA 44253 45548 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG5 protein_id gnl|my_center|LOCUS_22380 45662 46282 gene locus_tag LOCUS_22390 gene motX 45662 46282 CDS product flagellar rotation associated protein MotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073679.1 protein_id gnl|my_center|LOCUS_22390 46328 48742 gene locus_tag LOCUS_22400 gene rnr 46328 48742 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG7 protein_id gnl|my_center|LOCUS_22400 48743 49480 gene locus_tag LOCUS_22410 gene rlmB 48743 49480 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_22410 49550 50041 gene locus_tag LOCUS_22420 49550 50041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478242.1 protein_id gnl|my_center|LOCUS_22420 50811 50068 gene locus_tag LOCUS_22430 50811 50068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073675.1 protein_id gnl|my_center|LOCUS_22430 51017 51418 gene locus_tag LOCUS_22440 gene rpsF 51017 51418 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAH2 protein_id gnl|my_center|LOCUS_22440 51427 51732 gene locus_tag LOCUS_22450 gene priB 51427 51732 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAH3 protein_id gnl|my_center|LOCUS_22450 51744 51971 gene locus_tag LOCUS_22460 gene rpsR 51744 51971 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAH4 protein_id gnl|my_center|LOCUS_22460 52002 52454 gene locus_tag LOCUS_22470 gene rplI 52002 52454 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAH5 protein_id gnl|my_center|LOCUS_22470 54952 52751 gene locus_tag LOCUS_22480 54952 52751 CDS product peptidase S46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073664.1 protein_id gnl|my_center|LOCUS_22480 55083 56489 gene locus_tag LOCUS_22490 gene dnaB 55083 56489 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAI5 protein_id gnl|my_center|LOCUS_22490 56558 57634 gene locus_tag LOCUS_22500 gene alr 56558 57634 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAI6 protein_id gnl|my_center|LOCUS_22500 58158 57691 gene locus_tag LOCUS_22510 gene cheX 58158 57691 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_22510 61450 58340 gene locus_tag LOCUS_22520 61450 58340 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707057.1 protein_id gnl|my_center|LOCUS_22520 62523 61450 gene locus_tag LOCUS_22530 62523 61450 CDS product tetrathionate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707058.1 protein_id gnl|my_center|LOCUS_22530 63256 62513 gene locus_tag LOCUS_22540 63256 62513 CDS product tetrathionate reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707059.1 protein_id gnl|my_center|LOCUS_22540 63576 65282 gene locus_tag LOCUS_22550 63576 65282 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106007.1 protein_id gnl|my_center|LOCUS_22550 65309 65953 gene locus_tag LOCUS_22560 65309 65953 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457930.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence22 1062 133 gene locus_tag LOCUS_22570 1062 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072675.1 protein_id gnl|my_center|LOCUS_22570 1349 2770 gene locus_tag LOCUS_22580 gene creD 1349 2770 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073993.1 protein_id gnl|my_center|LOCUS_22580 2879 3706 gene locus_tag LOCUS_22590 gene pgpB 2879 3706 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073994.1 protein_id gnl|my_center|LOCUS_22590 4886 3756 gene locus_tag LOCUS_22600 gene agxT 4886 3756 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_22600 6567 5014 gene locus_tag LOCUS_22610 gene ilvA 6567 5014 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9E0 protein_id gnl|my_center|LOCUS_22610 8425 6569 gene locus_tag LOCUS_22620 gene ilvD 8425 6569 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D9 protein_id gnl|my_center|LOCUS_22620 8719 8462 gene locus_tag LOCUS_22630 gene ilvM 8719 8462 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074003.1 protein_id gnl|my_center|LOCUS_22630 10392 8716 gene locus_tag LOCUS_22640 gene ilvG 10392 8716 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D7 protein_id gnl|my_center|LOCUS_22640 12286 10805 gene locus_tag LOCUS_22650 gene ilvC 12286 10805 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_22650 12435 13307 gene locus_tag LOCUS_22660 gene ilvY 12435 13307 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074007.1 protein_id gnl|my_center|LOCUS_22660 14780 13449 gene locus_tag LOCUS_22670 gene hlyA 14780 13449 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074008.1 protein_id gnl|my_center|LOCUS_22670 14985 15809 gene locus_tag LOCUS_22680 14985 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706989.1 protein_id gnl|my_center|LOCUS_22680 16279 16031 gene locus_tag LOCUS_22690 16279 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073409.1 protein_id gnl|my_center|LOCUS_22690 16657 18177 gene locus_tag LOCUS_22700 gene yifB 16657 18177 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070714.1 protein_id gnl|my_center|LOCUS_22700 18337 18705 gene locus_tag LOCUS_22710 18337 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 19321 18710 gene locus_tag LOCUS_22720 19321 18710 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071620.1 protein_id gnl|my_center|LOCUS_22720 21050 19296 gene locus_tag LOCUS_22730 21050 19296 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071621.1 protein_id gnl|my_center|LOCUS_22730 21230 22750 gene locus_tag LOCUS_22740 21230 22750 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_22740 22761 23132 gene locus_tag LOCUS_22750 22761 23132 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071617.1 protein_id gnl|my_center|LOCUS_22750 23147 24178 gene locus_tag LOCUS_22760 23147 24178 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071624.1 protein_id gnl|my_center|LOCUS_22760 25327 24248 gene locus_tag LOCUS_22770 gene caiA 25327 24248 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32K58 protein_id gnl|my_center|LOCUS_22770 25727 26374 gene locus_tag LOCUS_22780 25727 26374 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_22780 27741 26422 gene locus_tag LOCUS_22790 27741 26422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183207.1 protein_id gnl|my_center|LOCUS_22790 28375 28088 gene locus_tag LOCUS_22800 28375 28088 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 protein_id gnl|my_center|LOCUS_22800 29664 28372 gene locus_tag LOCUS_22810 gene ydiS 29664 28372 CDS product oxidoreductase FixC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278474.1 protein_id gnl|my_center|LOCUS_22810 30675 29725 gene locus_tag LOCUS_22820 gene fixB 30675 29725 CDS product protein FixB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7R7 protein_id gnl|my_center|LOCUS_22820 31459 30686 gene locus_tag LOCUS_22830 gene fixA 31459 30686 CDS product protein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9L0 protein_id gnl|my_center|LOCUS_22830 31981 33087 gene locus_tag LOCUS_22840 31981 33087 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_22840 33216 34736 gene locus_tag LOCUS_22850 gene caiT 33216 34736 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHE4 protein_id gnl|my_center|LOCUS_22850 34799 35941 gene locus_tag LOCUS_22860 gene caiA 34799 35941 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7R4 protein_id gnl|my_center|LOCUS_22860 36058 37284 gene locus_tag LOCUS_22870 gene caiB 36058 37284 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7R3 protein_id gnl|my_center|LOCUS_22870 37365 38921 gene locus_tag LOCUS_22880 gene caiC 37365 38921 CDS product putative crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7R2 protein_id gnl|my_center|LOCUS_22880 39155 39940 gene locus_tag LOCUS_22890 gene caiD 39155 39940 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9L5 protein_id gnl|my_center|LOCUS_22890 40006 40596 gene locus_tag LOCUS_22900 gene caiE 40006 40596 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9L6 protein_id gnl|my_center|LOCUS_22900 40622 41563 gene locus_tag LOCUS_22910 40622 41563 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_22910 42186 41722 gene locus_tag LOCUS_22920 42186 41722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071094.1 protein_id gnl|my_center|LOCUS_22920 44354 42186 gene locus_tag LOCUS_22930 44354 42186 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071095.1 protein_id gnl|my_center|LOCUS_22930 45292 44579 gene locus_tag LOCUS_22940 gene yjjG 45292 44579 CDS product dUMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070735.1 protein_id gnl|my_center|LOCUS_22940 46462 45392 gene locus_tag LOCUS_22950 46462 45392 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_22950 47390 46455 gene locus_tag LOCUS_22960 47390 46455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070726.1 protein_id gnl|my_center|LOCUS_22960 48812 47502 gene locus_tag LOCUS_22970 48812 47502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 49039 49662 gene locus_tag LOCUS_22980 gene gmk 49039 49662 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU6 protein_id gnl|my_center|LOCUS_22980 49722 50003 gene locus_tag LOCUS_22990 gene rpoZ 49722 50003 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU7 protein_id gnl|my_center|LOCUS_22990 50029 52137 gene locus_tag LOCUS_23000 gene spoT 50029 52137 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070723.1 protein_id gnl|my_center|LOCUS_23000 52161 52544 gene locus_tag LOCUS_23010 52161 52544 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_23010 52602 53294 gene locus_tag LOCUS_23020 gene trmH 52602 53294 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XU23 protein_id gnl|my_center|LOCUS_23020 53454 55109 gene locus_tag LOCUS_23030 53454 55109 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070720.1 protein_id gnl|my_center|LOCUS_23030 55278 56207 gene locus_tag LOCUS_23040 gene yrbG 55278 56207 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_23040 56879 56358 gene locus_tag LOCUS_23050 56879 56358 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071241.1 protein_id gnl|my_center|LOCUS_23050 57474 57941 gene locus_tag LOCUS_23060 57474 57941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 57988 58356 gene locus_tag LOCUS_23070 57988 58356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 58402 59007 gene locus_tag LOCUS_23080 58402 59007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 59177 59419 gene locus_tag LOCUS_23090 59177 59419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 59581 61656 gene locus_tag LOCUS_23100 gene recG 59581 61656 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9C0 protein_id gnl|my_center|LOCUS_23100 61845 62711 gene locus_tag LOCUS_23110 61845 62711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_23110 62955 63683 gene locus_tag LOCUS_23120 62955 63683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074020.1 protein_id gnl|my_center|LOCUS_23120 63680 64477 gene locus_tag LOCUS_23130 63680 64477 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_23130 64464 64718 gene locus_tag LOCUS_23140 64464 64718 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 protein_id gnl|my_center|LOCUS_23140 64728 64976 gene locus_tag LOCUS_23150 gene acpP 64728 64976 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9B5 protein_id gnl|my_center|LOCUS_23150 >Feature sequence23 801 1094 gene locus_tag LOCUS_23160 801 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1184 1108 gene locus_tag LOCUS_t00290 1184 1108 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1319 1243 gene locus_tag LOCUS_t00300 1319 1243 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2741 1431 gene locus_tag LOCUS_23170 2741 1431 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072511.1 protein_id gnl|my_center|LOCUS_23170 3496 2750 gene locus_tag LOCUS_23180 gene dnaQ 3496 2750 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072512.1 protein_id gnl|my_center|LOCUS_23180 3569 4045 gene locus_tag LOCUS_23190 gene rnhA 3569 4045 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE30 protein_id gnl|my_center|LOCUS_23190 4956 4042 gene locus_tag LOCUS_23200 4956 4042 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072514.1 protein_id gnl|my_center|LOCUS_23200 5705 4962 gene locus_tag LOCUS_23210 5705 4962 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 protein_id gnl|my_center|LOCUS_23210 5822 6634 gene locus_tag LOCUS_23220 gene gloB 5822 6634 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_23220 6916 8448 gene locus_tag LOCUS_23230 6916 8448 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_23230 8608 10158 gene locus_tag LOCUS_23240 8608 10158 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883332.1 protein_id gnl|my_center|LOCUS_23240 10680 10258 gene locus_tag LOCUS_23250 10680 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 12626 10794 gene locus_tag LOCUS_23260 gene asmA 12626 10794 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 protein_id gnl|my_center|LOCUS_23260 13161 12667 gene locus_tag LOCUS_23270 13161 12667 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE23 protein_id gnl|my_center|LOCUS_23270 13375 13692 gene locus_tag LOCUS_23280 13375 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072521.1 protein_id gnl|my_center|LOCUS_23280 14036 15034 gene locus_tag LOCUS_23290 14036 15034 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881132.1 protein_id gnl|my_center|LOCUS_23290 15031 16350 gene locus_tag LOCUS_23300 15031 16350 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610805.1 protein_id gnl|my_center|LOCUS_23300 17004 16393 gene locus_tag LOCUS_23310 gene yedZ 17004 16393 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD8 protein_id gnl|my_center|LOCUS_23310 18038 17004 gene locus_tag LOCUS_23320 gene yedY 18038 17004 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD9 protein_id gnl|my_center|LOCUS_23320 18280 19776 gene locus_tag LOCUS_23330 gene rmuC 18280 19776 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 protein_id gnl|my_center|LOCUS_23330 19825 21774 gene locus_tag LOCUS_23340 gene sltY 19825 21774 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072113.1 protein_id gnl|my_center|LOCUS_23340 21945 22661 gene locus_tag LOCUS_23350 21945 22661 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 protein_id gnl|my_center|LOCUS_23350 22675 23577 gene locus_tag LOCUS_23360 22675 23577 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072205.1 protein_id gnl|my_center|LOCUS_23360 23585 24565 gene locus_tag LOCUS_23370 23585 24565 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_23370 24562 26625 gene locus_tag LOCUS_23380 24562 26625 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072203.1 protein_id gnl|my_center|LOCUS_23380 26668 30288 gene locus_tag LOCUS_23390 gene recC 26668 30288 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF44 protein_id gnl|my_center|LOCUS_23390 30290 33967 gene locus_tag LOCUS_23400 gene recB 30290 33967 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF45 protein_id gnl|my_center|LOCUS_23400 33964 35949 gene locus_tag LOCUS_23410 gene recD 33964 35949 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF46 protein_id gnl|my_center|LOCUS_23410 36147 37157 gene locus_tag LOCUS_23420 gene ddl 36147 37157 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEZ2 protein_id gnl|my_center|LOCUS_23420 37281 37673 gene locus_tag LOCUS_23430 37281 37673 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_23430 38372 37785 gene locus_tag LOCUS_23440 gene napC 38372 37785 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_23440 38857 38381 gene locus_tag LOCUS_23450 38857 38381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 41366 38871 gene locus_tag LOCUS_23460 gene napA 41366 38871 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIM1 protein_id gnl|my_center|LOCUS_23460 41620 41363 gene locus_tag LOCUS_23470 41620 41363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 41820 41659 gene locus_tag LOCUS_23480 41820 41659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 42406 43752 gene locus_tag LOCUS_23490 gene nrfA 42406 43752 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC7 protein_id gnl|my_center|LOCUS_23490 47841 43966 gene locus_tag LOCUS_23500 gene hrpA 47841 43966 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 protein_id gnl|my_center|LOCUS_23500 48367 47951 gene locus_tag LOCUS_23510 48367 47951 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072250.1 protein_id gnl|my_center|LOCUS_23510 49496 48462 gene locus_tag LOCUS_23520 gene iaaA 49496 48462 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_23520 49681 51480 gene locus_tag LOCUS_23530 49681 51480 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072177.1 protein_id gnl|my_center|LOCUS_23530 51492 55469 gene locus_tag LOCUS_23540 51492 55469 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072176.1 protein_id gnl|my_center|LOCUS_23540 55901 55614 gene locus_tag LOCUS_23550 gene rplY 55901 55614 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF74 protein_id gnl|my_center|LOCUS_23550 56196 56699 gene locus_tag LOCUS_23560 56196 56699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 56886 56587 gene locus_tag LOCUS_23570 56886 56587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 58788 57334 gene locus_tag LOCUS_23580 58788 57334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 59016 59282 gene locus_tag LOCUS_23590 59016 59282 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071975.1 protein_id gnl|my_center|LOCUS_23590 59574 59501 gene locus_tag LOCUS_t00310 59574 59501 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 59684 59609 gene locus_tag LOCUS_t00320 59684 59609 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 60235 59852 gene locus_tag LOCUS_23600 60235 59852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 62277 60448 gene locus_tag LOCUS_23610 gene uvrC 62277 60448 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV4 protein_id gnl|my_center|LOCUS_23610 63018 62368 gene locus_tag LOCUS_23620 gene uvrY 63018 62368 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071972.1 protein_id gnl|my_center|LOCUS_23620 63810 63289 gene locus_tag LOCUS_23630 63810 63289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106026.1 protein_id gnl|my_center|LOCUS_23630 64247 64157 gene locus_tag LOCUS_t00330 64247 64157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 333 3482 gene locus_tag LOCUS_23640 333 3482 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_23640 3652 4269 gene locus_tag LOCUS_23650 3652 4269 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 protein_id gnl|my_center|LOCUS_23650 4427 6646 gene locus_tag LOCUS_23660 4427 6646 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071223.1 protein_id gnl|my_center|LOCUS_23660 9087 6931 gene locus_tag LOCUS_23670 9087 6931 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_23670 10417 9224 gene locus_tag LOCUS_23680 10417 9224 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071327.1 protein_id gnl|my_center|LOCUS_23680 11113 11670 gene locus_tag LOCUS_23690 11113 11670 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 protein_id gnl|my_center|LOCUS_23690 13198 11735 gene locus_tag LOCUS_23700 gene katB 13198 11735 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY4 protein_id gnl|my_center|LOCUS_23700 13747 13484 gene locus_tag LOCUS_23710 13747 13484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071323.1 protein_id gnl|my_center|LOCUS_23710 14455 14018 gene locus_tag LOCUS_23720 14455 14018 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 protein_id gnl|my_center|LOCUS_23720 17216 14715 gene locus_tag LOCUS_23730 17216 14715 CDS product collagenolytic serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071157.1 protein_id gnl|my_center|LOCUS_23730 17628 18056 gene locus_tag LOCUS_23740 gene csgB 17628 18056 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071156.1 protein_id gnl|my_center|LOCUS_23740 18075 19511 gene locus_tag LOCUS_23750 gene csgA 18075 19511 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_23750 20728 20063 gene locus_tag LOCUS_23760 gene csgD 20728 20063 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071154.1 protein_id gnl|my_center|LOCUS_23760 21544 20939 gene locus_tag LOCUS_23770 gene yjdF 21544 20939 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_23770 21703 22932 gene locus_tag LOCUS_23780 gene serA 21703 22932 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 protein_id gnl|my_center|LOCUS_23780 23032 23997 gene locus_tag LOCUS_23790 gene ygfZ 23032 23997 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH8 protein_id gnl|my_center|LOCUS_23790 25087 24056 gene locus_tag LOCUS_23800 25087 24056 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_23800 30476 25179 gene locus_tag LOCUS_23810 30476 25179 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EII0 protein_id gnl|my_center|LOCUS_23810 32231 30870 gene locus_tag LOCUS_23820 gene glyP 32231 30870 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071148.1 protein_id gnl|my_center|LOCUS_23820 32483 32259 gene locus_tag LOCUS_23830 32483 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 32804 33469 gene locus_tag LOCUS_23840 gene attE 32804 33469 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071147.1 protein_id gnl|my_center|LOCUS_23840 33462 36041 gene locus_tag LOCUS_23850 gene attFG 33462 36041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071146.1 protein_id gnl|my_center|LOCUS_23850 36041 37231 gene locus_tag LOCUS_23860 gene attH 36041 37231 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071145.1 protein_id gnl|my_center|LOCUS_23860 37621 37920 gene locus_tag LOCUS_23870 gene napD 37621 37920 CDS product sorbose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 protein_id gnl|my_center|LOCUS_23870 37917 40400 gene locus_tag LOCUS_23880 gene napA 37917 40400 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIJ1 protein_id gnl|my_center|LOCUS_23880 40411 41154 gene locus_tag LOCUS_23890 gene napG 40411 41154 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071137.1 protein_id gnl|my_center|LOCUS_23890 41151 42089 gene locus_tag LOCUS_23900 gene napH 41151 42089 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071136.1 protein_id gnl|my_center|LOCUS_23900 42086 42526 gene locus_tag LOCUS_23910 gene napB 42086 42526 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIJ4 protein_id gnl|my_center|LOCUS_23910 43269 42634 gene locus_tag LOCUS_23920 43269 42634 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884291.1 protein_id gnl|my_center|LOCUS_23920 43908 44168 gene locus_tag LOCUS_23930 43908 44168 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_23930 44338 44198 gene locus_tag LOCUS_23940 44338 44198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 44434 45312 gene locus_tag LOCUS_23950 44434 45312 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071133.1 protein_id gnl|my_center|LOCUS_23950 46197 45328 gene locus_tag LOCUS_23960 gene uspE 46197 45328 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_23960 46408 47604 gene locus_tag LOCUS_23970 46408 47604 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_23970 49886 47664 gene locus_tag LOCUS_23980 gene dpp4 49886 47664 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_23980 50085 51074 gene locus_tag LOCUS_23990 gene fbp 50085 51074 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 protein_id gnl|my_center|LOCUS_23990 51282 51809 gene locus_tag LOCUS_24000 gene ppa 51282 51809 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP34 protein_id gnl|my_center|LOCUS_24000 53115 51865 gene locus_tag LOCUS_24010 53115 51865 CDS product proton/sodium:glutamate symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073727.1 protein_id gnl|my_center|LOCUS_24010 53560 53781 gene locus_tag LOCUS_24020 53560 53781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 54531 53842 gene locus_tag LOCUS_24030 gene lrgB 54531 53842 CDS product murein hydrolase effector protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071306.1 protein_id gnl|my_center|LOCUS_24030 55003 54536 gene locus_tag LOCUS_24040 gene lrgA 55003 54536 CDS product protein LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071305.1 protein_id gnl|my_center|LOCUS_24040 55103 55993 gene locus_tag LOCUS_24050 55103 55993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071304.1 protein_id gnl|my_center|LOCUS_24050 56361 57566 gene locus_tag LOCUS_24060 gene tyrP 56361 57566 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072133.1 protein_id gnl|my_center|LOCUS_24060 58093 57656 gene locus_tag LOCUS_24070 58093 57656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 58382 59284 gene locus_tag LOCUS_24080 58382 59284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895438.1 protein_id gnl|my_center|LOCUS_24080 59898 59359 gene locus_tag LOCUS_24090 59898 59359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_24090 60034 60963 gene locus_tag LOCUS_24100 60034 60963 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071093.1 protein_id gnl|my_center|LOCUS_24100 62543 61041 gene locus_tag LOCUS_24110 gene lysS 62543 61041 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI58 protein_id gnl|my_center|LOCUS_24110 63619 62561 gene locus_tag LOCUS_24120 gene prfB 63619 62561 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSP3 protein_id gnl|my_center|LOCUS_24120 >Feature sequence25 1426 419 gene locus_tag LOCUS_24130 1426 419 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 protein_id gnl|my_center|LOCUS_24130 1683 4547 gene locus_tag LOCUS_24140 1683 4547 CDS product periplasmic peptidase family S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_24140 6270 4882 gene locus_tag LOCUS_24150 gene yegQ 6270 4882 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_24150 6582 7424 gene locus_tag LOCUS_24160 6582 7424 CDS product signal transduction superfamily protein with modified HD-GYP domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 protein_id gnl|my_center|LOCUS_24160 7472 8965 gene locus_tag LOCUS_24170 7472 8965 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071478.1 protein_id gnl|my_center|LOCUS_24170 9419 8997 gene locus_tag LOCUS_24180 9419 8997 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_24180 10028 9480 gene locus_tag LOCUS_24190 10028 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 10417 10842 gene locus_tag LOCUS_24200 10417 10842 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073336.1 protein_id gnl|my_center|LOCUS_24200 14038 10919 gene locus_tag LOCUS_24210 14038 10919 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073327.1 protein_id gnl|my_center|LOCUS_24210 15129 14038 gene locus_tag LOCUS_24220 15129 14038 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073326.1 protein_id gnl|my_center|LOCUS_24220 17048 15381 gene locus_tag LOCUS_24230 gene yjjK 17048 15381 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073319.1 protein_id gnl|my_center|LOCUS_24230 17277 18530 gene locus_tag LOCUS_24240 gene glyA 17277 18530 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBN8 protein_id gnl|my_center|LOCUS_24240 18640 19092 gene locus_tag LOCUS_24250 gene nrdR 18640 19092 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBN9 protein_id gnl|my_center|LOCUS_24250 19133 20257 gene locus_tag LOCUS_24260 gene ribD 19133 20257 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP0 protein_id gnl|my_center|LOCUS_24260 20258 20914 gene locus_tag LOCUS_24270 20258 20914 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_24270 20996 22102 gene locus_tag LOCUS_24280 gene ribBA 20996 22102 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP2 protein_id gnl|my_center|LOCUS_24280 22222 22698 gene locus_tag LOCUS_24290 gene ribH 22222 22698 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 protein_id gnl|my_center|LOCUS_24290 22712 23119 gene locus_tag LOCUS_24300 gene nusB 22712 23119 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP4 protein_id gnl|my_center|LOCUS_24300 23194 24165 gene locus_tag LOCUS_24310 gene thiL 23194 24165 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP5 protein_id gnl|my_center|LOCUS_24310 24166 24660 gene locus_tag LOCUS_24320 gene pgpA 24166 24660 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_24320 24938 26383 gene locus_tag LOCUS_24330 24938 26383 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_24330 26385 27179 gene locus_tag LOCUS_24340 26385 27179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_24340 27358 28470 gene locus_tag LOCUS_24350 gene tonB 27358 28470 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073757.1 protein_id gnl|my_center|LOCUS_24350 30677 28959 gene locus_tag LOCUS_24360 gene proS 30677 28959 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECI8 protein_id gnl|my_center|LOCUS_24360 32046 30778 gene locus_tag LOCUS_24370 32046 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 32644 32054 gene locus_tag LOCUS_24380 32644 32054 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073041.1 protein_id gnl|my_center|LOCUS_24380 33438 32704 gene locus_tag LOCUS_24390 gene yaeB 33438 32704 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073040.1 protein_id gnl|my_center|LOCUS_24390 33829 33449 gene locus_tag LOCUS_24400 gene rcsF 33829 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073039.1 protein_id gnl|my_center|LOCUS_24400 35195 33891 gene locus_tag LOCUS_24410 35195 33891 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_24410 38278 35192 gene locus_tag LOCUS_24420 38278 35192 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_24420 38975 38577 gene locus_tag LOCUS_24430 38975 38577 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECJ6 protein_id gnl|my_center|LOCUS_24430 39335 40084 gene locus_tag LOCUS_24440 gene etfB 39335 40084 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073035.1 protein_id gnl|my_center|LOCUS_24440 40085 41008 gene locus_tag LOCUS_24450 gene etfA 40085 41008 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 protein_id gnl|my_center|LOCUS_24450 41379 42950 gene locus_tag LOCUS_24460 41379 42950 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_24460 43028 44191 gene locus_tag LOCUS_24470 43028 44191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 46448 44310 gene locus_tag LOCUS_24480 gene dcp 46448 44310 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073033.1 protein_id gnl|my_center|LOCUS_24480 46722 47300 gene locus_tag LOCUS_24490 gene tdk 46722 47300 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECK0 protein_id gnl|my_center|LOCUS_24490 47455 48408 gene locus_tag LOCUS_24500 47455 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 49538 48423 gene locus_tag LOCUS_24510 49538 48423 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070555.1 protein_id gnl|my_center|LOCUS_24510 49602 49769 gene locus_tag LOCUS_24520 49602 49769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 50214 49753 gene locus_tag LOCUS_24530 50214 49753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 51819 50428 gene locus_tag LOCUS_24540 51819 50428 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_24540 53162 52059 gene locus_tag LOCUS_24550 gene gldA 53162 52059 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706249.1 protein_id gnl|my_center|LOCUS_24550 54053 53475 gene locus_tag LOCUS_24560 54053 53475 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071762.1 protein_id gnl|my_center|LOCUS_24560 55252 54212 gene locus_tag LOCUS_24570 55252 54212 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929827.1 protein_id gnl|my_center|LOCUS_24570 55768 55325 gene locus_tag LOCUS_24580 55768 55325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 56025 55795 gene locus_tag LOCUS_24590 56025 55795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 57348 56173 gene locus_tag LOCUS_24600 57348 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 58795 58139 gene locus_tag LOCUS_24610 gene liuG 58795 58139 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_24610 59512 58811 gene locus_tag LOCUS_24620 gene liuF 59512 58811 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 protein_id gnl|my_center|LOCUS_24620 60467 59577 gene locus_tag LOCUS_24630 gene liuE 60467 59577 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence26 2170 1310 gene locus_tag LOCUS_24640 gene atpG 2170 1310 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B9 protein_id gnl|my_center|LOCUS_24640 3762 2221 gene locus_tag LOCUS_24650 gene atpA 3762 2221 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B8 protein_id gnl|my_center|LOCUS_24650 4310 3777 gene locus_tag LOCUS_24660 gene atpH 4310 3777 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B7 protein_id gnl|my_center|LOCUS_24660 4796 4326 gene locus_tag LOCUS_24670 gene atpF 4796 4326 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B6 protein_id gnl|my_center|LOCUS_24670 5085 4834 gene locus_tag LOCUS_24680 gene atpE 5085 4834 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B5 protein_id gnl|my_center|LOCUS_24680 5945 5151 gene locus_tag LOCUS_24690 gene atpB 5945 5151 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B4 protein_id gnl|my_center|LOCUS_24690 6341 5958 gene locus_tag LOCUS_24700 gene atpI 6341 5958 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 protein_id gnl|my_center|LOCUS_24700 7448 6567 gene locus_tag LOCUS_24710 gene parB 7448 6567 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_24710 8298 7459 gene locus_tag LOCUS_24720 gene parA 8298 7459 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_24720 8957 8334 gene locus_tag LOCUS_24730 gene rsmG 8957 8334 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B0 protein_id gnl|my_center|LOCUS_24730 10947 9058 gene locus_tag LOCUS_24740 gene mnmG 10947 9058 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8A9 protein_id gnl|my_center|LOCUS_24740 11838 11377 gene locus_tag LOCUS_24750 gene mioC 11838 11377 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070417.1 protein_id gnl|my_center|LOCUS_24750 11987 12838 gene locus_tag LOCUS_24760 11987 12838 CDS product UPF0294 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF7 protein_id gnl|my_center|LOCUS_24760 13363 13100 gene locus_tag LOCUS_24770 13363 13100 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_24770 13753 13902 gene locus_tag LOCUS_24780 13753 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 13877 15466 gene locus_tag LOCUS_24790 13877 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103602.1 protein_id gnl|my_center|LOCUS_24790 16990 16772 gene locus_tag LOCUS_24800 16990 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 18544 17201 gene locus_tag LOCUS_24810 gene mnmE 18544 17201 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX52 protein_id gnl|my_center|LOCUS_24810 20269 18644 gene locus_tag LOCUS_24820 gene yidC 20269 18644 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT6 protein_id gnl|my_center|LOCUS_24820 20850 20494 gene locus_tag LOCUS_24830 gene rnpA 20850 20494 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT4 protein_id gnl|my_center|LOCUS_24830 21006 20869 gene locus_tag LOCUS_24840 21006 20869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 21447 22835 gene locus_tag LOCUS_24850 gene dnaA 21447 22835 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT2 protein_id gnl|my_center|LOCUS_24850 22851 23951 gene locus_tag LOCUS_24860 gene dnaN 22851 23951 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT1 protein_id gnl|my_center|LOCUS_24860 23971 25053 gene locus_tag LOCUS_24870 gene recF 23971 25053 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT0 protein_id gnl|my_center|LOCUS_24870 25145 27487 gene locus_tag LOCUS_24880 gene gyrB 25145 27487 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_24880 27617 28669 gene locus_tag LOCUS_24890 27617 28669 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070429.1 protein_id gnl|my_center|LOCUS_24890 30794 28725 gene locus_tag LOCUS_24900 gene glyS 30794 28725 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS6 protein_id gnl|my_center|LOCUS_24900 31711 30806 gene locus_tag LOCUS_24910 gene glyQ 31711 30806 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_24910 31821 32384 gene locus_tag LOCUS_24920 gene tag 31821 32384 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070432.1 protein_id gnl|my_center|LOCUS_24920 32377 32733 gene locus_tag LOCUS_24930 32377 32733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 35963 32787 gene locus_tag LOCUS_24940 35963 32787 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_24940 36534 36064 gene locus_tag LOCUS_24950 36534 36064 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_24950 36807 36562 gene locus_tag LOCUS_24960 gene tusA 36807 36562 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS1 protein_id gnl|my_center|LOCUS_24960 38306 37143 gene locus_tag LOCUS_24970 gene fadA 38306 37143 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS0 protein_id gnl|my_center|LOCUS_24970 40478 38328 gene locus_tag LOCUS_24980 gene fadB 40478 38328 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR9 protein_id gnl|my_center|LOCUS_24980 40718 42037 gene locus_tag LOCUS_24990 gene pepQ 40718 42037 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR8 protein_id gnl|my_center|LOCUS_24990 42030 42644 gene locus_tag LOCUS_25000 gene yigZ 42030 42644 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070439.1 protein_id gnl|my_center|LOCUS_25000 42697 44166 gene locus_tag LOCUS_25010 gene trkH 42697 44166 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_25010 44166 44699 gene locus_tag LOCUS_25020 gene hemG 44166 44699 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070441.1 protein_id gnl|my_center|LOCUS_25020 45001 44696 gene locus_tag LOCUS_25030 45001 44696 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070442.1 protein_id gnl|my_center|LOCUS_25030 45231 45773 gene locus_tag LOCUS_25040 gene hemG 45231 45773 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070443.1 protein_id gnl|my_center|LOCUS_25040 47261 45819 gene locus_tag LOCUS_25050 gene trkI 47261 45819 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR2 protein_id gnl|my_center|LOCUS_25050 48681 47272 gene locus_tag LOCUS_25060 gene trkA 48681 47272 CDS product potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070445.1 protein_id gnl|my_center|LOCUS_25060 49989 48691 gene locus_tag LOCUS_25070 gene rsmB 49989 48691 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR0 protein_id gnl|my_center|LOCUS_25070 50939 49986 gene locus_tag LOCUS_25080 gene fmt 50939 49986 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_25080 51476 50967 gene locus_tag LOCUS_25090 gene def1 51476 50967 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ8 protein_id gnl|my_center|LOCUS_25090 51603 52703 gene locus_tag LOCUS_25100 51603 52703 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070449.1 protein_id gnl|my_center|LOCUS_25100 53024 53803 gene locus_tag LOCUS_25110 53024 53803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 53806 54282 gene locus_tag LOCUS_25120 gene smg 53806 54282 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ5 protein_id gnl|my_center|LOCUS_25120 54744 55307 gene locus_tag LOCUS_25130 gene yrdD 54744 55307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070452.1 protein_id gnl|my_center|LOCUS_25130 55390 55953 gene locus_tag LOCUS_25140 gene tsaC 55390 55953 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ3 protein_id gnl|my_center|LOCUS_25140 55979 56893 gene locus_tag LOCUS_25150 gene hemF 55979 56893 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ2 protein_id gnl|my_center|LOCUS_25150 57358 56927 gene locus_tag LOCUS_25160 57358 56927 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 protein_id gnl|my_center|LOCUS_25160 57484 58305 gene locus_tag LOCUS_25170 gene aroE 57484 58305 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ0 protein_id gnl|my_center|LOCUS_25170 58302 58574 gene locus_tag LOCUS_25180 58302 58574 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704275.1 protein_id gnl|my_center|LOCUS_25180 59131 58580 gene locus_tag LOCUS_25190 gene yrdA 59131 58580 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence27 106 2655 gene locus_tag LOCUS_25200 gene dmsA 106 2655 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071631.1 protein_id gnl|my_center|LOCUS_25200 2671 3336 gene locus_tag LOCUS_25210 gene dmsB 2671 3336 CDS product dimethylsulfoxide reductase, chain B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071632.1 protein_id gnl|my_center|LOCUS_25210 3384 4040 gene locus_tag LOCUS_25220 gene dmsG 3384 4040 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 protein_id gnl|my_center|LOCUS_25220 4177 4974 gene locus_tag LOCUS_25230 4177 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 5386 5174 gene locus_tag LOCUS_25240 gene rpmE 5386 5174 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Z0 protein_id gnl|my_center|LOCUS_25240 6351 5512 gene locus_tag LOCUS_25250 6351 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073822.1 protein_id gnl|my_center|LOCUS_25250 6561 8756 gene locus_tag LOCUS_25260 gene priA 6561 8756 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Y8 protein_id gnl|my_center|LOCUS_25260 9488 8811 gene locus_tag LOCUS_25270 9488 8811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463688.1 protein_id gnl|my_center|LOCUS_25270 9769 11514 gene locus_tag LOCUS_25280 gene argS 9769 11514 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Y7 protein_id gnl|my_center|LOCUS_25280 11518 12087 gene locus_tag LOCUS_25290 gene ftsN 11518 12087 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073825.1 protein_id gnl|my_center|LOCUS_25290 12314 12838 gene locus_tag LOCUS_25300 gene hslV 12314 12838 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9V0 protein_id gnl|my_center|LOCUS_25300 12860 14185 gene locus_tag LOCUS_25310 gene hslU 12860 14185 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9U9 protein_id gnl|my_center|LOCUS_25310 14294 14866 gene locus_tag LOCUS_25320 14294 14866 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070825.1 protein_id gnl|my_center|LOCUS_25320 15435 15007 gene locus_tag LOCUS_25330 15435 15007 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_25330 16614 15574 gene locus_tag LOCUS_25340 16614 15574 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_25340 17625 16765 gene locus_tag LOCUS_25350 gene ubiA 17625 16765 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJJ5 protein_id gnl|my_center|LOCUS_25350 19892 17727 gene locus_tag LOCUS_25360 gene uvrD 19892 17727 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJJ6 protein_id gnl|my_center|LOCUS_25360 20373 22016 gene locus_tag LOCUS_25370 20373 22016 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705497.1 protein_id gnl|my_center|LOCUS_25370 22116 22340 gene locus_tag LOCUS_25380 22116 22340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070795.1 protein_id gnl|my_center|LOCUS_25380 23197 22394 gene locus_tag LOCUS_25390 23197 22394 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_25390 25821 23224 gene locus_tag LOCUS_25400 gene pdeB 25821 23224 CDS product cyclic di-GMP phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM6 protein_id gnl|my_center|LOCUS_25400 25997 26185 gene locus_tag LOCUS_25410 25997 26185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 27371 26307 gene locus_tag LOCUS_25420 gene hemE 27371 26307 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM8 protein_id gnl|my_center|LOCUS_25420 27874 28356 gene locus_tag LOCUS_25430 gene rsd 27874 28356 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_25430 31070 28473 gene locus_tag LOCUS_25440 gene acnB 31070 28473 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN1 protein_id gnl|my_center|LOCUS_25440 31412 32074 gene locus_tag LOCUS_25450 gene yniC 31412 32074 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 protein_id gnl|my_center|LOCUS_25450 34187 32133 gene locus_tag LOCUS_25460 gene pepO 34187 32133 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 protein_id gnl|my_center|LOCUS_25460 36588 34339 gene locus_tag LOCUS_25470 gene plpD 36588 34339 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070786.1 protein_id gnl|my_center|LOCUS_25470 41084 36654 gene locus_tag LOCUS_25480 41084 36654 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070785.1 protein_id gnl|my_center|LOCUS_25480 42686 41256 gene locus_tag LOCUS_25490 gene lpdA 42686 41256 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN7 protein_id gnl|my_center|LOCUS_25490 44820 42844 gene locus_tag LOCUS_25500 gene aceF 44820 42844 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN8 protein_id gnl|my_center|LOCUS_25500 47500 44834 gene locus_tag LOCUS_25510 gene aceE 47500 44834 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN9 protein_id gnl|my_center|LOCUS_25510 48324 47572 gene locus_tag LOCUS_25520 gene pdhR 48324 47572 CDS product transcriptional regulator PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070781.1 protein_id gnl|my_center|LOCUS_25520 49377 48526 gene locus_tag LOCUS_25530 gene ampE 49377 48526 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070780.1 protein_id gnl|my_center|LOCUS_25530 49976 49431 gene locus_tag LOCUS_25540 gene ampD 49976 49431 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070779.1 protein_id gnl|my_center|LOCUS_25540 50199 51059 gene locus_tag LOCUS_25550 gene nadC 50199 51059 CDS product nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070778.1 protein_id gnl|my_center|LOCUS_25550 51533 51375 gene locus_tag LOCUS_25560 51533 51375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 52011 52430 gene locus_tag LOCUS_25570 gene pilA 52011 52430 CDS product type IV-A pilin protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769527.1 protein_id gnl|my_center|LOCUS_25570 52434 54140 gene locus_tag LOCUS_25580 gene pilB 52434 54140 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_25580 54236 55504 gene locus_tag LOCUS_25590 gene pilC 54236 55504 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 protein_id gnl|my_center|LOCUS_25590 55585 56499 gene locus_tag LOCUS_25600 gene pilD 55585 56499 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP8 protein_id gnl|my_center|LOCUS_25600 56500 57111 gene locus_tag LOCUS_25610 gene coaE 56500 57111 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP9 protein_id gnl|my_center|LOCUS_25610 57108 57848 gene locus_tag LOCUS_25620 gene zapD 57108 57848 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ0 protein_id gnl|my_center|LOCUS_25620 57893 58105 gene locus_tag LOCUS_25630 gene yacG 57893 58105 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJQ1 protein_id gnl|my_center|LOCUS_25630 58108 58503 gene locus_tag LOCUS_25640 gene mutT 58108 58503 CDS product 7,8-dihydro-8-oxoguanine-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence28 <1 856 gene locus_tag LOCUS_25650 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073774.1:thiosulfate reductase 869 1441 gene locus_tag LOCUS_25660 gene phsB 869 1441 CDS product polysulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 protein_id gnl|my_center|LOCUS_25660 1438 2382 gene locus_tag LOCUS_25670 gene phsC 1438 2382 CDS product polysulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 protein_id gnl|my_center|LOCUS_25670 2533 3726 gene locus_tag LOCUS_25680 2533 3726 CDS product conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_25680 4477 3734 gene locus_tag LOCUS_25690 4477 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 protein_id gnl|my_center|LOCUS_25690 4867 4553 gene locus_tag LOCUS_25700 gene metJ 4867 4553 CDS product Met repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA52 protein_id gnl|my_center|LOCUS_25700 5083 6243 gene locus_tag LOCUS_25710 gene metB 5083 6243 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073769.1 protein_id gnl|my_center|LOCUS_25710 6260 8653 gene locus_tag LOCUS_25720 gene metL 6260 8653 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073768.1 protein_id gnl|my_center|LOCUS_25720 9495 10385 gene locus_tag LOCUS_25730 gene metF 9495 10385 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA55 protein_id gnl|my_center|LOCUS_25730 12379 10469 gene locus_tag LOCUS_25740 12379 10469 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 protein_id gnl|my_center|LOCUS_25740 12588 13052 gene locus_tag LOCUS_25750 gene slyA 12588 13052 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073765.1 protein_id gnl|my_center|LOCUS_25750 13066 14124 gene locus_tag LOCUS_25760 13066 14124 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073764.1 protein_id gnl|my_center|LOCUS_25760 14133 15161 gene locus_tag LOCUS_25770 14133 15161 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073763.1 protein_id gnl|my_center|LOCUS_25770 15469 16005 gene locus_tag LOCUS_25780 15469 16005 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073762.1 protein_id gnl|my_center|LOCUS_25780 16015 17067 gene locus_tag LOCUS_25790 16015 17067 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073761.1 protein_id gnl|my_center|LOCUS_25790 17681 17286 gene locus_tag LOCUS_25800 17681 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 18325 18705 gene locus_tag LOCUS_25810 18325 18705 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 protein_id gnl|my_center|LOCUS_25810 18702 18908 gene locus_tag LOCUS_25820 18702 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 20746 18944 gene locus_tag LOCUS_25830 gene deaD 20746 18944 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA75 protein_id gnl|my_center|LOCUS_25830 21995 20916 gene locus_tag LOCUS_25840 21995 20916 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073748.1 protein_id gnl|my_center|LOCUS_25840 22413 22075 gene locus_tag LOCUS_25850 22413 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073747.1 protein_id gnl|my_center|LOCUS_25850 25243 22421 gene locus_tag LOCUS_25860 gene uvrA 25243 22421 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA79 protein_id gnl|my_center|LOCUS_25860 25550 26830 gene locus_tag LOCUS_25870 25550 26830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_25870 26864 27571 gene locus_tag LOCUS_25880 gene ssb 26864 27571 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA81 protein_id gnl|my_center|LOCUS_25880 28447 28187 gene locus_tag LOCUS_25890 28447 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 28481 31495 gene locus_tag LOCUS_25900 gene fdnG 28481 31495 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070509.1 transl_except (pos:29060..29062,aa:Sec) note codon on position 194 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_25900 31498 32421 gene locus_tag LOCUS_25910 gene fdnH 31498 32421 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070510.1 protein_id gnl|my_center|LOCUS_25910 32418 33059 gene locus_tag LOCUS_25920 gene fdnI 32418 33059 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070511.1 protein_id gnl|my_center|LOCUS_25920 33060 33974 gene locus_tag LOCUS_25930 gene fdhE 33060 33974 CDS product protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59188 protein_id gnl|my_center|LOCUS_25930 34042 35463 gene locus_tag LOCUS_25940 gene selA 34042 35463 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKI8 protein_id gnl|my_center|LOCUS_25940 35460 37499 gene locus_tag LOCUS_25950 gene selB 35460 37499 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070514.1 protein_id gnl|my_center|LOCUS_25950 37459 37365 gene locus_tag LOCUS_t00340 37459 37365 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 37601 38437 gene locus_tag LOCUS_25960 gene fdhD 37601 38437 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKI6 protein_id gnl|my_center|LOCUS_25960 38590 38739 gene locus_tag LOCUS_25970 38590 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 38736 39950 gene locus_tag LOCUS_25980 gene yedE 38736 39950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070516.1 protein_id gnl|my_center|LOCUS_25980 39950 40183 gene locus_tag LOCUS_25990 gene yedF 39950 40183 CDS product SirA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070517.1 protein_id gnl|my_center|LOCUS_25990 40427 41407 gene locus_tag LOCUS_26000 40427 41407 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070965.1 protein_id gnl|my_center|LOCUS_26000 41713 42177 gene locus_tag LOCUS_26010 41713 42177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071011.1 protein_id gnl|my_center|LOCUS_26010 42550 42738 gene locus_tag LOCUS_26020 42550 42738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26020 43445 43047 gene locus_tag LOCUS_26030 43445 43047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464146.1 protein_id gnl|my_center|LOCUS_26030 44473 43442 gene locus_tag LOCUS_26040 gene galM 44473 43442 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY4 protein_id gnl|my_center|LOCUS_26040 45657 44506 gene locus_tag LOCUS_26050 gene galK 45657 44506 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY3 protein_id gnl|my_center|LOCUS_26050 47508 45889 gene locus_tag LOCUS_26060 47508 45889 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_26060 49444 47636 gene locus_tag LOCUS_26070 gene dsbD 49444 47636 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY1 protein_id gnl|my_center|LOCUS_26070 49773 49441 gene locus_tag LOCUS_26080 gene cutA 49773 49441 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_26080 49974 50603 gene locus_tag LOCUS_26090 gene fsxA 49974 50603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 protein_id gnl|my_center|LOCUS_26090 52189 50825 gene locus_tag LOCUS_26100 52189 50825 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 protein_id gnl|my_center|LOCUS_26100 52439 52729 gene locus_tag LOCUS_26110 gene groS 52439 52729 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX49 protein_id gnl|my_center|LOCUS_26110 52787 54427 gene locus_tag LOCUS_26120 gene groL 52787 54427 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX48 protein_id gnl|my_center|LOCUS_26120 54982 55239 gene locus_tag LOCUS_26130 54982 55239 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463282.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence29 25 101 gene locus_tag LOCUS_t00350 25 101 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 153 229 gene locus_tag LOCUS_t00360 153 229 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 992 483 gene locus_tag LOCUS_26140 gene crr 992 483 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072253.1 protein_id gnl|my_center|LOCUS_26140 2802 1093 gene locus_tag LOCUS_26150 gene ptsI 2802 1093 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEX4 protein_id gnl|my_center|LOCUS_26150 3065 2808 gene locus_tag LOCUS_26160 gene ptsH 3065 2808 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072255.1 protein_id gnl|my_center|LOCUS_26160 3535 3146 gene locus_tag LOCUS_26170 3535 3146 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 protein_id gnl|my_center|LOCUS_26170 5328 3694 gene locus_tag LOCUS_26180 5328 3694 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072257.1 protein_id gnl|my_center|LOCUS_26180 5643 6341 gene locus_tag LOCUS_26190 5643 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072258.1 protein_id gnl|my_center|LOCUS_26190 6975 8066 gene locus_tag LOCUS_26200 6975 8066 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_26200 8060 8977 gene locus_tag LOCUS_26210 gene psuG 8060 8977 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I109 protein_id gnl|my_center|LOCUS_26210 9199 10413 gene locus_tag LOCUS_26220 9199 10413 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072239.1 protein_id gnl|my_center|LOCUS_26220 10963 10544 gene locus_tag LOCUS_26230 10963 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_26230 11326 11604 gene locus_tag LOCUS_26240 gene ppiC-2 11326 11604 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880W6 protein_id gnl|my_center|LOCUS_26240 11785 11606 gene locus_tag LOCUS_26250 11785 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 12025 11870 gene locus_tag LOCUS_26260 12025 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 12495 12022 gene locus_tag LOCUS_26270 12495 12022 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957571.1 protein_id gnl|my_center|LOCUS_26270 12730 14223 gene locus_tag LOCUS_26280 12730 14223 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704358.1 protein_id gnl|my_center|LOCUS_26280 14299 16074 gene locus_tag LOCUS_26290 14299 16074 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477565.1 protein_id gnl|my_center|LOCUS_26290 16332 17432 gene locus_tag LOCUS_26300 16332 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073491.1 protein_id gnl|my_center|LOCUS_26300 17628 17939 gene locus_tag LOCUS_26310 17628 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 18139 19302 gene locus_tag LOCUS_26320 18139 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262207.1 protein_id gnl|my_center|LOCUS_26320 20002 19457 gene locus_tag LOCUS_26330 20002 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837148.1 protein_id gnl|my_center|LOCUS_26330 20479 20132 gene locus_tag LOCUS_26340 gene hypA 20479 20132 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF96 protein_id gnl|my_center|LOCUS_26340 21483 20479 gene locus_tag LOCUS_26350 gene hypE 21483 20479 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 protein_id gnl|my_center|LOCUS_26350 22607 21483 gene locus_tag LOCUS_26360 gene hypD 22607 21483 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF94 protein_id gnl|my_center|LOCUS_26360 22842 22594 gene locus_tag LOCUS_26370 gene hypC 22842 22594 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072156.1 protein_id gnl|my_center|LOCUS_26370 23627 22842 gene locus_tag LOCUS_26380 gene hypB 23627 22842 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 protein_id gnl|my_center|LOCUS_26380 26189 23703 gene locus_tag LOCUS_26390 26189 23703 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH1 protein_id gnl|my_center|LOCUS_26390 28072 26189 gene locus_tag LOCUS_26400 gene hyaE 28072 26189 CDS product NiFe hydrogenase assembly chaperone HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072159.1 protein_id gnl|my_center|LOCUS_26400 28658 28059 gene locus_tag LOCUS_26410 gene hyaD 28658 28059 CDS product HybD peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072160.1 protein_id gnl|my_center|LOCUS_26410 29337 28666 gene locus_tag LOCUS_26420 gene hyaC 29337 28666 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 protein_id gnl|my_center|LOCUS_26420 31053 29350 gene locus_tag LOCUS_26430 gene hyaB 31053 29350 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072162.1 protein_id gnl|my_center|LOCUS_26430 32193 31057 gene locus_tag LOCUS_26440 gene hyaA 32193 31057 CDS product quinone-reactive Ni/Fe-hydrogenase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 protein_id gnl|my_center|LOCUS_26440 32630 33289 gene locus_tag LOCUS_26450 gene qseB 32630 33289 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072168.1 protein_id gnl|my_center|LOCUS_26450 33286 34677 gene locus_tag LOCUS_26460 gene qseC 33286 34677 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072169.1 protein_id gnl|my_center|LOCUS_26460 36719 34770 gene locus_tag LOCUS_26470 36719 34770 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203640.1 protein_id gnl|my_center|LOCUS_26470 36808 36996 gene locus_tag LOCUS_26480 36808 36996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 37510 37100 gene locus_tag LOCUS_26490 37510 37100 CDS product putative nickel-responsive regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25896 protein_id gnl|my_center|LOCUS_26490 38238 39713 gene locus_tag LOCUS_26500 38238 39713 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261409.1 protein_id gnl|my_center|LOCUS_26500 39782 40765 gene locus_tag LOCUS_26510 39782 40765 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261408.1 protein_id gnl|my_center|LOCUS_26510 40765 42627 gene locus_tag LOCUS_26520 40765 42627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 42624 43331 gene locus_tag LOCUS_26530 42624 43331 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261405.1 protein_id gnl|my_center|LOCUS_26530 44805 43405 gene locus_tag LOCUS_26540 gene asnS 44805 43405 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEZ1 protein_id gnl|my_center|LOCUS_26540 44836 45099 gene locus_tag LOCUS_26550 44836 45099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 45008 45343 gene locus_tag LOCUS_26560 45008 45343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072243.1 protein_id gnl|my_center|LOCUS_26560 45932 45363 gene locus_tag LOCUS_26570 gene yeaB 45932 45363 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072244.1 protein_id gnl|my_center|LOCUS_26570 47340 46030 gene locus_tag LOCUS_26580 gene pabB 47340 46030 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072245.1 protein_id gnl|my_center|LOCUS_26580 47693 49210 gene locus_tag LOCUS_26590 gene fumB 47693 49210 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEY7 protein_id gnl|my_center|LOCUS_26590 49277 51322 gene locus_tag LOCUS_26600 49277 51322 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072247.1 protein_id gnl|my_center|LOCUS_26600 51572 53341 gene locus_tag LOCUS_26610 gene acdS 51572 53341 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072374.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence30 135 401 gene locus_tag LOCUS_26620 135 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 653 1249 gene locus_tag LOCUS_26630 653 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3536 1515 gene locus_tag LOCUS_26640 3536 1515 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 protein_id gnl|my_center|LOCUS_26640 4456 3635 gene locus_tag LOCUS_26650 gene apaH 4456 3635 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB91 protein_id gnl|my_center|LOCUS_26650 4850 4470 gene locus_tag LOCUS_26660 gene apaG 4850 4470 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB92 protein_id gnl|my_center|LOCUS_26660 5716 4910 gene locus_tag LOCUS_26670 gene rsmA 5716 4910 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB93 protein_id gnl|my_center|LOCUS_26670 6718 5732 gene locus_tag LOCUS_26680 gene pdxA 6718 5732 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB94 protein_id gnl|my_center|LOCUS_26680 8028 6724 gene locus_tag LOCUS_26690 gene surA 8028 6724 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB95 protein_id gnl|my_center|LOCUS_26690 10455 8143 gene locus_tag LOCUS_26700 gene lptD 10455 8143 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB96 protein_id gnl|my_center|LOCUS_26700 10616 11674 gene locus_tag LOCUS_26710 10616 11674 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_26710 11671 12354 gene locus_tag LOCUS_26720 11671 12354 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073437.1 protein_id gnl|my_center|LOCUS_26720 12441 13214 gene locus_tag LOCUS_26730 gene djlA 12441 13214 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_26730 13273 13887 gene locus_tag LOCUS_26740 13273 13887 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073435.1 protein_id gnl|my_center|LOCUS_26740 13910 14863 gene locus_tag LOCUS_26750 gene hprA 13910 14863 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 protein_id gnl|my_center|LOCUS_26750 15422 14865 gene locus_tag LOCUS_26760 15422 14865 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706246.1 protein_id gnl|my_center|LOCUS_26760 16609 15434 gene locus_tag LOCUS_26770 gene purT 16609 15434 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBB7 protein_id gnl|my_center|LOCUS_26770 16793 18259 gene locus_tag LOCUS_26780 16793 18259 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073422.1 protein_id gnl|my_center|LOCUS_26780 18777 18250 gene locus_tag LOCUS_26790 18777 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073415.1 protein_id gnl|my_center|LOCUS_26790 18928 19239 gene locus_tag LOCUS_26800 18928 19239 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073414.1 protein_id gnl|my_center|LOCUS_26800 20503 19226 gene locus_tag LOCUS_26810 gene rstB 20503 19226 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073413.1 protein_id gnl|my_center|LOCUS_26810 21236 20523 gene locus_tag LOCUS_26820 gene rstA 21236 20523 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 protein_id gnl|my_center|LOCUS_26820 21655 21236 gene locus_tag LOCUS_26830 21655 21236 CDS product DUF3019 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073411.1 protein_id gnl|my_center|LOCUS_26830 22416 21661 gene locus_tag LOCUS_26840 gene mipA 22416 21661 CDS product outer membrane MltA-interaction protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_26840 22734 23909 gene locus_tag LOCUS_26850 22734 23909 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_26850 23923 24456 gene locus_tag LOCUS_26860 23923 24456 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707675.1 protein_id gnl|my_center|LOCUS_26860 25551 24457 gene locus_tag LOCUS_26870 gene chaA 25551 24457 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071267.1 protein_id gnl|my_center|LOCUS_26870 25981 25721 gene locus_tag LOCUS_26880 25981 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 26790 25978 gene locus_tag LOCUS_26890 26790 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 protein_id gnl|my_center|LOCUS_26890 28325 27366 gene locus_tag LOCUS_26900 28325 27366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_26900 31540 28661 gene locus_tag LOCUS_26910 gene valS 31540 28661 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS5 protein_id gnl|my_center|LOCUS_26910 31954 31556 gene locus_tag LOCUS_26920 gene holC 31954 31556 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073281.1 protein_id gnl|my_center|LOCUS_26920 32583 33605 gene locus_tag LOCUS_26930 32583 33605 CDS product Mn2+ and Fe2+ transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477169.1 protein_id gnl|my_center|LOCUS_26930 34849 33812 gene locus_tag LOCUS_26940 34849 33812 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 protein_id gnl|my_center|LOCUS_26940 35568 34942 gene locus_tag LOCUS_26950 35568 34942 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 protein_id gnl|my_center|LOCUS_26950 37558 36050 gene locus_tag LOCUS_26960 gene pepA2 37558 36050 CDS product putative cytosol aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH62 protein_id gnl|my_center|LOCUS_26960 37797 38909 gene locus_tag LOCUS_26970 gene lptF 37797 38909 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_26970 38906 39964 gene locus_tag LOCUS_26980 gene lptG 38906 39964 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_26980 40658 40149 gene locus_tag LOCUS_26990 40658 40149 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 protein_id gnl|my_center|LOCUS_26990 40935 40684 gene locus_tag LOCUS_27000 40935 40684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071581.1 protein_id gnl|my_center|LOCUS_27000 41312 40962 gene locus_tag LOCUS_27010 41312 40962 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071582.1 protein_id gnl|my_center|LOCUS_27010 41801 41316 gene locus_tag LOCUS_27020 41801 41316 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071583.1 protein_id gnl|my_center|LOCUS_27020 43385 41868 gene locus_tag LOCUS_27030 43385 41868 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071584.1 protein_id gnl|my_center|LOCUS_27030 43753 44385 gene locus_tag LOCUS_27040 43753 44385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071585.1 protein_id gnl|my_center|LOCUS_27040 44412 46244 gene locus_tag LOCUS_27050 44412 46244 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_27050 48856 47930 gene locus_tag LOCUS_27060 gene glsA 48856 47930 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBY0 protein_id gnl|my_center|LOCUS_27060 49167 48844 gene locus_tag LOCUS_27070 gene yggL 49167 48844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073234.1 protein_id gnl|my_center|LOCUS_27070 49906 49190 gene locus_tag LOCUS_27080 gene trmB 49906 49190 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_27080 50077 51183 gene locus_tag LOCUS_27090 gene mutY 50077 51183 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_27090 51186 51464 gene locus_tag LOCUS_27100 51186 51464 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX6 protein_id gnl|my_center|LOCUS_27100 53035 51707 gene locus_tag LOCUS_27110 53035 51707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence31 836 1939 gene locus_tag LOCUS_27120 gene purC 836 1939 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA43 protein_id gnl|my_center|LOCUS_27120 2327 2034 gene locus_tag LOCUS_27130 2327 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2774 3232 gene locus_tag LOCUS_27140 2774 3232 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073476.1 protein_id gnl|my_center|LOCUS_27140 4529 3249 gene locus_tag LOCUS_27150 4529 3249 CDS product CadC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070839.1 protein_id gnl|my_center|LOCUS_27150 5519 4704 gene locus_tag LOCUS_27160 gene nosY 5519 4704 CDS product membrane protein NosY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYK9 protein_id gnl|my_center|LOCUS_27160 6460 5546 gene locus_tag LOCUS_27170 gene nosF 6460 5546 CDS product ABC copper transporter ATPase NosF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070837.1 protein_id gnl|my_center|LOCUS_27170 7751 6447 gene locus_tag LOCUS_27180 gene nosD 7751 6447 CDS product copper ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070836.1 protein_id gnl|my_center|LOCUS_27180 8257 7757 gene locus_tag LOCUS_27190 gene nosL 8257 7757 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070835.1 protein_id gnl|my_center|LOCUS_27190 8987 8334 gene locus_tag LOCUS_27200 8987 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 9793 8999 gene locus_tag LOCUS_27210 gene sirI 9793 8999 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJI4 protein_id gnl|my_center|LOCUS_27210 10239 9790 gene locus_tag LOCUS_27220 gene sirB 10239 9790 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070830.1 protein_id gnl|my_center|LOCUS_27220 12333 10294 gene locus_tag LOCUS_27230 gene sirA 12333 10294 CDS product dissimilatory sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJI6 protein_id gnl|my_center|LOCUS_27230 12716 14644 gene locus_tag LOCUS_27240 gene sirE 12716 14644 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070828.1 protein_id gnl|my_center|LOCUS_27240 14637 15035 gene locus_tag LOCUS_27250 14637 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 15101 15637 gene locus_tag LOCUS_27260 gene sirH 15101 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070826.1 protein_id gnl|my_center|LOCUS_27260 15861 15604 gene locus_tag LOCUS_27270 15861 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 16884 15901 gene locus_tag LOCUS_27280 16884 15901 CDS product RNA pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 protein_id gnl|my_center|LOCUS_27280 17511 16924 gene locus_tag LOCUS_27290 17511 16924 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073871.1 protein_id gnl|my_center|LOCUS_27290 18735 17680 gene locus_tag LOCUS_27300 18735 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_27300 19239 21632 gene locus_tag LOCUS_27310 gene bfeA 19239 21632 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_27310 21832 22296 gene locus_tag LOCUS_27320 21832 22296 CDS product DUF386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 protein_id gnl|my_center|LOCUS_27320 23057 22350 gene locus_tag LOCUS_27330 23057 22350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070520.1 protein_id gnl|my_center|LOCUS_27330 23868 23191 gene locus_tag LOCUS_27340 23868 23191 CDS product N-ribosylnicotinamide CRP regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489362.1 protein_id gnl|my_center|LOCUS_27340 24662 23931 gene locus_tag LOCUS_27350 gene nadP 24662 23931 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073958.1 protein_id gnl|my_center|LOCUS_27350 25390 24662 gene locus_tag LOCUS_27360 25390 24662 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463710.1 protein_id gnl|my_center|LOCUS_27360 27311 25530 gene locus_tag LOCUS_27370 27311 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 28417 27308 gene locus_tag LOCUS_27380 28417 27308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292758.1 protein_id gnl|my_center|LOCUS_27380 30600 28402 gene locus_tag LOCUS_27390 30600 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_27390 31652 30600 gene locus_tag LOCUS_27400 31652 30600 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_27400 35396 31719 gene locus_tag LOCUS_27410 35396 31719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 35935 36486 gene locus_tag LOCUS_27420 gene mip 35935 36486 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P219 protein_id gnl|my_center|LOCUS_27420 36572 37141 gene locus_tag LOCUS_27430 36572 37141 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003133652.1 protein_id gnl|my_center|LOCUS_27430 40531 37325 gene locus_tag LOCUS_27440 40531 37325 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_27440 41651 40542 gene locus_tag LOCUS_27450 41651 40542 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_27450 42949 41681 gene locus_tag LOCUS_27460 42949 41681 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_27460 43032 43211 gene locus_tag LOCUS_27470 43032 43211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 43641 43222 gene locus_tag LOCUS_27480 43641 43222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070859.1 protein_id gnl|my_center|LOCUS_27480 43887 43711 gene locus_tag LOCUS_27490 43887 43711 CDS product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070858.1 protein_id gnl|my_center|LOCUS_27490 44327 43962 gene locus_tag LOCUS_27500 44327 43962 CDS product DUF3478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070857.1 protein_id gnl|my_center|LOCUS_27500 44571 44987 gene locus_tag LOCUS_27510 gene yaeJ 44571 44987 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070856.1 protein_id gnl|my_center|LOCUS_27510 45147 45590 gene locus_tag LOCUS_27520 gene aroQ 45147 45590 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV60 protein_id gnl|my_center|LOCUS_27520 45632 46012 gene locus_tag LOCUS_27530 45632 46012 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 protein_id gnl|my_center|LOCUS_27530 46455 46009 gene locus_tag LOCUS_27540 46455 46009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 47130 46468 gene locus_tag LOCUS_27550 gene dmsG 47130 46468 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071633.1 protein_id gnl|my_center|LOCUS_27550 47862 47182 gene locus_tag LOCUS_27560 gene dmsB 47862 47182 CDS product dimethylsulfoxide reductase, chain B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071632.1 protein_id gnl|my_center|LOCUS_27560 50393 47877 gene locus_tag LOCUS_27570 gene dmsA 50393 47877 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071631.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence32 441 1505 gene locus_tag LOCUS_27580 441 1505 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970506.1 protein_id gnl|my_center|LOCUS_27580 1615 2490 gene locus_tag LOCUS_27590 1615 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3769 2579 gene locus_tag LOCUS_27600 3769 2579 CDS product chloramphenicol efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970086.1 protein_id gnl|my_center|LOCUS_27600 4275 3937 gene locus_tag LOCUS_27610 4275 3937 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071041.1 protein_id gnl|my_center|LOCUS_27610 5015 4440 gene locus_tag LOCUS_27620 5015 4440 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX5 protein_id gnl|my_center|LOCUS_27620 5568 5020 gene locus_tag LOCUS_27630 gene yceJ 5568 5020 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_27630 5945 6020 gene locus_tag LOCUS_t00370 5945 6020 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6028 6103 gene locus_tag LOCUS_t00380 6028 6103 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7871 6549 gene locus_tag LOCUS_27640 gene nagP 7871 6549 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_27640 9494 8349 gene locus_tag LOCUS_27650 gene nagX 9494 8349 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_27650 10731 9586 gene locus_tag LOCUS_27660 gene nagA 10731 9586 CDS product N-acetylgalactosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBK8 protein_id gnl|my_center|LOCUS_27660 11779 10781 gene locus_tag LOCUS_27670 gene nagB 11779 10781 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073345.1 protein_id gnl|my_center|LOCUS_27670 12723 11776 gene locus_tag LOCUS_27680 gene nagK 12723 11776 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 protein_id gnl|my_center|LOCUS_27680 15859 13157 gene locus_tag LOCUS_27690 gene hexB 15859 13157 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073347.1 protein_id gnl|my_center|LOCUS_27690 16484 17170 gene locus_tag LOCUS_27700 16484 17170 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073348.1 protein_id gnl|my_center|LOCUS_27700 21333 18700 gene locus_tag LOCUS_27710 21333 18700 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073350.1 protein_id gnl|my_center|LOCUS_27710 21816 22832 gene locus_tag LOCUS_27720 gene nagR 21816 22832 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 protein_id gnl|my_center|LOCUS_27720 24196 22895 gene locus_tag LOCUS_27730 gene ndh 24196 22895 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073352.1 protein_id gnl|my_center|LOCUS_27730 25683 24322 gene locus_tag LOCUS_27740 25683 24322 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071689.1 protein_id gnl|my_center|LOCUS_27740 26978 25860 gene locus_tag LOCUS_27750 26978 25860 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071685.1 protein_id gnl|my_center|LOCUS_27750 27452 27105 gene locus_tag LOCUS_27760 27452 27105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 28808 27540 gene locus_tag LOCUS_27770 28808 27540 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071684.1 protein_id gnl|my_center|LOCUS_27770 31912 28862 gene locus_tag LOCUS_27780 31912 28862 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071683.1 protein_id gnl|my_center|LOCUS_27780 32755 32243 gene locus_tag LOCUS_27790 32755 32243 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_27790 33035 34222 gene locus_tag LOCUS_27800 33035 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 34226 35680 gene locus_tag LOCUS_27810 34226 35680 CDS product sodium:solute symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_27810 35677 36507 gene locus_tag LOCUS_27820 35677 36507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 36862 38010 gene locus_tag LOCUS_27830 gene adhB 36862 38010 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071675.1 protein_id gnl|my_center|LOCUS_27830 38318 38683 gene locus_tag LOCUS_27840 38318 38683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071674.1 protein_id gnl|my_center|LOCUS_27840 39142 40443 gene locus_tag LOCUS_27850 gene ndh 39142 40443 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00393 protein_id gnl|my_center|LOCUS_27850 40544 40780 gene locus_tag LOCUS_27860 40544 40780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071752.1 protein_id gnl|my_center|LOCUS_27860 40813 41028 gene locus_tag LOCUS_27870 40813 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 41546 41025 gene locus_tag LOCUS_27880 41546 41025 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071751.1 protein_id gnl|my_center|LOCUS_27880 42179 41604 gene locus_tag LOCUS_27890 42179 41604 CDS product cyclic nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071750.1 protein_id gnl|my_center|LOCUS_27890 42869 42207 gene locus_tag LOCUS_27900 42869 42207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262054.1 protein_id gnl|my_center|LOCUS_27900 43811 43257 gene locus_tag LOCUS_27910 43811 43257 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071747.1 protein_id gnl|my_center|LOCUS_27910 44529 43957 gene locus_tag LOCUS_27920 44529 43957 CDS product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_27920 44828 45502 gene locus_tag LOCUS_27930 44828 45502 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_27930 46136 45564 gene locus_tag LOCUS_27940 46136 45564 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071743.1 protein_id gnl|my_center|LOCUS_27940 46322 46942 gene locus_tag LOCUS_27950 gene gst 46322 46942 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_27950 46959 47630 gene locus_tag LOCUS_27960 gene yfcG 46959 47630 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_27960 47767 49083 gene locus_tag LOCUS_27970 gene rsmB 47767 49083 CDS product tRNA/rRNA cytosine-C5-methylase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_27970 49247 49408 gene locus_tag LOCUS_27980 49247 49408 CDS product small highly charged protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071739.1 protein_id gnl|my_center|LOCUS_27980 50195 49986 gene locus_tag LOCUS_27990 50195 49986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence33 3 503 gene locus_tag LOCUS_28000 3 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1183 2583 gene locus_tag LOCUS_28010 1183 2583 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 protein_id gnl|my_center|LOCUS_28010 2573 3547 gene locus_tag LOCUS_28020 2573 3547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073793.1 protein_id gnl|my_center|LOCUS_28020 3550 4707 gene locus_tag LOCUS_28030 3550 4707 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073792.1 protein_id gnl|my_center|LOCUS_28030 4704 5867 gene locus_tag LOCUS_28040 4704 5867 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073791.1 protein_id gnl|my_center|LOCUS_28040 7059 5827 gene locus_tag LOCUS_28050 gene hydF 7059 5827 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073671.1 protein_id gnl|my_center|LOCUS_28050 8065 7052 gene locus_tag LOCUS_28060 gene hydE 8065 7052 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073670.1 protein_id gnl|my_center|LOCUS_28060 8673 8062 gene locus_tag LOCUS_28070 8673 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 10124 8670 gene locus_tag LOCUS_28080 gene hydG 10124 8670 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073668.1 protein_id gnl|my_center|LOCUS_28080 10857 10192 gene locus_tag LOCUS_28090 gene fdh 10857 10192 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073667.1 protein_id gnl|my_center|LOCUS_28090 11185 10868 gene locus_tag LOCUS_28100 gene hydB 11185 10868 CDS product iron hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073666.1 protein_id gnl|my_center|LOCUS_28100 12428 11196 gene locus_tag LOCUS_28110 gene hydA 12428 11196 CDS product iron hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073665.1 protein_id gnl|my_center|LOCUS_28110 13116 12712 gene locus_tag LOCUS_28120 13116 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 13782 13249 gene locus_tag LOCUS_28130 13782 13249 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA30 protein_id gnl|my_center|LOCUS_28130 13931 15274 gene locus_tag LOCUS_28140 gene tldE 13931 15274 CDS product peptidase PMbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073785.1 protein_id gnl|my_center|LOCUS_28140 15704 15357 gene locus_tag LOCUS_28150 15704 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 16583 15807 gene locus_tag LOCUS_28160 16583 15807 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073783.1 protein_id gnl|my_center|LOCUS_28160 16986 17210 gene locus_tag LOCUS_28170 gene arfA 16986 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073782.1 protein_id gnl|my_center|LOCUS_28170 18672 17248 gene locus_tag LOCUS_28180 gene rimO 18672 17248 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA37 protein_id gnl|my_center|LOCUS_28180 18908 19615 gene locus_tag LOCUS_28190 gene yggE 18908 19615 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073780.1 protein_id gnl|my_center|LOCUS_28190 20364 20152 gene locus_tag LOCUS_28200 20364 20152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 20350 21930 gene locus_tag LOCUS_28210 20350 21930 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705702.1 protein_id gnl|my_center|LOCUS_28210 23146 22016 gene locus_tag LOCUS_28220 gene yiaV 23146 22016 CDS product MFP transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 protein_id gnl|my_center|LOCUS_28220 23692 23147 gene locus_tag LOCUS_28230 23692 23147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 24327 23815 gene locus_tag LOCUS_28240 gene yncA 24327 23815 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 protein_id gnl|my_center|LOCUS_28240 25060 24440 gene locus_tag LOCUS_28250 gene ureG 25060 24440 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E731 protein_id gnl|my_center|LOCUS_28250 25812 25069 gene locus_tag LOCUS_28260 gene ureF 25812 25069 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_28260 26356 25802 gene locus_tag LOCUS_28270 26356 25802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 28095 26392 gene locus_tag LOCUS_28280 gene ureC 28095 26392 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E728 protein_id gnl|my_center|LOCUS_28280 28412 28092 gene locus_tag LOCUS_28290 gene ureB 28412 28092 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E727 protein_id gnl|my_center|LOCUS_28290 28728 28426 gene locus_tag LOCUS_28300 gene ureA 28728 28426 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E726 protein_id gnl|my_center|LOCUS_28300 29622 28744 gene locus_tag LOCUS_28310 gene ureD 29622 28744 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E725 protein_id gnl|my_center|LOCUS_28310 30707 29805 gene locus_tag LOCUS_28320 30707 29805 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263889.1 protein_id gnl|my_center|LOCUS_28320 32688 30796 gene locus_tag LOCUS_28330 32688 30796 CDS product metallophosphatase-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073865.1 protein_id gnl|my_center|LOCUS_28330 32902 34194 gene locus_tag LOCUS_28340 gene prrB 32902 34194 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 protein_id gnl|my_center|LOCUS_28340 34191 34721 gene locus_tag LOCUS_28350 gene prrA 34191 34721 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073862.1 protein_id gnl|my_center|LOCUS_28350 36887 34842 gene locus_tag LOCUS_28360 36887 34842 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190808.1 protein_id gnl|my_center|LOCUS_28360 37654 37058 gene locus_tag LOCUS_28370 gene ttrR 37654 37058 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073853.1 protein_id gnl|my_center|LOCUS_28370 37831 39687 gene locus_tag LOCUS_28380 gene ttrS 37831 39687 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073852.1 protein_id gnl|my_center|LOCUS_28380 40859 39717 gene locus_tag LOCUS_28390 40859 39717 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073847.1 protein_id gnl|my_center|LOCUS_28390 42536 41136 gene locus_tag LOCUS_28400 gene otr 42536 41136 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_28400 44276 42549 gene locus_tag LOCUS_28410 44276 42549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073840.1 protein_id gnl|my_center|LOCUS_28410 44709 44386 gene locus_tag LOCUS_28420 44709 44386 CDS product periplasmic monoheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073839.1 protein_id gnl|my_center|LOCUS_28420 >Feature sequence34 930 472 gene locus_tag LOCUS_28430 gene dut 930 472 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M0 protein_id gnl|my_center|LOCUS_28430 2123 927 gene locus_tag LOCUS_28440 gene dfp 2123 927 CDS product bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073924.1 protein_id gnl|my_center|LOCUS_28440 2252 2929 gene locus_tag LOCUS_28450 2252 2929 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M2 protein_id gnl|my_center|LOCUS_28450 3052 3288 gene locus_tag LOCUS_28460 gene rpmB 3052 3288 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M3 protein_id gnl|my_center|LOCUS_28460 3295 3468 gene locus_tag LOCUS_28470 gene rpmG 3295 3468 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9M4 protein_id gnl|my_center|LOCUS_28470 3879 5267 gene locus_tag LOCUS_28480 gene argA 3879 5267 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59292 protein_id gnl|my_center|LOCUS_28480 5383 5913 gene locus_tag LOCUS_28490 5383 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073921.1 protein_id gnl|my_center|LOCUS_28490 6852 5968 gene locus_tag LOCUS_28500 gene rarD 6852 5968 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 protein_id gnl|my_center|LOCUS_28500 7423 6959 gene locus_tag LOCUS_28510 gene yigI 7423 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_28510 7574 9415 gene locus_tag LOCUS_28520 gene recQ 7574 9415 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073918.1 protein_id gnl|my_center|LOCUS_28520 11160 9397 gene locus_tag LOCUS_28530 11160 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 11640 13208 gene locus_tag LOCUS_28540 gene leuA 11640 13208 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N2 protein_id gnl|my_center|LOCUS_28540 13205 14299 gene locus_tag LOCUS_28550 gene leuB 13205 14299 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N3 protein_id gnl|my_center|LOCUS_28550 14299 15708 gene locus_tag LOCUS_28560 gene leuC 14299 15708 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N4 protein_id gnl|my_center|LOCUS_28560 15710 16315 gene locus_tag LOCUS_28570 gene leuD 15710 16315 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N5 protein_id gnl|my_center|LOCUS_28570 16823 18169 gene locus_tag LOCUS_28580 16823 18169 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856207.1 protein_id gnl|my_center|LOCUS_28580 18351 18821 gene locus_tag LOCUS_28590 18351 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 18848 20353 gene locus_tag LOCUS_28600 gene glpK 18848 20353 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N7 protein_id gnl|my_center|LOCUS_28600 20443 21156 gene locus_tag LOCUS_28610 gene nrtR 20443 21156 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_28610 21302 22180 gene locus_tag LOCUS_28620 gene prs 21302 22180 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_28620 22193 23773 gene locus_tag LOCUS_28630 gene nadV 22193 23773 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 protein_id gnl|my_center|LOCUS_28630 24104 23805 gene locus_tag LOCUS_28640 24104 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073910.1 protein_id gnl|my_center|LOCUS_28640 24699 25157 gene locus_tag LOCUS_28650 gene mraZ 24699 25157 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N9 protein_id gnl|my_center|LOCUS_28650 25187 26128 gene locus_tag LOCUS_28660 gene rsmH 25187 26128 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P0 protein_id gnl|my_center|LOCUS_28660 26136 26450 gene locus_tag LOCUS_28670 gene ftsL 26136 26450 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P1 protein_id gnl|my_center|LOCUS_28670 26447 28183 gene locus_tag LOCUS_28680 gene ftsI 26447 28183 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_28680 28180 29649 gene locus_tag LOCUS_28690 gene murE 28180 29649 CDS product UDP-N-acetylmuramyl-tripeptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P3 protein_id gnl|my_center|LOCUS_28690 29646 31022 gene locus_tag LOCUS_28700 gene murF 29646 31022 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P4 protein_id gnl|my_center|LOCUS_28700 31023 32105 gene locus_tag LOCUS_28710 gene mraY 31023 32105 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P5 protein_id gnl|my_center|LOCUS_28710 32115 33431 gene locus_tag LOCUS_28720 gene murD 32115 33431 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P6 protein_id gnl|my_center|LOCUS_28720 33421 34638 gene locus_tag LOCUS_28730 gene ftsW 33421 34638 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P7 protein_id gnl|my_center|LOCUS_28730 34635 35738 gene locus_tag LOCUS_28740 gene murG 34635 35738 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX35 protein_id gnl|my_center|LOCUS_28740 35735 37204 gene locus_tag LOCUS_28750 gene murC 35735 37204 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P8 protein_id gnl|my_center|LOCUS_28750 37302 38066 gene locus_tag LOCUS_28760 gene ftsQ 37302 38066 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P9 protein_id gnl|my_center|LOCUS_28760 38070 39305 gene locus_tag LOCUS_28770 gene ftsA 38070 39305 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q0 protein_id gnl|my_center|LOCUS_28770 39341 40513 gene locus_tag LOCUS_28780 gene ftsZ 39341 40513 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q1 protein_id gnl|my_center|LOCUS_28780 40720 41613 gene locus_tag LOCUS_28790 gene lpxC 40720 41613 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q2 protein_id gnl|my_center|LOCUS_28790 42074 41622 gene locus_tag LOCUS_28800 42074 41622 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073894.1 protein_id gnl|my_center|LOCUS_28800 42103 43002 gene locus_tag LOCUS_28810 42103 43002 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073893.1 protein_id gnl|my_center|LOCUS_28810 43061 45784 gene locus_tag LOCUS_28820 gene secA 43061 45784 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q5 protein_id gnl|my_center|LOCUS_28820 >Feature sequence35 165 992 gene locus_tag LOCUS_28830 165 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1097 1570 gene locus_tag LOCUS_28840 1097 1570 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071096.1 protein_id gnl|my_center|LOCUS_28840 2217 1795 gene locus_tag LOCUS_28850 2217 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2552 2214 gene locus_tag LOCUS_28860 2552 2214 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704429.1 protein_id gnl|my_center|LOCUS_28860 2759 3073 gene locus_tag LOCUS_28870 2759 3073 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704428.1 protein_id gnl|my_center|LOCUS_28870 3208 6474 gene locus_tag LOCUS_28880 3208 6474 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBT8 protein_id gnl|my_center|LOCUS_28880 7023 6580 gene locus_tag LOCUS_28890 7023 6580 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073267.1 protein_id gnl|my_center|LOCUS_28890 7367 8929 gene locus_tag LOCUS_28900 7367 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 9335 9012 gene locus_tag LOCUS_28910 9335 9012 CDS product siderophore transporter component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073266.1 protein_id gnl|my_center|LOCUS_28910 10939 9332 gene locus_tag LOCUS_28920 10939 9332 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 protein_id gnl|my_center|LOCUS_28920 11246 10941 gene locus_tag LOCUS_28930 11246 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 11607 11963 gene locus_tag LOCUS_28940 gene raiA 11607 11963 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 protein_id gnl|my_center|LOCUS_28940 12760 12038 gene locus_tag LOCUS_28950 12760 12038 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_28950 13023 14597 gene locus_tag LOCUS_28960 13023 14597 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_28960 15225 14644 gene locus_tag LOCUS_28970 15225 14644 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073259.1 protein_id gnl|my_center|LOCUS_28970 15408 16451 gene locus_tag LOCUS_28980 15408 16451 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129732.1 protein_id gnl|my_center|LOCUS_28980 18511 16643 gene locus_tag LOCUS_28990 18511 16643 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233308.2 protein_id gnl|my_center|LOCUS_28990 20497 18722 gene locus_tag LOCUS_29000 gene ifcA 20497 18722 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071625.1 protein_id gnl|my_center|LOCUS_29000 20645 21580 gene locus_tag LOCUS_29010 gene ifcR 20645 21580 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071626.1 protein_id gnl|my_center|LOCUS_29010 24002 21624 gene locus_tag LOCUS_29020 24002 21624 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073257.1 protein_id gnl|my_center|LOCUS_29020 24230 25453 gene locus_tag LOCUS_29030 24230 25453 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 protein_id gnl|my_center|LOCUS_29030 25708 26469 gene locus_tag LOCUS_29040 25708 26469 CDS product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGF2 protein_id gnl|my_center|LOCUS_29040 26673 27731 gene locus_tag LOCUS_29050 26673 27731 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071806.1 protein_id gnl|my_center|LOCUS_29050 27860 28681 gene locus_tag LOCUS_29060 gene cysQ 27860 28681 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_29060 28710 29612 gene locus_tag LOCUS_29070 gene hexA 28710 29612 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071808.1 protein_id gnl|my_center|LOCUS_29070 29716 29558 gene locus_tag LOCUS_29080 29716 29558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 29818 30597 gene locus_tag LOCUS_29090 29818 30597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071809.1 protein_id gnl|my_center|LOCUS_29090 30666 31340 gene locus_tag LOCUS_29100 30666 31340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071810.1 protein_id gnl|my_center|LOCUS_29100 33711 31447 gene locus_tag LOCUS_29110 33711 31447 CDS product surface localized decaheme cytochrome c lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071811.1 protein_id gnl|my_center|LOCUS_29110 34958 33996 gene locus_tag LOCUS_29120 34958 33996 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071812.1 protein_id gnl|my_center|LOCUS_29120 35504 35100 gene locus_tag LOCUS_29130 35504 35100 CDS product DUF583 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071813.1 protein_id gnl|my_center|LOCUS_29130 36097 35618 gene locus_tag LOCUS_29140 gene napF 36097 35618 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 protein_id gnl|my_center|LOCUS_29140 37113 36100 gene locus_tag LOCUS_29150 gene galE 37113 36100 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_29150 38027 37110 gene locus_tag LOCUS_29160 gene galU 38027 37110 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD9 protein_id gnl|my_center|LOCUS_29160 38308 39099 gene locus_tag LOCUS_29170 gene phhA 38308 39099 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 protein_id gnl|my_center|LOCUS_29170 39154 39492 gene locus_tag LOCUS_29180 39154 39492 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_29180 39691 41229 gene locus_tag LOCUS_29190 gene tyrR 39691 41229 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071819.1 protein_id gnl|my_center|LOCUS_29190 41491 42480 gene locus_tag LOCUS_29200 gene fahA 41491 42480 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_29200 42637 43299 gene locus_tag LOCUS_29210 gene maiA 42637 43299 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_29210 43761 45878 gene locus_tag LOCUS_29220 43761 45878 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 protein_id gnl|my_center|LOCUS_29220 45889 46350 gene locus_tag LOCUS_29230 45889 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence36 2307 793 gene locus_tag LOCUS_29240 gene purF 2307 793 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR8 protein_id gnl|my_center|LOCUS_29240 2839 2351 gene locus_tag LOCUS_29250 gene cvpA 2839 2351 CDS product bacteriocin production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 protein_id gnl|my_center|LOCUS_29250 3540 2947 gene locus_tag LOCUS_29260 3540 2947 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262247.1 protein_id gnl|my_center|LOCUS_29260 5114 3843 gene locus_tag LOCUS_29270 gene folC 5114 3843 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072965.1 protein_id gnl|my_center|LOCUS_29270 5968 5183 gene locus_tag LOCUS_29280 gene truA 5968 5183 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSU2 protein_id gnl|my_center|LOCUS_29280 9159 6100 gene locus_tag LOCUS_29290 9159 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 10342 9326 gene locus_tag LOCUS_29300 gene asd 10342 9326 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_29300 11473 10343 gene locus_tag LOCUS_29310 gene pdxB 11473 10343 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR2 protein_id gnl|my_center|LOCUS_29310 12861 11650 gene locus_tag LOCUS_29320 gene fabB 12861 11650 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072970.1 protein_id gnl|my_center|LOCUS_29320 13003 15057 gene locus_tag LOCUS_29330 gene mnmC 13003 15057 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR0 protein_id gnl|my_center|LOCUS_29330 15412 15143 gene locus_tag LOCUS_29340 gene yfcL 15412 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072973.1 protein_id gnl|my_center|LOCUS_29340 16534 15416 gene locus_tag LOCUS_29350 16534 15416 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_29350 17773 16586 gene locus_tag LOCUS_29360 17773 16586 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 protein_id gnl|my_center|LOCUS_29360 18868 17774 gene locus_tag LOCUS_29370 gene aroC 18868 17774 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW14 protein_id gnl|my_center|LOCUS_29370 19909 18965 gene locus_tag LOCUS_29380 gene prmB 19909 18965 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECQ4 protein_id gnl|my_center|LOCUS_29380 19994 20524 gene locus_tag LOCUS_29390 19994 20524 CDS product UPF0115 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59236 protein_id gnl|my_center|LOCUS_29390 21165 20695 gene locus_tag LOCUS_29400 gene sixA 21165 20695 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072979.1 protein_id gnl|my_center|LOCUS_29400 21338 24127 gene locus_tag LOCUS_29410 21338 24127 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 protein_id gnl|my_center|LOCUS_29410 24490 24356 gene locus_tag LOCUS_29420 24490 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 26205 28646 gene locus_tag LOCUS_29430 26205 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 28766 29221 gene locus_tag LOCUS_29440 28766 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 29636 29418 gene locus_tag LOCUS_29450 29636 29418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 32252 29799 gene locus_tag LOCUS_29460 gene ybbP 32252 29799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 protein_id gnl|my_center|LOCUS_29460 33064 32252 gene locus_tag LOCUS_29470 gene ybbA 33064 32252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_29470 33003 33677 gene locus_tag LOCUS_29480 gene tesA 33003 33677 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072832.1 protein_id gnl|my_center|LOCUS_29480 34241 33741 gene locus_tag LOCUS_29490 34241 33741 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072034.1 protein_id gnl|my_center|LOCUS_29490 34450 35511 gene locus_tag LOCUS_29500 34450 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072833.1 protein_id gnl|my_center|LOCUS_29500 36327 35608 gene locus_tag LOCUS_29510 36327 35608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_29510 36566 36754 gene locus_tag LOCUS_29520 36566 36754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 37799 36777 gene locus_tag LOCUS_29530 gene sohB 37799 36777 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_29530 40372 37919 gene locus_tag LOCUS_29540 40372 37919 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_29540 40649 41386 gene locus_tag LOCUS_29550 40649 41386 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_29550 41482 42399 gene locus_tag LOCUS_29560 41482 42399 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 protein_id gnl|my_center|LOCUS_29560 43055 42531 gene locus_tag LOCUS_29570 43055 42531 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481442.1 protein_id gnl|my_center|LOCUS_29570 43150 43368 gene locus_tag LOCUS_29580 43150 43368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 44187 43564 gene locus_tag LOCUS_29590 44187 43564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 45742 44951 gene locus_tag LOCUS_29600 45742 44951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 46267 46013 gene locus_tag LOCUS_29610 46267 46013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence37 3356 225 gene locus_tag LOCUS_29620 gene vmeB 3356 225 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 protein_id gnl|my_center|LOCUS_29620 4512 3370 gene locus_tag LOCUS_29630 gene vmeA 4512 3370 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074282.1 protein_id gnl|my_center|LOCUS_29630 4998 5930 gene locus_tag LOCUS_29640 4998 5930 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070865.1 protein_id gnl|my_center|LOCUS_29640 6124 6807 gene locus_tag LOCUS_29650 gene torF 6124 6807 CDS product TMAO reductase system porin TorF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074283.1 protein_id gnl|my_center|LOCUS_29650 7408 6947 gene locus_tag LOCUS_29660 7408 6947 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074302.1 protein_id gnl|my_center|LOCUS_29660 8154 7495 gene locus_tag LOCUS_29670 8154 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 protein_id gnl|my_center|LOCUS_29670 8323 9069 gene locus_tag LOCUS_29680 8323 9069 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074300.1 protein_id gnl|my_center|LOCUS_29680 10424 9066 gene locus_tag LOCUS_29690 gene menF 10424 9066 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074299.1 protein_id gnl|my_center|LOCUS_29690 10779 12881 gene locus_tag LOCUS_29700 10779 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 12884 14233 gene locus_tag LOCUS_29710 12884 14233 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074298.1 protein_id gnl|my_center|LOCUS_29710 14223 14906 gene locus_tag LOCUS_29720 14223 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 14893 15447 gene locus_tag LOCUS_29730 14893 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 15461 16192 gene locus_tag LOCUS_29740 15461 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 16193 16408 gene locus_tag LOCUS_29750 16193 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 16856 18037 gene locus_tag LOCUS_29760 16856 18037 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074297.1 protein_id gnl|my_center|LOCUS_29760 18113 18730 gene locus_tag LOCUS_29770 18113 18730 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_29770 19026 18721 gene locus_tag LOCUS_29780 19026 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 22076 19023 gene locus_tag LOCUS_29790 22076 19023 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_29790 23100 22078 gene locus_tag LOCUS_29800 23100 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 24275 23097 gene locus_tag LOCUS_29810 24275 23097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 24426 24950 gene locus_tag LOCUS_29820 24426 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 25109 25321 gene locus_tag LOCUS_29830 25109 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 26285 25356 gene locus_tag LOCUS_29840 26285 25356 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8F7 protein_id gnl|my_center|LOCUS_29840 27061 26507 gene locus_tag LOCUS_29850 27061 26507 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074293.1 protein_id gnl|my_center|LOCUS_29850 27208 28746 gene locus_tag LOCUS_29860 27208 28746 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 protein_id gnl|my_center|LOCUS_29860 29168 28851 gene locus_tag LOCUS_29870 29168 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 31230 29320 gene locus_tag LOCUS_29880 31230 29320 CDS product energy taxis-modulating methyl-accepting chemotaxis protein with Cache_1 sensory domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 protein_id gnl|my_center|LOCUS_29880 33145 31493 gene locus_tag LOCUS_29890 gene etfQ 33145 31493 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_29890 33546 34478 gene locus_tag LOCUS_29900 gene moaA 33546 34478 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E941 protein_id gnl|my_center|LOCUS_29900 34549 35079 gene locus_tag LOCUS_29910 34549 35079 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY1 protein_id gnl|my_center|LOCUS_29910 35072 35548 gene locus_tag LOCUS_29920 gene moaC 35072 35548 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E942 protein_id gnl|my_center|LOCUS_29920 35553 35801 gene locus_tag LOCUS_29930 gene moaD 35553 35801 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E943 protein_id gnl|my_center|LOCUS_29930 35803 36261 gene locus_tag LOCUS_29940 gene moaE 35803 36261 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074081.1 protein_id gnl|my_center|LOCUS_29940 36274 37074 gene locus_tag LOCUS_29950 gene modA 36274 37074 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_29950 37075 37740 gene locus_tag LOCUS_29960 gene modB 37075 37740 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_29960 37737 38831 gene locus_tag LOCUS_29970 gene modC 37737 38831 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_29970 38954 39316 gene locus_tag LOCUS_29980 38954 39316 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707500.1 protein_id gnl|my_center|LOCUS_29980 39372 39893 gene locus_tag LOCUS_29990 39372 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074071.1 protein_id gnl|my_center|LOCUS_29990 39896 40573 gene locus_tag LOCUS_30000 39896 40573 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074070.1 protein_id gnl|my_center|LOCUS_30000 40617 41885 gene locus_tag LOCUS_30010 40617 41885 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074069.1 protein_id gnl|my_center|LOCUS_30010 41889 42569 gene locus_tag LOCUS_30020 41889 42569 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074068.1 protein_id gnl|my_center|LOCUS_30020 42685 42852 gene locus_tag LOCUS_30030 42685 42852 CDS product Pmp3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 protein_id gnl|my_center|LOCUS_30030 43588 42932 gene locus_tag LOCUS_30040 gene azoR 43588 42932 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN28 protein_id gnl|my_center|LOCUS_30040 >Feature sequence38 331 828 gene locus_tag LOCUS_30050 331 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1431 1093 gene locus_tag LOCUS_30060 gene glnB 1431 1093 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_30060 1780 2310 gene locus_tag LOCUS_30070 gene fimU 1780 2310 CDS product type IV pilus biogenesis protein FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 protein_id gnl|my_center|LOCUS_30070 2405 2911 gene locus_tag LOCUS_30080 gene fimU 2405 2911 CDS product type IV pilus biogenesis protein FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 protein_id gnl|my_center|LOCUS_30080 4455 3100 gene locus_tag LOCUS_30090 4455 3100 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071463.1 protein_id gnl|my_center|LOCUS_30090 4808 4960 gene locus_tag LOCUS_30100 gene torE 4808 4960 CDS product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071462.1 protein_id gnl|my_center|LOCUS_30100 4979 6157 gene locus_tag LOCUS_30110 gene torC 4979 6157 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHI8 protein_id gnl|my_center|LOCUS_30110 6170 8659 gene locus_tag LOCUS_30120 gene torA 6170 8659 CDS product trimethylamine-N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHI9 protein_id gnl|my_center|LOCUS_30120 8731 9360 gene locus_tag LOCUS_30130 gene torD 8731 9360 CDS product chaperone protein TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHJ0 protein_id gnl|my_center|LOCUS_30130 12438 9565 gene locus_tag LOCUS_30140 gene torS 12438 9565 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHJ1 protein_id gnl|my_center|LOCUS_30140 12565 13674 gene locus_tag LOCUS_30150 gene torT 12565 13674 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071457.1 protein_id gnl|my_center|LOCUS_30150 14374 13664 gene locus_tag LOCUS_30160 gene torR 14374 13664 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071456.1 protein_id gnl|my_center|LOCUS_30160 14523 14891 gene locus_tag LOCUS_30170 14523 14891 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHJ4 protein_id gnl|my_center|LOCUS_30170 16313 14973 gene locus_tag LOCUS_30180 gene radA 16313 14973 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHJ5 protein_id gnl|my_center|LOCUS_30180 16506 18920 gene locus_tag LOCUS_30190 16506 18920 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 protein_id gnl|my_center|LOCUS_30190 19807 18887 gene locus_tag LOCUS_30200 19807 18887 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071452.1 protein_id gnl|my_center|LOCUS_30200 20876 19899 gene locus_tag LOCUS_30210 gene serB 20876 19899 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071451.1 protein_id gnl|my_center|LOCUS_30210 20955 21968 gene locus_tag LOCUS_30220 20955 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 22775 22065 gene locus_tag LOCUS_30230 gene deoD2 22775 22065 CDS product purine nucleoside phosphorylase DeoD-type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK0 protein_id gnl|my_center|LOCUS_30230 24069 22852 gene locus_tag LOCUS_30240 gene deoB 24069 22852 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK2 protein_id gnl|my_center|LOCUS_30240 25411 24071 gene locus_tag LOCUS_30250 gene deoA 25411 24071 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK3 protein_id gnl|my_center|LOCUS_30250 26328 25555 gene locus_tag LOCUS_30260 gene deoC 26328 25555 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK4 protein_id gnl|my_center|LOCUS_30260 27628 26714 gene locus_tag LOCUS_30270 gene ompK 27628 26714 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071445.1 protein_id gnl|my_center|LOCUS_30270 29208 27925 gene locus_tag LOCUS_30280 29208 27925 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK7 protein_id gnl|my_center|LOCUS_30280 30197 29397 gene locus_tag LOCUS_30290 30197 29397 CDS product hydrolase TatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071443.1 protein_id gnl|my_center|LOCUS_30290 32005 30422 gene locus_tag LOCUS_30300 gene prfC 32005 30422 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M18 protein_id gnl|my_center|LOCUS_30300 33004 32105 gene locus_tag LOCUS_30310 gene nlpI 33004 32105 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL0 protein_id gnl|my_center|LOCUS_30310 35260 33158 gene locus_tag LOCUS_30320 gene pnp 35260 33158 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL1 protein_id gnl|my_center|LOCUS_30320 35461 37515 gene locus_tag LOCUS_30330 35461 37515 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071438.1 protein_id gnl|my_center|LOCUS_30330 37896 37627 gene locus_tag LOCUS_30340 gene rpsO 37896 37627 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL3 protein_id gnl|my_center|LOCUS_30340 38945 37998 gene locus_tag LOCUS_30350 gene truB 38945 37998 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSE0 protein_id gnl|my_center|LOCUS_30350 39358 38945 gene locus_tag LOCUS_30360 gene rbfA 39358 38945 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL4 protein_id gnl|my_center|LOCUS_30360 42079 39416 gene locus_tag LOCUS_30370 gene infB 42079 39416 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL5 protein_id gnl|my_center|LOCUS_30370 <43568 42104 gene locus_tag LOCUS_30380 <43568 42104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHL6:transcription termination/antitermination protein NusA >Feature sequence39 1867 296 gene locus_tag LOCUS_30390 1867 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 2381 2554 gene locus_tag LOCUS_30400 2381 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072074.1 protein_id gnl|my_center|LOCUS_30400 2869 3105 gene locus_tag LOCUS_30410 2869 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 4045 3107 gene locus_tag LOCUS_30420 4045 3107 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072070.1 protein_id gnl|my_center|LOCUS_30420 4382 4789 gene locus_tag LOCUS_30430 4382 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072069.1 protein_id gnl|my_center|LOCUS_30430 5631 4855 gene locus_tag LOCUS_30440 5631 4855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_30440 6664 5624 gene locus_tag LOCUS_30450 6664 5624 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_30450 7469 6705 gene locus_tag LOCUS_30460 7469 6705 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_30460 7817 8806 gene locus_tag LOCUS_30470 gene ccpA 7817 8806 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072214.1 protein_id gnl|my_center|LOCUS_30470 10590 8869 gene locus_tag LOCUS_30480 10590 8869 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072065.1 protein_id gnl|my_center|LOCUS_30480 11272 10922 gene locus_tag LOCUS_30490 11272 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072064.1 protein_id gnl|my_center|LOCUS_30490 11416 11880 gene locus_tag LOCUS_30500 11416 11880 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_30500 11877 12197 gene locus_tag LOCUS_30510 11877 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072062.1 protein_id gnl|my_center|LOCUS_30510 13194 12400 gene locus_tag LOCUS_30520 13194 12400 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_30520 14228 13314 gene locus_tag LOCUS_30530 gene hmgR 14228 13314 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_30530 14473 15633 gene locus_tag LOCUS_30540 gene hmgA 14473 15633 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072058.1 protein_id gnl|my_center|LOCUS_30540 15669 16745 gene locus_tag LOCUS_30550 gene hppD 15669 16745 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072057.1 protein_id gnl|my_center|LOCUS_30550 16895 17509 gene locus_tag LOCUS_30560 16895 17509 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 protein_id gnl|my_center|LOCUS_30560 18687 17506 gene locus_tag LOCUS_30570 18687 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072048.1 protein_id gnl|my_center|LOCUS_30570 18780 20522 gene locus_tag LOCUS_30580 gene ggtA 18780 20522 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_30580 21071 23158 gene locus_tag LOCUS_30590 21071 23158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 23527 23940 gene locus_tag LOCUS_30600 23527 23940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 24297 26348 gene locus_tag LOCUS_30610 24297 26348 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074135.1 protein_id gnl|my_center|LOCUS_30610 27019 26612 gene locus_tag LOCUS_30620 27019 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_30620 27464 27123 gene locus_tag LOCUS_30630 27464 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 28097 27474 gene locus_tag LOCUS_30640 28097 27474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 28715 28290 gene locus_tag LOCUS_30650 28715 28290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 29153 28722 gene locus_tag LOCUS_30660 29153 28722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 29756 29175 gene locus_tag LOCUS_30670 29756 29175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 29890 30081 gene locus_tag LOCUS_30680 29890 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 30939 30007 gene locus_tag LOCUS_30690 30939 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 31455 31150 gene locus_tag LOCUS_30700 31455 31150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 31793 31500 gene locus_tag LOCUS_30710 31793 31500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 32591 31923 gene locus_tag LOCUS_30720 32591 31923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 33559 32702 gene locus_tag LOCUS_30730 33559 32702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 34762 33629 gene locus_tag LOCUS_30740 34762 33629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 35218 34799 gene locus_tag LOCUS_30750 35218 34799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 35540 35259 gene locus_tag LOCUS_30760 35540 35259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 36257 38407 gene locus_tag LOCUS_30770 gene hutA 36257 38407 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 protein_id gnl|my_center|LOCUS_30770 39196 39738 gene locus_tag LOCUS_30780 39196 39738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 40274 39840 gene locus_tag LOCUS_30790 40274 39840 CDS product DUF4826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072584.1 protein_id gnl|my_center|LOCUS_30790 40562 41596 gene locus_tag LOCUS_30800 gene ldh 40562 41596 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_30800 41773 42108 gene locus_tag LOCUS_30810 41773 42108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 42559 42137 gene locus_tag LOCUS_30820 42559 42137 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072587.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence40 2289 694 gene locus_tag LOCUS_30830 2289 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073381.1 protein_id gnl|my_center|LOCUS_30830 2929 4716 gene locus_tag LOCUS_30840 2929 4716 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073382.1 protein_id gnl|my_center|LOCUS_30840 4926 6011 gene locus_tag LOCUS_30850 4926 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 6022 7413 gene locus_tag LOCUS_30860 6022 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482207.1 protein_id gnl|my_center|LOCUS_30860 7512 8678 gene locus_tag LOCUS_30870 7512 8678 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_30870 8920 9411 gene locus_tag LOCUS_30880 gene purE 8920 9411 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBG4 protein_id gnl|my_center|LOCUS_30880 9413 10492 gene locus_tag LOCUS_30890 gene purK 9413 10492 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBG3 protein_id gnl|my_center|LOCUS_30890 10558 11781 gene locus_tag LOCUS_30900 10558 11781 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073385.1 protein_id gnl|my_center|LOCUS_30900 11836 14148 gene locus_tag LOCUS_30910 11836 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071268.1 protein_id gnl|my_center|LOCUS_30910 15070 14453 gene locus_tag LOCUS_30920 gene grpE 15070 14453 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGS0 protein_id gnl|my_center|LOCUS_30920 15165 16043 gene locus_tag LOCUS_30930 gene nadK 15165 16043 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGS1 protein_id gnl|my_center|LOCUS_30930 16696 18342 gene locus_tag LOCUS_30940 16696 18342 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071701.1 protein_id gnl|my_center|LOCUS_30940 18422 21226 gene locus_tag LOCUS_30950 gene dld 18422 21226 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071700.1 protein_id gnl|my_center|LOCUS_30950 21539 22282 gene locus_tag LOCUS_30960 gene lldE 21539 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071699.1 protein_id gnl|my_center|LOCUS_30960 22293 23669 gene locus_tag LOCUS_30970 gene lldF 22293 23669 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071698.1 protein_id gnl|my_center|LOCUS_30970 23674 24243 gene locus_tag LOCUS_30980 gene lldG 23674 24243 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071697.1 protein_id gnl|my_center|LOCUS_30980 24970 24338 gene locus_tag LOCUS_30990 24970 24338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_30990 25499 25074 gene locus_tag LOCUS_31000 25499 25074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073387.1 protein_id gnl|my_center|LOCUS_31000 27088 25496 gene locus_tag LOCUS_31010 gene gshA 27088 25496 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBF9 protein_id gnl|my_center|LOCUS_31010 30217 27362 gene locus_tag LOCUS_31020 30217 27362 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_31020 30681 30256 gene locus_tag LOCUS_31030 30681 30256 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073390.1 protein_id gnl|my_center|LOCUS_31030 30973 31140 gene locus_tag LOCUS_31040 30973 31140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 32456 31323 gene locus_tag LOCUS_31050 32456 31323 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_31050 34259 32466 gene locus_tag LOCUS_31060 34259 32466 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_31060 34555 34286 gene locus_tag LOCUS_31070 34555 34286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 36670 35087 gene locus_tag LOCUS_31080 gene tilS 36670 35087 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGF9 protein_id gnl|my_center|LOCUS_31080 40143 36670 gene locus_tag LOCUS_31090 gene dnaE 40143 36670 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG0 protein_id gnl|my_center|LOCUS_31090 >Feature sequence41 56 1792 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtttatccccgtgggtgcggggaactc 2181 1891 gene locus_tag LOCUS_31100 2181 1891 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_31100 3101 2184 gene locus_tag LOCUS_31110 gene ygbT 3101 2184 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46896 protein_id gnl|my_center|LOCUS_31110 4016 3135 gene locus_tag LOCUS_31120 4016 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 4747 4016 gene locus_tag LOCUS_31130 4747 4016 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_31130 5837 4758 gene locus_tag LOCUS_31140 5837 4758 CDS product Cse4 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_457330.1 protein_id gnl|my_center|LOCUS_31140 6400 5873 gene locus_tag LOCUS_31150 6400 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 7986 6400 gene locus_tag LOCUS_31160 7986 6400 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602845.1 protein_id gnl|my_center|LOCUS_31160 10682 7983 gene locus_tag LOCUS_31170 10682 7983 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233965.1 protein_id gnl|my_center|LOCUS_31170 11652 10798 gene locus_tag LOCUS_31180 11652 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 14699 11850 gene locus_tag LOCUS_31190 14699 11850 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815400.1 protein_id gnl|my_center|LOCUS_31190 16473 14701 gene locus_tag LOCUS_31200 16473 14701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815399.1 protein_id gnl|my_center|LOCUS_31200 18994 16532 gene locus_tag LOCUS_31210 18994 16532 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815398.1 protein_id gnl|my_center|LOCUS_31210 19228 19941 gene locus_tag LOCUS_31220 19228 19941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 19938 21266 gene locus_tag LOCUS_31230 19938 21266 CDS product biopolymer transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_31230 21263 21757 gene locus_tag LOCUS_31240 21263 21757 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_31240 21761 22168 gene locus_tag LOCUS_31250 21761 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 22137 22796 gene locus_tag LOCUS_31260 22137 22796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 22780 23976 gene locus_tag LOCUS_31270 22780 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 24104 24805 gene locus_tag LOCUS_31280 gene dnrN 24104 24805 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_31280 24870 25385 gene locus_tag LOCUS_31290 24870 25385 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073962.1 protein_id gnl|my_center|LOCUS_31290 25939 25355 gene locus_tag LOCUS_31300 gene hupE 25939 25355 CDS product urease accessory protein UreJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 protein_id gnl|my_center|LOCUS_31300 26529 26059 gene locus_tag LOCUS_31310 26529 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 27325 26609 gene locus_tag LOCUS_31320 27325 26609 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 protein_id gnl|my_center|LOCUS_31320 28221 27325 gene locus_tag LOCUS_31330 gene xerC 28221 27325 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ5 protein_id gnl|my_center|LOCUS_31330 28856 28221 gene locus_tag LOCUS_31340 28856 28221 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073966.1 protein_id gnl|my_center|LOCUS_31340 29680 28853 gene locus_tag LOCUS_31350 gene dapF 29680 28853 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H5 protein_id gnl|my_center|LOCUS_31350 30974 29730 gene locus_tag LOCUS_31360 gene lysA 30974 29730 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 protein_id gnl|my_center|LOCUS_31360 31136 30975 gene locus_tag LOCUS_31370 31136 30975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 31205 31534 gene locus_tag LOCUS_31380 gene cyaY 31205 31534 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H2 protein_id gnl|my_center|LOCUS_31380 33975 31549 gene locus_tag LOCUS_31390 gene cyaA 33975 31549 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073971.1 protein_id gnl|my_center|LOCUS_31390 34175 35104 gene locus_tag LOCUS_31400 gene hemC 34175 35104 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H0 protein_id gnl|my_center|LOCUS_31400 35117 35845 gene locus_tag LOCUS_31410 gene hemD 35117 35845 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 protein_id gnl|my_center|LOCUS_31410 35897 37006 gene locus_tag LOCUS_31420 35897 37006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 37003 38172 gene locus_tag LOCUS_31430 gene hemY 37003 38172 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073975.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence42 1164 187 gene locus_tag LOCUS_31440 1164 187 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071196.1 protein_id gnl|my_center|LOCUS_31440 1940 1404 gene locus_tag LOCUS_31450 1940 1404 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIC6 protein_id gnl|my_center|LOCUS_31450 2174 4735 gene locus_tag LOCUS_31460 gene aaiD 2174 4735 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_31460 5152 6465 gene locus_tag LOCUS_31470 gene sdaC 5152 6465 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071199.1 protein_id gnl|my_center|LOCUS_31470 6481 7845 gene locus_tag LOCUS_31480 gene sdaA-1 6481 7845 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705996.1 protein_id gnl|my_center|LOCUS_31480 8297 7848 gene locus_tag LOCUS_31490 8297 7848 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_31490 8614 9888 gene locus_tag LOCUS_31500 8614 9888 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_31500 11099 9948 gene locus_tag LOCUS_31510 gene metK 11099 9948 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB4 protein_id gnl|my_center|LOCUS_31510 11545 13539 gene locus_tag LOCUS_31520 gene tkt1 11545 13539 CDS product transketolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK8 protein_id gnl|my_center|LOCUS_31520 13671 14687 gene locus_tag LOCUS_31530 gene epd 13671 14687 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB2 protein_id gnl|my_center|LOCUS_31530 14775 15950 gene locus_tag LOCUS_31540 gene pgk 14775 15950 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_31540 16064 17131 gene locus_tag LOCUS_31550 gene fba 16064 17131 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071213.1 protein_id gnl|my_center|LOCUS_31550 18710 17295 gene locus_tag LOCUS_31560 gene ydcR 18710 17295 CDS product putative HTH-type transcriptional regulator YdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77730 protein_id gnl|my_center|LOCUS_31560 18852 20249 gene locus_tag LOCUS_31570 18852 20249 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705562.1 protein_id gnl|my_center|LOCUS_31570 20252 21259 gene locus_tag LOCUS_31580 20252 21259 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477299.1 protein_id gnl|my_center|LOCUS_31580 21578 22315 gene locus_tag LOCUS_31590 21578 22315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_31590 22585 23991 gene locus_tag LOCUS_31600 gene nhaD 22585 23991 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_31600 24148 24939 gene locus_tag LOCUS_31610 24148 24939 CDS product CadC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071220.1 protein_id gnl|my_center|LOCUS_31610 24932 25540 gene locus_tag LOCUS_31620 24932 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 26082 25537 gene locus_tag LOCUS_31630 26082 25537 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071218.1 protein_id gnl|my_center|LOCUS_31630 26914 26093 gene locus_tag LOCUS_31640 26914 26093 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071219.1 protein_id gnl|my_center|LOCUS_31640 27345 28094 gene locus_tag LOCUS_31650 27345 28094 CDS product CadC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071220.1 protein_id gnl|my_center|LOCUS_31650 28087 28596 gene locus_tag LOCUS_31660 28087 28596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071221.1 protein_id gnl|my_center|LOCUS_31660 28723 30342 gene locus_tag LOCUS_31670 28723 30342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071222.1 protein_id gnl|my_center|LOCUS_31670 31116 30403 gene locus_tag LOCUS_31680 31116 30403 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PTX7 protein_id gnl|my_center|LOCUS_31680 31850 31176 gene locus_tag LOCUS_31690 31850 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 33291 31954 gene locus_tag LOCUS_31700 gene metT 33291 31954 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071333.1 protein_id gnl|my_center|LOCUS_31700 34251 33523 gene locus_tag LOCUS_31710 34251 33523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 34531 35205 gene locus_tag LOCUS_31720 gene yfeN 34531 35205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261438.1 protein_id gnl|my_center|LOCUS_31720 35248 36981 gene locus_tag LOCUS_31730 gene assT 35248 36981 CDS product arylsulfate sulfotransferase AssT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3N6 protein_id gnl|my_center|LOCUS_31730 37030 37644 gene locus_tag LOCUS_31740 37030 37644 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAM7 protein_id gnl|my_center|LOCUS_31740 37655 38269 gene locus_tag LOCUS_31750 gene dsbI 37655 38269 CDS product putative protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAM8 protein_id gnl|my_center|LOCUS_31750 38402 39691 gene locus_tag LOCUS_31760 gene metY 38402 39691 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence43 9 84 gene locus_tag LOCUS_t00390 9 84 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 105 178 gene locus_tag LOCUS_t00400 105 178 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 222 308 gene locus_tag LOCUS_t00410 222 308 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 470 1339 gene locus_tag LOCUS_31770 470 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_31770 1433 2122 gene locus_tag LOCUS_31780 1433 2122 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_31780 2539 4419 gene locus_tag LOCUS_31790 2539 4419 CDS product alkaline serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473082.1 protein_id gnl|my_center|LOCUS_31790 5666 4542 gene locus_tag LOCUS_31800 5666 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 6150 6422 gene locus_tag LOCUS_31810 6150 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261432.1 protein_id gnl|my_center|LOCUS_31810 6770 8017 gene locus_tag LOCUS_31820 6770 8017 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707646.1 protein_id gnl|my_center|LOCUS_31820 9516 8056 gene locus_tag LOCUS_31830 gene dgt 9516 8056 CDS product putative deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4L1 protein_id gnl|my_center|LOCUS_31830 9704 10162 gene locus_tag LOCUS_31840 9704 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 10437 10859 gene locus_tag LOCUS_31850 10437 10859 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707321.1 protein_id gnl|my_center|LOCUS_31850 11140 12927 gene locus_tag LOCUS_31860 11140 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072522.1 protein_id gnl|my_center|LOCUS_31860 13182 13844 gene locus_tag LOCUS_31870 13182 13844 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072402.1 protein_id gnl|my_center|LOCUS_31870 13991 15118 gene locus_tag LOCUS_31880 13991 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_31880 15128 15445 gene locus_tag LOCUS_31890 15128 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072400.1 protein_id gnl|my_center|LOCUS_31890 15442 15723 gene locus_tag LOCUS_31900 15442 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072399.1 protein_id gnl|my_center|LOCUS_31900 16805 15789 gene locus_tag LOCUS_31910 gene ansA 16805 15789 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_31910 18771 16918 gene locus_tag LOCUS_31920 gene sppA 18771 16918 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG2 protein_id gnl|my_center|LOCUS_31920 18969 20990 gene locus_tag LOCUS_31930 gene fadH 18969 20990 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 protein_id gnl|my_center|LOCUS_31930 21098 21589 gene locus_tag LOCUS_31940 21098 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 22599 21631 gene locus_tag LOCUS_31950 22599 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 23816 22596 gene locus_tag LOCUS_31960 23816 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 24225 23806 gene locus_tag LOCUS_31970 24225 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 25084 24227 gene locus_tag LOCUS_31980 25084 24227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 26370 25129 gene locus_tag LOCUS_31990 26370 25129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 26787 26473 gene locus_tag LOCUS_32000 26787 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 27907 26777 gene locus_tag LOCUS_32010 gene nrdB 27907 26777 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072393.1 protein_id gnl|my_center|LOCUS_32010 30243 27967 gene locus_tag LOCUS_32020 gene nrdA 30243 27967 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG7 protein_id gnl|my_center|LOCUS_32020 31397 30729 gene locus_tag LOCUS_32030 31397 30729 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072391.1 protein_id gnl|my_center|LOCUS_32030 32112 31402 gene locus_tag LOCUS_32040 gene ubiG 32112 31402 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG9 protein_id gnl|my_center|LOCUS_32040 32470 35100 gene locus_tag LOCUS_32050 gene gyrA 32470 35100 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence44 <1 1561 gene locus_tag LOCUS_32060 <1 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112650.1:aerotaxis transducer Aer2 1572 2444 gene locus_tag LOCUS_32070 gene cheR1 1572 2444 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3N9 protein_id gnl|my_center|LOCUS_32070 2447 3466 gene locus_tag LOCUS_32080 gene cheB1 2447 3466 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_32080 4466 3456 gene locus_tag LOCUS_32090 4466 3456 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_32090 4531 5871 gene locus_tag LOCUS_32100 gene dinF 4531 5871 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 protein_id gnl|my_center|LOCUS_32100 6517 5939 gene locus_tag LOCUS_32110 gene nfuA 6517 5939 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P2 protein_id gnl|my_center|LOCUS_32110 7108 6680 gene locus_tag LOCUS_32120 7108 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 7476 8255 gene locus_tag LOCUS_32130 gene bioH 7476 8255 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8N6 protein_id gnl|my_center|LOCUS_32130 8294 8797 gene locus_tag LOCUS_32140 8294 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074223.1 protein_id gnl|my_center|LOCUS_32140 10749 8749 gene locus_tag LOCUS_32150 10749 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_32150 13427 11085 gene locus_tag LOCUS_32160 gene tex 13427 11085 CDS product transcription accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 protein_id gnl|my_center|LOCUS_32160 13727 15877 gene locus_tag LOCUS_32170 13727 15877 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_32170 16740 16177 gene locus_tag LOCUS_32180 gene cymA 16740 16177 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S0 protein_id gnl|my_center|LOCUS_32180 17132 17491 gene locus_tag LOCUS_32190 17132 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 17561 18016 gene locus_tag LOCUS_32200 17561 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 18182 18604 gene locus_tag LOCUS_32210 18182 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_720472.1 protein_id gnl|my_center|LOCUS_32210 18721 19041 gene locus_tag LOCUS_32220 18721 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074443.1 protein_id gnl|my_center|LOCUS_32220 19149 20714 gene locus_tag LOCUS_32230 gene cusB 19149 20714 CDS product copper/silver efflux pump MFP component CusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074194.1 protein_id gnl|my_center|LOCUS_32230 20723 23866 gene locus_tag LOCUS_32240 20723 23866 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074441.1 protein_id gnl|my_center|LOCUS_32240 25124 23934 gene locus_tag LOCUS_32250 25124 23934 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704093.1 protein_id gnl|my_center|LOCUS_32250 26219 25203 gene locus_tag LOCUS_32260 gene gpsA 26219 25203 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKN9 protein_id gnl|my_center|LOCUS_32260 26712 26227 gene locus_tag LOCUS_32270 gene secB 26712 26227 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKP0 protein_id gnl|my_center|LOCUS_32270 27352 26918 gene locus_tag LOCUS_32280 27352 26918 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_32280 27548 29122 gene locus_tag LOCUS_32290 gene gpmI 27548 29122 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59175 protein_id gnl|my_center|LOCUS_32290 29133 30269 gene locus_tag LOCUS_32300 29133 30269 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_32300 30302 31507 gene locus_tag LOCUS_32310 30302 31507 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070462.1 protein_id gnl|my_center|LOCUS_32310 31523 32272 gene locus_tag LOCUS_32320 gene yibQ 31523 32272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_32320 32683 32273 gene locus_tag LOCUS_32330 gene nsrR 32683 32273 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070460.1 protein_id gnl|my_center|LOCUS_32330 32890 32735 gene locus_tag LOCUS_32340 32890 32735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 33308 33232 gene locus_tag LOCUS_t00420 33308 33232 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 1036 194 gene locus_tag LOCUS_32350 gene truC 1036 194 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071776.1 protein_id gnl|my_center|LOCUS_32350 1331 1008 gene locus_tag LOCUS_32360 gene yqcC 1331 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 protein_id gnl|my_center|LOCUS_32360 1436 2449 gene locus_tag LOCUS_32370 1436 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071774.1 protein_id gnl|my_center|LOCUS_32370 2446 2835 gene locus_tag LOCUS_32380 2446 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071773.1 protein_id gnl|my_center|LOCUS_32380 4045 3830 gene locus_tag LOCUS_32390 4045 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 4307 4020 gene locus_tag LOCUS_32400 4307 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 4810 4505 gene locus_tag LOCUS_32410 4810 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_32410 5473 4823 gene locus_tag LOCUS_32420 5473 4823 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 protein_id gnl|my_center|LOCUS_32420 5738 5968 gene locus_tag LOCUS_32430 5738 5968 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071770.1 protein_id gnl|my_center|LOCUS_32430 6356 5991 gene locus_tag LOCUS_32440 6356 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 protein_id gnl|my_center|LOCUS_32440 6523 6861 gene locus_tag LOCUS_32450 6523 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071768.1 protein_id gnl|my_center|LOCUS_32450 6861 7634 gene locus_tag LOCUS_32460 6861 7634 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071767.1 protein_id gnl|my_center|LOCUS_32460 8334 7693 gene locus_tag LOCUS_32470 gene syd 8334 7693 CDS product protein Syd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGJ3 protein_id gnl|my_center|LOCUS_32470 8361 9251 gene locus_tag LOCUS_32480 gene queF 8361 9251 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGJ4 protein_id gnl|my_center|LOCUS_32480 10159 9335 gene locus_tag LOCUS_32490 gene mscS 10159 9335 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_32490 10765 10190 gene locus_tag LOCUS_32500 10765 10190 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073209.1 protein_id gnl|my_center|LOCUS_32500 11390 10959 gene locus_tag LOCUS_32510 11390 10959 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462438.1 protein_id gnl|my_center|LOCUS_32510 11476 12375 gene locus_tag LOCUS_32520 11476 12375 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462429.1 protein_id gnl|my_center|LOCUS_32520 12996 12439 gene locus_tag LOCUS_32530 12996 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_32530 13175 13489 gene locus_tag LOCUS_32540 13175 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 13670 13999 gene locus_tag LOCUS_32550 gene yciH 13670 13999 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073215.1 protein_id gnl|my_center|LOCUS_32550 14027 14587 gene locus_tag LOCUS_32560 14027 14587 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ9 protein_id gnl|my_center|LOCUS_32560 14601 15020 gene locus_tag LOCUS_32570 14601 15020 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ8 protein_id gnl|my_center|LOCUS_32570 16267 15137 gene locus_tag LOCUS_32580 gene kynU 16267 15137 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 protein_id gnl|my_center|LOCUS_32580 17012 16278 gene locus_tag LOCUS_32590 gene kynA 17012 16278 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA8 protein_id gnl|my_center|LOCUS_32590 18203 17184 gene locus_tag LOCUS_32600 gene hemH2 18203 17184 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_32600 18828 18232 gene locus_tag LOCUS_32610 18828 18232 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_32610 19995 18886 gene locus_tag LOCUS_32620 19995 18886 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_32620 21264 20152 gene locus_tag LOCUS_32630 gene pilU 21264 20152 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 protein_id gnl|my_center|LOCUS_32630 22311 21274 gene locus_tag LOCUS_32640 gene pilT 22311 21274 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_32640 22348 23043 gene locus_tag LOCUS_32650 gene yggS 22348 23043 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 protein_id gnl|my_center|LOCUS_32650 23176 23994 gene locus_tag LOCUS_32660 gene proC 23176 23994 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ1 protein_id gnl|my_center|LOCUS_32660 24018 24569 gene locus_tag LOCUS_32670 gene yggT 24018 24569 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_32670 24569 24856 gene locus_tag LOCUS_32680 24569 24856 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBY9 protein_id gnl|my_center|LOCUS_32680 24919 25353 gene locus_tag LOCUS_32690 24919 25353 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073226.1 protein_id gnl|my_center|LOCUS_32690 25613 26215 gene locus_tag LOCUS_32700 25613 26215 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBY7 protein_id gnl|my_center|LOCUS_32700 26215 27351 gene locus_tag LOCUS_32710 gene yggW 26215 27351 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073228.1 protein_id gnl|my_center|LOCUS_32710 27835 29694 gene locus_tag LOCUS_32720 27835 29694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_32720 31084 30137 gene locus_tag LOCUS_32730 31084 30137 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073231.1 protein_id gnl|my_center|LOCUS_32730 32203 31400 gene locus_tag LOCUS_32740 32203 31400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073232.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence46 2966 798 gene locus_tag LOCUS_32750 gene putA 2966 798 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072936.1 protein_id gnl|my_center|LOCUS_32750 4882 2990 gene locus_tag LOCUS_32760 gene pubC 4882 2990 CDS product NTP-dependent putrebactin synthetase PubC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072935.1 protein_id gnl|my_center|LOCUS_32760 5496 4879 gene locus_tag LOCUS_32770 gene pubB 5496 4879 CDS product N-hydroxyputrescine-succinyl CoA transferase PubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072934.1 protein_id gnl|my_center|LOCUS_32770 6842 5496 gene locus_tag LOCUS_32780 gene pubA 6842 5496 CDS product putrescine monooxygenase PubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072933.1 protein_id gnl|my_center|LOCUS_32780 8421 6853 gene locus_tag LOCUS_32790 8421 6853 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211877.1 protein_id gnl|my_center|LOCUS_32790 8943 9710 gene locus_tag LOCUS_32800 8943 9710 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 protein_id gnl|my_center|LOCUS_32800 9707 10651 gene locus_tag LOCUS_32810 9707 10651 CDS product ABC drugE1 family efflux system MFP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071849.1 protein_id gnl|my_center|LOCUS_32810 10648 11643 gene locus_tag LOCUS_32820 10648 11643 CDS product ABC drugE1 family efflux system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_32820 11657 12763 gene locus_tag LOCUS_32830 11657 12763 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071851.1 protein_id gnl|my_center|LOCUS_32830 13340 12774 gene locus_tag LOCUS_32840 13340 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 14473 13622 gene locus_tag LOCUS_32850 gene sseA 14473 13622 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261980.1 protein_id gnl|my_center|LOCUS_32850 15080 14622 gene locus_tag LOCUS_32860 15080 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 15863 15084 gene locus_tag LOCUS_32870 15863 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 16208 15990 gene locus_tag LOCUS_32880 16208 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704507.1 protein_id gnl|my_center|LOCUS_32880 16603 16241 gene locus_tag LOCUS_32890 16603 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468055.1 protein_id gnl|my_center|LOCUS_32890 17112 16693 gene locus_tag LOCUS_32900 17112 16693 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181693.1 protein_id gnl|my_center|LOCUS_32900 18270 17467 gene locus_tag LOCUS_32910 gene trpA 18270 17467 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECU9 protein_id gnl|my_center|LOCUS_32910 19496 18267 gene locus_tag LOCUS_32920 gene trpB 19496 18267 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV0 protein_id gnl|my_center|LOCUS_32920 20943 19555 gene locus_tag LOCUS_32930 gene trpCF 20943 19555 CDS product bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072927.1 protein_id gnl|my_center|LOCUS_32930 22016 20940 gene locus_tag LOCUS_32940 gene trpD 22016 20940 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV2 protein_id gnl|my_center|LOCUS_32940 22611 22009 gene locus_tag LOCUS_32950 gene trpG 22611 22009 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072925.1 protein_id gnl|my_center|LOCUS_32950 24167 22608 gene locus_tag LOCUS_32960 gene trpE 24167 22608 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV4 protein_id gnl|my_center|LOCUS_32960 24541 25383 gene locus_tag LOCUS_32970 gene trpH 24541 25383 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072922.1 protein_id gnl|my_center|LOCUS_32970 25380 26000 gene locus_tag LOCUS_32980 gene yciO 25380 26000 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072921.1 protein_id gnl|my_center|LOCUS_32980 26078 26869 gene locus_tag LOCUS_32990 gene scpA 26078 26869 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV8 protein_id gnl|my_center|LOCUS_32990 26881 27471 gene locus_tag LOCUS_33000 gene scpB 26881 27471 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ6 protein_id gnl|my_center|LOCUS_33000 27472 28344 gene locus_tag LOCUS_33010 gene rluB 27472 28344 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PST1 protein_id gnl|my_center|LOCUS_33010 28639 29604 gene locus_tag LOCUS_33020 28639 29604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072840.1 protein_id gnl|my_center|LOCUS_33020 30073 30705 gene locus_tag LOCUS_33030 30073 30705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 30983 31441 gene locus_tag LOCUS_33040 30983 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 31545 31934 gene locus_tag LOCUS_33050 31545 31934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33050 >Feature sequence47 1784 168 gene locus_tag LOCUS_33060 gene fadD 1784 168 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 protein_id gnl|my_center|LOCUS_33060 3549 2143 gene locus_tag LOCUS_33070 3549 2143 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 protein_id gnl|my_center|LOCUS_33070 5155 3743 gene locus_tag LOCUS_33080 5155 3743 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073458.1 protein_id gnl|my_center|LOCUS_33080 5782 5240 gene locus_tag LOCUS_33090 5782 5240 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073457.1 protein_id gnl|my_center|LOCUS_33090 5810 5986 gene locus_tag LOCUS_33100 5810 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 5991 6590 gene locus_tag LOCUS_33110 5991 6590 CDS product amino acid efflux permease RhtB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 protein_id gnl|my_center|LOCUS_33110 7308 6982 gene locus_tag LOCUS_33120 7308 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073455.1 protein_id gnl|my_center|LOCUS_33120 7641 8309 gene locus_tag LOCUS_33130 gene ung 7641 8309 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB78 protein_id gnl|my_center|LOCUS_33130 10378 8423 gene locus_tag LOCUS_33140 10378 8423 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074095.1 protein_id gnl|my_center|LOCUS_33140 10698 11723 gene locus_tag LOCUS_33150 10698 11723 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123164.1 protein_id gnl|my_center|LOCUS_33150 11720 12727 gene locus_tag LOCUS_33160 11720 12727 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223651.1 protein_id gnl|my_center|LOCUS_33160 12724 13464 gene locus_tag LOCUS_33170 12724 13464 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173318.1 protein_id gnl|my_center|LOCUS_33170 13505 14314 gene locus_tag LOCUS_33180 13505 14314 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 protein_id gnl|my_center|LOCUS_33180 14422 16419 gene locus_tag LOCUS_33190 14422 16419 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640133.1 protein_id gnl|my_center|LOCUS_33190 17067 16507 gene locus_tag LOCUS_33200 17067 16507 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_33200 17524 17057 gene locus_tag LOCUS_33210 17524 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 17803 18510 gene locus_tag LOCUS_33220 gene folM 17803 18510 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071075.1 protein_id gnl|my_center|LOCUS_33220 19399 18512 gene locus_tag LOCUS_33230 19399 18512 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 protein_id gnl|my_center|LOCUS_33230 20504 19530 gene locus_tag LOCUS_33240 20504 19530 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073630.1 protein_id gnl|my_center|LOCUS_33240 21418 20657 gene locus_tag LOCUS_33250 21418 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073629.1 protein_id gnl|my_center|LOCUS_33250 23239 21461 gene locus_tag LOCUS_33260 gene assT 23239 21461 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073628.1 protein_id gnl|my_center|LOCUS_33260 23629 24192 gene locus_tag LOCUS_33270 23629 24192 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAM7 protein_id gnl|my_center|LOCUS_33270 24198 24806 gene locus_tag LOCUS_33280 gene dsbI 24198 24806 CDS product putative protein-disulfide oxidoreductase DsbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAM8 protein_id gnl|my_center|LOCUS_33280 25292 24873 gene locus_tag LOCUS_33290 25292 24873 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_33290 25937 25335 gene locus_tag LOCUS_33300 gene azr 25937 25335 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073405.1 protein_id gnl|my_center|LOCUS_33300 26077 26715 gene locus_tag LOCUS_33310 gene azrR 26077 26715 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073404.1 protein_id gnl|my_center|LOCUS_33310 26705 27418 gene locus_tag LOCUS_33320 26705 27418 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_33320 28516 27434 gene locus_tag LOCUS_33330 28516 27434 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 protein_id gnl|my_center|LOCUS_33330 30198 28663 gene locus_tag LOCUS_33340 30198 28663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_33340 30535 30792 gene locus_tag LOCUS_33350 30535 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 31014 30826 gene locus_tag LOCUS_33360 31014 30826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 31305 31054 gene locus_tag LOCUS_33370 31305 31054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 31761 31447 gene locus_tag LOCUS_33380 31761 31447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence48 29 104 gene locus_tag LOCUS_t00430 29 104 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 142 217 gene locus_tag LOCUS_t00440 142 217 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 253 328 gene locus_tag LOCUS_t00450 253 328 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 706 1218 gene locus_tag LOCUS_33390 gene rfbC 706 1218 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056309.1 protein_id gnl|my_center|LOCUS_33390 1611 3854 gene locus_tag LOCUS_33400 gene katG2 1611 3854 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_33400 4189 4488 gene locus_tag LOCUS_33410 4189 4488 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071089.1 protein_id gnl|my_center|LOCUS_33410 4713 4516 gene locus_tag LOCUS_33420 4713 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 5195 8716 gene locus_tag LOCUS_33430 gene hsdR 5195 8716 CDS product type I restriction-modification system deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073938.1 protein_id gnl|my_center|LOCUS_33430 8713 9579 gene locus_tag LOCUS_33440 8713 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 9527 12649 gene locus_tag LOCUS_33450 9527 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 13637 12540 gene locus_tag LOCUS_33460 13637 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 13798 15372 gene locus_tag LOCUS_33470 gene hsdM 13798 15372 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073936.1 protein_id gnl|my_center|LOCUS_33470 15369 16853 gene locus_tag LOCUS_33480 gene hsdS 15369 16853 CDS product type I restriction-modification system restriction endonuclease DNA specificity subunit HsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 protein_id gnl|my_center|LOCUS_33480 16892 20566 gene locus_tag LOCUS_33490 16892 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204821.1 protein_id gnl|my_center|LOCUS_33490 20712 21665 gene locus_tag LOCUS_33500 20712 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 22864 22190 gene locus_tag LOCUS_33510 22864 22190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 23918 24448 gene locus_tag LOCUS_33520 23918 24448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 24727 25392 gene locus_tag LOCUS_33530 gene yagK 24727 25392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263371.1 protein_id gnl|my_center|LOCUS_33530 26226 25501 gene locus_tag LOCUS_33540 26226 25501 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071643.1 protein_id gnl|my_center|LOCUS_33540 26856 26296 gene locus_tag LOCUS_33550 26856 26296 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071644.1 protein_id gnl|my_center|LOCUS_33550 27372 26965 gene locus_tag LOCUS_33560 27372 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071645.1 protein_id gnl|my_center|LOCUS_33560 27810 27448 gene locus_tag LOCUS_33570 27810 27448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071648.1 protein_id gnl|my_center|LOCUS_33570 28294 27803 gene locus_tag LOCUS_33580 gene yfjY 28294 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071649.1 protein_id gnl|my_center|LOCUS_33580 28440 28643 gene locus_tag LOCUS_33590 28440 28643 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889716.1 protein_id gnl|my_center|LOCUS_33590 29044 28709 gene locus_tag LOCUS_33600 29044 28709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071658.1 protein_id gnl|my_center|LOCUS_33600 29578 29411 gene locus_tag LOCUS_33610 29578 29411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 30962 29955 gene locus_tag LOCUS_33620 30962 29955 CDS product putative family 20 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HI37 protein_id gnl|my_center|LOCUS_33620 >Feature sequence49 1401 82 gene locus_tag LOCUS_33630 gene ubiF 1401 82 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071414.1 protein_id gnl|my_center|LOCUS_33630 1503 1862 gene locus_tag LOCUS_33640 1503 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1999 3384 gene locus_tag LOCUS_33650 gene miaB 1999 3384 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX45 protein_id gnl|my_center|LOCUS_33650 3514 4560 gene locus_tag LOCUS_33660 gene ybeZ 3514 4560 CDS product ATP-binding protein YbeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071411.1 protein_id gnl|my_center|LOCUS_33660 4550 5011 gene locus_tag LOCUS_33670 gene ybeY 4550 5011 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_33670 5012 5926 gene locus_tag LOCUS_33680 gene corC 5012 5926 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 protein_id gnl|my_center|LOCUS_33680 5923 7476 gene locus_tag LOCUS_33690 gene lnt 5923 7476 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP1 protein_id gnl|my_center|LOCUS_33690 7589 8308 gene locus_tag LOCUS_33700 7589 8308 CDS product thermostable hemolysin delta-VPH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464330.1 protein_id gnl|my_center|LOCUS_33700 8305 9951 gene locus_tag LOCUS_33710 8305 9951 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_33710 9951 10622 gene locus_tag LOCUS_33720 9951 10622 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_33720 10637 11482 gene locus_tag LOCUS_33730 10637 11482 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_33730 11469 12122 gene locus_tag LOCUS_33740 11469 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_33740 12792 12292 gene locus_tag LOCUS_33750 12792 12292 CDS product DUF1451 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071406.1 protein_id gnl|my_center|LOCUS_33750 12900 15494 gene locus_tag LOCUS_33760 gene leuS 12900 15494 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP4 protein_id gnl|my_center|LOCUS_33760 15512 16021 gene locus_tag LOCUS_33770 gene lptE 15512 16021 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP5 protein_id gnl|my_center|LOCUS_33770 16021 17052 gene locus_tag LOCUS_33780 gene holA 16021 17052 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 protein_id gnl|my_center|LOCUS_33780 17062 17748 gene locus_tag LOCUS_33790 gene nadD 17062 17748 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX46 protein_id gnl|my_center|LOCUS_33790 17840 18169 gene locus_tag LOCUS_33800 gene rsfS 17840 18169 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP7 protein_id gnl|my_center|LOCUS_33800 18169 18639 gene locus_tag LOCUS_33810 gene rlmH 18169 18639 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP8 protein_id gnl|my_center|LOCUS_33810 18727 20571 gene locus_tag LOCUS_33820 gene mrdA 18727 20571 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071399.1 protein_id gnl|my_center|LOCUS_33820 20555 21658 gene locus_tag LOCUS_33830 gene mrdB 20555 21658 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_33830 21670 22665 gene locus_tag LOCUS_33840 gene mltB 21670 22665 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071397.1 protein_id gnl|my_center|LOCUS_33840 22652 23443 gene locus_tag LOCUS_33850 gene rlpA 22652 23443 CDS product septal ring lipoprotein RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_33850 23575 24753 gene locus_tag LOCUS_33860 gene dacA 23575 24753 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071395.1 protein_id gnl|my_center|LOCUS_33860 25026 26327 gene locus_tag LOCUS_33870 25026 26327 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 protein_id gnl|my_center|LOCUS_33870 26742 26422 gene locus_tag LOCUS_33880 26742 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071588.1 protein_id gnl|my_center|LOCUS_33880 27377 26820 gene locus_tag LOCUS_33890 27377 26820 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 protein_id gnl|my_center|LOCUS_33890 27673 28305 gene locus_tag LOCUS_33900 27673 28305 CDS product DUF2913 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071589.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence50 2462 2088 gene locus_tag LOCUS_33910 2462 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3076 3303 gene locus_tag LOCUS_33920 3076 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3330 5567 gene locus_tag LOCUS_33930 gene iutA 3330 5567 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 protein_id gnl|my_center|LOCUS_33930 5675 5998 gene locus_tag LOCUS_33940 5675 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 6613 6062 gene locus_tag LOCUS_33950 6613 6062 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106351.1 protein_id gnl|my_center|LOCUS_33950 7173 6748 gene locus_tag LOCUS_33960 7173 6748 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_33960 9073 7274 gene locus_tag LOCUS_33970 9073 7274 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072705.1 protein_id gnl|my_center|LOCUS_33970 9279 10127 gene locus_tag LOCUS_33980 9279 10127 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_33980 10205 13768 gene locus_tag LOCUS_33990 10205 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 13783 13980 gene locus_tag LOCUS_34000 13783 13980 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072131.1 protein_id gnl|my_center|LOCUS_34000 14011 14331 gene locus_tag LOCUS_34010 14011 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_34010 14961 16616 gene locus_tag LOCUS_34020 14961 16616 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705497.1 protein_id gnl|my_center|LOCUS_34020 17124 18488 gene locus_tag LOCUS_34030 17124 18488 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943428.1 protein_id gnl|my_center|LOCUS_34030 20675 18594 gene locus_tag LOCUS_34040 20675 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 21849 23504 gene locus_tag LOCUS_34050 21849 23504 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705497.1 protein_id gnl|my_center|LOCUS_34050 26011 23867 gene locus_tag LOCUS_34060 gene fadJ 26011 23867 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_34060 27322 26012 gene locus_tag LOCUS_34070 gene fadI 27322 26012 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP6 protein_id gnl|my_center|LOCUS_34070 27567 28523 gene locus_tag LOCUS_34080 27567 28523 CDS product MoxR-like ATPase in aerotolerance operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 protein_id gnl|my_center|LOCUS_34080 >Feature sequence51 730 206 gene locus_tag LOCUS_34090 730 206 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073508.1 protein_id gnl|my_center|LOCUS_34090 1339 743 gene locus_tag LOCUS_34100 gene hemG 1339 743 CDS product oxygen-independent protoporphyrinogen oxidase HemG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 protein_id gnl|my_center|LOCUS_34100 1795 2625 gene locus_tag LOCUS_34110 1795 2625 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073510.1 protein_id gnl|my_center|LOCUS_34110 3278 2640 gene locus_tag LOCUS_34120 gene cysC 3278 2640 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB13 protein_id gnl|my_center|LOCUS_34120 5024 3288 gene locus_tag LOCUS_34130 gene yfbS 5024 3288 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_34130 6441 5026 gene locus_tag LOCUS_34140 gene cysN 6441 5026 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP35 protein_id gnl|my_center|LOCUS_34140 7349 6441 gene locus_tag LOCUS_34150 gene cysD 7349 6441 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E831 protein_id gnl|my_center|LOCUS_34150 8195 7368 gene locus_tag LOCUS_34160 gene cysG 8195 7368 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073514.1 protein_id gnl|my_center|LOCUS_34160 8581 9492 gene locus_tag LOCUS_34170 8581 9492 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_34170 9564 11039 gene locus_tag LOCUS_34180 9564 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073515.1 protein_id gnl|my_center|LOCUS_34180 12307 11546 gene locus_tag LOCUS_34190 gene cysH 12307 11546 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB01 protein_id gnl|my_center|LOCUS_34190 14006 12300 gene locus_tag LOCUS_34200 gene cysI 14006 12300 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB00 protein_id gnl|my_center|LOCUS_34200 15853 14039 gene locus_tag LOCUS_34210 gene cysJ 15853 14039 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ9 protein_id gnl|my_center|LOCUS_34210 16286 17812 gene locus_tag LOCUS_34220 gene pntA 16286 17812 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQF4 protein_id gnl|my_center|LOCUS_34220 17824 19308 gene locus_tag LOCUS_34230 gene pntB 17824 19308 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQF3 protein_id gnl|my_center|LOCUS_34230 20589 19507 gene locus_tag LOCUS_34240 20589 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 21440 20859 gene locus_tag LOCUS_34250 21440 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 21825 21541 gene locus_tag LOCUS_34260 21825 21541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262395.1 protein_id gnl|my_center|LOCUS_34260 22957 21848 gene locus_tag LOCUS_34270 22957 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 25040 22959 gene locus_tag LOCUS_34280 25040 22959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705047.1 protein_id gnl|my_center|LOCUS_34280 25900 25037 gene locus_tag LOCUS_34290 25900 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263771.1 protein_id gnl|my_center|LOCUS_34290 26503 25946 gene locus_tag LOCUS_34300 26503 25946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 <27763 26503 gene locus_tag LOCUS_34310 <27763 26503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KS45:actin cross-linking toxin VgrG1 >Feature sequence52 516 722 gene locus_tag LOCUS_34320 gene cspD 516 722 CDS product cold shock domain protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_34320 3047 822 gene locus_tag LOCUS_34330 gene icd 3047 822 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_34330 3542 4243 gene locus_tag LOCUS_34340 3542 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 4236 4688 gene locus_tag LOCUS_34350 4236 4688 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072579.1 protein_id gnl|my_center|LOCUS_34350 4856 5971 gene locus_tag LOCUS_34360 gene mnmA 4856 5971 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX40 protein_id gnl|my_center|LOCUS_34360 5975 6592 gene locus_tag LOCUS_34370 gene hflD 5975 6592 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV9 protein_id gnl|my_center|LOCUS_34370 6621 7991 gene locus_tag LOCUS_34380 gene purB 6621 7991 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV8 protein_id gnl|my_center|LOCUS_34380 8115 9257 gene locus_tag LOCUS_34390 8115 9257 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072583.1 protein_id gnl|my_center|LOCUS_34390 9662 10066 gene locus_tag LOCUS_34400 9662 10066 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_34400 11622 10147 gene locus_tag LOCUS_34410 11622 10147 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103517.1 protein_id gnl|my_center|LOCUS_34410 11993 14203 gene locus_tag LOCUS_34420 11993 14203 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_34420 16945 14768 gene locus_tag LOCUS_34430 16945 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267853.1 protein_id gnl|my_center|LOCUS_34430 17198 17007 gene locus_tag LOCUS_34440 17198 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 19428 17263 gene locus_tag LOCUS_34450 gene dcp 19428 17263 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073393.1 protein_id gnl|my_center|LOCUS_34450 19903 21954 gene locus_tag LOCUS_34460 gene cpdB 19903 21954 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073394.1 protein_id gnl|my_center|LOCUS_34460 22126 22746 gene locus_tag LOCUS_34470 22126 22746 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence53 301 1254 gene locus_tag LOCUS_34480 301 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 2141 2629 gene locus_tag LOCUS_34490 2141 2629 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031391.1 protein_id gnl|my_center|LOCUS_34490 2664 4190 gene locus_tag LOCUS_34500 2664 4190 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882966.1 protein_id gnl|my_center|LOCUS_34500 4196 4624 gene locus_tag LOCUS_34510 4196 4624 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221000.1 protein_id gnl|my_center|LOCUS_34510 4627 6393 gene locus_tag LOCUS_34520 4627 6393 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 protein_id gnl|my_center|LOCUS_34520 6420 7367 gene locus_tag LOCUS_34530 6420 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 protein_id gnl|my_center|LOCUS_34530 7383 8711 gene locus_tag LOCUS_34540 7383 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089704.1 protein_id gnl|my_center|LOCUS_34540 8711 9241 gene locus_tag LOCUS_34550 8711 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 9244 10575 gene locus_tag LOCUS_34560 9244 10575 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458007.1 protein_id gnl|my_center|LOCUS_34560 10579 11370 gene locus_tag LOCUS_34570 10579 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083409.1 protein_id gnl|my_center|LOCUS_34570 11381 13969 gene locus_tag LOCUS_34580 11381 13969 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619136.1 protein_id gnl|my_center|LOCUS_34580 13969 15525 gene locus_tag LOCUS_34590 13969 15525 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084793.1 protein_id gnl|my_center|LOCUS_34590 15525 16178 gene locus_tag LOCUS_34600 15525 16178 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882968.1 protein_id gnl|my_center|LOCUS_34600 16182 17582 gene locus_tag LOCUS_34610 16182 17582 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426093.1 protein_id gnl|my_center|LOCUS_34610 17593 21159 gene locus_tag LOCUS_34620 17593 21159 CDS product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 protein_id gnl|my_center|LOCUS_34620 21274 22509 gene locus_tag LOCUS_34630 21274 22509 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894578.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence54 160 891 gene locus_tag LOCUS_34640 160 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1022 1312 gene locus_tag LOCUS_34650 1022 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 2442 1495 gene locus_tag LOCUS_34660 gene prs 2442 1495 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAQ9 protein_id gnl|my_center|LOCUS_34660 3399 2521 gene locus_tag LOCUS_34670 gene ispE 3399 2521 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR0 protein_id gnl|my_center|LOCUS_34670 4121 3396 gene locus_tag LOCUS_34680 gene lolB 4121 3396 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR1 protein_id gnl|my_center|LOCUS_34680 4260 5555 gene locus_tag LOCUS_34690 gene hemA 4260 5555 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR2 protein_id gnl|my_center|LOCUS_34690 5570 6655 gene locus_tag LOCUS_34700 gene prfA 5570 6655 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR3 protein_id gnl|my_center|LOCUS_34700 6667 7512 gene locus_tag LOCUS_34710 gene prmC 6667 7512 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 protein_id gnl|my_center|LOCUS_34710 7669 8064 gene locus_tag LOCUS_34720 7669 8064 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_34720 8064 8855 gene locus_tag LOCUS_34730 8064 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073593.1 protein_id gnl|my_center|LOCUS_34730 8935 10206 gene locus_tag LOCUS_34740 8935 10206 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_34740 10251 11099 gene locus_tag LOCUS_34750 gene kdsA 10251 11099 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_34750 11222 11566 gene locus_tag LOCUS_34760 11222 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 12482 11568 gene locus_tag LOCUS_34770 12482 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 12846 12487 gene locus_tag LOCUS_34780 12846 12487 CDS product teicoplanin resistance protein VanZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073586.1 protein_id gnl|my_center|LOCUS_34780 12992 13477 gene locus_tag LOCUS_34790 12992 13477 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAS7 protein_id gnl|my_center|LOCUS_34790 15159 13474 gene locus_tag LOCUS_34800 15159 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 15641 15321 gene locus_tag LOCUS_34810 15641 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073583.1 protein_id gnl|my_center|LOCUS_34810 16291 15707 gene locus_tag LOCUS_34820 gene ppiA 16291 15707 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT0 protein_id gnl|my_center|LOCUS_34820 16923 16357 gene locus_tag LOCUS_34830 16923 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073581.1 protein_id gnl|my_center|LOCUS_34830 17086 17670 gene locus_tag LOCUS_34840 17086 17670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073580.1 protein_id gnl|my_center|LOCUS_34840 17797 18858 gene locus_tag LOCUS_34850 17797 18858 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 protein_id gnl|my_center|LOCUS_34850 18880 19800 gene locus_tag LOCUS_34860 18880 19800 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_34860 19800 20450 gene locus_tag LOCUS_34870 gene grxB 19800 20450 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262154.1 protein_id gnl|my_center|LOCUS_34870 21972 20590 gene locus_tag LOCUS_34880 21972 20590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074243.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence55 81 6 gene locus_tag LOCUS_t00460 81 6 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 186 111 gene locus_tag LOCUS_t00470 186 111 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 298 223 gene locus_tag LOCUS_t00480 298 223 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 408 333 gene locus_tag LOCUS_t00490 408 333 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 511 436 gene locus_tag LOCUS_t00500 511 436 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1377 649 gene locus_tag LOCUS_34890 gene ybgF 1377 649 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_34890 1943 1404 gene locus_tag LOCUS_34900 gene pal 1943 1404 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072686.1 protein_id gnl|my_center|LOCUS_34900 3293 1968 gene locus_tag LOCUS_34910 gene tolB 3293 1968 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDJ8 protein_id gnl|my_center|LOCUS_34910 4262 3303 gene locus_tag LOCUS_34920 4262 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 4700 4263 gene locus_tag LOCUS_34930 gene tolR 4700 4263 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_34930 5353 4697 gene locus_tag LOCUS_34940 gene tolQ 5353 4697 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 protein_id gnl|my_center|LOCUS_34940 5777 5376 gene locus_tag LOCUS_34950 gene ybgC 5777 5376 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072691.1 protein_id gnl|my_center|LOCUS_34950 8053 5906 gene locus_tag LOCUS_34960 8053 5906 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072692.1 protein_id gnl|my_center|LOCUS_34960 8638 9045 gene locus_tag LOCUS_34970 8638 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 9149 9409 gene locus_tag LOCUS_34980 9149 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 10075 9449 gene locus_tag LOCUS_34990 gene upp 10075 9449 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI9 protein_id gnl|my_center|LOCUS_34990 10336 11373 gene locus_tag LOCUS_35000 gene purM 10336 11373 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI8 protein_id gnl|my_center|LOCUS_35000 11373 12017 gene locus_tag LOCUS_35010 gene purN 11373 12017 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI7 protein_id gnl|my_center|LOCUS_35010 12504 13250 gene locus_tag LOCUS_35020 gene nagD 12504 13250 CDS product UMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072701.1 protein_id gnl|my_center|LOCUS_35020 13382 15028 gene locus_tag LOCUS_35030 13382 15028 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 protein_id gnl|my_center|LOCUS_35030 15350 17014 gene locus_tag LOCUS_35040 gene asnB 15350 17014 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072704.1 protein_id gnl|my_center|LOCUS_35040 17699 17355 gene locus_tag LOCUS_35050 17699 17355 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133286.1 protein_id gnl|my_center|LOCUS_35050 18083 17733 gene locus_tag LOCUS_35060 18083 17733 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072726.1 protein_id gnl|my_center|LOCUS_35060 18925 18185 gene locus_tag LOCUS_35070 18925 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 protein_id gnl|my_center|LOCUS_35070 19397 18981 gene locus_tag LOCUS_35080 19397 18981 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122286.1 protein_id gnl|my_center|LOCUS_35080 19673 19401 gene locus_tag LOCUS_35090 19673 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 20352 21326 gene locus_tag LOCUS_35100 20352 21326 CDS product DUF4917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161327.1 protein_id gnl|my_center|LOCUS_35100 21412 21756 gene locus_tag LOCUS_35110 21412 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 22170 21991 gene locus_tag LOCUS_35120 22170 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence56 97 173 gene locus_tag LOCUS_t00510 97 173 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1434 547 gene locus_tag LOCUS_35130 1434 547 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071801.1 protein_id gnl|my_center|LOCUS_35130 1625 3571 gene locus_tag LOCUS_35140 gene kefB 1625 3571 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_35140 3728 4660 gene locus_tag LOCUS_35150 3728 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 5792 4668 gene locus_tag LOCUS_35160 5792 4668 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 protein_id gnl|my_center|LOCUS_35160 7820 5955 gene locus_tag LOCUS_35170 gene dxs 7820 5955 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGR9 protein_id gnl|my_center|LOCUS_35170 8723 7842 gene locus_tag LOCUS_35180 gene ispA 8723 7842 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071705.1 protein_id gnl|my_center|LOCUS_35180 8963 8724 gene locus_tag LOCUS_35190 gene xseB 8963 8724 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PTY3 protein_id gnl|my_center|LOCUS_35190 9359 10126 gene locus_tag LOCUS_35200 gene pomA 9359 10126 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 protein_id gnl|my_center|LOCUS_35200 10131 11069 gene locus_tag LOCUS_35210 gene pomB 10131 11069 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 protein_id gnl|my_center|LOCUS_35210 11193 12680 gene locus_tag LOCUS_35220 gene thiI 11193 12680 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGR4 protein_id gnl|my_center|LOCUS_35220 13025 12747 gene locus_tag LOCUS_35230 13025 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 13210 14121 gene locus_tag LOCUS_35240 gene gcvA 13210 14121 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_35240 14198 14833 gene locus_tag LOCUS_35250 14198 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105832.1 protein_id gnl|my_center|LOCUS_35250 14840 15331 gene locus_tag LOCUS_35260 14840 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480696.1 protein_id gnl|my_center|LOCUS_35260 15457 16101 gene locus_tag LOCUS_35270 15457 16101 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071712.1 protein_id gnl|my_center|LOCUS_35270 16104 16493 gene locus_tag LOCUS_35280 16104 16493 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_35280 16836 17918 gene locus_tag LOCUS_35290 gene rlmM 16836 17918 CDS product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGQ9 protein_id gnl|my_center|LOCUS_35290 18334 18026 gene locus_tag LOCUS_35300 18334 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 18601 19854 gene locus_tag LOCUS_35310 gene avtA 18601 19854 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_35310 >Feature sequence57 566 4789 gene locus_tag LOCUS_35320 566 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 4791 5618 gene locus_tag LOCUS_35330 4791 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 5658 6203 gene locus_tag LOCUS_35340 5658 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 8147 6384 gene locus_tag LOCUS_35350 gene phoD 8147 6384 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_35350 8395 8814 gene locus_tag LOCUS_35360 8395 8814 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 protein_id gnl|my_center|LOCUS_35360 9208 8924 gene locus_tag LOCUS_35370 9208 8924 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071611.1 protein_id gnl|my_center|LOCUS_35370 9531 9205 gene locus_tag LOCUS_35380 9531 9205 CDS product Hg(II) uptake system permease component MerT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071610.1 protein_id gnl|my_center|LOCUS_35380 10681 9539 gene locus_tag LOCUS_35390 10681 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_35390 12181 10961 gene locus_tag LOCUS_35400 12181 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073729.1 protein_id gnl|my_center|LOCUS_35400 12828 12178 gene locus_tag LOCUS_35410 12828 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073730.1 protein_id gnl|my_center|LOCUS_35410 16499 12828 gene locus_tag LOCUS_35420 16499 12828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_35420 16870 16673 gene locus_tag LOCUS_35430 16870 16673 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071175.1 protein_id gnl|my_center|LOCUS_35430 17110 17787 gene locus_tag LOCUS_35440 gene nfi 17110 17787 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDJ2 protein_id gnl|my_center|LOCUS_35440 18691 17942 gene locus_tag LOCUS_35450 18691 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 19122 18694 gene locus_tag LOCUS_35460 19122 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 19617 19318 gene locus_tag LOCUS_35470 19617 19318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 20283 19762 gene locus_tag LOCUS_35480 20283 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence58 <1 4922 gene locus_tag LOCUS_35490 <1 4922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:biofilm-promoting protein BpfA 5025 7196 gene locus_tag LOCUS_35500 gene aggC 5025 7196 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073977.1 protein_id gnl|my_center|LOCUS_35500 7198 8580 gene locus_tag LOCUS_35510 gene aggB 7198 8580 CDS product type I protein secretion system MFP component AggB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073978.1 protein_id gnl|my_center|LOCUS_35510 8614 10017 gene locus_tag LOCUS_35520 gene aggA 8614 10017 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 protein_id gnl|my_center|LOCUS_35520 10017 10622 gene locus_tag LOCUS_35530 10017 10622 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073980.1 protein_id gnl|my_center|LOCUS_35530 10775 11347 gene locus_tag LOCUS_35540 10775 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073981.1 protein_id gnl|my_center|LOCUS_35540 11356 13275 gene locus_tag LOCUS_35550 11356 13275 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073982.1 protein_id gnl|my_center|LOCUS_35550 13500 13424 gene locus_tag LOCUS_t00520 13500 13424 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13639 13563 gene locus_tag LOCUS_t00530 13639 13563 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13749 13674 gene locus_tag LOCUS_t00540 13749 13674 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13863 13787 gene locus_tag LOCUS_t00550 13863 13787 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14085 16739 gene locus_tag LOCUS_35560 14085 16739 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073983.1 protein_id gnl|my_center|LOCUS_35560 18779 16767 gene locus_tag LOCUS_35570 gene rep 18779 16767 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9F8 protein_id gnl|my_center|LOCUS_35570 18949 19296 gene locus_tag LOCUS_35580 18949 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence59 479 288 gene locus_tag LOCUS_35590 479 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 1003 2181 gene locus_tag LOCUS_35600 1003 2181 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072958.1 protein_id gnl|my_center|LOCUS_35600 2273 3028 gene locus_tag LOCUS_35610 2273 3028 CDS product nucleoside-specific porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074217.1 protein_id gnl|my_center|LOCUS_35610 4613 3090 gene locus_tag LOCUS_35620 4613 3090 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_35620 4781 6340 gene locus_tag LOCUS_35630 4781 6340 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_35630 6367 8004 gene locus_tag LOCUS_35640 6367 8004 CDS product phenylalanine/histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072955.1 protein_id gnl|my_center|LOCUS_35640 8116 8433 gene locus_tag LOCUS_35650 8116 8433 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072954.1 protein_id gnl|my_center|LOCUS_35650 10001 8715 gene locus_tag LOCUS_35660 gene pip 10001 8715 CDS product proline iminopeptidase Pip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072953.1 protein_id gnl|my_center|LOCUS_35660 10379 10164 gene locus_tag LOCUS_35670 10379 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 10278 10844 gene locus_tag LOCUS_35680 10278 10844 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_35680 11043 11546 gene locus_tag LOCUS_35690 11043 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072946.1 protein_id gnl|my_center|LOCUS_35690 12192 11623 gene locus_tag LOCUS_35700 gene yecM 12192 11623 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072218.1 protein_id gnl|my_center|LOCUS_35700 12710 12207 gene locus_tag LOCUS_35710 12710 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 protein_id gnl|my_center|LOCUS_35710 12709 12918 gene locus_tag LOCUS_35720 12709 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 12987 13847 gene locus_tag LOCUS_35730 12987 13847 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_35730 13849 15390 gene locus_tag LOCUS_35740 13849 15390 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_35740 15650 15423 gene locus_tag LOCUS_35750 15650 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 16131 15775 gene locus_tag LOCUS_35760 16131 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 16632 16198 gene locus_tag LOCUS_35770 16632 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072732.1 protein_id gnl|my_center|LOCUS_35770 16783 17472 gene locus_tag LOCUS_35780 16783 17472 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072731.1 protein_id gnl|my_center|LOCUS_35780 18100 17576 gene locus_tag LOCUS_35790 18100 17576 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287237.1 protein_id gnl|my_center|LOCUS_35790 18573 18217 gene locus_tag LOCUS_35800 18573 18217 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072730.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence60 3727 2345 gene locus_tag LOCUS_35810 gene rseP 3727 2345 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG8 protein_id gnl|my_center|LOCUS_35810 4933 3743 gene locus_tag LOCUS_35820 gene dxr 4933 3743 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG9 protein_id gnl|my_center|LOCUS_35820 5687 4938 gene locus_tag LOCUS_35830 gene cdsA 5687 4938 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH0 protein_id gnl|my_center|LOCUS_35830 6703 5816 gene locus_tag LOCUS_35840 gene uppS 6703 5816 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH1 protein_id gnl|my_center|LOCUS_35840 7285 6728 gene locus_tag LOCUS_35850 gene frr 7285 6728 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH2 protein_id gnl|my_center|LOCUS_35850 8045 7314 gene locus_tag LOCUS_35860 gene pyrH 8045 7314 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH3 protein_id gnl|my_center|LOCUS_35860 8966 8115 gene locus_tag LOCUS_35870 gene tsf 8966 8115 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH4 protein_id gnl|my_center|LOCUS_35870 9827 9099 gene locus_tag LOCUS_35880 gene rpsB 9827 9099 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH5 protein_id gnl|my_center|LOCUS_35880 10243 11046 gene locus_tag LOCUS_35890 gene map 10243 11046 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH7 protein_id gnl|my_center|LOCUS_35890 11067 13646 gene locus_tag LOCUS_35900 gene glnD 11067 13646 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH8 protein_id gnl|my_center|LOCUS_35900 13664 14488 gene locus_tag LOCUS_35910 gene dapD 13664 14488 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH9 protein_id gnl|my_center|LOCUS_35910 14742 15107 gene locus_tag LOCUS_35920 14742 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 15966 15133 gene locus_tag LOCUS_35930 gene purU 15966 15133 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGI0 protein_id gnl|my_center|LOCUS_35930 17534 16053 gene locus_tag LOCUS_35940 gene ptsG 17534 16053 CDS product PTS glucose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071779.1 protein_id gnl|my_center|LOCUS_35940 17995 17486 gene locus_tag LOCUS_35950 gene yqcA 17995 17486 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071778.1 protein_id gnl|my_center|LOCUS_35950 18078 18254 gene locus_tag LOCUS_35960 18078 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence61 593 108 gene locus_tag LOCUS_35970 593 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 925 1896 gene locus_tag LOCUS_35980 gene dusA 925 1896 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_35980 2140 2439 gene locus_tag LOCUS_35990 2140 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2567 2761 gene locus_tag LOCUS_36000 2567 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2758 3132 gene locus_tag LOCUS_36010 2758 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3935 3195 gene locus_tag LOCUS_36020 gene echH 3935 3195 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073654.1 protein_id gnl|my_center|LOCUS_36020 3988 4452 gene locus_tag LOCUS_36030 3988 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073653.1 protein_id gnl|my_center|LOCUS_36030 4465 5436 gene locus_tag LOCUS_36040 4465 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_36040 5440 6177 gene locus_tag LOCUS_36050 5440 6177 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 protein_id gnl|my_center|LOCUS_36050 7560 6244 gene locus_tag LOCUS_36060 gene tolC 7560 6244 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073650.1 protein_id gnl|my_center|LOCUS_36060 7833 8408 gene locus_tag LOCUS_36070 gene nudF 7833 8408 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073649.1 protein_id gnl|my_center|LOCUS_36070 8405 8839 gene locus_tag LOCUS_36080 8405 8839 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073648.1 protein_id gnl|my_center|LOCUS_36080 8855 9694 gene locus_tag LOCUS_36090 gene cpdA 8855 9694 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK1 protein_id gnl|my_center|LOCUS_36090 9727 10302 gene locus_tag LOCUS_36100 9727 10302 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 protein_id gnl|my_center|LOCUS_36100 10356 12242 gene locus_tag LOCUS_36110 gene parE 10356 12242 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK3 protein_id gnl|my_center|LOCUS_36110 12290 13465 gene locus_tag LOCUS_36120 12290 13465 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073644.1 protein_id gnl|my_center|LOCUS_36120 13465 15732 gene locus_tag LOCUS_36130 gene parC 13465 15732 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK5 protein_id gnl|my_center|LOCUS_36130 16000 15809 gene locus_tag LOCUS_36140 gene bfd 16000 15809 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070919.1 protein_id gnl|my_center|LOCUS_36140 17218 16292 gene locus_tag LOCUS_36150 17218 16292 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070921.1 protein_id gnl|my_center|LOCUS_36150 17267 17599 gene locus_tag LOCUS_36160 17267 17599 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070922.1 protein_id gnl|my_center|LOCUS_36160 18351 17632 gene locus_tag LOCUS_36170 18351 17632 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence62 3033 376 gene locus_tag LOCUS_36180 gene kdpD 3033 376 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167969.1 protein_id gnl|my_center|LOCUS_36180 3595 3038 gene locus_tag LOCUS_36190 gene kdpC 3595 3038 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRJ2 protein_id gnl|my_center|LOCUS_36190 5713 3608 gene locus_tag LOCUS_36200 gene kdpB 5713 3608 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQS2 protein_id gnl|my_center|LOCUS_36200 7418 5733 gene locus_tag LOCUS_36210 gene kdpA 7418 5733 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8E4 protein_id gnl|my_center|LOCUS_36210 12501 7765 gene locus_tag LOCUS_36220 12501 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 13732 13112 gene locus_tag LOCUS_36230 gene rnhB 13732 13112 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG1 protein_id gnl|my_center|LOCUS_36230 14889 13729 gene locus_tag LOCUS_36240 gene lpxB 14889 13729 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG2 protein_id gnl|my_center|LOCUS_36240 15674 14904 gene locus_tag LOCUS_36250 gene lpxA 15674 14904 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG3 protein_id gnl|my_center|LOCUS_36250 16132 15671 gene locus_tag LOCUS_36260 gene fabZ 16132 15671 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_36260 17195 16170 gene locus_tag LOCUS_36270 gene lpxD 17195 16170 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG5 protein_id gnl|my_center|LOCUS_36270 17706 17200 gene locus_tag LOCUS_36280 gene skp 17706 17200 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071793.1 protein_id gnl|my_center|LOCUS_36280 18067 17756 gene locus_tag LOCUS_36290 18067 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence63 544 104 gene locus_tag LOCUS_36300 544 104 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072588.1 protein_id gnl|my_center|LOCUS_36300 3687 643 gene locus_tag LOCUS_36310 3687 643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072589.1 protein_id gnl|my_center|LOCUS_36310 6146 3777 gene locus_tag LOCUS_36320 gene ppsA 6146 3777 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU9 protein_id gnl|my_center|LOCUS_36320 6271 7083 gene locus_tag LOCUS_36330 6271 7083 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU8 protein_id gnl|my_center|LOCUS_36330 7326 8390 gene locus_tag LOCUS_36340 gene aroH 7326 8390 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU7 protein_id gnl|my_center|LOCUS_36340 8566 8997 gene locus_tag LOCUS_36350 8566 8997 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072593.1 protein_id gnl|my_center|LOCUS_36350 9223 9888 gene locus_tag LOCUS_36360 9223 9888 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_36360 10372 9911 gene locus_tag LOCUS_36370 10372 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 11372 10536 gene locus_tag LOCUS_36380 gene frmB 11372 10536 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC6 protein_id gnl|my_center|LOCUS_36380 12507 11383 gene locus_tag LOCUS_36390 gene frmA 12507 11383 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_36390 12640 13533 gene locus_tag LOCUS_36400 12640 13533 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072126.1 protein_id gnl|my_center|LOCUS_36400 14214 13711 gene locus_tag LOCUS_36410 gene yaiI 14214 13711 CDS product UPF0178 protein YaiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83M67 protein_id gnl|my_center|LOCUS_36410 15076 14510 gene locus_tag LOCUS_36420 15076 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105832.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence64 115 507 gene locus_tag LOCUS_36430 115 507 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073202.1 protein_id gnl|my_center|LOCUS_36430 674 504 gene locus_tag LOCUS_36440 674 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 686 1510 gene locus_tag LOCUS_36450 686 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_36450 1619 2161 gene locus_tag LOCUS_36460 1619 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073206.1 protein_id gnl|my_center|LOCUS_36460 3586 2141 gene locus_tag LOCUS_36470 3586 2141 CDS product signal transduction protein with HDOD/GAF domains inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073207.1 protein_id gnl|my_center|LOCUS_36470 5145 3823 gene locus_tag LOCUS_36480 gene aceA 5145 3823 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071671.1 protein_id gnl|my_center|LOCUS_36480 6829 5219 gene locus_tag LOCUS_36490 gene aceB 6829 5219 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071670.1 protein_id gnl|my_center|LOCUS_36490 7565 9991 gene locus_tag LOCUS_36500 7565 9991 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071669.1 protein_id gnl|my_center|LOCUS_36500 11807 10038 gene locus_tag LOCUS_36510 gene kefC 11807 10038 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 protein_id gnl|my_center|LOCUS_36510 12225 12722 gene locus_tag LOCUS_36520 gene bamE 12225 12722 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGW5 protein_id gnl|my_center|LOCUS_36520 13143 12808 gene locus_tag LOCUS_36530 13143 12808 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGW6 protein_id gnl|my_center|LOCUS_36530 13672 13133 gene locus_tag LOCUS_36540 gene yfjG 13672 13133 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071662.1 protein_id gnl|my_center|LOCUS_36540 13779 14264 gene locus_tag LOCUS_36550 gene smpB 13779 14264 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGW8 protein_id gnl|my_center|LOCUS_36550 14381 14735 gene locus_tag LOCUS_tm00010 14381 14735 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence65 824 174 gene locus_tag LOCUS_36560 824 174 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_36560 1063 845 gene locus_tag LOCUS_36570 1063 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_36570 1246 2133 gene locus_tag LOCUS_36580 1246 2133 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E985 protein_id gnl|my_center|LOCUS_36580 2111 3076 gene locus_tag LOCUS_36590 2111 3076 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074049.1 protein_id gnl|my_center|LOCUS_36590 3073 3510 gene locus_tag LOCUS_36600 gene dtd 3073 3510 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E988 protein_id gnl|my_center|LOCUS_36600 3512 3982 gene locus_tag LOCUS_36610 gene yiiD 3512 3982 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074046.1 protein_id gnl|my_center|LOCUS_36610 4194 4787 gene locus_tag LOCUS_36620 gene azoR 4194 4787 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E990 protein_id gnl|my_center|LOCUS_36620 5025 4843 gene locus_tag LOCUS_36630 5025 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 5351 5031 gene locus_tag LOCUS_36640 5351 5031 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074043.1 protein_id gnl|my_center|LOCUS_36640 5498 6625 gene locus_tag LOCUS_36650 5498 6625 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705269.1 protein_id gnl|my_center|LOCUS_36650 7929 6697 gene locus_tag LOCUS_36660 gene fabF 7929 6697 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_36660 8651 7926 gene locus_tag LOCUS_36670 gene fabG 8651 7926 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_36670 9139 8648 gene locus_tag LOCUS_36680 9139 8648 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074035.1 protein_id gnl|my_center|LOCUS_36680 10326 9136 gene locus_tag LOCUS_36690 10326 9136 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_36690 11041 10358 gene locus_tag LOCUS_36700 11041 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074033.1 protein_id gnl|my_center|LOCUS_36700 12294 11038 gene locus_tag LOCUS_36710 12294 11038 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_36710 <13291 12291 gene locus_tag LOCUS_36720 <13291 12291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074031.1:MMPL family efflux pump permease component >Feature sequence66 893 675 gene locus_tag LOCUS_36730 gene infA 893 675 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69225 protein_id gnl|my_center|LOCUS_36730 1684 974 gene locus_tag LOCUS_36740 gene ate 1684 974 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW7 protein_id gnl|my_center|LOCUS_36740 2384 1674 gene locus_tag LOCUS_36750 gene aat 2384 1674 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW8 protein_id gnl|my_center|LOCUS_36750 2438 2917 gene locus_tag LOCUS_36760 2438 2917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072571.1 protein_id gnl|my_center|LOCUS_36760 3389 2994 gene locus_tag LOCUS_36770 3389 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3620 4372 gene locus_tag LOCUS_36780 gene ybgI 3620 4372 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX0 protein_id gnl|my_center|LOCUS_36780 5274 4504 gene locus_tag LOCUS_36790 gene cysZ 5274 4504 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED68 protein_id gnl|my_center|LOCUS_36790 5517 8942 gene locus_tag LOCUS_36800 gene smc 5517 8942 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ7 protein_id gnl|my_center|LOCUS_36800 8964 9932 gene locus_tag LOCUS_36810 gene zipA 8964 9932 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED69 protein_id gnl|my_center|LOCUS_36810 10007 12013 gene locus_tag LOCUS_36820 gene ligA 10007 12013 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED70 protein_id gnl|my_center|LOCUS_36820 >Feature sequence67 1745 207 gene locus_tag LOCUS_36830 gene dacB 1745 207 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072373.1 protein_id gnl|my_center|LOCUS_36830 1961 1797 gene locus_tag LOCUS_36840 1961 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072372.1 protein_id gnl|my_center|LOCUS_36840 2310 3623 gene locus_tag LOCUS_36850 gene pssA 2310 3623 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEJ1 protein_id gnl|my_center|LOCUS_36850 3744 4679 gene locus_tag LOCUS_36860 3744 4679 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072387.1 protein_id gnl|my_center|LOCUS_36860 5736 4666 gene locus_tag LOCUS_36870 5736 4666 CDS product glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704588.1 protein_id gnl|my_center|LOCUS_36870 7298 5748 gene locus_tag LOCUS_36880 7298 5748 CDS product glycine radical enzyme, YjjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072385.1 protein_id gnl|my_center|LOCUS_36880 8637 7627 gene locus_tag LOCUS_36890 gene gapA 8637 7627 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN3 protein_id gnl|my_center|LOCUS_36890 9787 8855 gene locus_tag LOCUS_36900 9787 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072335.1 protein_id gnl|my_center|LOCUS_36900 9980 11422 gene locus_tag LOCUS_36910 gene gapB 9980 11422 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN1 protein_id gnl|my_center|LOCUS_36910 11850 11925 gene locus_tag LOCUS_t00560 11850 11925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence68 1634 372 gene locus_tag LOCUS_36920 gene ccoG 1634 372 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_36920 1884 2237 gene locus_tag LOCUS_36930 1884 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074322.1 protein_id gnl|my_center|LOCUS_36930 2348 3250 gene locus_tag LOCUS_36940 gene menB 2348 3250 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C7 protein_id gnl|my_center|LOCUS_36940 3383 3586 gene locus_tag LOCUS_36950 3383 3586 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 protein_id gnl|my_center|LOCUS_36950 5473 3644 gene locus_tag LOCUS_36960 gene glmS 5473 3644 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX33 protein_id gnl|my_center|LOCUS_36960 6268 5498 gene locus_tag LOCUS_36970 gene glmR 6268 5498 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074326.1 protein_id gnl|my_center|LOCUS_36970 8589 6499 gene locus_tag LOCUS_36980 8589 6499 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074327.1 protein_id gnl|my_center|LOCUS_36980 10219 8771 gene locus_tag LOCUS_36990 gene glmU 10219 8771 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C2 protein_id gnl|my_center|LOCUS_36990 10719 10291 gene locus_tag LOCUS_37000 gene atpC 10719 10291 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence69 352 276 gene locus_tag LOCUS_t00570 352 276 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 726 2855 gene locus_tag LOCUS_37010 gene rlmL 726 2855 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFW4 protein_id gnl|my_center|LOCUS_37010 2848 3078 gene locus_tag LOCUS_37020 2848 3078 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071966.1 protein_id gnl|my_center|LOCUS_37020 3080 4993 gene locus_tag LOCUS_37030 gene uup 3080 4993 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071967.1 protein_id gnl|my_center|LOCUS_37030 5023 6861 gene locus_tag LOCUS_37040 5023 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071968.1 protein_id gnl|my_center|LOCUS_37040 7044 7220 gene locus_tag LOCUS_37050 gene rmf 7044 7220 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFW0 protein_id gnl|my_center|LOCUS_37050 7834 7319 gene locus_tag LOCUS_37060 gene fabA 7834 7319 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV9 protein_id gnl|my_center|LOCUS_37060 9290 7911 gene locus_tag LOCUS_37070 9290 7911 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071971.1 protein_id gnl|my_center|LOCUS_37070 9721 9811 gene locus_tag LOCUS_t00580 9721 9811 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence70 1217 141 gene locus_tag LOCUS_37080 gene fabH 1217 141 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDA9 protein_id gnl|my_center|LOCUS_37080 1975 1304 gene locus_tag LOCUS_37090 gene hypR 1975 1304 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 protein_id gnl|my_center|LOCUS_37090 4603 2276 gene locus_tag LOCUS_37100 gene omcA 4603 2276 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071902.1 protein_id gnl|my_center|LOCUS_37100 4944 5588 gene locus_tag LOCUS_37110 gene ydhY 4944 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070227.1 protein_id gnl|my_center|LOCUS_37110 5602 7725 gene locus_tag LOCUS_37120 5602 7725 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 protein_id gnl|my_center|LOCUS_37120 7729 8253 gene locus_tag LOCUS_37130 7729 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 8445 8999 gene locus_tag LOCUS_37140 gene gmhB 8445 8999 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence71 1696 914 gene locus_tag LOCUS_37150 gene argB 1696 914 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59301 protein_id gnl|my_center|LOCUS_37150 2710 1730 gene locus_tag LOCUS_37160 gene argC 2710 1730 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59309 protein_id gnl|my_center|LOCUS_37160 2976 4127 gene locus_tag LOCUS_37170 gene argE 2976 4127 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTH4 protein_id gnl|my_center|LOCUS_37170 4272 6908 gene locus_tag LOCUS_37180 gene ppc 4272 6908 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK30 protein_id gnl|my_center|LOCUS_37180 6905 7444 gene locus_tag LOCUS_37190 6905 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070645.1 protein_id gnl|my_center|LOCUS_37190 8806 7532 gene locus_tag LOCUS_37200 gene pncC 8806 7532 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK32 protein_id gnl|my_center|LOCUS_37200 9146 9070 gene locus_tag LOCUS_t00590 9146 9070 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence72 3 78 gene locus_tag LOCUS_t00600 3 78 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 114 189 gene locus_tag LOCUS_t00610 114 189 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 218 293 gene locus_tag LOCUS_t00620 218 293 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 313 388 gene locus_tag LOCUS_t00630 313 388 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 607 1776 gene locus_tag LOCUS_37210 607 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_37210 2104 1910 gene locus_tag LOCUS_37220 2104 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4182 2230 gene locus_tag LOCUS_37230 gene acsA 4182 2230 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK3 protein_id gnl|my_center|LOCUS_37230 4512 7940 gene locus_tag LOCUS_37240 gene prlS 4512 7940 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072681.1 protein_id gnl|my_center|LOCUS_37240 8805 8011 gene locus_tag LOCUS_37250 8805 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence73 84 632 gene locus_tag LOCUS_37260 84 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 643 2013 gene locus_tag LOCUS_37270 643 2013 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074025.1 protein_id gnl|my_center|LOCUS_37270 2006 2368 gene locus_tag LOCUS_37280 2006 2368 CDS product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074026.1 protein_id gnl|my_center|LOCUS_37280 2365 4077 gene locus_tag LOCUS_37290 2365 4077 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074027.1 protein_id gnl|my_center|LOCUS_37290 4074 5627 gene locus_tag LOCUS_37300 4074 5627 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074028.1 protein_id gnl|my_center|LOCUS_37300 5624 6061 gene locus_tag LOCUS_37310 5624 6061 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 protein_id gnl|my_center|LOCUS_37310 6058 6909 gene locus_tag LOCUS_37320 6058 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence74 1038 157 gene locus_tag LOCUS_37330 1038 157 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072017.1 protein_id gnl|my_center|LOCUS_37330 1186 2448 gene locus_tag LOCUS_37340 1186 2448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072018.1 protein_id gnl|my_center|LOCUS_37340 4055 2658 gene locus_tag LOCUS_37350 gene dctM 4055 2658 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_37350 4741 4064 gene locus_tag LOCUS_37360 gene dctQ 4741 4064 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_37360 5767 4748 gene locus_tag LOCUS_37370 gene dctP 5767 4748 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_37370 6247 6020 gene locus_tag LOCUS_37380 6247 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073026.1 protein_id gnl|my_center|LOCUS_37380 6511 7920 gene locus_tag LOCUS_37390 gene gltX 6511 7920 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ0 protein_id gnl|my_center|LOCUS_37390 >Feature sequence75 1415 630 gene locus_tag LOCUS_37400 1415 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 1939 1628 gene locus_tag LOCUS_37410 1939 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 3168 2068 gene locus_tag LOCUS_37420 3168 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104753.1 protein_id gnl|my_center|LOCUS_37420 6543 3253 gene locus_tag LOCUS_37430 6543 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 7430 6540 gene locus_tag LOCUS_37440 7430 6540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257973.1 protein_id gnl|my_center|LOCUS_37440 <8047 7435 gene locus_tag LOCUS_37450 <8047 7435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705045.1:type IV secretion protein Rhs >Feature sequence76 3317 111 gene locus_tag LOCUS_37460 3317 111 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070924.1 protein_id gnl|my_center|LOCUS_37460 4283 3393 gene locus_tag LOCUS_37470 4283 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_37470 5149 4286 gene locus_tag LOCUS_37480 gene psd 5149 4286 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW03 protein_id gnl|my_center|LOCUS_37480 6227 5181 gene locus_tag LOCUS_37490 gene rsgA 6227 5181 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ79 protein_id gnl|my_center|LOCUS_37490 6358 6903 gene locus_tag LOCUS_37500 gene orn 6358 6903 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ78 protein_id gnl|my_center|LOCUS_37500 7110 7185 gene locus_tag LOCUS_t00640 7110 7185 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7232 7307 gene locus_tag LOCUS_t00650 7232 7307 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7354 7429 gene locus_tag LOCUS_t00660 7354 7429 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence77 80 5 gene locus_tag LOCUS_t00670 80 5 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 184 109 gene locus_tag LOCUS_t00680 184 109 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 282 207 gene locus_tag LOCUS_t00690 282 207 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 406 331 gene locus_tag LOCUS_t00700 406 331 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1305 3317 gene locus_tag LOCUS_37510 gene uvrB 1305 3317 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE83 protein_id gnl|my_center|LOCUS_37510 4019 3477 gene locus_tag LOCUS_37520 4019 3477 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 protein_id gnl|my_center|LOCUS_37520 4825 4049 gene locus_tag LOCUS_37530 gene queC 4825 4049 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE85 protein_id gnl|my_center|LOCUS_37530 4982 5650 gene locus_tag LOCUS_37540 gene queE 4982 5650 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE87 protein_id gnl|my_center|LOCUS_37540 6777 5713 gene locus_tag LOCUS_37550 6777 5713 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 protein_id gnl|my_center|LOCUS_37550 7041 6957 gene locus_tag LOCUS_t00710 7041 6957 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence78 217 1365 gene locus_tag LOCUS_37560 gene sdaR 217 1365 CDS product CdaR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071897.1 protein_id gnl|my_center|LOCUS_37560 1522 2880 gene locus_tag LOCUS_37570 gene grtP 1522 2880 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071896.1 protein_id gnl|my_center|LOCUS_37570 2935 4095 gene locus_tag LOCUS_37580 gene garK 2935 4095 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 protein_id gnl|my_center|LOCUS_37580 4236 5882 gene locus_tag LOCUS_37590 4236 5882 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 protein_id gnl|my_center|LOCUS_37590 6936 5887 gene locus_tag LOCUS_37600 6936 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence79 1368 1928 gene locus_tag LOCUS_37610 1368 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 2079 2003 gene locus_tag LOCUS_t00720 2079 2003 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2641 2192 gene locus_tag LOCUS_37620 gene sufE 2641 2192 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073562.1 protein_id gnl|my_center|LOCUS_37620 3859 2645 gene locus_tag LOCUS_37630 gene sufS 3859 2645 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV2 protein_id gnl|my_center|LOCUS_37630 4979 3939 gene locus_tag LOCUS_37640 4979 3939 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071182.1 protein_id gnl|my_center|LOCUS_37640 5444 6139 gene locus_tag LOCUS_37650 5444 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence80 333 3557 gene locus_tag LOCUS_37660 333 3557 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_37660 4211 4894 gene locus_tag LOCUS_37670 4211 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 4912 5322 gene locus_tag LOCUS_37680 4912 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 5608 5354 gene locus_tag LOCUS_37690 5608 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence81 <1 1533 gene locus_tag LOCUS_37700 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000212125.1:type IV secretion protein Rhs 1538 2065 gene locus_tag LOCUS_37710 1538 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2067 2357 gene locus_tag LOCUS_37720 2067 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 2368 2724 gene locus_tag LOCUS_37730 2368 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2714 4513 gene locus_tag LOCUS_37740 2714 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence82 24 203 gene locus_tag LOCUS_37750 24 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 207 1703 gene locus_tag LOCUS_37760 gene opuE 207 1703 CDS product osmoregulated proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06493 protein_id gnl|my_center|LOCUS_37760 1809 2951 gene locus_tag LOCUS_37770 gene proB 1809 2951 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S355 protein_id gnl|my_center|LOCUS_37770 2998 4245 gene locus_tag LOCUS_37780 gene proA 2998 4245 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S354 protein_id gnl|my_center|LOCUS_37780 >Feature sequence83 149 733 gene locus_tag LOCUS_37790 149 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 747 1436 gene locus_tag LOCUS_37800 747 1436 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074241.1 protein_id gnl|my_center|LOCUS_37800 1436 2785 gene locus_tag LOCUS_37810 1436 2785 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence84 160 414 gene locus_tag LOCUS_37820 gene rpmA 160 414 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB81 protein_id gnl|my_center|LOCUS_37820 549 1715 gene locus_tag LOCUS_37830 gene obg 549 1715 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB83 protein_id gnl|my_center|LOCUS_37830 1739 2500 gene locus_tag LOCUS_37840 1739 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073449.1 protein_id gnl|my_center|LOCUS_37840 2497 2967 gene locus_tag LOCUS_37850 2497 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073448.1 protein_id gnl|my_center|LOCUS_37850 2991 3473 gene locus_tag LOCUS_37860 gene folA 2991 3473 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_37860 3606 3995 gene locus_tag LOCUS_37870 3606 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073446.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence85 436 361 gene locus_tag LOCUS_t00730 436 361 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 519 446 gene locus_tag LOCUS_t00740 519 446 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 640 556 gene locus_tag LOCUS_t00750 640 556 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 724 649 gene locus_tag LOCUS_t00760 724 649 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 958 1905 gene locus_tag LOCUS_37880 gene coaA 958 1905 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK83 protein_id gnl|my_center|LOCUS_37880 2865 1906 gene locus_tag LOCUS_37890 gene birA 2865 1906 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK84 protein_id gnl|my_center|LOCUS_37890 3785 2868 gene locus_tag LOCUS_37900 gene murB 3785 2868 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK85 protein_id gnl|my_center|LOCUS_37900 4292 4173 gene locus_tag LOCUS_37910 4292 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 >Feature sequence86 1613 2746 gene locus_tag LOCUS_37920 gene hisC 1613 2746 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_37920 2853 3311 gene locus_tag LOCUS_37930 2853 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 3308 3721 gene locus_tag LOCUS_37940 3308 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 4090 4016 gene locus_tag LOCUS_t00770 4090 4016 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4234 4158 gene locus_tag LOCUS_t00780 4234 4158 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4335 4261 gene locus_tag LOCUS_t00790 4335 4261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence87 1552 650 gene locus_tag LOCUS_37950 gene pssA 1552 650 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_37950 1665 2087 gene locus_tag LOCUS_37960 1665 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073397.1 protein_id gnl|my_center|LOCUS_37960 3100 2165 gene locus_tag LOCUS_37970 gene mdh 3100 2165 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P82177 protein_id gnl|my_center|LOCUS_37970 3386 3856 gene locus_tag LOCUS_37980 gene argR 3386 3856 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR6 protein_id gnl|my_center|LOCUS_37980 >Feature sequence88 83 9 gene locus_tag LOCUS_t00800 83 9 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 203 119 gene locus_tag LOCUS_t00810 203 119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 311 235 gene locus_tag LOCUS_t00820 311 235 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1578 487 gene locus_tag LOCUS_37990 gene ychF 1578 487 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN4 protein_id gnl|my_center|LOCUS_37990 2251 1664 gene locus_tag LOCUS_38000 gene pth 2251 1664 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN5 protein_id gnl|my_center|LOCUS_38000 >Feature sequence89