>Feature sequence001 174 845 gene locus_tag LOCUS_00010 174 845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948970.1 protein_id gnl|my_center|LOCUS_00010 842 1537 gene locus_tag LOCUS_00020 842 1537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437066.1 protein_id gnl|my_center|LOCUS_00020 2430 1534 gene locus_tag LOCUS_00030 2430 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3126 2485 gene locus_tag LOCUS_00040 gene rex 3126 2485 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05521 protein_id gnl|my_center|LOCUS_00040 4288 3167 gene locus_tag LOCUS_00050 4288 3167 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_00050 4674 4291 gene locus_tag LOCUS_00060 4674 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6622 4679 gene locus_tag LOCUS_00070 6622 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8365 6626 gene locus_tag LOCUS_00080 gene hymC 8365 6626 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_00080 10244 8286 gene locus_tag LOCUS_00090 10244 8286 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393220.1 protein_id gnl|my_center|LOCUS_00090 10704 10246 gene locus_tag LOCUS_00100 10704 10246 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_00100 10817 11074 gene locus_tag LOCUS_00110 10817 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11064 12947 gene locus_tag LOCUS_00120 11064 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12944 14131 gene locus_tag LOCUS_00130 12944 14131 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_00130 14670 14185 gene locus_tag LOCUS_00140 14670 14185 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_00140 16470 14692 gene locus_tag LOCUS_00150 16470 14692 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_00150 17947 16478 gene locus_tag LOCUS_00160 17947 16478 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 18354 17950 gene locus_tag LOCUS_00170 18354 17950 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_00170 20377 18587 gene locus_tag LOCUS_00180 20377 18587 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00180 21580 20399 gene locus_tag LOCUS_00190 21580 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 22055 21591 gene locus_tag LOCUS_00200 22055 21591 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_00200 24317 22206 gene locus_tag LOCUS_00210 24317 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26700 24526 gene locus_tag LOCUS_00220 gene dpp11 26700 24526 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_00220 27312 26704 gene locus_tag LOCUS_00230 27312 26704 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R56 protein_id gnl|my_center|LOCUS_00230 28277 27315 gene locus_tag LOCUS_00240 28277 27315 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_00240 28789 28274 gene locus_tag LOCUS_00250 gene kdsC 28789 28274 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_00250 29585 28803 gene locus_tag LOCUS_00260 29585 28803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_00260 31441 29660 gene locus_tag LOCUS_00270 31441 29660 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_00270 33550 31475 gene locus_tag LOCUS_00280 33550 31475 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_00280 34567 33602 gene locus_tag LOCUS_00290 gene etfA 34567 33602 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_00290 35342 34593 gene locus_tag LOCUS_00300 gene etfB 35342 34593 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_00300 37192 35480 gene locus_tag LOCUS_00310 gene cstA 37192 35480 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_00310 37603 37280 gene locus_tag LOCUS_00320 37603 37280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_00320 41896 37622 gene locus_tag LOCUS_00330 gene rpoC 41896 37622 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_00330 45764 41955 gene locus_tag LOCUS_00340 gene rpoB 45764 41955 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ7 protein_id gnl|my_center|LOCUS_00340 46248 45871 gene locus_tag LOCUS_00350 gene rplL 46248 45871 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_00350 46811 46287 gene locus_tag LOCUS_00360 46811 46287 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_00360 47532 46837 gene locus_tag LOCUS_00370 gene rplA 47532 46837 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_00370 47987 47550 gene locus_tag LOCUS_00380 gene rplK 47987 47550 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_00380 48809 48120 gene locus_tag LOCUS_00390 gene nusG 48809 48120 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_00390 48963 48890 gene locus_tag LOCUS_t00010 48963 48890 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 50118 49030 gene locus_tag LOCUS_00400 gene tuf 50118 49030 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_00400 50348 50276 gene locus_tag LOCUS_t00020 50348 50276 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50428 50356 gene locus_tag LOCUS_t00030 50428 50356 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50525 50442 gene locus_tag LOCUS_t00040 50525 50442 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 50617 50543 gene locus_tag LOCUS_t00050 50617 50543 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 51028 50729 gene locus_tag LOCUS_00410 51028 50729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51949 51056 gene locus_tag LOCUS_00420 gene xerC 51949 51056 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_00420 52217 52020 gene locus_tag LOCUS_00430 gene rpsU 52217 52020 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_00430 52910 52314 gene locus_tag LOCUS_00440 52910 52314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54354 52984 gene locus_tag LOCUS_00450 54354 52984 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z78 protein_id gnl|my_center|LOCUS_00450 55467 54394 gene locus_tag LOCUS_00460 55467 54394 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 protein_id gnl|my_center|LOCUS_00460 57909 55639 gene locus_tag LOCUS_00470 57909 55639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_00470 58109 58888 gene locus_tag LOCUS_00480 58109 58888 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_00480 60443 58869 gene locus_tag LOCUS_00490 60443 58869 CDS product NAD-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_00490 61067 60447 gene locus_tag LOCUS_00500 gene porT 61067 60447 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_00500 61933 61214 gene locus_tag LOCUS_00510 gene menG 61933 61214 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_00510 62731 61958 gene locus_tag LOCUS_00520 62731 61958 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_00520 64359 62752 gene locus_tag LOCUS_00530 64359 62752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 65112 64360 gene locus_tag LOCUS_00540 65112 64360 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_00540 65365 66102 gene locus_tag LOCUS_00550 65365 66102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 66614 66105 gene locus_tag LOCUS_00560 gene moaB 66614 66105 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_00560 67057 66611 gene locus_tag LOCUS_00570 67057 66611 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214726.1 protein_id gnl|my_center|LOCUS_00570 67808 67089 gene locus_tag LOCUS_00580 gene moaA 67808 67089 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ09 protein_id gnl|my_center|LOCUS_00580 69048 67873 gene locus_tag LOCUS_00590 69048 67873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69203 69508 gene locus_tag LOCUS_00600 69203 69508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70097 71272 gene locus_tag LOCUS_00610 70097 71272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71285 71614 gene locus_tag LOCUS_00620 71285 71614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72625 71747 gene locus_tag LOCUS_00630 72625 71747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73187 72609 gene locus_tag LOCUS_00640 73187 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73878 73138 gene locus_tag LOCUS_00650 73878 73138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 74319 73924 gene locus_tag LOCUS_00660 74319 73924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 74641 74360 gene locus_tag LOCUS_00670 74641 74360 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_00670 77050 74747 gene locus_tag LOCUS_00680 77050 74747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78631 77252 gene locus_tag LOCUS_00690 78631 77252 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_00690 80902 78749 gene locus_tag LOCUS_00700 80902 78749 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_00700 81039 81770 gene locus_tag LOCUS_00710 81039 81770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 81740 82330 gene locus_tag LOCUS_00720 81740 82330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 82398 83480 gene locus_tag LOCUS_00730 82398 83480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83413 83685 gene locus_tag LOCUS_00740 83413 83685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 83788 84342 gene locus_tag LOCUS_00750 83788 84342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 84369 84938 gene locus_tag LOCUS_00760 84369 84938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 84919 85866 gene locus_tag LOCUS_00770 84919 85866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 86569 85910 gene locus_tag LOCUS_00780 86569 85910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 86588 88267 gene locus_tag LOCUS_00790 gene pruA 86588 88267 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_00790 88306 89607 gene locus_tag LOCUS_00800 88306 89607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_00800 89610 90311 gene locus_tag LOCUS_00810 89610 90311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 90337 90645 gene locus_tag LOCUS_00820 90337 90645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 91941 90670 gene locus_tag LOCUS_00830 91941 90670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 92549 91938 gene locus_tag LOCUS_00840 92549 91938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203201.1 protein_id gnl|my_center|LOCUS_00840 94006 92633 gene locus_tag LOCUS_00850 94006 92633 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435305.1 protein_id gnl|my_center|LOCUS_00850 94156 97392 gene locus_tag LOCUS_00860 94156 97392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 98374 97805 gene locus_tag LOCUS_00870 98374 97805 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_00870 98502 99170 gene locus_tag LOCUS_00880 98502 99170 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_00880 99167 100246 gene locus_tag LOCUS_00890 99167 100246 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_00890 100243 101862 gene locus_tag LOCUS_00900 100243 101862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 101841 102929 gene locus_tag LOCUS_00910 101841 102929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 103019 103912 gene locus_tag LOCUS_00920 103019 103912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 103905 105206 gene locus_tag LOCUS_00930 103905 105206 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_00930 105997 105188 gene locus_tag LOCUS_00940 105997 105188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 108252 106045 gene locus_tag LOCUS_00950 108252 106045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 109180 108341 gene locus_tag LOCUS_00960 gene mqnD 109180 108341 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_00960 109862 109182 gene locus_tag LOCUS_00970 109862 109182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109950 110576 gene locus_tag LOCUS_00980 gene folE 109950 110576 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P85 protein_id gnl|my_center|LOCUS_00980 110595 111479 gene locus_tag LOCUS_00990 110595 111479 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M6 protein_id gnl|my_center|LOCUS_00990 112123 111611 gene locus_tag LOCUS_01000 112123 111611 CDS product HybD peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_01000 113590 112130 gene locus_tag LOCUS_01010 113590 112130 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_01010 114659 113667 gene locus_tag LOCUS_01020 114659 113667 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_01020 115095 114670 gene locus_tag LOCUS_01030 115095 114670 CDS product methyl-viologen-reducing hydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_01030 116825 115098 gene locus_tag LOCUS_01040 116825 115098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 118024 116837 gene locus_tag LOCUS_01050 118024 116837 CDS product QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_01050 119796 118021 gene locus_tag LOCUS_01060 gene hdrA 119796 118021 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TYP4 protein_id gnl|my_center|LOCUS_01060 120123 120737 gene locus_tag LOCUS_01070 gene rex 120123 120737 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZB8 protein_id gnl|my_center|LOCUS_01070 120748 120981 gene locus_tag LOCUS_01080 120748 120981 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_01080 120978 122057 gene locus_tag LOCUS_01090 gene hypD 120978 122057 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GD8 protein_id gnl|my_center|LOCUS_01090 122071 123084 gene locus_tag LOCUS_01100 gene hypE 122071 123084 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_01100 124431 123097 gene locus_tag LOCUS_01110 gene gdhB 124431 123097 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94316 protein_id gnl|my_center|LOCUS_01110 127610 124614 gene locus_tag LOCUS_01120 127610 124614 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_01120 131095 127622 gene locus_tag LOCUS_01130 131095 127622 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_01130 132207 131191 gene locus_tag LOCUS_01140 132207 131191 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_01140 134057 132210 gene locus_tag LOCUS_01150 134057 132210 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_01150 134369 134884 gene locus_tag LOCUS_01160 134369 134884 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_01160 135699 134932 gene locus_tag LOCUS_01170 gene murI 135699 134932 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_01170 136272 135754 gene locus_tag LOCUS_01180 136272 135754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_01180 136813 136346 gene locus_tag LOCUS_01190 136813 136346 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_01190 139466 137013 gene locus_tag LOCUS_01200 139466 137013 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_01200 140253 139516 gene locus_tag LOCUS_01210 gene uppS 140253 139516 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E0 protein_id gnl|my_center|LOCUS_01210 140849 140253 gene locus_tag LOCUS_01220 140849 140253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 141851 140943 gene locus_tag LOCUS_01230 gene nadK 141851 140943 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_01230 142570 141905 gene locus_tag LOCUS_01240 142570 141905 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_01240 142630 143349 gene locus_tag LOCUS_01250 gene pdxJ 142630 143349 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_01250 143342 144064 gene locus_tag LOCUS_01260 143342 144064 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_01260 144928 144119 gene locus_tag LOCUS_01270 144928 144119 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_01270 145551 144937 gene locus_tag LOCUS_01280 gene udk 145551 144937 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE1 protein_id gnl|my_center|LOCUS_01280 145597 145911 gene locus_tag LOCUS_01290 145597 145911 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789142.1 protein_id gnl|my_center|LOCUS_01290 145938 146936 gene locus_tag LOCUS_01300 145938 146936 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_01300 146933 147529 gene locus_tag LOCUS_01310 gene engB 146933 147529 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_01310 147622 148560 gene locus_tag LOCUS_01320 147622 148560 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538156.1 protein_id gnl|my_center|LOCUS_01320 148674 149312 gene locus_tag LOCUS_01330 gene rplY 148674 149312 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_01330 149344 149922 gene locus_tag LOCUS_01340 gene pth 149344 149922 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_01340 149989 151278 gene locus_tag LOCUS_01350 149989 151278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 151387 152088 gene locus_tag LOCUS_01360 gene rprY 151387 152088 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_01360 152085 152459 gene locus_tag LOCUS_01370 152085 152459 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_01370 152469 153014 gene locus_tag LOCUS_01380 152469 153014 CDS product DUF4924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_01380 153650 153018 gene locus_tag LOCUS_01390 153650 153018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_01390 154426 153698 gene locus_tag LOCUS_01400 154426 153698 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_01400 157289 154431 gene locus_tag LOCUS_01410 157289 154431 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_01410 158753 157329 gene locus_tag LOCUS_01420 158753 157329 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_01420 158826 159515 gene locus_tag LOCUS_01430 158826 159515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 159599 160201 gene locus_tag LOCUS_01440 159599 160201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 160210 161613 gene locus_tag LOCUS_01450 gene hisS 160210 161613 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_01450 161745 163343 gene locus_tag LOCUS_01460 gene hutH 161745 163343 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58083 protein_id gnl|my_center|LOCUS_01460 163884 163366 gene locus_tag LOCUS_01470 163884 163366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_01470 164305 163871 gene locus_tag LOCUS_01480 164305 163871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 164888 164349 gene locus_tag LOCUS_01490 164888 164349 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_01490 166984 164948 gene locus_tag LOCUS_01500 166984 164948 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAW5 protein_id gnl|my_center|LOCUS_01500 167078 168175 gene locus_tag LOCUS_01510 gene ychF 167078 168175 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_01510 168244 169839 gene locus_tag LOCUS_01520 168244 169839 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947578.1 protein_id gnl|my_center|LOCUS_01520 169973 171475 gene locus_tag LOCUS_01530 169973 171475 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_01530 171465 172196 gene locus_tag LOCUS_01540 171465 172196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 172938 172174 gene locus_tag LOCUS_01550 gene pcrB 172938 172174 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_01550 173528 172914 gene locus_tag LOCUS_01560 gene gldD 173528 172914 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_01560 174892 173630 gene locus_tag LOCUS_01570 174892 173630 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_01570 175345 174905 gene locus_tag LOCUS_01580 gene ssb-1 175345 174905 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B90 protein_id gnl|my_center|LOCUS_01580 175715 175999 gene locus_tag LOCUS_01590 175715 175999 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_01590 176238 177788 gene locus_tag LOCUS_01600 176238 177788 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_01600 177876 179882 gene locus_tag LOCUS_01610 gene dsbD 177876 179882 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_01610 181827 179929 gene locus_tag LOCUS_01620 181827 179929 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886977.1 protein_id gnl|my_center|LOCUS_01620 182544 181909 gene locus_tag LOCUS_01630 182544 181909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 183542 182550 gene locus_tag LOCUS_01640 gene rpoA 183542 182550 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN5 protein_id gnl|my_center|LOCUS_01640 184175 183564 gene locus_tag LOCUS_01650 gene rpsD 184175 183564 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_01650 184600 184208 gene locus_tag LOCUS_01660 gene rpsK 184600 184208 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_01660 184986 184609 gene locus_tag LOCUS_01670 gene rpsM 184986 184609 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_01670 185366 185145 gene locus_tag LOCUS_01680 gene infA 185366 185145 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_01680 186154 185375 gene locus_tag LOCUS_01690 gene map 186154 185375 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM9 protein_id gnl|my_center|LOCUS_01690 187508 186177 gene locus_tag LOCUS_01700 gene secY 187508 186177 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_01700 187959 187513 gene locus_tag LOCUS_01710 gene rplO 187959 187513 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_01710 188195 187980 gene locus_tag LOCUS_01720 gene rpmD 188195 187980 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM6 protein_id gnl|my_center|LOCUS_01720 188703 188188 gene locus_tag LOCUS_01730 gene rpsE 188703 188188 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_01730 189068 188709 gene locus_tag LOCUS_01740 gene rplR 189068 188709 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ4 protein_id gnl|my_center|LOCUS_01740 189650 189093 gene locus_tag LOCUS_01750 gene rplF 189650 189093 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A491 protein_id gnl|my_center|LOCUS_01750 190058 189663 gene locus_tag LOCUS_01760 gene rpsH 190058 189663 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_01760 190344 190075 gene locus_tag LOCUS_01770 gene rpsN 190344 190075 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_01770 190904 190347 gene locus_tag LOCUS_01780 gene rplE 190904 190347 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM0 protein_id gnl|my_center|LOCUS_01780 191227 190904 gene locus_tag LOCUS_01790 gene rplX 191227 190904 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_01790 191611 191246 gene locus_tag LOCUS_01800 gene rplN 191611 191246 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_01800 191874 191614 gene locus_tag LOCUS_01810 gene rpsQ 191874 191614 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_01810 192089 191880 gene locus_tag LOCUS_01820 192089 191880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 192523 192089 gene locus_tag LOCUS_01830 gene rplP 192523 192089 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_01830 193241 192549 gene locus_tag LOCUS_01840 gene rpsC 193241 192549 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A482 protein_id gnl|my_center|LOCUS_01840 193658 193242 gene locus_tag LOCUS_01850 gene rplV 193658 193242 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL3 protein_id gnl|my_center|LOCUS_01850 193959 193690 gene locus_tag LOCUS_01860 gene rpsS 193959 193690 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_01860 194801 193980 gene locus_tag LOCUS_01870 gene rplB 194801 193980 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_01870 195098 194808 gene locus_tag LOCUS_01880 gene rplW 195098 194808 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_01880 195740 195111 gene locus_tag LOCUS_01890 gene rplD 195740 195111 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_01890 196363 195740 gene locus_tag LOCUS_01900 gene rplC 196363 195740 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A476 protein_id gnl|my_center|LOCUS_01900 196687 196382 gene locus_tag LOCUS_01910 gene rpsJ 196687 196382 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A475 protein_id gnl|my_center|LOCUS_01910 198811 196694 gene locus_tag LOCUS_01920 gene fusA 198811 196694 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A474 protein_id gnl|my_center|LOCUS_01920 199322 198846 gene locus_tag LOCUS_01930 gene rpsG 199322 198846 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK5 protein_id gnl|my_center|LOCUS_01930 199722 199345 gene locus_tag LOCUS_01940 gene rpsL 199722 199345 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK4 protein_id gnl|my_center|LOCUS_01940 200237 199845 gene locus_tag LOCUS_01950 200237 199845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 200541 203294 gene locus_tag LOCUS_01960 200541 203294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 203429 205585 gene locus_tag LOCUS_01970 203429 205585 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_01970 206925 205699 gene locus_tag LOCUS_01980 206925 205699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 207101 209368 gene locus_tag LOCUS_01990 207101 209368 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_01990 209468 210076 gene locus_tag LOCUS_02000 209468 210076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_02000 210101 211405 gene locus_tag LOCUS_02010 gene murA 210101 211405 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_02010 211499 212107 gene locus_tag LOCUS_02020 gene grpE 211499 212107 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_02020 212138 213283 gene locus_tag LOCUS_02030 gene dnaJ 212138 213283 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_02030 213302 214237 gene locus_tag LOCUS_02040 gene natA 213302 214237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_02040 214248 215585 gene locus_tag LOCUS_02050 gene natB 214248 215585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_02050 215615 216796 gene locus_tag LOCUS_02060 215615 216796 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_02060 217506 216793 gene locus_tag LOCUS_02070 217506 216793 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_02070 218192 217506 gene locus_tag LOCUS_02080 218192 217506 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_02080 221224 218240 gene locus_tag LOCUS_02090 221224 218240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 221299 222759 gene locus_tag LOCUS_02100 221299 222759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 223638 222745 gene locus_tag LOCUS_02110 223638 222745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 223712 225934 gene locus_tag LOCUS_02120 223712 225934 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_02120 226007 226480 gene locus_tag LOCUS_02130 gene coaD 226007 226480 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MK4 protein_id gnl|my_center|LOCUS_02130 226519 227154 gene locus_tag LOCUS_02140 gene pyrE 226519 227154 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_02140 227176 227595 gene locus_tag LOCUS_02150 227176 227595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 228256 227582 gene locus_tag LOCUS_02160 228256 227582 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_02160 228380 228751 gene locus_tag LOCUS_02170 gene rsfS 228380 228751 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_02170 228840 230987 gene locus_tag LOCUS_02180 gene ftsH 228840 230987 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA1 protein_id gnl|my_center|LOCUS_02180 230980 231630 gene locus_tag LOCUS_02190 230980 231630 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_02190 231636 231842 gene locus_tag LOCUS_02200 231636 231842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 231839 232654 gene locus_tag LOCUS_02210 231839 232654 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_02210 232659 233315 gene locus_tag LOCUS_02220 gene psd 232659 233315 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_02220 233420 233749 gene locus_tag LOCUS_02230 233420 233749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 234805 233804 gene locus_tag LOCUS_02240 234805 233804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_02240 234967 235704 gene locus_tag LOCUS_02250 gene pssA 234967 235704 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_02250 236887 235697 gene locus_tag LOCUS_02260 236887 235697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_02260 237968 236892 gene locus_tag LOCUS_02270 237968 236892 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_02270 241124 238146 gene locus_tag LOCUS_02280 241124 238146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence002 1554 163 gene locus_tag LOCUS_02290 1554 163 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_02290 3129 1966 gene locus_tag LOCUS_02300 3129 1966 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861825.1 protein_id gnl|my_center|LOCUS_02300 4125 3256 gene locus_tag LOCUS_02310 4125 3256 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_02310 5152 4118 gene locus_tag LOCUS_02320 gene yjmD 5152 4118 CDS product putative zinc-type alcohol dehydrogenase-like protein YjmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35045 protein_id gnl|my_center|LOCUS_02320 6800 5166 gene locus_tag LOCUS_02330 6800 5166 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_02330 7010 8230 gene locus_tag LOCUS_02340 gene xylR 7010 8230 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94490 protein_id gnl|my_center|LOCUS_02340 8306 9178 gene locus_tag LOCUS_02350 8306 9178 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_02350 9371 12490 gene locus_tag LOCUS_02360 9371 12490 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_02360 12509 13972 gene locus_tag LOCUS_02370 12509 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_02370 14287 15738 gene locus_tag LOCUS_02380 14287 15738 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124074.1 protein_id gnl|my_center|LOCUS_02380 15847 18228 gene locus_tag LOCUS_02390 15847 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_02390 18374 19732 gene locus_tag LOCUS_02400 18374 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_02400 19748 20872 gene locus_tag LOCUS_02410 19748 20872 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_02410 20869 21129 gene locus_tag LOCUS_02420 20869 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 21113 21652 gene locus_tag LOCUS_02430 21113 21652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 22129 22554 gene locus_tag LOCUS_02440 gene furR1 22129 22554 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_02440 22579 23295 gene locus_tag LOCUS_02450 22579 23295 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_02450 23382 23612 gene locus_tag LOCUS_02460 23382 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24185 24898 gene locus_tag LOCUS_02470 24185 24898 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_02470 25048 26625 gene locus_tag LOCUS_02480 gene aslA 25048 26625 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120093.1 protein_id gnl|my_center|LOCUS_02480 26618 27853 gene locus_tag LOCUS_02490 26618 27853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 27965 29287 gene locus_tag LOCUS_02500 27965 29287 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088280.1 protein_id gnl|my_center|LOCUS_02500 29405 30529 gene locus_tag LOCUS_02510 29405 30529 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_02510 30925 32487 gene locus_tag LOCUS_02520 30925 32487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 35103 32614 gene locus_tag LOCUS_02530 35103 32614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 35405 35644 gene locus_tag LOCUS_02540 35405 35644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_02540 35742 37592 gene locus_tag LOCUS_02550 gene glaB 35742 37592 CDS product alpha-1,3-galactosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZX0 protein_id gnl|my_center|LOCUS_02550 37665 37856 gene locus_tag LOCUS_02560 37665 37856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 37853 38917 gene locus_tag LOCUS_02570 gene yloQ 37853 38917 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJV8 protein_id gnl|my_center|LOCUS_02570 38826 39194 gene locus_tag LOCUS_02580 38826 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 39404 40339 gene locus_tag LOCUS_02590 39404 40339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 40661 40807 gene locus_tag LOCUS_02600 40661 40807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 40877 43834 gene locus_tag LOCUS_02610 40877 43834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 45138 43861 gene locus_tag LOCUS_02620 45138 43861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 46549 45389 gene locus_tag LOCUS_02630 gene rhlE 46549 45389 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY79 protein_id gnl|my_center|LOCUS_02630 48344 46740 gene locus_tag LOCUS_02640 48344 46740 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_02640 48705 48433 gene locus_tag LOCUS_02650 48705 48433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 48734 50518 gene locus_tag LOCUS_02660 48734 50518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 50646 51104 gene locus_tag LOCUS_02670 50646 51104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 54218 51168 gene locus_tag LOCUS_02680 54218 51168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_02680 54602 55870 gene locus_tag LOCUS_02690 54602 55870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 55964 57082 gene locus_tag LOCUS_02700 55964 57082 CDS product hydrophobic dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834W6 protein_id gnl|my_center|LOCUS_02700 57069 58181 gene locus_tag LOCUS_02710 57069 58181 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251167.1 protein_id gnl|my_center|LOCUS_02710 58908 58225 gene locus_tag LOCUS_02720 58908 58225 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391618.1 protein_id gnl|my_center|LOCUS_02720 60194 58905 gene locus_tag LOCUS_02730 60194 58905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 61237 62865 gene locus_tag LOCUS_02740 61237 62865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 62858 64573 gene locus_tag LOCUS_02750 62858 64573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 64679 65476 gene locus_tag LOCUS_02760 64679 65476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 66897 65635 gene locus_tag LOCUS_02770 66897 65635 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_02770 67057 68709 gene locus_tag LOCUS_02780 67057 68709 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_02780 68836 70095 gene locus_tag LOCUS_02790 gene adh 68836 70095 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_02790 70175 70357 gene locus_tag LOCUS_02800 70175 70357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 70451 72847 gene locus_tag LOCUS_02810 70451 72847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_02810 73035 74270 gene locus_tag LOCUS_02820 73035 74270 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_02820 77301 74248 gene locus_tag LOCUS_02830 77301 74248 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_02830 78947 77583 gene locus_tag LOCUS_02840 78947 77583 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_02840 80353 78959 gene locus_tag LOCUS_02850 80353 78959 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_02850 80560 81240 gene locus_tag LOCUS_02860 80560 81240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_02860 81285 83639 gene locus_tag LOCUS_02870 81285 83639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_02870 83833 86094 gene locus_tag LOCUS_02880 83833 86094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_02880 86114 87535 gene locus_tag LOCUS_02890 86114 87535 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 protein_id gnl|my_center|LOCUS_02890 87559 87717 gene locus_tag LOCUS_02900 87559 87717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 87750 90143 gene locus_tag LOCUS_02910 87750 90143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 90225 90848 gene locus_tag LOCUS_02920 90225 90848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_02920 90860 93652 gene locus_tag LOCUS_02930 90860 93652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 93698 95578 gene locus_tag LOCUS_02940 93698 95578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 95693 97099 gene locus_tag LOCUS_02950 95693 97099 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_02950 97129 98418 gene locus_tag LOCUS_02960 97129 98418 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_02960 98532 99248 gene locus_tag LOCUS_02970 98532 99248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118034.1 protein_id gnl|my_center|LOCUS_02970 99365 102148 gene locus_tag LOCUS_02980 99365 102148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 102145 105018 gene locus_tag LOCUS_02990 102145 105018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 105025 105339 gene locus_tag LOCUS_03000 gene rhaM 105025 105339 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A044 protein_id gnl|my_center|LOCUS_03000 105348 106460 gene locus_tag LOCUS_03010 105348 106460 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_03010 106527 107651 gene locus_tag LOCUS_03020 106527 107651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 107670 107993 gene locus_tag LOCUS_03030 107670 107993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_03030 108182 108631 gene locus_tag LOCUS_03040 108182 108631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 108669 108854 gene locus_tag LOCUS_03050 108669 108854 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_03050 109063 110475 gene locus_tag LOCUS_03060 109063 110475 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3P5 protein_id gnl|my_center|LOCUS_03060 110517 111923 gene locus_tag LOCUS_03070 110517 111923 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117895.1 protein_id gnl|my_center|LOCUS_03070 111926 113398 gene locus_tag LOCUS_03080 111926 113398 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_03080 113507 116791 gene locus_tag LOCUS_03090 113507 116791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 116796 119750 gene locus_tag LOCUS_03100 116796 119750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 119763 121031 gene locus_tag LOCUS_03110 gene rhaA 119763 121031 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A2 protein_id gnl|my_center|LOCUS_03110 121036 122301 gene locus_tag LOCUS_03120 121036 122301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_03120 122481 123572 gene locus_tag LOCUS_03130 122481 123572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 123651 125090 gene locus_tag LOCUS_03140 123651 125090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962770.1 protein_id gnl|my_center|LOCUS_03140 125105 126673 gene locus_tag LOCUS_03150 125105 126673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 127077 128042 gene locus_tag LOCUS_03160 127077 128042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 128094 130583 gene locus_tag LOCUS_03170 128094 130583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 130612 132030 gene locus_tag LOCUS_03180 gene nagA 130612 132030 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_03180 132035 134770 gene locus_tag LOCUS_03190 132035 134770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 134935 137535 gene locus_tag LOCUS_03200 134935 137535 CDS product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109093.1 protein_id gnl|my_center|LOCUS_03200 137832 138497 gene locus_tag LOCUS_03210 137832 138497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 138505 139860 gene locus_tag LOCUS_03220 138505 139860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 139934 143929 gene locus_tag LOCUS_03230 139934 143929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 143948 145216 gene locus_tag LOCUS_03240 gene mntH 143948 145216 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence003 <1 526 gene locus_tag LOCUS_03250 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887476.1:ion transporter 644 892 gene locus_tag LOCUS_03260 644 892 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730609.1 protein_id gnl|my_center|LOCUS_03260 905 1315 gene locus_tag LOCUS_03270 905 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2260 1319 gene locus_tag LOCUS_03280 2260 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3256 2264 gene locus_tag LOCUS_03290 3256 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4619 3426 gene locus_tag LOCUS_03300 4619 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7810 5006 gene locus_tag LOCUS_03310 7810 5006 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405034.1 protein_id gnl|my_center|LOCUS_03310 8569 8219 gene locus_tag LOCUS_03320 8569 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10243 8645 gene locus_tag LOCUS_03330 10243 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 12498 10390 gene locus_tag LOCUS_03340 12498 10390 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_03340 13771 12545 gene locus_tag LOCUS_03350 13771 12545 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_03350 14440 13916 gene locus_tag LOCUS_03360 14440 13916 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_03360 15861 14536 gene locus_tag LOCUS_03370 15861 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 protein_id gnl|my_center|LOCUS_03370 17191 15884 gene locus_tag LOCUS_03380 17191 15884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_03380 17931 17188 gene locus_tag LOCUS_03390 gene coaX 17931 17188 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_03390 18285 19646 gene locus_tag LOCUS_03400 18285 19646 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_03400 19636 21039 gene locus_tag LOCUS_03410 19636 21039 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107804.1 protein_id gnl|my_center|LOCUS_03410 21103 23496 gene locus_tag LOCUS_03420 21103 23496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_03420 25770 23827 gene locus_tag LOCUS_03430 gene dnaG 25770 23827 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_03430 25842 26567 gene locus_tag LOCUS_03440 gene cobB 25842 26567 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H9 protein_id gnl|my_center|LOCUS_03440 26732 26550 gene locus_tag LOCUS_03450 26732 26550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 27634 26834 gene locus_tag LOCUS_03460 27634 26834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 28425 27676 gene locus_tag LOCUS_03470 28425 27676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 30082 28430 gene locus_tag LOCUS_03480 30082 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 31398 30115 gene locus_tag LOCUS_03490 31398 30115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 32675 31401 gene locus_tag LOCUS_03500 gene ftsA 32675 31401 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_03500 33419 32697 gene locus_tag LOCUS_03510 33419 32697 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_03510 34818 33430 gene locus_tag LOCUS_03520 gene murC 34818 33430 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_03520 35934 34819 gene locus_tag LOCUS_03530 gene murG 35934 34819 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM1 protein_id gnl|my_center|LOCUS_03530 37057 35918 gene locus_tag LOCUS_03540 37057 35918 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_03540 38416 37079 gene locus_tag LOCUS_03550 gene murD 38416 37079 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_03550 39668 38421 gene locus_tag LOCUS_03560 gene mraY 39668 38421 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_03560 41129 39678 gene locus_tag LOCUS_03570 gene murE 41129 39678 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A254 protein_id gnl|my_center|LOCUS_03570 43249 41126 gene locus_tag LOCUS_03580 gene ftsI 43249 41126 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_03580 43638 43255 gene locus_tag LOCUS_03590 43638 43255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763719.1 protein_id gnl|my_center|LOCUS_03590 44543 43635 gene locus_tag LOCUS_03600 gene rsmH 44543 43635 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_03600 44941 44546 gene locus_tag LOCUS_03610 gene mraZ 44941 44546 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL3 protein_id gnl|my_center|LOCUS_03610 45173 46015 gene locus_tag LOCUS_03620 45173 46015 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_03620 46055 47098 gene locus_tag LOCUS_03630 46055 47098 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_03630 48984 47095 gene locus_tag LOCUS_03640 gene purF 48984 47095 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_03640 49527 49024 gene locus_tag LOCUS_03650 49527 49024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 50242 49499 gene locus_tag LOCUS_03660 50242 49499 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6F4 protein_id gnl|my_center|LOCUS_03660 50372 51658 gene locus_tag LOCUS_03670 gene miaB 50372 51658 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650P7 protein_id gnl|my_center|LOCUS_03670 53403 51655 gene locus_tag LOCUS_03680 gene aspS 53403 51655 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9E3 protein_id gnl|my_center|LOCUS_03680 53461 53913 gene locus_tag LOCUS_03690 gene tadA 53461 53913 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K5 protein_id gnl|my_center|LOCUS_03690 53942 55765 gene locus_tag LOCUS_03700 53942 55765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 56823 55762 gene locus_tag LOCUS_03710 56823 55762 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD2 protein_id gnl|my_center|LOCUS_03710 56893 58065 gene locus_tag LOCUS_03720 gene putA 56893 58065 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_03720 58066 58512 gene locus_tag LOCUS_03730 58066 58512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 58517 59224 gene locus_tag LOCUS_03740 58517 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 59202 59672 gene locus_tag LOCUS_03750 59202 59672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 59669 60523 gene locus_tag LOCUS_03760 59669 60523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 60558 61334 gene locus_tag LOCUS_03770 60558 61334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 61778 61344 gene locus_tag LOCUS_03780 61778 61344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 63692 62409 gene locus_tag LOCUS_03790 63692 62409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 64720 64277 gene locus_tag LOCUS_03800 64720 64277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 65039 66193 gene locus_tag LOCUS_03810 65039 66193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 66550 66933 gene locus_tag LOCUS_03820 66550 66933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 67154 67705 gene locus_tag LOCUS_03830 67154 67705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 67653 68057 gene locus_tag LOCUS_03840 67653 68057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 68032 68868 gene locus_tag LOCUS_03850 68032 68868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 68834 69685 gene locus_tag LOCUS_03860 68834 69685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 69682 70611 gene locus_tag LOCUS_03870 69682 70611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 70671 71786 gene locus_tag LOCUS_03880 gene smf 70671 71786 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_03880 71942 73282 gene locus_tag LOCUS_03890 gene gdhA 71942 73282 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_03890 73360 74124 gene locus_tag LOCUS_03900 gene tatD 73360 74124 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_03900 74139 75173 gene locus_tag LOCUS_03910 74139 75173 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_03910 75219 75309 gene locus_tag LOCUS_t00060 75219 75309 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75384 76205 gene locus_tag LOCUS_03920 75384 76205 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_03920 76230 76703 gene locus_tag LOCUS_03930 76230 76703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761056.1 protein_id gnl|my_center|LOCUS_03930 76746 77321 gene locus_tag LOCUS_03940 76746 77321 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_03940 77333 77818 gene locus_tag LOCUS_03950 77333 77818 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108110.1 protein_id gnl|my_center|LOCUS_03950 78807 77971 gene locus_tag LOCUS_03960 gene tatC 78807 77971 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_03960 79063 78857 gene locus_tag LOCUS_03970 79063 78857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 79265 82048 gene locus_tag LOCUS_03980 gene leuS 79265 82048 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG4 protein_id gnl|my_center|LOCUS_03980 82241 83302 gene locus_tag LOCUS_03990 82241 83302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 83313 84350 gene locus_tag LOCUS_04000 83313 84350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 84368 85480 gene locus_tag LOCUS_04010 84368 85480 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_04010 85553 86815 gene locus_tag LOCUS_04020 85553 86815 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 protein_id gnl|my_center|LOCUS_04020 87375 86806 gene locus_tag LOCUS_04030 gene purN 87375 86806 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_04030 87579 87815 gene locus_tag LOCUS_04040 gene acpP 87579 87815 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_04040 87842 89089 gene locus_tag LOCUS_04050 87842 89089 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E7 protein_id gnl|my_center|LOCUS_04050 89101 89820 gene locus_tag LOCUS_04060 gene rnc 89101 89820 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV9 protein_id gnl|my_center|LOCUS_04060 89823 90239 gene locus_tag LOCUS_04070 89823 90239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 91253 90300 gene locus_tag LOCUS_04080 91253 90300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 91435 93024 gene locus_tag LOCUS_04090 91435 93024 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_04090 93027 93707 gene locus_tag LOCUS_04100 93027 93707 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_04100 95504 93717 gene locus_tag LOCUS_04110 gene lepA 95504 93717 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_04110 96004 95564 gene locus_tag LOCUS_04120 96004 95564 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405207.1 protein_id gnl|my_center|LOCUS_04120 97334 96015 gene locus_tag LOCUS_04130 97334 96015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 99066 97426 gene locus_tag LOCUS_04140 gene groL 99066 97426 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QU2 protein_id gnl|my_center|LOCUS_04140 99380 99102 gene locus_tag LOCUS_04150 gene groS 99380 99102 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_04150 99967 99608 gene locus_tag LOCUS_04160 99967 99608 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_04160 101256 99976 gene locus_tag LOCUS_04170 101256 99976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 101694 101263 gene locus_tag LOCUS_04180 101694 101263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 103006 101771 gene locus_tag LOCUS_04190 103006 101771 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_04190 103160 103822 gene locus_tag LOCUS_04200 gene kdsB 103160 103822 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT5 protein_id gnl|my_center|LOCUS_04200 103835 105409 gene locus_tag LOCUS_04210 103835 105409 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_04210 106364 105387 gene locus_tag LOCUS_04220 106364 105387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_04220 108010 106370 gene locus_tag LOCUS_04230 108010 106370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 108863 108090 gene locus_tag LOCUS_04240 gene queG 108863 108090 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_04240 109325 109023 gene locus_tag LOCUS_04250 109325 109023 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_04250 109753 109328 gene locus_tag LOCUS_04260 109753 109328 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_04260 110987 109764 gene locus_tag LOCUS_04270 110987 109764 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ8 protein_id gnl|my_center|LOCUS_04270 112365 110998 gene locus_tag LOCUS_04280 112365 110998 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_04280 113123 112377 gene locus_tag LOCUS_04290 113123 112377 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_04290 114606 113158 gene locus_tag LOCUS_04300 114606 113158 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769206.1 protein_id gnl|my_center|LOCUS_04300 114734 115777 gene locus_tag LOCUS_04310 gene thiL 114734 115777 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_04310 116568 115798 gene locus_tag LOCUS_04320 gene lpxA 116568 115798 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_04320 117971 116577 gene locus_tag LOCUS_04330 117971 116577 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW9 protein_id gnl|my_center|LOCUS_04330 119069 118026 gene locus_tag LOCUS_04340 gene lpxD 119069 118026 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_04340 120369 119116 gene locus_tag LOCUS_04350 120369 119116 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_04350 120569 121033 gene locus_tag LOCUS_04360 120569 121033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 121051 122286 gene locus_tag LOCUS_04370 gene nusA 121051 122286 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_04370 >Feature sequence004 1377 271 gene locus_tag LOCUS_04380 1377 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202954.1 protein_id gnl|my_center|LOCUS_04380 2237 1530 gene locus_tag LOCUS_04390 2237 1530 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_04390 3305 2247 gene locus_tag LOCUS_04400 3305 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3456 5075 gene locus_tag LOCUS_04410 3456 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 8253 5092 gene locus_tag LOCUS_04420 8253 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108138.1 protein_id gnl|my_center|LOCUS_04420 10256 8298 gene locus_tag LOCUS_04430 10256 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 12498 10354 gene locus_tag LOCUS_04440 12498 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 13064 12570 gene locus_tag LOCUS_04450 13064 12570 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_04450 13342 13061 gene locus_tag LOCUS_04460 13342 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 14846 14100 gene locus_tag LOCUS_04470 14846 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 14928 16466 gene locus_tag LOCUS_04480 14928 16466 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_04480 17346 16459 gene locus_tag LOCUS_04490 17346 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 18951 17689 gene locus_tag LOCUS_04500 gene sorE 18951 17689 CDS product L-sorbose 1-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_04500 20985 19000 gene locus_tag LOCUS_04510 20985 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 22160 20997 gene locus_tag LOCUS_04520 22160 20997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 24631 22163 gene locus_tag LOCUS_04530 24631 22163 CDS product pyruvate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_04530 25995 24613 gene locus_tag LOCUS_04540 25995 24613 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q1 protein_id gnl|my_center|LOCUS_04540 27376 26009 gene locus_tag LOCUS_04550 27376 26009 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VEM3 protein_id gnl|my_center|LOCUS_04550 27530 28237 gene locus_tag LOCUS_04560 27530 28237 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_04560 29902 28316 gene locus_tag LOCUS_04570 29902 28316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 30210 29878 gene locus_tag LOCUS_04580 30210 29878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 32069 30402 gene locus_tag LOCUS_04590 32069 30402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 32092 32688 gene locus_tag LOCUS_04600 32092 32688 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_04600 32741 33823 gene locus_tag LOCUS_04610 32741 33823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 33816 35687 gene locus_tag LOCUS_04620 33816 35687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 35792 36994 gene locus_tag LOCUS_04630 35792 36994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 38466 36991 gene locus_tag LOCUS_04640 gene phoD 38466 36991 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_04640 40404 38653 gene locus_tag LOCUS_04650 40404 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 41309 40416 gene locus_tag LOCUS_04660 41309 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 41527 41309 gene locus_tag LOCUS_04670 41527 41309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 43386 41584 gene locus_tag LOCUS_04680 gene hdrA 43386 41584 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8TYP4 protein_id gnl|my_center|LOCUS_04680 44893 43430 gene locus_tag LOCUS_04690 44893 43430 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_04690 45864 44890 gene locus_tag LOCUS_04700 45864 44890 CDS product methyl viologen-reducing hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_04700 46306 45881 gene locus_tag LOCUS_04710 46306 45881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 48220 46829 gene locus_tag LOCUS_04720 gene panF 48220 46829 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44963 protein_id gnl|my_center|LOCUS_04720 48444 48217 gene locus_tag LOCUS_04730 48444 48217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 50069 48483 gene locus_tag LOCUS_04740 50069 48483 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_04740 50236 51345 gene locus_tag LOCUS_04750 50236 51345 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080642.1 protein_id gnl|my_center|LOCUS_04750 52795 51413 gene locus_tag LOCUS_04760 gene fucP 52795 51413 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_04760 53239 52805 gene locus_tag LOCUS_04770 gene fucU 53239 52805 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z427 protein_id gnl|my_center|LOCUS_04770 54232 53300 gene locus_tag LOCUS_04780 54232 53300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 57459 54247 gene locus_tag LOCUS_04790 57459 54247 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202201.1 protein_id gnl|my_center|LOCUS_04790 57683 61303 gene locus_tag LOCUS_04800 57683 61303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 61325 62035 gene locus_tag LOCUS_04810 61325 62035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 62161 64299 gene locus_tag LOCUS_04820 62161 64299 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107275.1 protein_id gnl|my_center|LOCUS_04820 64292 65800 gene locus_tag LOCUS_04830 64292 65800 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_04830 66585 65899 gene locus_tag LOCUS_04840 gene scdA 66585 65899 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_04840 66786 67520 gene locus_tag LOCUS_04850 66786 67520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 69006 67591 gene locus_tag LOCUS_04860 69006 67591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 69563 69012 gene locus_tag LOCUS_04870 69563 69012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 70087 70746 gene locus_tag LOCUS_04880 70087 70746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 70758 70985 gene locus_tag LOCUS_04890 70758 70985 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_04890 71004 72353 gene locus_tag LOCUS_04900 71004 72353 CDS product succinoglycan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036232.1 protein_id gnl|my_center|LOCUS_04900 72671 72462 gene locus_tag LOCUS_04910 72671 72462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 72818 73681 gene locus_tag LOCUS_04920 72818 73681 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_04920 75595 73763 gene locus_tag LOCUS_04930 75595 73763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_04930 77892 75595 gene locus_tag LOCUS_04940 77892 75595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 78885 78115 gene locus_tag LOCUS_04950 78885 78115 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_04950 80513 78864 gene locus_tag LOCUS_04960 80513 78864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 82764 80893 gene locus_tag LOCUS_04970 82764 80893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 82875 83312 gene locus_tag LOCUS_04980 82875 83312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 83319 84530 gene locus_tag LOCUS_04990 83319 84530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_04990 84658 85884 gene locus_tag LOCUS_05000 84658 85884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_05000 85910 86419 gene locus_tag LOCUS_05010 85910 86419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 88353 86503 gene locus_tag LOCUS_05020 88353 86503 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_05020 88870 88586 gene locus_tag LOCUS_05030 88870 88586 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_05030 89450 88863 gene locus_tag LOCUS_05040 89450 88863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 89575 90222 gene locus_tag LOCUS_05050 89575 90222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 92637 90235 gene locus_tag LOCUS_05060 92637 90235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_05060 94300 92726 gene locus_tag LOCUS_05070 94300 92726 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_05070 95565 94396 gene locus_tag LOCUS_05080 95565 94396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 96654 95632 gene locus_tag LOCUS_05090 96654 95632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 96825 99164 gene locus_tag LOCUS_05100 96825 99164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 100114 99179 gene locus_tag LOCUS_05110 100114 99179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 100324 101955 gene locus_tag LOCUS_05120 100324 101955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 103314 101986 gene locus_tag LOCUS_05130 103314 101986 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_05130 104729 103347 gene locus_tag LOCUS_05140 gene mttB 104729 103347 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P0C0W7 protein_id gnl|my_center|LOCUS_05140 106143 104902 gene locus_tag LOCUS_05150 106143 104902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 108452 106146 gene locus_tag LOCUS_05160 108452 106146 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_05160 109420 108440 gene locus_tag LOCUS_05170 109420 108440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 110379 109417 gene locus_tag LOCUS_05180 110379 109417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 110619 111791 gene locus_tag LOCUS_05190 110619 111791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 111918 114308 gene locus_tag LOCUS_05200 111918 114308 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_05200 114309 115241 gene locus_tag LOCUS_05210 114309 115241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 117207 115294 gene locus_tag LOCUS_05220 117207 115294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 117421 117966 gene locus_tag LOCUS_05230 117421 117966 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_05230 118639 118118 gene locus_tag LOCUS_05240 118639 118118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_05240 120239 118941 gene locus_tag LOCUS_05250 120239 118941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence005 <1 2344 gene locus_tag LOCUS_05260 <1 2344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405424.1:acylaminoacyl-peptidase 2405 3751 gene locus_tag LOCUS_05270 gene xylE 2405 3751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_05270 3766 5355 gene locus_tag LOCUS_05280 3766 5355 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108622.1 protein_id gnl|my_center|LOCUS_05280 5355 8117 gene locus_tag LOCUS_05290 5355 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8119 9744 gene locus_tag LOCUS_05300 8119 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_05300 9765 12239 gene locus_tag LOCUS_05310 9765 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12251 14062 gene locus_tag LOCUS_05320 12251 14062 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_05320 14116 15675 gene locus_tag LOCUS_05330 14116 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 15787 18066 gene locus_tag LOCUS_05340 15787 18066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_05340 18111 19547 gene locus_tag LOCUS_05350 gene arsA 18111 19547 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_05350 19552 22503 gene locus_tag LOCUS_05360 gene lacZ 19552 22503 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_05360 22593 24794 gene locus_tag LOCUS_05370 22593 24794 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_05370 26152 24836 gene locus_tag LOCUS_05380 26152 24836 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_05380 26902 26204 gene locus_tag LOCUS_05390 26902 26204 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_05390 27345 26905 gene locus_tag LOCUS_05400 27345 26905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 27590 27357 gene locus_tag LOCUS_05410 27590 27357 CDS product redox-active disulfide protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_05410 27949 27650 gene locus_tag LOCUS_05420 27949 27650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 29309 28104 gene locus_tag LOCUS_05430 29309 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 29583 31184 gene locus_tag LOCUS_05440 29583 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203329.1 protein_id gnl|my_center|LOCUS_05440 32091 31171 gene locus_tag LOCUS_05450 gene lpqC 32091 31171 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_05450 32314 33342 gene locus_tag LOCUS_05460 32314 33342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 33373 36414 gene locus_tag LOCUS_05470 33373 36414 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_05470 36425 37927 gene locus_tag LOCUS_05480 36425 37927 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_05480 37953 39509 gene locus_tag LOCUS_05490 37953 39509 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_05490 39541 43566 gene locus_tag LOCUS_05500 39541 43566 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_05500 43667 45676 gene locus_tag LOCUS_05510 43667 45676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 46466 45699 gene locus_tag LOCUS_05520 46466 45699 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_05520 47542 46463 gene locus_tag LOCUS_05530 47542 46463 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661662.1 protein_id gnl|my_center|LOCUS_05530 48142 47570 gene locus_tag LOCUS_05540 48142 47570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 49282 48167 gene locus_tag LOCUS_05550 49282 48167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 50682 49456 gene locus_tag LOCUS_05560 50682 49456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 51018 51602 gene locus_tag LOCUS_05570 51018 51602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 54841 52721 gene locus_tag LOCUS_05580 54841 52721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 55951 54863 gene locus_tag LOCUS_05590 55951 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 56344 55955 gene locus_tag LOCUS_05600 56344 55955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 57126 56368 gene locus_tag LOCUS_05610 gene fabG 57126 56368 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706106.1 protein_id gnl|my_center|LOCUS_05610 58435 57140 gene locus_tag LOCUS_05620 gene fabF 58435 57140 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7X3 protein_id gnl|my_center|LOCUS_05620 59511 58432 gene locus_tag LOCUS_05630 59511 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 59990 59508 gene locus_tag LOCUS_05640 gene fabZ 59990 59508 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61453 protein_id gnl|my_center|LOCUS_05640 61136 60054 gene locus_tag LOCUS_05650 61136 60054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 65539 61136 gene locus_tag LOCUS_05660 65539 61136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 66397 65705 gene locus_tag LOCUS_05670 66397 65705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 68033 66804 gene locus_tag LOCUS_05680 68033 66804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 68167 69288 gene locus_tag LOCUS_05690 68167 69288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 70036 69326 gene locus_tag LOCUS_05700 70036 69326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 72647 70263 gene locus_tag LOCUS_05710 gene pflD 72647 70263 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_05710 72866 73744 gene locus_tag LOCUS_05720 72866 73744 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_05720 74867 73755 gene locus_tag LOCUS_05730 74867 73755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 77707 75080 gene locus_tag LOCUS_05740 77707 75080 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766170.1 protein_id gnl|my_center|LOCUS_05740 78494 77721 gene locus_tag LOCUS_05750 78494 77721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 80388 78832 gene locus_tag LOCUS_05760 80388 78832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203591.1 protein_id gnl|my_center|LOCUS_05760 81118 81450 gene locus_tag LOCUS_05770 81118 81450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 82832 81567 gene locus_tag LOCUS_05780 82832 81567 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_05780 83125 82838 gene locus_tag LOCUS_05790 83125 82838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 84932 83193 gene locus_tag LOCUS_05800 84932 83193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 84901 85311 gene locus_tag LOCUS_05810 84901 85311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 85628 85338 gene locus_tag LOCUS_05820 85628 85338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 88544 85827 gene locus_tag LOCUS_05830 88544 85827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 89869 88553 gene locus_tag LOCUS_05840 89869 88553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_05840 91217 89874 gene locus_tag LOCUS_05850 91217 89874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802077.1 protein_id gnl|my_center|LOCUS_05850 92908 91352 gene locus_tag LOCUS_05860 92908 91352 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_05860 96015 92923 gene locus_tag LOCUS_05870 96015 92923 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_05870 97139 96027 gene locus_tag LOCUS_05880 97139 96027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 98662 97208 gene locus_tag LOCUS_05890 98662 97208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 101838 98908 gene locus_tag LOCUS_05900 101838 98908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_05900 102834 101983 gene locus_tag LOCUS_05910 102834 101983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 105124 102839 gene locus_tag LOCUS_05920 105124 102839 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_05920 105330 106679 gene locus_tag LOCUS_05930 105330 106679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_05930 106688 108337 gene locus_tag LOCUS_05940 106688 108337 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_05940 108414 109265 gene locus_tag LOCUS_05950 108414 109265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 109336 109983 gene locus_tag LOCUS_05960 109336 109983 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_05960 111566 110094 gene locus_tag LOCUS_05970 111566 110094 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_05970 113139 111895 gene locus_tag LOCUS_05980 gene ltrA 113139 111895 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence006 85 1599 gene locus_tag LOCUS_05990 85 1599 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_05990 1664 2458 gene locus_tag LOCUS_06000 1664 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2636 3994 gene locus_tag LOCUS_06010 2636 3994 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_06010 4050 4268 gene locus_tag LOCUS_06020 4050 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4323 5054 gene locus_tag LOCUS_06030 4323 5054 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_06030 5330 5010 gene locus_tag LOCUS_06040 5330 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5791 6624 gene locus_tag LOCUS_06050 5791 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6654 7478 gene locus_tag LOCUS_06060 gene xynB 6654 7478 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_06060 9632 7632 gene locus_tag LOCUS_06070 9632 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_06070 9875 11806 gene locus_tag LOCUS_06080 9875 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 12013 13689 gene locus_tag LOCUS_06090 12013 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 13861 16170 gene locus_tag LOCUS_06100 13861 16170 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_06100 16371 18995 gene locus_tag LOCUS_06110 16371 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 23514 19003 gene locus_tag LOCUS_06120 23514 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 23734 25179 gene locus_tag LOCUS_06130 23734 25179 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_06130 26205 25180 gene locus_tag LOCUS_06140 26205 25180 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_06140 27562 26330 gene locus_tag LOCUS_06150 27562 26330 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_06150 27855 28727 gene locus_tag LOCUS_06160 gene sucD 27855 28727 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_06160 28767 29513 gene locus_tag LOCUS_06170 28767 29513 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_06170 29492 31621 gene locus_tag LOCUS_06180 29492 31621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 31694 32659 gene locus_tag LOCUS_06190 31694 32659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32682 33686 gene locus_tag LOCUS_06200 32682 33686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 33699 34964 gene locus_tag LOCUS_06210 33699 34964 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_06210 35120 35362 gene locus_tag LOCUS_06220 gene rpmB 35120 35362 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_06220 35377 35565 gene locus_tag LOCUS_06230 gene rpmG 35377 35565 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 protein_id gnl|my_center|LOCUS_06230 35823 36785 gene locus_tag LOCUS_06240 gene ftsY 35823 36785 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_06240 36791 38086 gene locus_tag LOCUS_06250 gene rimO 36791 38086 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK5 protein_id gnl|my_center|LOCUS_06250 38140 38544 gene locus_tag LOCUS_06260 38140 38544 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06260 38621 40942 gene locus_tag LOCUS_06270 38621 40942 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_06270 40961 41896 gene locus_tag LOCUS_06280 40961 41896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 41948 42493 gene locus_tag LOCUS_06290 41948 42493 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_06290 42450 43034 gene locus_tag LOCUS_06300 42450 43034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 43047 43571 gene locus_tag LOCUS_06310 43047 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 43623 44174 gene locus_tag LOCUS_06320 43623 44174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 44403 47051 gene locus_tag LOCUS_06330 44403 47051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_06330 47155 48414 gene locus_tag LOCUS_06340 47155 48414 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_06340 49175 48411 gene locus_tag LOCUS_06350 49175 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_06350 50995 49172 gene locus_tag LOCUS_06360 50995 49172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_06360 51767 51018 gene locus_tag LOCUS_06370 51767 51018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 52834 51764 gene locus_tag LOCUS_06380 52834 51764 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_06380 53830 52838 gene locus_tag LOCUS_06390 53830 52838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_06390 54788 53823 gene locus_tag LOCUS_06400 54788 53823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_06400 55654 54824 gene locus_tag LOCUS_06410 55654 54824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_06410 56715 55720 gene locus_tag LOCUS_06420 56715 55720 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_06420 56815 57618 gene locus_tag LOCUS_06430 gene truA 56815 57618 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV0 protein_id gnl|my_center|LOCUS_06430 57688 59793 gene locus_tag LOCUS_06440 57688 59793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 59800 61380 gene locus_tag LOCUS_06450 59800 61380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257294.1 protein_id gnl|my_center|LOCUS_06450 61377 63677 gene locus_tag LOCUS_06460 61377 63677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 63771 64760 gene locus_tag LOCUS_06470 63771 64760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 64757 66055 gene locus_tag LOCUS_06480 64757 66055 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_06480 66048 68045 gene locus_tag LOCUS_06490 66048 68045 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_06490 68042 68806 gene locus_tag LOCUS_06500 gene fabG 68042 68806 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_06500 68803 69984 gene locus_tag LOCUS_06510 68803 69984 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_06510 70012 72330 gene locus_tag LOCUS_06520 70012 72330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 73098 72352 gene locus_tag LOCUS_06530 73098 72352 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_06530 74045 73095 gene locus_tag LOCUS_06540 74045 73095 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_06540 75210 74032 gene locus_tag LOCUS_06550 75210 74032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 76850 75282 gene locus_tag LOCUS_06560 76850 75282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_06560 78454 76925 gene locus_tag LOCUS_06570 78454 76925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 78580 79323 gene locus_tag LOCUS_06580 gene ugpQ 78580 79323 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_06580 79681 79908 gene locus_tag LOCUS_06590 79681 79908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 79977 80834 gene locus_tag LOCUS_06600 79977 80834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 82990 80837 gene locus_tag LOCUS_06610 82990 80837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 84548 83118 gene locus_tag LOCUS_06620 gene dnaA 84548 83118 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_06620 86052 84799 gene locus_tag LOCUS_06630 86052 84799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 87237 86062 gene locus_tag LOCUS_06640 87237 86062 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_06640 87363 89984 gene locus_tag LOCUS_06650 87363 89984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_06650 90111 90491 gene locus_tag LOCUS_06660 90111 90491 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_06660 90990 90544 gene locus_tag LOCUS_06670 gene rplI 90990 90544 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH9 protein_id gnl|my_center|LOCUS_06670 91277 91008 gene locus_tag LOCUS_06680 gene rpsR 91277 91008 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_06680 91642 91280 gene locus_tag LOCUS_06690 gene rpsF 91642 91280 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 protein_id gnl|my_center|LOCUS_06690 91915 93726 gene locus_tag LOCUS_06700 91915 93726 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_06700 93800 97129 gene locus_tag LOCUS_06710 gene secA 93800 97129 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL5 protein_id gnl|my_center|LOCUS_06710 98051 97146 gene locus_tag LOCUS_06720 gene dapA 98051 97146 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_06720 98580 98032 gene locus_tag LOCUS_06730 98580 98032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 100659 98650 gene locus_tag LOCUS_06740 gene ligA 100659 98650 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_06740 100743 103385 gene locus_tag LOCUS_06750 100743 103385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 104726 103386 gene locus_tag LOCUS_06760 104726 103386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 104773 105669 gene locus_tag LOCUS_06770 104773 105669 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_06770 105704 107500 gene locus_tag LOCUS_06780 gene argS 105704 107500 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 protein_id gnl|my_center|LOCUS_06780 107516 108850 gene locus_tag LOCUS_06790 gene ffh 107516 108850 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_06790 >Feature sequence007 2477 162 gene locus_tag LOCUS_06800 2477 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2792 2478 gene locus_tag LOCUS_06810 2792 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4108 2879 gene locus_tag LOCUS_06820 4108 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6842 4200 gene locus_tag LOCUS_06830 6842 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11854 6953 gene locus_tag LOCUS_06840 11854 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 12107 11826 gene locus_tag LOCUS_06850 12107 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 12450 12220 gene locus_tag LOCUS_06860 12450 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 12639 13961 gene locus_tag LOCUS_06870 12639 13961 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_06870 13958 15118 gene locus_tag LOCUS_06880 13958 15118 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_06880 16021 15098 gene locus_tag LOCUS_06890 16021 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 16203 16856 gene locus_tag LOCUS_06900 16203 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_06900 16911 17435 gene locus_tag LOCUS_06910 16911 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 19841 17442 gene locus_tag LOCUS_06920 19841 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_06920 22038 19903 gene locus_tag LOCUS_06930 gene ptrB 22038 19903 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_06930 23816 22095 gene locus_tag LOCUS_06940 23816 22095 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_06940 26408 23919 gene locus_tag LOCUS_06950 gene mutS2 26408 23919 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_06950 28987 26444 gene locus_tag LOCUS_06960 28987 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 29260 29922 gene locus_tag LOCUS_06970 29260 29922 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912074.1 protein_id gnl|my_center|LOCUS_06970 32034 29893 gene locus_tag LOCUS_06980 32034 29893 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_06980 34216 32036 gene locus_tag LOCUS_06990 34216 32036 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_06990 34270 35037 gene locus_tag LOCUS_07000 34270 35037 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXK2 protein_id gnl|my_center|LOCUS_07000 36261 35062 gene locus_tag LOCUS_07010 36261 35062 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_07010 36859 36278 gene locus_tag LOCUS_07020 36859 36278 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_07020 38808 36907 gene locus_tag LOCUS_07030 38808 36907 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_07030 38866 40335 gene locus_tag LOCUS_07040 gene guaB 38866 40335 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_07040 40425 42395 gene locus_tag LOCUS_07050 40425 42395 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_07050 42433 43245 gene locus_tag LOCUS_07060 42433 43245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 43253 44629 gene locus_tag LOCUS_07070 43253 44629 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_07070 44659 45627 gene locus_tag LOCUS_07080 44659 45627 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_07080 45611 47137 gene locus_tag LOCUS_07090 45611 47137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_07090 47444 47163 gene locus_tag LOCUS_07100 47444 47163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_07100 48155 47454 gene locus_tag LOCUS_07110 48155 47454 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_07110 48270 50381 gene locus_tag LOCUS_07120 gene recG 48270 50381 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U7 protein_id gnl|my_center|LOCUS_07120 50511 52115 gene locus_tag LOCUS_07130 50511 52115 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 protein_id gnl|my_center|LOCUS_07130 52208 52789 gene locus_tag LOCUS_07140 52208 52789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 52803 53339 gene locus_tag LOCUS_07150 52803 53339 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_07150 53342 53623 gene locus_tag LOCUS_07160 gene groS 53342 53623 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYI9 protein_id gnl|my_center|LOCUS_07160 54361 53690 gene locus_tag LOCUS_07170 54361 53690 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903942.1 protein_id gnl|my_center|LOCUS_07170 54605 57466 gene locus_tag LOCUS_07180 54605 57466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_07180 57513 58301 gene locus_tag LOCUS_07190 57513 58301 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_07190 58301 58708 gene locus_tag LOCUS_07200 58301 58708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 58923 60320 gene locus_tag LOCUS_07210 gene trpE 58923 60320 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_07210 60325 60903 gene locus_tag LOCUS_07220 gene pabA 60325 60903 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_07220 60900 61895 gene locus_tag LOCUS_07230 gene trpD 60900 61895 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_07230 61899 62708 gene locus_tag LOCUS_07240 61899 62708 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX5 protein_id gnl|my_center|LOCUS_07240 62692 63315 gene locus_tag LOCUS_07250 gene trpF 62692 63315 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX4 protein_id gnl|my_center|LOCUS_07250 63308 64501 gene locus_tag LOCUS_07260 gene trpB 63308 64501 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD2 protein_id gnl|my_center|LOCUS_07260 64494 65285 gene locus_tag LOCUS_07270 gene trpA 64494 65285 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_07270 65387 67162 gene locus_tag LOCUS_07280 65387 67162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 67802 67185 gene locus_tag LOCUS_07290 67802 67185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 68313 67792 gene locus_tag LOCUS_07300 68313 67792 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_07300 69534 68362 gene locus_tag LOCUS_07310 gene mnmA 69534 68362 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_07310 69761 70888 gene locus_tag LOCUS_07320 69761 70888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_07320 70908 72374 gene locus_tag LOCUS_07330 70908 72374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 72377 72811 gene locus_tag LOCUS_07340 72377 72811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 72808 75072 gene locus_tag LOCUS_07350 72808 75072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008686570.1 protein_id gnl|my_center|LOCUS_07350 75078 75869 gene locus_tag LOCUS_07360 75078 75869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_07360 75866 76897 gene locus_tag LOCUS_07370 75866 76897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 76956 77462 gene locus_tag LOCUS_07380 76956 77462 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_07380 77459 78166 gene locus_tag LOCUS_07390 77459 78166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 78364 78759 gene locus_tag LOCUS_07400 78364 78759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 78956 79870 gene locus_tag LOCUS_07410 78956 79870 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_07410 80427 81752 gene locus_tag LOCUS_07420 80427 81752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 81822 82847 gene locus_tag LOCUS_07430 gene scbA 81822 82847 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_07430 82851 83678 gene locus_tag LOCUS_07440 82851 83678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_07440 83691 84533 gene locus_tag LOCUS_07450 gene znuB 83691 84533 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_07450 84990 84637 gene locus_tag LOCUS_07460 84990 84637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 85553 84996 gene locus_tag LOCUS_07470 85553 84996 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_07470 86817 85639 gene locus_tag LOCUS_07480 gene glpT 86817 85639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 protein_id gnl|my_center|LOCUS_07480 86945 88972 gene locus_tag LOCUS_07490 86945 88972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 90175 88991 gene locus_tag LOCUS_07500 gene arsA 90175 88991 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_07500 91653 90283 gene locus_tag LOCUS_07510 91653 90283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 91747 92922 gene locus_tag LOCUS_07520 91747 92922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 93834 92944 gene locus_tag LOCUS_07530 gene msrA 93834 92944 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCX9 protein_id gnl|my_center|LOCUS_07530 95663 93945 gene locus_tag LOCUS_07540 95663 93945 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_07540 95929 97209 gene locus_tag LOCUS_07550 gene glyA 95929 97209 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U78 protein_id gnl|my_center|LOCUS_07550 >Feature sequence008 2047 419 gene locus_tag LOCUS_07560 2047 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3925 2117 gene locus_tag LOCUS_07570 3925 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4281 4066 gene locus_tag LOCUS_07580 4281 4066 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_07580 5355 4357 gene locus_tag LOCUS_07590 5355 4357 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_07590 5649 6656 gene locus_tag LOCUS_07600 5649 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6793 7254 gene locus_tag LOCUS_07610 6793 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7341 9620 gene locus_tag LOCUS_07620 7341 9620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_07620 9665 11032 gene locus_tag LOCUS_07630 9665 11032 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_07630 11004 12368 gene locus_tag LOCUS_07640 11004 12368 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107804.1 protein_id gnl|my_center|LOCUS_07640 13756 12365 gene locus_tag LOCUS_07650 gene yidJ 13756 12365 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122680.1 protein_id gnl|my_center|LOCUS_07650 14059 14799 gene locus_tag LOCUS_07660 14059 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 14796 17576 gene locus_tag LOCUS_07670 14796 17576 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_07670 17731 18726 gene locus_tag LOCUS_07680 17731 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 18734 20866 gene locus_tag LOCUS_07690 18734 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 22120 20957 gene locus_tag LOCUS_07700 22120 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702420.1 protein_id gnl|my_center|LOCUS_07700 22357 23442 gene locus_tag LOCUS_07710 22357 23442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 23506 23976 gene locus_tag LOCUS_07720 23506 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 25859 24063 gene locus_tag LOCUS_07730 25859 24063 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107131.1 protein_id gnl|my_center|LOCUS_07730 27118 26303 gene locus_tag LOCUS_07740 27118 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 28203 27064 gene locus_tag LOCUS_07750 28203 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 28644 28213 gene locus_tag LOCUS_07760 28644 28213 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_07760 31126 28646 gene locus_tag LOCUS_07770 31126 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31840 31130 gene locus_tag LOCUS_07780 31840 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 32079 32753 gene locus_tag LOCUS_07790 32079 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 35017 32780 gene locus_tag LOCUS_07800 35017 32780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 35350 35904 gene locus_tag LOCUS_07810 35350 35904 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_07810 35907 37685 gene locus_tag LOCUS_07820 35907 37685 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_07820 37716 41330 gene locus_tag LOCUS_07830 37716 41330 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071257.1 protein_id gnl|my_center|LOCUS_07830 41327 41788 gene locus_tag LOCUS_07840 41327 41788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 41974 43899 gene locus_tag LOCUS_07850 41974 43899 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202945.1 protein_id gnl|my_center|LOCUS_07850 44928 43930 gene locus_tag LOCUS_07860 gene argF 44928 43930 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7U4 protein_id gnl|my_center|LOCUS_07860 45921 44938 gene locus_tag LOCUS_07870 45921 44938 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_07870 46109 48532 gene locus_tag LOCUS_07880 46109 48532 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_07880 48537 49166 gene locus_tag LOCUS_07890 48537 49166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 49184 50368 gene locus_tag LOCUS_07900 gene yjcL 49184 50368 CDS product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 protein_id gnl|my_center|LOCUS_07900 50459 51745 gene locus_tag LOCUS_07910 50459 51745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 53475 51880 gene locus_tag LOCUS_07920 53475 51880 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_07920 53565 55352 gene locus_tag LOCUS_07930 53565 55352 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_07930 55356 56588 gene locus_tag LOCUS_07940 gene hutI 55356 56588 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_07940 56585 58270 gene locus_tag LOCUS_07950 56585 58270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 58785 58324 gene locus_tag LOCUS_07960 58785 58324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 60930 58807 gene locus_tag LOCUS_07970 60930 58807 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_07970 61229 62032 gene locus_tag LOCUS_07980 61229 62032 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_07980 62173 62628 gene locus_tag LOCUS_07990 62173 62628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 62688 63242 gene locus_tag LOCUS_08000 62688 63242 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_08000 64094 63252 gene locus_tag LOCUS_08010 64094 63252 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_08010 65745 64156 gene locus_tag LOCUS_08020 65745 64156 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A813 protein_id gnl|my_center|LOCUS_08020 66815 65907 gene locus_tag LOCUS_08030 66815 65907 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_08030 68149 66875 gene locus_tag LOCUS_08040 68149 66875 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_08040 68497 68162 gene locus_tag LOCUS_08050 68497 68162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_08050 69337 68516 gene locus_tag LOCUS_08060 69337 68516 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_08060 69451 70671 gene locus_tag LOCUS_08070 69451 70671 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_08070 73336 70760 gene locus_tag LOCUS_08080 73336 70760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 73439 73281 gene locus_tag LOCUS_08090 73439 73281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 73626 75005 gene locus_tag LOCUS_08100 73626 75005 CDS product methanol--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392723.1 protein_id gnl|my_center|LOCUS_08100 76009 75014 gene locus_tag LOCUS_08110 76009 75014 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP0 protein_id gnl|my_center|LOCUS_08110 77659 76244 gene locus_tag LOCUS_08120 77659 76244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 80123 78186 gene locus_tag LOCUS_08130 80123 78186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 80813 82978 gene locus_tag LOCUS_08140 80813 82978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 83267 82968 gene locus_tag LOCUS_08150 83267 82968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 84031 83540 gene locus_tag LOCUS_08160 84031 83540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 85154 84132 gene locus_tag LOCUS_08170 85154 84132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08170 85973 85173 gene locus_tag LOCUS_08180 85973 85173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 86245 87399 gene locus_tag LOCUS_08190 86245 87399 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_08190 87537 88514 gene locus_tag LOCUS_08200 87537 88514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 88595 90214 gene locus_tag LOCUS_08210 88595 90214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 90229 90876 gene locus_tag LOCUS_08220 90229 90876 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_08220 90873 91823 gene locus_tag LOCUS_08230 90873 91823 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_08230 91869 92912 gene locus_tag LOCUS_08240 91869 92912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 93093 93803 gene locus_tag LOCUS_08250 93093 93803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 93941 94792 gene locus_tag LOCUS_08260 93941 94792 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_08260 94850 95473 gene locus_tag LOCUS_08270 94850 95473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence009 3477 3830 gene locus_tag LOCUS_08280 3477 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3843 4214 gene locus_tag LOCUS_08290 3843 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4215 6575 gene locus_tag LOCUS_08300 4215 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8503 6560 gene locus_tag LOCUS_08310 8503 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8773 10731 gene locus_tag LOCUS_08320 8773 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 10738 12177 gene locus_tag LOCUS_08330 10738 12177 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_08330 12229 12303 gene locus_tag LOCUS_t00070 12229 12303 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13834 12458 gene locus_tag LOCUS_08340 13834 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 14464 13838 gene locus_tag LOCUS_08350 14464 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15567 14611 gene locus_tag LOCUS_08360 15567 14611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16944 15661 gene locus_tag LOCUS_08370 16944 15661 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_08370 17701 17024 gene locus_tag LOCUS_08380 17701 17024 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_08380 18999 17749 gene locus_tag LOCUS_08390 18999 17749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_08390 19253 19876 gene locus_tag LOCUS_08400 gene queE 19253 19876 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_08400 19978 21912 gene locus_tag LOCUS_08410 19978 21912 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_08410 22310 21909 gene locus_tag LOCUS_08420 22310 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 24292 22325 gene locus_tag LOCUS_08430 24292 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 26050 24416 gene locus_tag LOCUS_08440 26050 24416 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791324.1 protein_id gnl|my_center|LOCUS_08440 29252 26058 gene locus_tag LOCUS_08450 29252 26058 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D7 protein_id gnl|my_center|LOCUS_08450 29668 29285 gene locus_tag LOCUS_08460 29668 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 30214 29690 gene locus_tag LOCUS_08470 30214 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 30495 30902 gene locus_tag LOCUS_08480 30495 30902 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_08480 30913 32472 gene locus_tag LOCUS_08490 30913 32472 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_08490 32484 32849 gene locus_tag LOCUS_08500 32484 32849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 32968 33387 gene locus_tag LOCUS_08510 32968 33387 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_08510 33390 34736 gene locus_tag LOCUS_08520 33390 34736 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_08520 34875 36107 gene locus_tag LOCUS_08530 34875 36107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 36100 37659 gene locus_tag LOCUS_08540 36100 37659 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_08540 37634 40417 gene locus_tag LOCUS_08550 37634 40417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 40629 40462 gene locus_tag LOCUS_08560 40629 40462 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_08560 40836 42776 gene locus_tag LOCUS_08570 40836 42776 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_08570 42787 44160 gene locus_tag LOCUS_08580 42787 44160 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_08580 44172 45509 gene locus_tag LOCUS_08590 44172 45509 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_08590 45572 49819 gene locus_tag LOCUS_08600 45572 49819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 51525 49816 gene locus_tag LOCUS_08610 51525 49816 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_08610 53552 51522 gene locus_tag LOCUS_08620 53552 51522 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U39 protein_id gnl|my_center|LOCUS_08620 55003 53555 gene locus_tag LOCUS_08630 55003 53555 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_08630 55144 56340 gene locus_tag LOCUS_08640 55144 56340 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_08640 56347 56919 gene locus_tag LOCUS_08650 56347 56919 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_08650 57142 57747 gene locus_tag LOCUS_08660 57142 57747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 57750 58652 gene locus_tag LOCUS_08670 57750 58652 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_08670 58665 59894 gene locus_tag LOCUS_08680 58665 59894 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_08680 59916 61067 gene locus_tag LOCUS_08690 59916 61067 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_08690 61070 62266 gene locus_tag LOCUS_08700 gene rfaG 61070 62266 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_08700 62282 62902 gene locus_tag LOCUS_08710 62282 62902 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765040.1 protein_id gnl|my_center|LOCUS_08710 62930 64123 gene locus_tag LOCUS_08720 62930 64123 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_08720 64217 65662 gene locus_tag LOCUS_08730 64217 65662 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_08730 65765 66394 gene locus_tag LOCUS_08740 65765 66394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 66391 67650 gene locus_tag LOCUS_08750 66391 67650 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107323.1 protein_id gnl|my_center|LOCUS_08750 67657 68535 gene locus_tag LOCUS_08760 67657 68535 CDS product secretion protein HylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_08760 68538 69446 gene locus_tag LOCUS_08770 68538 69446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 69446 70192 gene locus_tag LOCUS_08780 69446 70192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 70189 71298 gene locus_tag LOCUS_08790 70189 71298 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T01 protein_id gnl|my_center|LOCUS_08790 71295 72410 gene locus_tag LOCUS_08800 71295 72410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_08800 73039 72392 gene locus_tag LOCUS_08810 73039 72392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 74987 73044 gene locus_tag LOCUS_08820 gene pepO 74987 73044 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 protein_id gnl|my_center|LOCUS_08820 75413 75024 gene locus_tag LOCUS_08830 75413 75024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 76691 75483 gene locus_tag LOCUS_08840 gene rocD 76691 75483 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_08840 78816 76768 gene locus_tag LOCUS_08850 78816 76768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_08850 81202 78821 gene locus_tag LOCUS_08860 81202 78821 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_08860 81947 81309 gene locus_tag LOCUS_08870 81947 81309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 82016 82468 gene locus_tag LOCUS_08880 82016 82468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_08880 82481 84103 gene locus_tag LOCUS_08890 82481 84103 CDS product indolepyruvate oxidoreductase subunit IorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN4 protein_id gnl|my_center|LOCUS_08890 84195 84779 gene locus_tag LOCUS_08900 84195 84779 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_08900 85691 84786 gene locus_tag LOCUS_08910 85691 84786 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_08910 86270 85770 gene locus_tag LOCUS_08920 86270 85770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_08920 86600 86289 gene locus_tag LOCUS_08930 86600 86289 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_08930 87287 86616 gene locus_tag LOCUS_08940 87287 86616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 88533 87298 gene locus_tag LOCUS_08950 88533 87298 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_08950 88616 89344 gene locus_tag LOCUS_08960 88616 89344 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_08960 89409 90512 gene locus_tag LOCUS_08970 89409 90512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403149.1 protein_id gnl|my_center|LOCUS_08970 90529 93474 gene locus_tag LOCUS_08980 90529 93474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence010 580 1401 gene locus_tag LOCUS_08990 580 1401 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971218.1 protein_id gnl|my_center|LOCUS_08990 2526 1420 gene locus_tag LOCUS_09000 2526 1420 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_09000 3921 2557 gene locus_tag LOCUS_09010 3921 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6368 3924 gene locus_tag LOCUS_09020 gene lon 6368 3924 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_09020 6823 6557 gene locus_tag LOCUS_09030 gene rpmE 6823 6557 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_09030 8121 6922 gene locus_tag LOCUS_09040 8121 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_09040 8225 8299 gene locus_tag LOCUS_t00080 8225 8299 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8349 9263 gene locus_tag LOCUS_09050 8349 9263 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146242.1 protein_id gnl|my_center|LOCUS_09050 9295 10341 gene locus_tag LOCUS_09060 9295 10341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 10369 11076 gene locus_tag LOCUS_09070 gene cmk 10369 11076 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A626 protein_id gnl|my_center|LOCUS_09070 11163 12134 gene locus_tag LOCUS_09080 gene pfkA 11163 12134 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU0 protein_id gnl|my_center|LOCUS_09080 12140 14635 gene locus_tag LOCUS_09090 gene priA 12140 14635 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_09090 15361 14666 gene locus_tag LOCUS_09100 15361 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 15551 16894 gene locus_tag LOCUS_09110 15551 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 16944 17936 gene locus_tag LOCUS_09120 16944 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 18188 19063 gene locus_tag LOCUS_09130 18188 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 19133 20578 gene locus_tag LOCUS_09140 19133 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 21683 20691 gene locus_tag LOCUS_09150 21683 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_09150 22165 24447 gene locus_tag LOCUS_09160 22165 24447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 24511 26223 gene locus_tag LOCUS_09170 24511 26223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 26229 26990 gene locus_tag LOCUS_09180 26229 26990 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_09180 27421 28095 gene locus_tag LOCUS_09190 27421 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 28114 28926 gene locus_tag LOCUS_09200 28114 28926 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965524.1 protein_id gnl|my_center|LOCUS_09200 28928 30112 gene locus_tag LOCUS_09210 28928 30112 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_09210 31891 30179 gene locus_tag LOCUS_09220 31891 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 32553 31909 gene locus_tag LOCUS_09230 32553 31909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 33239 32727 gene locus_tag LOCUS_09240 gene purE 33239 32727 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N35 protein_id gnl|my_center|LOCUS_09240 33339 33872 gene locus_tag LOCUS_09250 33339 33872 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_09250 33890 34474 gene locus_tag LOCUS_09260 gene adk 33890 34474 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 protein_id gnl|my_center|LOCUS_09260 34478 35467 gene locus_tag LOCUS_09270 gene obg 34478 35467 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_09270 35472 36059 gene locus_tag LOCUS_09280 35472 36059 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_09280 36034 36876 gene locus_tag LOCUS_09290 36034 36876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 36977 38830 gene locus_tag LOCUS_09300 gene parE 36977 38830 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_09300 38845 41670 gene locus_tag LOCUS_09310 38845 41670 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108893.1 protein_id gnl|my_center|LOCUS_09310 41664 42188 gene locus_tag LOCUS_09320 gene aroK 41664 42188 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_09320 42899 42162 gene locus_tag LOCUS_09330 gene ppa 42899 42162 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6Y8 protein_id gnl|my_center|LOCUS_09330 44360 42939 gene locus_tag LOCUS_09340 44360 42939 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_09340 45846 44428 gene locus_tag LOCUS_09350 45846 44428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964011.1 protein_id gnl|my_center|LOCUS_09350 46458 45877 gene locus_tag LOCUS_09360 46458 45877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 47341 46478 gene locus_tag LOCUS_09370 47341 46478 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_09370 48185 47367 gene locus_tag LOCUS_09380 48185 47367 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 protein_id gnl|my_center|LOCUS_09380 50046 48325 gene locus_tag LOCUS_09390 50046 48325 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_09390 50135 51871 gene locus_tag LOCUS_09400 gene lysS 50135 51871 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_09400 51878 53200 gene locus_tag LOCUS_09410 gene pgi 51878 53200 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM7 protein_id gnl|my_center|LOCUS_09410 53206 54108 gene locus_tag LOCUS_09420 53206 54108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 55550 54105 gene locus_tag LOCUS_09430 55550 54105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 56923 55550 gene locus_tag LOCUS_09440 56923 55550 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963534.1 protein_id gnl|my_center|LOCUS_09440 58342 56999 gene locus_tag LOCUS_09450 58342 56999 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_09450 59852 58422 gene locus_tag LOCUS_09460 59852 58422 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_09460 61660 59852 gene locus_tag LOCUS_09470 61660 59852 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_09470 62127 61672 gene locus_tag LOCUS_09480 gene mreD 62127 61672 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_09480 62995 62192 gene locus_tag LOCUS_09490 62995 62192 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_09490 64030 63008 gene locus_tag LOCUS_09500 64030 63008 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_09500 65580 64057 gene locus_tag LOCUS_09510 gene purH 65580 64057 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_09510 67018 65663 gene locus_tag LOCUS_09520 67018 65663 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H9 protein_id gnl|my_center|LOCUS_09520 67942 67088 gene locus_tag LOCUS_09530 gene rsmA 67942 67088 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_09530 68025 68903 gene locus_tag LOCUS_09540 68025 68903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 68939 69415 gene locus_tag LOCUS_09550 68939 69415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_09550 69415 70548 gene locus_tag LOCUS_09560 69415 70548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 71374 70550 gene locus_tag LOCUS_09570 71374 70550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 72282 71386 gene locus_tag LOCUS_09580 72282 71386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_09580 74520 72331 gene locus_tag LOCUS_09590 74520 72331 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_09590 74641 75606 gene locus_tag LOCUS_09600 gene kdsD 74641 75606 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_09600 75719 76444 gene locus_tag LOCUS_09610 gene lptB 75719 76444 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_09610 76468 76550 gene locus_tag LOCUS_t00090 76468 76550 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76627 77979 gene locus_tag LOCUS_09620 76627 77979 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_09620 77999 78685 gene locus_tag LOCUS_09630 gene clpP 77999 78685 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW2 protein_id gnl|my_center|LOCUS_09630 78701 79915 gene locus_tag LOCUS_09640 gene clpX 78701 79915 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW3 protein_id gnl|my_center|LOCUS_09640 80434 79943 gene locus_tag LOCUS_09650 80434 79943 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ0 protein_id gnl|my_center|LOCUS_09650 81243 80449 gene locus_tag LOCUS_09660 gene thyA 81243 80449 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A639 protein_id gnl|my_center|LOCUS_09660 82741 81251 gene locus_tag LOCUS_09670 82741 81251 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_09670 83504 82920 gene locus_tag LOCUS_09680 83504 82920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_09680 83671 83985 gene locus_tag LOCUS_09690 83671 83985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 84004 84270 gene locus_tag LOCUS_09700 gene rpmA 84004 84270 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_09700 84316 85650 gene locus_tag LOCUS_09710 gene serS 84316 85650 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_09710 85679 87517 gene locus_tag LOCUS_09720 85679 87517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 87510 88064 gene locus_tag LOCUS_09730 gene ruvC 87510 88064 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_09730 88452 88057 gene locus_tag LOCUS_09740 88452 88057 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_09740 89033 88464 gene locus_tag LOCUS_09750 89033 88464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence011 115 3351 gene locus_tag LOCUS_09760 115 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_09760 4410 5609 gene locus_tag LOCUS_09770 4410 5609 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_09770 5781 5587 gene locus_tag LOCUS_09780 5781 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6913 5789 gene locus_tag LOCUS_09790 6913 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8417 7305 gene locus_tag LOCUS_09800 8417 7305 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_09800 8746 15357 gene locus_tag LOCUS_09810 8746 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 16194 15445 gene locus_tag LOCUS_09820 16194 15445 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_09820 17243 16191 gene locus_tag LOCUS_09830 17243 16191 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_09830 17484 18632 gene locus_tag LOCUS_09840 17484 18632 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_09840 19203 18673 gene locus_tag LOCUS_09850 19203 18673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 19777 22812 gene locus_tag LOCUS_09860 19777 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203707.1 protein_id gnl|my_center|LOCUS_09860 22892 25285 gene locus_tag LOCUS_09870 22892 25285 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_09870 25399 26520 gene locus_tag LOCUS_09880 25399 26520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 26553 27326 gene locus_tag LOCUS_09890 26553 27326 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E3 protein_id gnl|my_center|LOCUS_09890 28710 27397 gene locus_tag LOCUS_09900 28710 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 29611 28703 gene locus_tag LOCUS_09910 29611 28703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_09910 32132 29670 gene locus_tag LOCUS_09920 32132 29670 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_09920 32744 33388 gene locus_tag LOCUS_09930 32744 33388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 33385 34113 gene locus_tag LOCUS_09940 33385 34113 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_09940 34167 35909 gene locus_tag LOCUS_09950 34167 35909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 37154 35967 gene locus_tag LOCUS_09960 37154 35967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124143.1 protein_id gnl|my_center|LOCUS_09960 37307 37996 gene locus_tag LOCUS_09970 37307 37996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 38449 39837 gene locus_tag LOCUS_09980 38449 39837 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_09980 41994 40399 gene locus_tag LOCUS_09990 41994 40399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 43786 42302 gene locus_tag LOCUS_10000 gene arsA 43786 42302 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 protein_id gnl|my_center|LOCUS_10000 47060 43803 gene locus_tag LOCUS_10010 47060 43803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_10010 47745 47065 gene locus_tag LOCUS_10020 gene lolD 47745 47065 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57031 protein_id gnl|my_center|LOCUS_10020 49046 47757 gene locus_tag LOCUS_10030 49046 47757 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_10030 50152 49043 gene locus_tag LOCUS_10040 50152 49043 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877095.1 protein_id gnl|my_center|LOCUS_10040 51711 50149 gene locus_tag LOCUS_10050 51711 50149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 54050 51708 gene locus_tag LOCUS_10060 54050 51708 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_10060 55935 54058 gene locus_tag LOCUS_10070 55935 54058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 57203 55938 gene locus_tag LOCUS_10080 57203 55938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 57799 57200 gene locus_tag LOCUS_10090 57799 57200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 58001 57807 gene locus_tag LOCUS_10100 58001 57807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 58960 58004 gene locus_tag LOCUS_10110 58960 58004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 60389 58950 gene locus_tag LOCUS_10120 60389 58950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_10120 61658 60393 gene locus_tag LOCUS_10130 61658 60393 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_10130 62846 61674 gene locus_tag LOCUS_10140 62846 61674 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_10140 64388 63099 gene locus_tag LOCUS_10150 64388 63099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_10150 64762 66048 gene locus_tag LOCUS_10160 64762 66048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_10160 68032 66068 gene locus_tag LOCUS_10170 gene tetP/tetQ 68032 66068 CDS product tetracycline resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_10170 68175 69437 gene locus_tag LOCUS_10180 68175 69437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 69555 70154 gene locus_tag LOCUS_10190 69555 70154 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_10190 70347 79463 gene locus_tag LOCUS_10200 70347 79463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 79473 82190 gene locus_tag LOCUS_10210 79473 82190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 82353 84224 gene locus_tag LOCUS_10220 82353 84224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence012 1966 1163 gene locus_tag LOCUS_10230 1966 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_10230 2214 3221 gene locus_tag LOCUS_10240 2214 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3319 4284 gene locus_tag LOCUS_10250 3319 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6122 4419 gene locus_tag LOCUS_10260 6122 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6519 6280 gene locus_tag LOCUS_10270 6519 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9009 6919 gene locus_tag LOCUS_10280 9009 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9852 10898 gene locus_tag LOCUS_10290 9852 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 10888 11601 gene locus_tag LOCUS_10300 10888 11601 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_10300 11982 11797 gene locus_tag LOCUS_10310 11982 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 12282 13694 gene locus_tag LOCUS_10320 12282 13694 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_10320 13678 16290 gene locus_tag LOCUS_10330 13678 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 16300 19011 gene locus_tag LOCUS_10340 16300 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 19004 19534 gene locus_tag LOCUS_10350 19004 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 19525 20217 gene locus_tag LOCUS_10360 19525 20217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 22347 20323 gene locus_tag LOCUS_10370 22347 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 22451 25702 gene locus_tag LOCUS_10380 22451 25702 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_10380 27864 25759 gene locus_tag LOCUS_10390 gene pepX1 27864 25759 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_10390 28453 29619 gene locus_tag LOCUS_10400 28453 29619 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_10400 32214 30721 gene locus_tag LOCUS_10410 32214 30721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 32666 34813 gene locus_tag LOCUS_10420 32666 34813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 34782 34973 gene locus_tag LOCUS_10430 34782 34973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 36861 35128 gene locus_tag LOCUS_10440 36861 35128 CDS product IS1634 family transposase ISMac10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_10440 37256 37044 gene locus_tag LOCUS_10450 37256 37044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 38043 37348 gene locus_tag LOCUS_10460 gene drrA 38043 37348 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_10460 40075 38012 gene locus_tag LOCUS_10470 40075 38012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 40261 41277 gene locus_tag LOCUS_10480 40261 41277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_10480 41440 41748 gene locus_tag LOCUS_10490 41440 41748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 44053 41840 gene locus_tag LOCUS_10500 44053 41840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 44822 44136 gene locus_tag LOCUS_10510 44822 44136 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_10510 46744 44819 gene locus_tag LOCUS_10520 46744 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 47578 46931 gene locus_tag LOCUS_10530 47578 46931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 47981 47628 gene locus_tag LOCUS_10540 47981 47628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_10540 48131 49102 gene locus_tag LOCUS_10550 48131 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 49095 50111 gene locus_tag LOCUS_10560 49095 50111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 50349 51269 gene locus_tag LOCUS_10570 50349 51269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 52624 51290 gene locus_tag LOCUS_10580 52624 51290 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_10580 54197 52668 gene locus_tag LOCUS_10590 54197 52668 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865192.1 protein_id gnl|my_center|LOCUS_10590 54750 54289 gene locus_tag LOCUS_10600 54750 54289 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_10600 55774 54767 gene locus_tag LOCUS_10610 gene cdh 55774 54767 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 protein_id gnl|my_center|LOCUS_10610 57393 55750 gene locus_tag LOCUS_10620 57393 55750 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_10620 58312 57653 gene locus_tag LOCUS_10630 58312 57653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 59273 58302 gene locus_tag LOCUS_10640 59273 58302 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729427.1 protein_id gnl|my_center|LOCUS_10640 60288 59377 gene locus_tag LOCUS_10650 gene dhmA1 60288 59377 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_10650 60829 60347 gene locus_tag LOCUS_10660 60829 60347 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXQ7 protein_id gnl|my_center|LOCUS_10660 61452 62603 gene locus_tag LOCUS_10670 61452 62603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 63427 62693 gene locus_tag LOCUS_10680 63427 62693 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302068.1 protein_id gnl|my_center|LOCUS_10680 63748 66024 gene locus_tag LOCUS_10690 63748 66024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 67701 66031 gene locus_tag LOCUS_10700 67701 66031 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_10700 67858 69516 gene locus_tag LOCUS_10710 67858 69516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 69561 70916 gene locus_tag LOCUS_10720 69561 70916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 70918 73311 gene locus_tag LOCUS_10730 70918 73311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 75799 73367 gene locus_tag LOCUS_10740 75799 73367 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_10740 76083 77444 gene locus_tag LOCUS_10750 gene trpB-2 76083 77444 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFX8 protein_id gnl|my_center|LOCUS_10750 78024 77569 gene locus_tag LOCUS_10760 78024 77569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 protein_id gnl|my_center|LOCUS_10760 79699 78089 gene locus_tag LOCUS_10770 79699 78089 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_10770 79810 80550 gene locus_tag LOCUS_10780 79810 80550 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z9 protein_id gnl|my_center|LOCUS_10780 80556 81485 gene locus_tag LOCUS_10790 80556 81485 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_10790 81609 82163 gene locus_tag LOCUS_10800 81609 82163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence013 1235 537 gene locus_tag LOCUS_10810 1235 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1305 1973 gene locus_tag LOCUS_10820 1305 1973 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_10820 2719 2021 gene locus_tag LOCUS_10830 2719 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3566 2769 gene locus_tag LOCUS_10840 gene hypB 3566 2769 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_10840 3918 3577 gene locus_tag LOCUS_10850 gene hypA 3918 3577 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G73 protein_id gnl|my_center|LOCUS_10850 6218 3924 gene locus_tag LOCUS_10860 gene hypF 6218 3924 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 protein_id gnl|my_center|LOCUS_10860 6403 8592 gene locus_tag LOCUS_10870 6403 8592 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_10870 9773 8595 gene locus_tag LOCUS_10880 9773 8595 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389823.1 protein_id gnl|my_center|LOCUS_10880 9893 11554 gene locus_tag LOCUS_10890 9893 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 12916 11588 gene locus_tag LOCUS_10900 12916 11588 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_10900 14469 13018 gene locus_tag LOCUS_10910 14469 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 16868 14589 gene locus_tag LOCUS_10920 16868 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 18758 17130 gene locus_tag LOCUS_10930 18758 17130 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_10930 19348 18788 gene locus_tag LOCUS_10940 19348 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 19622 21178 gene locus_tag LOCUS_10950 19622 21178 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_10950 21447 21175 gene locus_tag LOCUS_10960 21447 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 23093 21525 gene locus_tag LOCUS_10970 23093 21525 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108637.1 protein_id gnl|my_center|LOCUS_10970 23916 23086 gene locus_tag LOCUS_10980 23916 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 26402 24057 gene locus_tag LOCUS_10990 26402 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 26802 26593 gene locus_tag LOCUS_11000 26802 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258573.1 protein_id gnl|my_center|LOCUS_11000 27873 26827 gene locus_tag LOCUS_11010 27873 26827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 28945 27875 gene locus_tag LOCUS_11020 28945 27875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 29809 28955 gene locus_tag LOCUS_11030 29809 28955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727706.1 protein_id gnl|my_center|LOCUS_11030 30480 29824 gene locus_tag LOCUS_11040 30480 29824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 31123 30584 gene locus_tag LOCUS_11050 31123 30584 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N93 protein_id gnl|my_center|LOCUS_11050 33010 31340 gene locus_tag LOCUS_11060 33010 31340 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_11060 35237 33093 gene locus_tag LOCUS_11070 35237 33093 CDS product dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638894.2 protein_id gnl|my_center|LOCUS_11070 35692 35261 gene locus_tag LOCUS_11080 35692 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_11080 37081 35720 gene locus_tag LOCUS_11090 37081 35720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 38834 37131 gene locus_tag LOCUS_11100 38834 37131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 39530 38976 gene locus_tag LOCUS_11110 39530 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 39637 40680 gene locus_tag LOCUS_11120 39637 40680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 40839 43556 gene locus_tag LOCUS_11130 40839 43556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 43615 45888 gene locus_tag LOCUS_11140 43615 45888 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_11140 47223 45898 gene locus_tag LOCUS_11150 47223 45898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 47681 47295 gene locus_tag LOCUS_11160 47681 47295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 48629 47754 gene locus_tag LOCUS_11170 48629 47754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 49483 48764 gene locus_tag LOCUS_11180 gene rprY 49483 48764 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_11180 50646 49480 gene locus_tag LOCUS_11190 50646 49480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 50934 51173 gene locus_tag LOCUS_11200 50934 51173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 51360 52958 gene locus_tag LOCUS_11210 51360 52958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 56075 52977 gene locus_tag LOCUS_11220 56075 52977 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_11220 56205 56543 gene locus_tag LOCUS_11230 56205 56543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 56562 58136 gene locus_tag LOCUS_11240 56562 58136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 58121 58876 gene locus_tag LOCUS_11250 58121 58876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 58967 59674 gene locus_tag LOCUS_11260 58967 59674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962838.1 protein_id gnl|my_center|LOCUS_11260 59825 61336 gene locus_tag LOCUS_11270 59825 61336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 62990 61383 gene locus_tag LOCUS_11280 gene gldM 62990 61383 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_11280 63498 62995 gene locus_tag LOCUS_11290 63498 62995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 66177 63517 gene locus_tag LOCUS_11300 66177 63517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 66997 66206 gene locus_tag LOCUS_11310 66997 66206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 67591 67028 gene locus_tag LOCUS_11320 67591 67028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 68300 67746 gene locus_tag LOCUS_11330 68300 67746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 68951 68481 gene locus_tag LOCUS_11340 68951 68481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 69777 69118 gene locus_tag LOCUS_11350 69777 69118 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_11350 70818 69934 gene locus_tag LOCUS_11360 70818 69934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 72559 70841 gene locus_tag LOCUS_11370 72559 70841 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_11370 74245 72629 gene locus_tag LOCUS_11380 74245 72629 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_11380 74482 75963 gene locus_tag LOCUS_11390 74482 75963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 75988 79107 gene locus_tag LOCUS_11400 75988 79107 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_11400 79104 80300 gene locus_tag LOCUS_11410 79104 80300 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence014 2007 1147 gene locus_tag LOCUS_11420 2007 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2258 2019 gene locus_tag LOCUS_11430 2258 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3818 2292 gene locus_tag LOCUS_11440 gene atpD 3818 2292 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13356 protein_id gnl|my_center|LOCUS_11440 4831 3851 gene locus_tag LOCUS_11450 4831 3851 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_11450 7059 4828 gene locus_tag LOCUS_11460 7059 4828 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_11460 7317 9548 gene locus_tag LOCUS_11470 7317 9548 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_11470 9629 11323 gene locus_tag LOCUS_11480 9629 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_11480 12704 11331 gene locus_tag LOCUS_11490 12704 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 13586 12708 gene locus_tag LOCUS_11500 gene atpG 13586 12708 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_11500 15188 13614 gene locus_tag LOCUS_11510 gene atpA 15188 13614 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_11510 15771 15214 gene locus_tag LOCUS_11520 15771 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 16331 15783 gene locus_tag LOCUS_11530 gene atpH 16331 15783 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_11530 16827 16333 gene locus_tag LOCUS_11540 gene atpF 16827 16333 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA6 protein_id gnl|my_center|LOCUS_11540 17154 16894 gene locus_tag LOCUS_11550 17154 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 18284 17184 gene locus_tag LOCUS_11560 gene atpB 18284 17184 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9V1 protein_id gnl|my_center|LOCUS_11560 18720 18337 gene locus_tag LOCUS_11570 18720 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 18956 18717 gene locus_tag LOCUS_11580 18956 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 19299 18925 gene locus_tag LOCUS_11590 19299 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_11590 20345 19350 gene locus_tag LOCUS_11600 gene fabH 20345 19350 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_11600 21262 20345 gene locus_tag LOCUS_11610 gene plsX 21262 20345 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_11610 22002 21523 gene locus_tag LOCUS_11620 22002 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 23265 22063 gene locus_tag LOCUS_11630 gene porY 23265 22063 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_11630 24388 23360 gene locus_tag LOCUS_11640 24388 23360 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_11640 25159 24392 gene locus_tag LOCUS_11650 25159 24392 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_11650 27277 25163 gene locus_tag LOCUS_11660 27277 25163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 29543 27288 gene locus_tag LOCUS_11670 29543 27288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 30447 29512 gene locus_tag LOCUS_11680 gene rsgA2 30447 29512 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_11680 31291 30587 gene locus_tag LOCUS_11690 gene pepE 31291 30587 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263875.1 protein_id gnl|my_center|LOCUS_11690 32073 31288 gene locus_tag LOCUS_11700 32073 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 32981 32145 gene locus_tag LOCUS_11710 32981 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 34101 33055 gene locus_tag LOCUS_11720 34101 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 34589 34104 gene locus_tag LOCUS_11730 34589 34104 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824008.1 protein_id gnl|my_center|LOCUS_11730 34673 35452 gene locus_tag LOCUS_11740 34673 35452 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782763.1 protein_id gnl|my_center|LOCUS_11740 35555 36130 gene locus_tag LOCUS_11750 35555 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 36205 36972 gene locus_tag LOCUS_11760 36205 36972 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 protein_id gnl|my_center|LOCUS_11760 36990 38210 gene locus_tag LOCUS_11770 36990 38210 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_11770 38235 39527 gene locus_tag LOCUS_11780 38235 39527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_11780 39582 40253 gene locus_tag LOCUS_11790 39582 40253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_11790 40320 41474 gene locus_tag LOCUS_11800 40320 41474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_11800 41721 43037 gene locus_tag LOCUS_11810 41721 43037 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_11810 43051 44286 gene locus_tag LOCUS_11820 43051 44286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 44299 45615 gene locus_tag LOCUS_11830 44299 45615 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_11830 45618 46955 gene locus_tag LOCUS_11840 45618 46955 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_11840 46965 47696 gene locus_tag LOCUS_11850 46965 47696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_11850 47730 48620 gene locus_tag LOCUS_11860 47730 48620 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_11860 49649 48657 gene locus_tag LOCUS_11870 49649 48657 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_11870 49818 50996 gene locus_tag LOCUS_11880 49818 50996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 51007 52137 gene locus_tag LOCUS_11890 51007 52137 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_11890 52184 53101 gene locus_tag LOCUS_11900 52184 53101 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_11900 53104 55188 gene locus_tag LOCUS_11910 53104 55188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 55462 56814 gene locus_tag LOCUS_11920 55462 56814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 57003 58355 gene locus_tag LOCUS_11930 57003 58355 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_11930 58659 61028 gene locus_tag LOCUS_11940 58659 61028 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405469.1 protein_id gnl|my_center|LOCUS_11940 61236 62429 gene locus_tag LOCUS_11950 61236 62429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 62763 62449 gene locus_tag LOCUS_11960 62763 62449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 63909 63529 gene locus_tag LOCUS_11970 63909 63529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 64195 65073 gene locus_tag LOCUS_11980 64195 65073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 65334 65768 gene locus_tag LOCUS_11990 65334 65768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 66518 65712 gene locus_tag LOCUS_12000 66518 65712 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_12000 67823 66693 gene locus_tag LOCUS_12010 67823 66693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 68296 68802 gene locus_tag LOCUS_12020 68296 68802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 68981 69928 gene locus_tag LOCUS_12030 68981 69928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_12030 70658 70152 gene locus_tag LOCUS_12040 70658 70152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 70618 70809 gene locus_tag LOCUS_12050 70618 70809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 71179 72546 gene locus_tag LOCUS_12060 71179 72546 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_12060 72634 73212 gene locus_tag LOCUS_12070 72634 73212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 73402 74844 gene locus_tag LOCUS_12080 73402 74844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 75100 76383 gene locus_tag LOCUS_12090 75100 76383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 <77063 76416 gene locus_tag LOCUS_12100 <77063 76416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259450.1:potassium transporter TrkA >Feature sequence015 328 1002 gene locus_tag LOCUS_12110 328 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2601 1084 gene locus_tag LOCUS_12120 2601 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_12120 5873 2625 gene locus_tag LOCUS_12130 5873 2625 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_12130 7152 6196 gene locus_tag LOCUS_12140 7152 6196 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253886.1 protein_id gnl|my_center|LOCUS_12140 7513 7779 gene locus_tag LOCUS_12150 7513 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7766 10201 gene locus_tag LOCUS_12160 7766 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 10467 11270 gene locus_tag LOCUS_12170 10467 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 13895 11334 gene locus_tag LOCUS_12180 13895 11334 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_12180 14046 16097 gene locus_tag LOCUS_12190 14046 16097 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_12190 16376 16906 gene locus_tag LOCUS_12200 16376 16906 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAZ9 protein_id gnl|my_center|LOCUS_12200 16956 18281 gene locus_tag LOCUS_12210 16956 18281 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_12210 18354 18584 gene locus_tag LOCUS_12220 18354 18584 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_12220 18604 19677 gene locus_tag LOCUS_12230 18604 19677 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_12230 19677 20456 gene locus_tag LOCUS_12240 19677 20456 CDS product 2-oxoglutarate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_12240 20468 21013 gene locus_tag LOCUS_12250 20468 21013 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_12250 21815 21003 gene locus_tag LOCUS_12260 21815 21003 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_12260 21946 23019 gene locus_tag LOCUS_12270 21946 23019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 23625 23026 gene locus_tag LOCUS_12280 gene nadD 23625 23026 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_12280 24172 23600 gene locus_tag LOCUS_12290 gene gmk 24172 23600 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_12290 25124 24249 gene locus_tag LOCUS_12300 25124 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_12300 26531 25155 gene locus_tag LOCUS_12310 gene tnaA 26531 25155 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_12310 26832 28421 gene locus_tag LOCUS_12320 26832 28421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 29285 28416 gene locus_tag LOCUS_12330 gene ubiA 29285 28416 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_12330 29375 30199 gene locus_tag LOCUS_12340 29375 30199 CDS product sugar phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263310.1 protein_id gnl|my_center|LOCUS_12340 32643 30196 gene locus_tag LOCUS_12350 gene pheT 32643 30196 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA39 protein_id gnl|my_center|LOCUS_12350 33030 34784 gene locus_tag LOCUS_12360 33030 34784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 34789 35649 gene locus_tag LOCUS_12370 34789 35649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 35753 37816 gene locus_tag LOCUS_12380 gene htpG 35753 37816 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_12380 37910 38578 gene locus_tag LOCUS_12390 37910 38578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 39138 38617 gene locus_tag LOCUS_12400 39138 38617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_12400 39249 40442 gene locus_tag LOCUS_12410 39249 40442 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A529 protein_id gnl|my_center|LOCUS_12410 40455 41504 gene locus_tag LOCUS_12420 40455 41504 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_12420 41504 42847 gene locus_tag LOCUS_12430 gene manB 41504 42847 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_12430 43860 42844 gene locus_tag LOCUS_12440 gene murB 43860 42844 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_12440 43911 45035 gene locus_tag LOCUS_12450 43911 45035 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_12450 45085 46563 gene locus_tag LOCUS_12460 45085 46563 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_12460 47467 46745 gene locus_tag LOCUS_12470 gene ftsE 47467 46745 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_12470 47606 50623 gene locus_tag LOCUS_12480 47606 50623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_12480 50630 52342 gene locus_tag LOCUS_12490 50630 52342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_12490 52496 54454 gene locus_tag LOCUS_12500 gene gyrB 52496 54454 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_12500 55526 54480 gene locus_tag LOCUS_12510 55526 54480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 56385 55600 gene locus_tag LOCUS_12520 gene dapF 56385 55600 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_12520 56556 58037 gene locus_tag LOCUS_12530 56556 58037 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788554.1 protein_id gnl|my_center|LOCUS_12530 58188 59048 gene locus_tag LOCUS_12540 58188 59048 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_12540 61067 59058 gene locus_tag LOCUS_12550 gene uvrB 61067 59058 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_12550 61803 61132 gene locus_tag LOCUS_12560 gene prsW 61803 61132 CDS product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q188Z4 protein_id gnl|my_center|LOCUS_12560 62835 61843 gene locus_tag LOCUS_12570 62835 61843 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_12570 65194 62870 gene locus_tag LOCUS_12580 65194 62870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 65486 65307 gene locus_tag LOCUS_12590 65486 65307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 65449 65727 gene locus_tag LOCUS_12600 65449 65727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 67924 65756 gene locus_tag LOCUS_12610 67924 65756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477586.1 protein_id gnl|my_center|LOCUS_12610 69265 68123 gene locus_tag LOCUS_12620 69265 68123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 70055 69249 gene locus_tag LOCUS_12630 70055 69249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 72270 71983 gene locus_tag LOCUS_12640 72270 71983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 74739 72367 gene locus_tag LOCUS_12650 gene feoB 74739 72367 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023399.1 protein_id gnl|my_center|LOCUS_12650 75228 76286 gene locus_tag LOCUS_12660 75228 76286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence016 788 264 gene locus_tag LOCUS_12670 788 264 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_12670 910 2109 gene locus_tag LOCUS_12680 gene sucC 910 2109 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_12680 3449 2202 gene locus_tag LOCUS_12690 3449 2202 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_12690 3605 4150 gene locus_tag LOCUS_12700 3605 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4804 4151 gene locus_tag LOCUS_12710 4804 4151 CDS product isoprenoid biosynthesis protein ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_12710 6284 4869 gene locus_tag LOCUS_12720 6284 4869 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_12720 7174 6284 gene locus_tag LOCUS_12730 7174 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7077 7889 gene locus_tag LOCUS_12740 gene pcm 7077 7889 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_12740 7991 10702 gene locus_tag LOCUS_12750 7991 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10715 11353 gene locus_tag LOCUS_12760 10715 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_12760 11437 14301 gene locus_tag LOCUS_12770 gene gcvP 11437 14301 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_12770 15060 14347 gene locus_tag LOCUS_12780 15060 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 16075 15086 gene locus_tag LOCUS_12790 gene ddl 16075 15086 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_12790 17169 16126 gene locus_tag LOCUS_12800 17169 16126 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_12800 19012 17162 gene locus_tag LOCUS_12810 19012 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 19880 19026 gene locus_tag LOCUS_12820 19880 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 21059 19971 gene locus_tag LOCUS_12830 gene mqnE 21059 19971 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK48 protein_id gnl|my_center|LOCUS_12830 21145 22659 gene locus_tag LOCUS_12840 21145 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_12840 22646 24391 gene locus_tag LOCUS_12850 22646 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 25335 24712 gene locus_tag LOCUS_12860 gene rsmG 25335 24712 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_12860 25932 25336 gene locus_tag LOCUS_12870 gene rpoE 25932 25336 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_12870 27077 25923 gene locus_tag LOCUS_12880 27077 25923 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_12880 27202 28332 gene locus_tag LOCUS_12890 gene tgt 27202 28332 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9I0 protein_id gnl|my_center|LOCUS_12890 28338 29420 gene locus_tag LOCUS_12900 28338 29420 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_12900 29631 30698 gene locus_tag LOCUS_12910 gene fsr 29631 30698 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149429.1 protein_id gnl|my_center|LOCUS_12910 31123 30683 gene locus_tag LOCUS_12920 31123 30683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 31707 31123 gene locus_tag LOCUS_12930 gene sigW 31707 31123 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_12930 31814 32176 gene locus_tag LOCUS_12940 31814 32176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 32318 33205 gene locus_tag LOCUS_12950 32318 33205 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_12950 33217 36642 gene locus_tag LOCUS_12960 33217 36642 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766164.1 protein_id gnl|my_center|LOCUS_12960 36668 38137 gene locus_tag LOCUS_12970 36668 38137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760594.1 protein_id gnl|my_center|LOCUS_12970 38145 39212 gene locus_tag LOCUS_12980 38145 39212 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_12980 39236 42340 gene locus_tag LOCUS_12990 39236 42340 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_12990 42337 47058 gene locus_tag LOCUS_13000 42337 47058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 47066 47782 gene locus_tag LOCUS_13010 47066 47782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766161.1 protein_id gnl|my_center|LOCUS_13010 49154 47913 gene locus_tag LOCUS_13020 49154 47913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_13020 49283 50560 gene locus_tag LOCUS_13030 49283 50560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_13030 50609 51073 gene locus_tag LOCUS_13040 50609 51073 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_13040 51180 52346 gene locus_tag LOCUS_13050 51180 52346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 52346 53080 gene locus_tag LOCUS_13060 52346 53080 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_13060 53374 53075 gene locus_tag LOCUS_13070 53374 53075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 55330 53402 gene locus_tag LOCUS_13080 55330 53402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_13080 55917 55327 gene locus_tag LOCUS_13090 55917 55327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 56021 57172 gene locus_tag LOCUS_13100 56021 57172 CDS product geranylgeranyl hydrogenase BchP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_13100 57236 58654 gene locus_tag LOCUS_13110 57236 58654 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_13110 58721 60112 gene locus_tag LOCUS_13120 58721 60112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 protein_id gnl|my_center|LOCUS_13120 61981 60134 gene locus_tag LOCUS_13130 61981 60134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 62792 62034 gene locus_tag LOCUS_13140 gene comB 62792 62034 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_13140 63388 62789 gene locus_tag LOCUS_13150 63388 62789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 64340 63372 gene locus_tag LOCUS_13160 64340 63372 CDS product putative PabA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57527 protein_id gnl|my_center|LOCUS_13160 64405 64995 gene locus_tag LOCUS_13170 64405 64995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 65395 65006 gene locus_tag LOCUS_13180 65395 65006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 67359 65392 gene locus_tag LOCUS_13190 67359 65392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 67922 67446 gene locus_tag LOCUS_13200 67922 67446 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_13200 68923 67952 gene locus_tag LOCUS_13210 68923 67952 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_13210 69895 68984 gene locus_tag LOCUS_13220 69895 68984 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584138.1 protein_id gnl|my_center|LOCUS_13220 70838 69966 gene locus_tag LOCUS_13230 70838 69966 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_13230 71908 70895 gene locus_tag LOCUS_13240 71908 70895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 72921 71905 gene locus_tag LOCUS_13250 72921 71905 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_13250 72987 73478 gene locus_tag LOCUS_13260 72987 73478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 73553 73972 gene locus_tag LOCUS_13270 73553 73972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 <75602 74007 gene locus_tag LOCUS_13280 <75602 74007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107338.1:prolyl oligopeptidase >Feature sequence017 <1 1070 gene locus_tag LOCUS_13290 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:peptidase 1200 1286 gene locus_tag LOCUS_t00100 1200 1286 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1473 2663 gene locus_tag LOCUS_13300 1473 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203575.1 protein_id gnl|my_center|LOCUS_13300 4151 2772 gene locus_tag LOCUS_13310 4151 2772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 protein_id gnl|my_center|LOCUS_13310 5192 4476 gene locus_tag LOCUS_13320 5192 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6847 5717 gene locus_tag LOCUS_13330 6847 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7040 7483 gene locus_tag LOCUS_13340 7040 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_13340 7489 9087 gene locus_tag LOCUS_13350 7489 9087 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_13350 9232 9774 gene locus_tag LOCUS_13360 9232 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9879 11615 gene locus_tag LOCUS_13370 9879 11615 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_13370 12388 11591 gene locus_tag LOCUS_13380 12388 11591 CDS product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701102.1 protein_id gnl|my_center|LOCUS_13380 12766 13407 gene locus_tag LOCUS_13390 12766 13407 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_13390 13439 15382 gene locus_tag LOCUS_13400 13439 15382 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_13400 15391 16134 gene locus_tag LOCUS_13410 15391 16134 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_13410 17598 16210 gene locus_tag LOCUS_13420 17598 16210 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_13420 17770 18426 gene locus_tag LOCUS_13430 17770 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 18932 18423 gene locus_tag LOCUS_13440 18932 18423 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 protein_id gnl|my_center|LOCUS_13440 19866 18943 gene locus_tag LOCUS_13450 19866 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 21558 19963 gene locus_tag LOCUS_13460 21558 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 21894 21565 gene locus_tag LOCUS_13470 21894 21565 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_13470 22622 21912 gene locus_tag LOCUS_13480 22622 21912 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_13480 23178 22639 gene locus_tag LOCUS_13490 23178 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 23358 24155 gene locus_tag LOCUS_13500 23358 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957679.1 protein_id gnl|my_center|LOCUS_13500 25258 24242 gene locus_tag LOCUS_13510 25258 24242 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_13510 25355 25951 gene locus_tag LOCUS_13520 25355 25951 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG2 protein_id gnl|my_center|LOCUS_13520 26015 28357 gene locus_tag LOCUS_13530 26015 28357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_13530 28360 29085 gene locus_tag LOCUS_13540 28360 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 29149 31671 gene locus_tag LOCUS_13550 29149 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 31816 32289 gene locus_tag LOCUS_13560 31816 32289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 32354 33319 gene locus_tag LOCUS_13570 32354 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 33411 34853 gene locus_tag LOCUS_13580 33411 34853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 34933 36204 gene locus_tag LOCUS_13590 34933 36204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 36859 38559 gene locus_tag LOCUS_13600 36859 38559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 38576 39448 gene locus_tag LOCUS_13610 38576 39448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33389 protein_id gnl|my_center|LOCUS_13610 39441 40664 gene locus_tag LOCUS_13620 39441 40664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545584.1 protein_id gnl|my_center|LOCUS_13620 40683 41399 gene locus_tag LOCUS_13630 40683 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 41494 43170 gene locus_tag LOCUS_13640 41494 43170 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_13640 43160 44794 gene locus_tag LOCUS_13650 43160 44794 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_13650 44819 46159 gene locus_tag LOCUS_13660 gene pilR 44819 46159 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_13660 46192 46725 gene locus_tag LOCUS_13670 46192 46725 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_13670 46854 47375 gene locus_tag LOCUS_13680 46854 47375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 47837 49123 gene locus_tag LOCUS_13690 47837 49123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 49113 49445 gene locus_tag LOCUS_13700 gene spoIIAA 49113 49445 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7V3 protein_id gnl|my_center|LOCUS_13700 50045 49452 gene locus_tag LOCUS_13710 50045 49452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 51136 50021 gene locus_tag LOCUS_13720 51136 50021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 51440 52459 gene locus_tag LOCUS_13730 gene ltaE 51440 52459 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_13730 52586 52410 gene locus_tag LOCUS_13740 52586 52410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 53065 52856 gene locus_tag LOCUS_13750 53065 52856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462097.1 protein_id gnl|my_center|LOCUS_13750 53166 53774 gene locus_tag LOCUS_13760 53166 53774 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_13760 53955 54029 gene locus_tag LOCUS_t00110 53955 54029 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54428 54132 gene locus_tag LOCUS_13770 54428 54132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 55889 54951 gene locus_tag LOCUS_13780 55889 54951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 56180 56034 gene locus_tag LOCUS_13790 56180 56034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 56148 56750 gene locus_tag LOCUS_13800 56148 56750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 57054 57977 gene locus_tag LOCUS_13810 57054 57977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 58563 59015 gene locus_tag LOCUS_13820 58563 59015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 59017 59712 gene locus_tag LOCUS_13830 59017 59712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 59799 60068 gene locus_tag LOCUS_13840 59799 60068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 60305 61210 gene locus_tag LOCUS_13850 60305 61210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 61907 61329 gene locus_tag LOCUS_13860 61907 61329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 62428 64254 gene locus_tag LOCUS_13870 62428 64254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 64852 66807 gene locus_tag LOCUS_13880 64852 66807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 66831 67406 gene locus_tag LOCUS_13890 66831 67406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 67565 68779 gene locus_tag LOCUS_13900 67565 68779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 69161 69985 gene locus_tag LOCUS_13910 69161 69985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 70696 70082 gene locus_tag LOCUS_13920 70696 70082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 72152 70923 gene locus_tag LOCUS_13930 72152 70923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence018 1457 543 gene locus_tag LOCUS_13940 1457 543 CDS product bacitracin ABC transporter ATP-binding protein BcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253713.1 protein_id gnl|my_center|LOCUS_13940 3610 1484 gene locus_tag LOCUS_13950 3610 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4591 3611 gene locus_tag LOCUS_13960 4591 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13960 5368 4595 gene locus_tag LOCUS_13970 5368 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13970 5478 6008 gene locus_tag LOCUS_13980 5478 6008 CDS product D-lyxose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_13980 6096 8312 gene locus_tag LOCUS_13990 6096 8312 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_13990 9313 8429 gene locus_tag LOCUS_14000 9313 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 10048 10317 gene locus_tag LOCUS_14010 10048 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10765 10328 gene locus_tag LOCUS_14020 gene ppi 10765 10328 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_14020 10969 12882 gene locus_tag LOCUS_14030 gene acsA 10969 12882 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_14030 13049 14512 gene locus_tag LOCUS_14040 13049 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 16661 14529 gene locus_tag LOCUS_14050 16661 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 17664 17059 gene locus_tag LOCUS_14060 17664 17059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 20037 17752 gene locus_tag LOCUS_14070 20037 17752 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_14070 20115 21455 gene locus_tag LOCUS_14080 20115 21455 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_14080 21480 23393 gene locus_tag LOCUS_14090 21480 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119909.1 protein_id gnl|my_center|LOCUS_14090 24608 23415 gene locus_tag LOCUS_14100 24608 23415 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_14100 25207 24605 gene locus_tag LOCUS_14110 25207 24605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 25806 25339 gene locus_tag LOCUS_14120 25806 25339 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004301986.1 protein_id gnl|my_center|LOCUS_14120 26237 28360 gene locus_tag LOCUS_14130 26237 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 28394 30277 gene locus_tag LOCUS_14140 28394 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036596.1 protein_id gnl|my_center|LOCUS_14140 32135 30384 gene locus_tag LOCUS_14150 32135 30384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120263.1 protein_id gnl|my_center|LOCUS_14150 32272 34464 gene locus_tag LOCUS_14160 32272 34464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 35748 34504 gene locus_tag LOCUS_14170 35748 34504 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 protein_id gnl|my_center|LOCUS_14170 37127 35817 gene locus_tag LOCUS_14180 37127 35817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 37236 37739 gene locus_tag LOCUS_14190 37236 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 38478 37777 gene locus_tag LOCUS_14200 38478 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 39261 38500 gene locus_tag LOCUS_14210 39261 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 41110 39755 gene locus_tag LOCUS_14220 41110 39755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 41381 41103 gene locus_tag LOCUS_14230 41381 41103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 43411 41510 gene locus_tag LOCUS_14240 43411 41510 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202360.1 protein_id gnl|my_center|LOCUS_14240 45923 43692 gene locus_tag LOCUS_14250 45923 43692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 47146 46061 gene locus_tag LOCUS_14260 47146 46061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 50959 47252 gene locus_tag LOCUS_14270 50959 47252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 51649 50990 gene locus_tag LOCUS_14280 51649 50990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768705.1 protein_id gnl|my_center|LOCUS_14280 52789 51653 gene locus_tag LOCUS_14290 52789 51653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_14290 56050 52958 gene locus_tag LOCUS_14300 gene lacZ 56050 52958 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_14300 57520 56063 gene locus_tag LOCUS_14310 gene xylE 57520 56063 CDS product D-xylose-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGF4 protein_id gnl|my_center|LOCUS_14310 57752 58978 gene locus_tag LOCUS_14320 gene pepP 57752 58978 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_14320 59199 60920 gene locus_tag LOCUS_14330 59199 60920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 60901 63114 gene locus_tag LOCUS_14340 60901 63114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 64638 63193 gene locus_tag LOCUS_14350 64638 63193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203634.1 protein_id gnl|my_center|LOCUS_14350 66256 64772 gene locus_tag LOCUS_14360 66256 64772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 67760 66555 gene locus_tag LOCUS_14370 67760 66555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 68203 67880 gene locus_tag LOCUS_14380 68203 67880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 70566 68206 gene locus_tag LOCUS_14390 70566 68206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence019 1022 648 gene locus_tag LOCUS_14400 1022 648 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_14400 3019 1049 gene locus_tag LOCUS_14410 3019 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_14410 4766 3087 gene locus_tag LOCUS_14420 4766 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6793 4805 gene locus_tag LOCUS_14430 6793 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8024 6888 gene locus_tag LOCUS_14440 gene arcT 8024 6888 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R6 protein_id gnl|my_center|LOCUS_14440 9543 8224 gene locus_tag LOCUS_14450 9543 8224 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_14450 10355 9540 gene locus_tag LOCUS_14460 10355 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11574 10435 gene locus_tag LOCUS_14470 11574 10435 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_14470 14115 11743 gene locus_tag LOCUS_14480 14115 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 15497 14220 gene locus_tag LOCUS_14490 15497 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 17054 15609 gene locus_tag LOCUS_14500 17054 15609 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_14500 19582 17084 gene locus_tag LOCUS_14510 19582 17084 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_14510 21034 19616 gene locus_tag LOCUS_14520 21034 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 22381 21074 gene locus_tag LOCUS_14530 22381 21074 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124070.1 protein_id gnl|my_center|LOCUS_14530 22411 22593 gene locus_tag LOCUS_14540 22411 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 22641 23867 gene locus_tag LOCUS_14550 22641 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119116.1 protein_id gnl|my_center|LOCUS_14550 27133 23873 gene locus_tag LOCUS_14560 27133 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 29805 27145 gene locus_tag LOCUS_14570 29805 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 33513 29830 gene locus_tag LOCUS_14580 33513 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 35193 33592 gene locus_tag LOCUS_14590 35193 33592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 38104 35267 gene locus_tag LOCUS_14600 38104 35267 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A925 protein_id gnl|my_center|LOCUS_14600 39814 38138 gene locus_tag LOCUS_14610 39814 38138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 41566 39827 gene locus_tag LOCUS_14620 41566 39827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203606.1 protein_id gnl|my_center|LOCUS_14620 44483 41733 gene locus_tag LOCUS_14630 44483 41733 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_14630 45610 44480 gene locus_tag LOCUS_14640 45610 44480 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_14640 45951 45670 gene locus_tag LOCUS_14650 45951 45670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 46901 45951 gene locus_tag LOCUS_14660 46901 45951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 48301 46898 gene locus_tag LOCUS_14670 48301 46898 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_14670 50981 48390 gene locus_tag LOCUS_14680 50981 48390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 53924 51072 gene locus_tag LOCUS_14690 53924 51072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 56700 53929 gene locus_tag LOCUS_14700 56700 53929 CDS product alpha-1,2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108135.1 protein_id gnl|my_center|LOCUS_14700 58304 56787 gene locus_tag LOCUS_14710 58304 56787 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_14710 60926 58347 gene locus_tag LOCUS_14720 60926 58347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 63167 60951 gene locus_tag LOCUS_14730 63167 60951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 64099 63284 gene locus_tag LOCUS_14740 64099 63284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 65826 64093 gene locus_tag LOCUS_14750 65826 64093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_14750 69059 65838 gene locus_tag LOCUS_14760 69059 65838 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202219.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence020 1171 50 gene locus_tag LOCUS_14770 1171 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1595 1173 gene locus_tag LOCUS_14780 1595 1173 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_14780 4924 1634 gene locus_tag LOCUS_14790 4924 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5342 4995 gene locus_tag LOCUS_14800 5342 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6400 5351 gene locus_tag LOCUS_14810 6400 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 8413 6404 gene locus_tag LOCUS_14820 8413 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 11461 8465 gene locus_tag LOCUS_14830 11461 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 12547 11501 gene locus_tag LOCUS_14840 12547 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 13657 12578 gene locus_tag LOCUS_14850 13657 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 14503 13661 gene locus_tag LOCUS_14860 gene cheR 14503 13661 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405317.1 protein_id gnl|my_center|LOCUS_14860 14689 17202 gene locus_tag LOCUS_14870 14689 17202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_14870 17208 18401 gene locus_tag LOCUS_14880 17208 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 19851 18433 gene locus_tag LOCUS_14890 19851 18433 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_14890 20086 21762 gene locus_tag LOCUS_14900 20086 21762 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_14900 23337 21799 gene locus_tag LOCUS_14910 23337 21799 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_14910 24348 23380 gene locus_tag LOCUS_14920 24348 23380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 25517 24348 gene locus_tag LOCUS_14930 25517 24348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 26532 25588 gene locus_tag LOCUS_14940 gene rlmF 26532 25588 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU40 protein_id gnl|my_center|LOCUS_14940 26753 26544 gene locus_tag LOCUS_14950 26753 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_14950 26938 28158 gene locus_tag LOCUS_14960 26938 28158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 protein_id gnl|my_center|LOCUS_14960 28729 28166 gene locus_tag LOCUS_14970 28729 28166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_14970 29934 28813 gene locus_tag LOCUS_14980 29934 28813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 31276 29918 gene locus_tag LOCUS_14990 31276 29918 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_14990 32642 31266 gene locus_tag LOCUS_15000 32642 31266 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_15000 32895 35249 gene locus_tag LOCUS_15010 32895 35249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_15010 35531 35316 gene locus_tag LOCUS_15020 35531 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 35655 36005 gene locus_tag LOCUS_15030 35655 36005 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_15030 36010 37518 gene locus_tag LOCUS_15040 36010 37518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 39068 37596 gene locus_tag LOCUS_15050 39068 37596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 39347 41431 gene locus_tag LOCUS_15060 39347 41431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 43091 42537 gene locus_tag LOCUS_15070 43091 42537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 43304 45367 gene locus_tag LOCUS_15080 43304 45367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 48340 45407 gene locus_tag LOCUS_15090 48340 45407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108855.1 protein_id gnl|my_center|LOCUS_15090 49217 48510 gene locus_tag LOCUS_15100 49217 48510 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_15100 50134 49217 gene locus_tag LOCUS_15110 50134 49217 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_15110 50501 51799 gene locus_tag LOCUS_15120 50501 51799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 51825 53369 gene locus_tag LOCUS_15130 51825 53369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 53396 54556 gene locus_tag LOCUS_15140 53396 54556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 56941 54644 gene locus_tag LOCUS_15150 56941 54644 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 protein_id gnl|my_center|LOCUS_15150 57126 57713 gene locus_tag LOCUS_15160 57126 57713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 57977 58858 gene locus_tag LOCUS_15170 57977 58858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 59149 59925 gene locus_tag LOCUS_15180 59149 59925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 61076 60099 gene locus_tag LOCUS_15190 61076 60099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 62666 61125 gene locus_tag LOCUS_15200 62666 61125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_15200 66043 62687 gene locus_tag LOCUS_15210 66043 62687 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403145.1 protein_id gnl|my_center|LOCUS_15210 66481 66969 gene locus_tag LOCUS_15220 66481 66969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_15220 66987 68411 gene locus_tag LOCUS_15230 66987 68411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence021 1069 2172 gene locus_tag LOCUS_15240 1069 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2179 3633 gene locus_tag LOCUS_15250 2179 3633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_15250 3782 4027 gene locus_tag LOCUS_15260 3782 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4020 5099 gene locus_tag LOCUS_15270 4020 5099 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965488.1 protein_id gnl|my_center|LOCUS_15270 5080 6429 gene locus_tag LOCUS_15280 gene lysA1 5080 6429 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_15280 6627 8642 gene locus_tag LOCUS_15290 6627 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8624 9949 gene locus_tag LOCUS_15300 8624 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 9937 10560 gene locus_tag LOCUS_15310 9937 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10566 11576 gene locus_tag LOCUS_15320 10566 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 11710 12486 gene locus_tag LOCUS_15330 11710 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12577 14112 gene locus_tag LOCUS_15340 12577 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 15438 14221 gene locus_tag LOCUS_15350 15438 14221 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024244.1 protein_id gnl|my_center|LOCUS_15350 16327 15431 gene locus_tag LOCUS_15360 16327 15431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_15360 16550 17563 gene locus_tag LOCUS_15370 16550 17563 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528458.1 protein_id gnl|my_center|LOCUS_15370 17589 19370 gene locus_tag LOCUS_15380 gene fucI 17589 19370 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZS4 protein_id gnl|my_center|LOCUS_15380 19443 20381 gene locus_tag LOCUS_15390 19443 20381 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_15390 21892 20483 gene locus_tag LOCUS_15400 21892 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 22158 23552 gene locus_tag LOCUS_15410 22158 23552 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_15410 23694 24899 gene locus_tag LOCUS_15420 23694 24899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 26218 24917 gene locus_tag LOCUS_15430 26218 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 26481 26768 gene locus_tag LOCUS_15440 26481 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 26989 28908 gene locus_tag LOCUS_15450 26989 28908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 29146 29457 gene locus_tag LOCUS_15460 29146 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_15460 29447 29779 gene locus_tag LOCUS_15470 29447 29779 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_15470 30250 31380 gene locus_tag LOCUS_15480 30250 31380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_15480 31428 31655 gene locus_tag LOCUS_15490 31428 31655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 31672 34383 gene locus_tag LOCUS_15500 31672 34383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 34380 35129 gene locus_tag LOCUS_15510 34380 35129 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_15510 35359 36144 gene locus_tag LOCUS_15520 35359 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 37552 36521 gene locus_tag LOCUS_15530 37552 36521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 39527 37635 gene locus_tag LOCUS_15540 39527 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 40648 39593 gene locus_tag LOCUS_15550 40648 39593 CDS product uroporphyrinogen III decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_15550 42060 40645 gene locus_tag LOCUS_15560 42060 40645 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761349.1 protein_id gnl|my_center|LOCUS_15560 43472 42234 gene locus_tag LOCUS_15570 gene salY 43472 42234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_15570 44698 43475 gene locus_tag LOCUS_15580 44698 43475 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_15580 45903 44695 gene locus_tag LOCUS_15590 45903 44695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 47152 45911 gene locus_tag LOCUS_15600 47152 45911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 47403 48851 gene locus_tag LOCUS_15610 47403 48851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 48855 50297 gene locus_tag LOCUS_15620 48855 50297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 50299 51048 gene locus_tag LOCUS_15630 50299 51048 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_15630 51088 52224 gene locus_tag LOCUS_15640 51088 52224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 52268 53599 gene locus_tag LOCUS_15650 52268 53599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 56999 53709 gene locus_tag LOCUS_15660 56999 53709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 58648 57221 gene locus_tag LOCUS_15670 58648 57221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 59344 58652 gene locus_tag LOCUS_15680 59344 58652 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_15680 61380 59341 gene locus_tag LOCUS_15690 61380 59341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 62041 62586 gene locus_tag LOCUS_15700 62041 62586 CDS product specialized sigma subunit of RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_15700 62583 63299 gene locus_tag LOCUS_15710 62583 63299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 63301 64098 gene locus_tag LOCUS_15720 63301 64098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 64136 65287 gene locus_tag LOCUS_15730 64136 65287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 65570 66334 gene locus_tag LOCUS_15740 65570 66334 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence022 2482 1370 gene locus_tag LOCUS_15750 gene nagX 2482 1370 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_15750 2729 3583 gene locus_tag LOCUS_15760 2729 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4676 3714 gene locus_tag LOCUS_15770 4676 3714 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_15770 4859 6046 gene locus_tag LOCUS_15780 gene kbl 4859 6046 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RZ5 protein_id gnl|my_center|LOCUS_15780 6134 7840 gene locus_tag LOCUS_15790 gene acsA 6134 7840 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_15790 7876 8124 gene locus_tag LOCUS_15800 7876 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8146 9393 gene locus_tag LOCUS_15810 gene kbl 8146 9393 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_15810 9414 10520 gene locus_tag LOCUS_15820 9414 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 11922 10684 gene locus_tag LOCUS_15830 11922 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12896 12150 gene locus_tag LOCUS_15840 12896 12150 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_15840 15820 12893 gene locus_tag LOCUS_15850 15820 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 16186 17454 gene locus_tag LOCUS_15860 16186 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 17792 18040 gene locus_tag LOCUS_15870 17792 18040 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730609.1 protein_id gnl|my_center|LOCUS_15870 18053 18466 gene locus_tag LOCUS_15880 18053 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 19720 18527 gene locus_tag LOCUS_15890 19720 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 21670 19790 gene locus_tag LOCUS_15900 21670 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 22227 21667 gene locus_tag LOCUS_15910 22227 21667 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568255.1 protein_id gnl|my_center|LOCUS_15910 22373 22750 gene locus_tag LOCUS_15920 gene acpS 22373 22750 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W4 protein_id gnl|my_center|LOCUS_15920 25327 22766 gene locus_tag LOCUS_15930 25327 22766 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_15930 26768 25521 gene locus_tag LOCUS_15940 26768 25521 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_15940 27526 26774 gene locus_tag LOCUS_15950 27526 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 27739 31197 gene locus_tag LOCUS_15960 27739 31197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_15960 32408 31194 gene locus_tag LOCUS_15970 gene ald 32408 31194 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_15970 32916 32482 gene locus_tag LOCUS_15980 32916 32482 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_15980 34480 32927 gene locus_tag LOCUS_15990 gene porX 34480 32927 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_15990 37282 34487 gene locus_tag LOCUS_16000 gene sprE 37282 34487 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_16000 37433 38770 gene locus_tag LOCUS_16010 gene gnfM 37433 38770 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_16010 39003 38767 gene locus_tag LOCUS_16020 39003 38767 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_16020 40121 39021 gene locus_tag LOCUS_16030 40121 39021 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P46 protein_id gnl|my_center|LOCUS_16030 40521 40204 gene locus_tag LOCUS_16040 gene ogt2 40521 40204 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_16040 41233 40514 gene locus_tag LOCUS_16050 gene trmB 41233 40514 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_16050 41702 41217 gene locus_tag LOCUS_16060 41702 41217 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_16060 42955 41699 gene locus_tag LOCUS_16070 42955 41699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 44106 42970 gene locus_tag LOCUS_16080 44106 42970 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_16080 44203 45396 gene locus_tag LOCUS_16090 gene pgk 44203 45396 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_16090 46385 45420 gene locus_tag LOCUS_16100 46385 45420 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_16100 46729 46382 gene locus_tag LOCUS_16110 46729 46382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_16110 47038 50025 gene locus_tag LOCUS_16120 47038 50025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 50389 50009 gene locus_tag LOCUS_16130 gene yraN 50389 50009 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0D3 protein_id gnl|my_center|LOCUS_16130 50486 52519 gene locus_tag LOCUS_16140 gene metG 50486 52519 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3M1 protein_id gnl|my_center|LOCUS_16140 53542 52520 gene locus_tag LOCUS_16150 53542 52520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_16150 53695 54816 gene locus_tag LOCUS_16160 gene porR 53695 54816 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_16160 54816 55397 gene locus_tag LOCUS_16170 54816 55397 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_16170 55394 56422 gene locus_tag LOCUS_16180 55394 56422 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_16180 56429 57490 gene locus_tag LOCUS_16190 gene rfbB 56429 57490 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFL8 protein_id gnl|my_center|LOCUS_16190 59521 57530 gene locus_tag LOCUS_16200 59521 57530 CDS product DUF4954 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_16200 61358 59523 gene locus_tag LOCUS_16210 gene glmS 61358 59523 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG38 protein_id gnl|my_center|LOCUS_16210 62782 61475 gene locus_tag LOCUS_16220 62782 61475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 63607 62795 gene locus_tag LOCUS_16230 63607 62795 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109194.1 protein_id gnl|my_center|LOCUS_16230 63739 64602 gene locus_tag LOCUS_16240 gene panC 63739 64602 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_16240 64640 64990 gene locus_tag LOCUS_16250 gene panD 64640 64990 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_16250 >Feature sequence023 255 2030 gene locus_tag LOCUS_16260 gene susA 255 2030 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_16260 2222 4945 gene locus_tag LOCUS_16270 2222 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5005 7020 gene locus_tag LOCUS_16280 gene hutU 5005 7020 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_16280 7040 7447 gene locus_tag LOCUS_16290 7040 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7954 7472 gene locus_tag LOCUS_16300 gene ispF 7954 7472 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y7 protein_id gnl|my_center|LOCUS_16300 9162 7954 gene locus_tag LOCUS_16310 gene porV 9162 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_16310 13019 9258 gene locus_tag LOCUS_16320 gene porU 13019 9258 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_16320 13450 14928 gene locus_tag LOCUS_16330 gene gldJ 13450 14928 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_16330 14929 16218 gene locus_tag LOCUS_16340 gene murF 14929 16218 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L7 protein_id gnl|my_center|LOCUS_16340 17226 16213 gene locus_tag LOCUS_16350 17226 16213 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_16350 17962 17243 gene locus_tag LOCUS_16360 17962 17243 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 protein_id gnl|my_center|LOCUS_16360 19591 18128 gene locus_tag LOCUS_16370 19591 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 20394 19633 gene locus_tag LOCUS_16380 20394 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 20994 20458 gene locus_tag LOCUS_16390 20994 20458 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_16390 21789 21001 gene locus_tag LOCUS_16400 21789 21001 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_16400 23103 21796 gene locus_tag LOCUS_16410 23103 21796 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_16410 24456 23128 gene locus_tag LOCUS_16420 24456 23128 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_16420 24561 25064 gene locus_tag LOCUS_16430 24561 25064 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083201.1 protein_id gnl|my_center|LOCUS_16430 25126 26424 gene locus_tag LOCUS_16440 25126 26424 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_16440 26518 27828 gene locus_tag LOCUS_16450 gene kynU 26518 27828 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_16450 27979 28476 gene locus_tag LOCUS_16460 27979 28476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 28552 30327 gene locus_tag LOCUS_16470 gene fadD 28552 30327 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_16470 30336 31496 gene locus_tag LOCUS_16480 30336 31496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_16480 31518 32957 gene locus_tag LOCUS_16490 31518 32957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089791.1 protein_id gnl|my_center|LOCUS_16490 34969 33050 gene locus_tag LOCUS_16500 34969 33050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 35108 35803 gene locus_tag LOCUS_16510 35108 35803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 35921 37411 gene locus_tag LOCUS_16520 35921 37411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 37709 40609 gene locus_tag LOCUS_16530 37709 40609 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_16530 41400 40984 gene locus_tag LOCUS_16540 41400 40984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 41658 42632 gene locus_tag LOCUS_16550 41658 42632 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262468.1 protein_id gnl|my_center|LOCUS_16550 43041 43178 gene locus_tag LOCUS_16560 43041 43178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 43262 44008 gene locus_tag LOCUS_16570 43262 44008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 44009 45091 gene locus_tag LOCUS_16580 44009 45091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 45753 46997 gene locus_tag LOCUS_16590 45753 46997 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_16590 47100 47825 gene locus_tag LOCUS_16600 47100 47825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_16600 47827 48801 gene locus_tag LOCUS_16610 47827 48801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_16610 49240 49545 gene locus_tag LOCUS_16620 49240 49545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 49542 50807 gene locus_tag LOCUS_16630 49542 50807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 50994 51827 gene locus_tag LOCUS_16640 50994 51827 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_16640 52326 53438 gene locus_tag LOCUS_16650 52326 53438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 55229 53742 gene locus_tag LOCUS_16660 55229 53742 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_16660 58071 55249 gene locus_tag LOCUS_16670 58071 55249 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_16670 58473 62006 gene locus_tag LOCUS_16680 58473 62006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 62469 63548 gene locus_tag LOCUS_16690 62469 63548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence024 <1 2285 gene locus_tag LOCUS_16700 <1 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:penicillin-binding protein 1A 2383 2874 gene locus_tag LOCUS_16710 2383 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3394 3095 gene locus_tag LOCUS_16720 3394 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3601 4809 gene locus_tag LOCUS_16730 3601 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5330 5884 gene locus_tag LOCUS_16740 gene yjgM 5330 5884 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_16740 7212 5893 gene locus_tag LOCUS_16750 7212 5893 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_16750 8606 7209 gene locus_tag LOCUS_16760 8606 7209 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_16760 8806 9471 gene locus_tag LOCUS_16770 8806 9471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_16770 9500 11860 gene locus_tag LOCUS_16780 9500 11860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_16780 13446 11923 gene locus_tag LOCUS_16790 13446 11923 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_16790 14278 13544 gene locus_tag LOCUS_16800 14278 13544 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_16800 14952 14275 gene locus_tag LOCUS_16810 14952 14275 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_16810 15144 17702 gene locus_tag LOCUS_16820 15144 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 19599 17779 gene locus_tag LOCUS_16830 19599 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 20040 19600 gene locus_tag LOCUS_16840 20040 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 21190 20159 gene locus_tag LOCUS_16850 21190 20159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 22395 21415 gene locus_tag LOCUS_16860 22395 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 23342 22395 gene locus_tag LOCUS_16870 23342 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 24458 23457 gene locus_tag LOCUS_16880 24458 23457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 24607 25467 gene locus_tag LOCUS_16890 24607 25467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 25481 26329 gene locus_tag LOCUS_16900 gene ispH 25481 26329 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_16900 27682 26330 gene locus_tag LOCUS_16910 27682 26330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 28211 27672 gene locus_tag LOCUS_16920 28211 27672 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_16920 30873 28219 gene locus_tag LOCUS_16930 30873 28219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 33509 31680 gene locus_tag LOCUS_16940 33509 31680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_16940 33637 35139 gene locus_tag LOCUS_16950 33637 35139 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_16950 35123 36379 gene locus_tag LOCUS_16960 35123 36379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 36394 37968 gene locus_tag LOCUS_16970 36394 37968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_16970 37993 39444 gene locus_tag LOCUS_16980 gene pepD 37993 39444 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_16980 40858 39593 gene locus_tag LOCUS_16990 gene purA 40858 39593 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QR7 protein_id gnl|my_center|LOCUS_16990 41178 40954 gene locus_tag LOCUS_17000 41178 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 41703 41260 gene locus_tag LOCUS_17010 gene fur 41703 41260 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_17010 43999 41783 gene locus_tag LOCUS_17020 43999 41783 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_17020 45355 44066 gene locus_tag LOCUS_17030 45355 44066 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_17030 46592 45342 gene locus_tag LOCUS_17040 46592 45342 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_17040 46727 47149 gene locus_tag LOCUS_17050 46727 47149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793421.1 protein_id gnl|my_center|LOCUS_17050 47160 48032 gene locus_tag LOCUS_17060 47160 48032 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_17060 48066 49397 gene locus_tag LOCUS_17070 48066 49397 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T32 protein_id gnl|my_center|LOCUS_17070 49394 50395 gene locus_tag LOCUS_17080 49394 50395 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T33 protein_id gnl|my_center|LOCUS_17080 50395 50967 gene locus_tag LOCUS_17090 50395 50967 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T34 protein_id gnl|my_center|LOCUS_17090 50964 51557 gene locus_tag LOCUS_17100 50964 51557 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T35 protein_id gnl|my_center|LOCUS_17100 51577 52149 gene locus_tag LOCUS_17110 51577 52149 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA43 protein_id gnl|my_center|LOCUS_17110 52302 55076 gene locus_tag LOCUS_17120 52302 55076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 56140 55115 gene locus_tag LOCUS_17130 gene tsaD 56140 55115 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ9 protein_id gnl|my_center|LOCUS_17130 56671 60693 gene locus_tag LOCUS_17140 56671 60693 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202866.1 protein_id gnl|my_center|LOCUS_17140 60784 61452 gene locus_tag LOCUS_17150 60784 61452 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_17150 61484 61882 gene locus_tag LOCUS_17160 61484 61882 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence025 1218 184 gene locus_tag LOCUS_17170 1218 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3470 1242 gene locus_tag LOCUS_17180 3470 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6410 3480 gene locus_tag LOCUS_17190 6410 3480 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_17190 6879 7913 gene locus_tag LOCUS_17200 6879 7913 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_17200 8064 9578 gene locus_tag LOCUS_17210 gene malT 8064 9578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_17210 9587 11866 gene locus_tag LOCUS_17220 9587 11866 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_17220 11943 13205 gene locus_tag LOCUS_17230 11943 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 16116 13222 gene locus_tag LOCUS_17240 16116 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 17754 16156 gene locus_tag LOCUS_17250 gene choB 17754 16156 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_17250 17929 19299 gene locus_tag LOCUS_17260 17929 19299 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_17260 19306 20871 gene locus_tag LOCUS_17270 19306 20871 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_17270 21178 24942 gene locus_tag LOCUS_17280 21178 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 25507 25241 gene locus_tag LOCUS_17290 25507 25241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 28834 25634 gene locus_tag LOCUS_17300 28834 25634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 28999 30861 gene locus_tag LOCUS_17310 28999 30861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 31029 31241 gene locus_tag LOCUS_17320 31029 31241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 32330 31275 gene locus_tag LOCUS_17330 32330 31275 CDS product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_17330 33305 32526 gene locus_tag LOCUS_17340 33305 32526 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120356.1 protein_id gnl|my_center|LOCUS_17340 34465 33542 gene locus_tag LOCUS_17350 34465 33542 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358407.1 protein_id gnl|my_center|LOCUS_17350 36322 34562 gene locus_tag LOCUS_17360 36322 34562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 36605 37333 gene locus_tag LOCUS_17370 gene nagB 36605 37333 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_864370.2 protein_id gnl|my_center|LOCUS_17370 39441 37513 gene locus_tag LOCUS_17380 39441 37513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 39875 39453 gene locus_tag LOCUS_17390 39875 39453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 41427 40225 gene locus_tag LOCUS_17400 41427 40225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 41671 42048 gene locus_tag LOCUS_17410 41671 42048 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_17410 42331 42110 gene locus_tag LOCUS_17420 42331 42110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 42456 43445 gene locus_tag LOCUS_17430 42456 43445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 43548 44948 gene locus_tag LOCUS_17440 43548 44948 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS5 protein_id gnl|my_center|LOCUS_17440 48631 44939 gene locus_tag LOCUS_17450 gene purL 48631 44939 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R22 protein_id gnl|my_center|LOCUS_17450 48763 49323 gene locus_tag LOCUS_17460 48763 49323 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_17460 49307 50014 gene locus_tag LOCUS_17470 49307 50014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 50011 51060 gene locus_tag LOCUS_17480 50011 51060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764717.1 protein_id gnl|my_center|LOCUS_17480 52517 51057 gene locus_tag LOCUS_17490 gene cotH 52517 51057 CDS product inner spore coat protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45535 protein_id gnl|my_center|LOCUS_17490 54385 52697 gene locus_tag LOCUS_17500 gene ggtB 54385 52697 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_17500 54474 58520 gene locus_tag LOCUS_17510 54474 58520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 60699 58537 gene locus_tag LOCUS_17520 60699 58537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence026 1129 83 gene locus_tag LOCUS_17530 1129 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1263 2192 gene locus_tag LOCUS_17540 1263 2192 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 protein_id gnl|my_center|LOCUS_17540 3427 2366 gene locus_tag LOCUS_17550 3427 2366 CDS product QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_17550 5727 3586 gene locus_tag LOCUS_17560 5727 3586 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_17560 6971 5727 gene locus_tag LOCUS_17570 gene hdrA-1 6971 5727 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_17570 8917 7028 gene locus_tag LOCUS_17580 8917 7028 CDS product adenylylsulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_17580 9360 8923 gene locus_tag LOCUS_17590 gene aspB 9360 8923 CDS product adenylylsulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_17590 10408 9476 gene locus_tag LOCUS_17600 10408 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 12988 10538 gene locus_tag LOCUS_17610 12988 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 14543 13095 gene locus_tag LOCUS_17620 gene gnd 14543 13095 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1Q5 protein_id gnl|my_center|LOCUS_17620 15762 14638 gene locus_tag LOCUS_17630 gene pdxB 15762 14638 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E4 protein_id gnl|my_center|LOCUS_17630 17000 15759 gene locus_tag LOCUS_17640 17000 15759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122789.1 protein_id gnl|my_center|LOCUS_17640 17895 17008 gene locus_tag LOCUS_17650 17895 17008 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_17650 19244 17970 gene locus_tag LOCUS_17660 gene pfp 19244 17970 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_17660 19380 20162 gene locus_tag LOCUS_17670 gene surE 19380 20162 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_17670 20490 21593 gene locus_tag LOCUS_17680 gene lpxB 20490 21593 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_17680 21645 22376 gene locus_tag LOCUS_17690 gene gldF 21645 22376 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_17690 22370 24127 gene locus_tag LOCUS_17700 gene gldG 22370 24127 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_17700 24225 25226 gene locus_tag LOCUS_17710 24225 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 25331 26461 gene locus_tag LOCUS_17720 25331 26461 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A810 protein_id gnl|my_center|LOCUS_17720 26454 27224 gene locus_tag LOCUS_17730 26454 27224 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 protein_id gnl|my_center|LOCUS_17730 27239 27850 gene locus_tag LOCUS_17740 27239 27850 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_17740 29038 27851 gene locus_tag LOCUS_17750 gene argD 29038 27851 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_17750 29760 29038 gene locus_tag LOCUS_17760 29760 29038 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_17760 30594 29923 gene locus_tag LOCUS_17770 gene trmH 30594 29923 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51081 protein_id gnl|my_center|LOCUS_17770 30914 30642 gene locus_tag LOCUS_17780 30914 30642 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_17780 31187 31272 gene locus_tag LOCUS_t00120 31187 31272 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31645 34173 gene locus_tag LOCUS_17790 31645 34173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 35423 34404 gene locus_tag LOCUS_17800 35423 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 36580 36822 gene locus_tag LOCUS_17810 36580 36822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 37060 37452 gene locus_tag LOCUS_17820 37060 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 37973 42937 gene locus_tag LOCUS_17830 37973 42937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 42927 44066 gene locus_tag LOCUS_17840 42927 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 44195 44476 gene locus_tag LOCUS_17850 44195 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 44776 45078 gene locus_tag LOCUS_17860 44776 45078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 46140 45112 gene locus_tag LOCUS_17870 46140 45112 CDS product putative trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I489 protein_id gnl|my_center|LOCUS_17870 47600 46137 gene locus_tag LOCUS_17880 47600 46137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 47964 48278 gene locus_tag LOCUS_17890 47964 48278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 48367 49533 gene locus_tag LOCUS_17900 48367 49533 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846900.1 protein_id gnl|my_center|LOCUS_17900 52097 49530 gene locus_tag LOCUS_17910 52097 49530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 52194 53207 gene locus_tag LOCUS_17920 52194 53207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 53957 53244 gene locus_tag LOCUS_17930 53957 53244 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_17930 54710 53961 gene locus_tag LOCUS_17940 54710 53961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 55248 57380 gene locus_tag LOCUS_17950 55248 57380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 57389 59428 gene locus_tag LOCUS_17960 57389 59428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 60225 59470 gene locus_tag LOCUS_17970 60225 59470 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL2 protein_id gnl|my_center|LOCUS_17970 <60876 60242 gene locus_tag LOCUS_17980 <60876 60242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87FK5:ribulokinase >Feature sequence027 897 1148 gene locus_tag LOCUS_17990 897 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3675 1255 gene locus_tag LOCUS_18000 3675 1255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_18000 5391 4024 gene locus_tag LOCUS_18010 5391 4024 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_18010 6751 5381 gene locus_tag LOCUS_18020 6751 5381 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_18020 6920 9325 gene locus_tag LOCUS_18030 6920 9325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_18030 9479 9925 gene locus_tag LOCUS_18040 9479 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 9940 11292 gene locus_tag LOCUS_18050 9940 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 11297 12331 gene locus_tag LOCUS_18060 11297 12331 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_18060 12347 15382 gene locus_tag LOCUS_18070 gene acrB5 12347 15382 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_18070 15419 16258 gene locus_tag LOCUS_18080 15419 16258 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_18080 16321 16620 gene locus_tag LOCUS_18090 16321 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 16634 18445 gene locus_tag LOCUS_18100 gene mutL 16634 18445 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_18100 18485 19306 gene locus_tag LOCUS_18110 18485 19306 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_18110 19318 20208 gene locus_tag LOCUS_18120 19318 20208 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_18120 20230 21318 gene locus_tag LOCUS_18130 20230 21318 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_18130 22264 21308 gene locus_tag LOCUS_18140 22264 21308 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_18140 24709 22295 gene locus_tag LOCUS_18150 24709 22295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_18150 24791 25606 gene locus_tag LOCUS_18160 gene dapD 24791 25606 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_18160 25703 26461 gene locus_tag LOCUS_18170 25703 26461 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_18170 26445 27008 gene locus_tag LOCUS_18180 26445 27008 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_18180 27539 27009 gene locus_tag LOCUS_18190 gene rimM 27539 27009 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A682 protein_id gnl|my_center|LOCUS_18190 28378 27629 gene locus_tag LOCUS_18200 28378 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 28573 32031 gene locus_tag LOCUS_18210 gene dnaE 28573 32031 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3X0 protein_id gnl|my_center|LOCUS_18210 32098 32415 gene locus_tag LOCUS_18220 32098 32415 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG6 protein_id gnl|my_center|LOCUS_18220 32515 33453 gene locus_tag LOCUS_18230 32515 33453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_18230 34930 33455 gene locus_tag LOCUS_18240 34930 33455 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YC9 protein_id gnl|my_center|LOCUS_18240 35017 36471 gene locus_tag LOCUS_18250 35017 36471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 36502 37314 gene locus_tag LOCUS_18260 gene zupT 36502 37314 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 protein_id gnl|my_center|LOCUS_18260 37318 38577 gene locus_tag LOCUS_18270 gene pepT 37318 38577 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55179 protein_id gnl|my_center|LOCUS_18270 38645 39733 gene locus_tag LOCUS_18280 38645 39733 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182936.1 protein_id gnl|my_center|LOCUS_18280 39751 40728 gene locus_tag LOCUS_18290 39751 40728 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182937.1 protein_id gnl|my_center|LOCUS_18290 40733 42025 gene locus_tag LOCUS_18300 40733 42025 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819K5 protein_id gnl|my_center|LOCUS_18300 42046 43395 gene locus_tag LOCUS_18310 gene acoL 42046 43395 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A4 protein_id gnl|my_center|LOCUS_18310 43459 44079 gene locus_tag LOCUS_18320 43459 44079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 44212 45693 gene locus_tag LOCUS_18330 gene rhaB 44212 45693 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A3 protein_id gnl|my_center|LOCUS_18330 45741 47240 gene locus_tag LOCUS_18340 45741 47240 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_18340 47255 48574 gene locus_tag LOCUS_18350 gene xylA1 47255 48574 CDS product xylose isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T9 protein_id gnl|my_center|LOCUS_18350 48732 50771 gene locus_tag LOCUS_18360 gene pepX1 48732 50771 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_18360 50841 51683 gene locus_tag LOCUS_18370 50841 51683 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_18370 52227 51676 gene locus_tag LOCUS_18380 52227 51676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 52430 54529 gene locus_tag LOCUS_18390 52430 54529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 55621 54581 gene locus_tag LOCUS_18400 55621 54581 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_18400 57761 55629 gene locus_tag LOCUS_18410 57761 55629 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_18410 59734 57881 gene locus_tag LOCUS_18420 59734 57881 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_18420 <60342 59822 gene locus_tag LOCUS_18430 <60342 59822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083944.1:amidohydrolase >Feature sequence028 161 2107 gene locus_tag LOCUS_18440 161 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2123 3592 gene locus_tag LOCUS_18450 gene aslA 2123 3592 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_18450 3589 6063 gene locus_tag LOCUS_18460 3589 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 8324 6273 gene locus_tag LOCUS_18470 8324 6273 CDS product glycosyl hydrolase family 31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767349.1 protein_id gnl|my_center|LOCUS_18470 9710 8568 gene locus_tag LOCUS_18480 9710 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_18480 10857 9721 gene locus_tag LOCUS_18490 10857 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 12950 10854 gene locus_tag LOCUS_18500 12950 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 15219 12961 gene locus_tag LOCUS_18510 15219 12961 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203457.1 protein_id gnl|my_center|LOCUS_18510 18025 15344 gene locus_tag LOCUS_18520 18025 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 18779 18018 gene locus_tag LOCUS_18530 18779 18018 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_18530 21783 18802 gene locus_tag LOCUS_18540 21783 18802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_18540 23927 21795 gene locus_tag LOCUS_18550 23927 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 25315 23936 gene locus_tag LOCUS_18560 25315 23936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 27217 25352 gene locus_tag LOCUS_18570 27217 25352 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_18570 28345 27344 gene locus_tag LOCUS_18580 28345 27344 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107685.1 protein_id gnl|my_center|LOCUS_18580 29181 28453 gene locus_tag LOCUS_18590 29181 28453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 30080 29208 gene locus_tag LOCUS_18600 30080 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 31729 30086 gene locus_tag LOCUS_18610 31729 30086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 32240 31740 gene locus_tag LOCUS_18620 32240 31740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 34219 32426 gene locus_tag LOCUS_18630 gene sglT 34219 32426 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_18630 35666 34326 gene locus_tag LOCUS_18640 35666 34326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 36039 37019 gene locus_tag LOCUS_18650 36039 37019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 37031 38380 gene locus_tag LOCUS_18660 gene actC 37031 38380 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_18660 38392 39312 gene locus_tag LOCUS_18670 38392 39312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 39358 40140 gene locus_tag LOCUS_18680 39358 40140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 40142 41767 gene locus_tag LOCUS_18690 40142 41767 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B23 protein_id gnl|my_center|LOCUS_18690 41821 42435 gene locus_tag LOCUS_18700 41821 42435 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939101.1 protein_id gnl|my_center|LOCUS_18700 42449 42736 gene locus_tag LOCUS_18710 42449 42736 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939100.1 protein_id gnl|my_center|LOCUS_18710 42748 43677 gene locus_tag LOCUS_18720 gene coxB 42748 43677 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GM4 protein_id gnl|my_center|LOCUS_18720 43690 44532 gene locus_tag LOCUS_18730 43690 44532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 46459 44549 gene locus_tag LOCUS_18740 46459 44549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 47758 46472 gene locus_tag LOCUS_18750 47758 46472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 53161 47771 gene locus_tag LOCUS_18760 53161 47771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 54229 53249 gene locus_tag LOCUS_18770 54229 53249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 54930 54274 gene locus_tag LOCUS_18780 54930 54274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 55361 54933 gene locus_tag LOCUS_18790 55361 54933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 57630 56617 gene locus_tag LOCUS_18800 57630 56617 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence029 2118 64 gene locus_tag LOCUS_18810 2118 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4436 2115 gene locus_tag LOCUS_18820 4436 2115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036930.1 protein_id gnl|my_center|LOCUS_18820 4621 8484 gene locus_tag LOCUS_18830 4621 8484 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2L2 protein_id gnl|my_center|LOCUS_18830 8934 8761 gene locus_tag LOCUS_18840 8934 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18840 9180 10469 gene locus_tag LOCUS_18850 9180 10469 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_18850 10473 12917 gene locus_tag LOCUS_18860 10473 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 14056 13094 gene locus_tag LOCUS_18870 14056 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 14805 14266 gene locus_tag LOCUS_18880 14805 14266 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1W0 protein_id gnl|my_center|LOCUS_18880 16133 14928 gene locus_tag LOCUS_18890 16133 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 16448 16600 gene locus_tag LOCUS_18900 16448 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 16743 19202 gene locus_tag LOCUS_18910 16743 19202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 19439 20143 gene locus_tag LOCUS_18920 19439 20143 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_18920 20909 20238 gene locus_tag LOCUS_18930 20909 20238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 21271 20906 gene locus_tag LOCUS_18940 21271 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 21934 21353 gene locus_tag LOCUS_18950 21934 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 23264 21996 gene locus_tag LOCUS_18960 23264 21996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 24169 23477 gene locus_tag LOCUS_18970 24169 23477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_18970 25584 24205 gene locus_tag LOCUS_18980 25584 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 27207 25708 gene locus_tag LOCUS_18990 27207 25708 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_18990 27677 28588 gene locus_tag LOCUS_19000 27677 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 30431 28812 gene locus_tag LOCUS_19010 30431 28812 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_19010 30712 32043 gene locus_tag LOCUS_19020 30712 32043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 32072 33259 gene locus_tag LOCUS_19030 32072 33259 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_19030 33249 33965 gene locus_tag LOCUS_19040 33249 33965 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_19040 35600 34071 gene locus_tag LOCUS_19050 35600 34071 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_19050 36352 35753 gene locus_tag LOCUS_19060 36352 35753 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_19060 36579 37661 gene locus_tag LOCUS_19070 36579 37661 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_19070 37882 38553 gene locus_tag LOCUS_19080 37882 38553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 38931 39965 gene locus_tag LOCUS_19090 38931 39965 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861873.1 protein_id gnl|my_center|LOCUS_19090 40210 41325 gene locus_tag LOCUS_19100 40210 41325 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_19100 41685 41479 gene locus_tag LOCUS_19110 41685 41479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 42829 41666 gene locus_tag LOCUS_19120 42829 41666 CDS product putative transposase y4qJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55631 protein_id gnl|my_center|LOCUS_19120 43767 42832 gene locus_tag LOCUS_19130 43767 42832 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_19130 43936 44295 gene locus_tag LOCUS_19140 43936 44295 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_19140 44298 44750 gene locus_tag LOCUS_19150 44298 44750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 44935 45531 gene locus_tag LOCUS_19160 44935 45531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 45599 46102 gene locus_tag LOCUS_19170 45599 46102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 46201 46911 gene locus_tag LOCUS_19180 46201 46911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 47145 46933 gene locus_tag LOCUS_19190 47145 46933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 47111 47842 gene locus_tag LOCUS_19200 47111 47842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 48093 49262 gene locus_tag LOCUS_19210 48093 49262 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_19210 49669 50454 gene locus_tag LOCUS_19220 49669 50454 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_19220 50615 51571 gene locus_tag LOCUS_19230 50615 51571 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 protein_id gnl|my_center|LOCUS_19230 51674 52636 gene locus_tag LOCUS_19240 51674 52636 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_19240 53085 54629 gene locus_tag LOCUS_19250 53085 54629 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence030 576 1931 gene locus_tag LOCUS_19260 gene arsA 576 1931 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_19260 2064 3452 gene locus_tag LOCUS_19270 2064 3452 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_19270 3530 4891 gene locus_tag LOCUS_19280 3530 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_19280 5040 6470 gene locus_tag LOCUS_19290 5040 6470 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_19290 8144 6570 gene locus_tag LOCUS_19300 8144 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 11577 8173 gene locus_tag LOCUS_19310 11577 8173 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_19310 15982 11948 gene locus_tag LOCUS_19320 15982 11948 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_19320 16157 17383 gene locus_tag LOCUS_19330 16157 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 17440 18057 gene locus_tag LOCUS_19340 17440 18057 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 protein_id gnl|my_center|LOCUS_19340 18073 18942 gene locus_tag LOCUS_19350 18073 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 21712 19037 gene locus_tag LOCUS_19360 21712 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 21894 23075 gene locus_tag LOCUS_19370 gene cmeA 21894 23075 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858646.1 protein_id gnl|my_center|LOCUS_19370 23088 26285 gene locus_tag LOCUS_19380 23088 26285 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_19380 26298 27629 gene locus_tag LOCUS_19390 26298 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 27629 28819 gene locus_tag LOCUS_19400 27629 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_19400 30016 28829 gene locus_tag LOCUS_19410 30016 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 31675 30611 gene locus_tag LOCUS_19420 31675 30611 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_19420 32213 34291 gene locus_tag LOCUS_19430 32213 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 34456 34277 gene locus_tag LOCUS_19440 34456 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 34889 34802 gene locus_tag LOCUS_t00130 34889 34802 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34964 35644 gene locus_tag LOCUS_19450 34964 35644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_19450 35863 35672 gene locus_tag LOCUS_19460 35863 35672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 36730 35873 gene locus_tag LOCUS_19470 36730 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_19470 37162 36932 gene locus_tag LOCUS_19480 37162 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 37873 37289 gene locus_tag LOCUS_19490 37873 37289 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_19490 38018 40891 gene locus_tag LOCUS_19500 38018 40891 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R17 protein_id gnl|my_center|LOCUS_19500 40907 41410 gene locus_tag LOCUS_19510 40907 41410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 42112 41447 gene locus_tag LOCUS_19520 42112 41447 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_19520 42869 42129 gene locus_tag LOCUS_19530 42869 42129 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660378.1 protein_id gnl|my_center|LOCUS_19530 44045 42906 gene locus_tag LOCUS_19540 44045 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688558.1 protein_id gnl|my_center|LOCUS_19540 44132 44770 gene locus_tag LOCUS_19550 44132 44770 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_19550 45461 44784 gene locus_tag LOCUS_19560 45461 44784 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963636.1 protein_id gnl|my_center|LOCUS_19560 46836 45433 gene locus_tag LOCUS_19570 46836 45433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 46937 47710 gene locus_tag LOCUS_19580 46937 47710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 49032 47785 gene locus_tag LOCUS_19590 49032 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_19590 50004 49072 gene locus_tag LOCUS_19600 50004 49072 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_19600 51070 49997 gene locus_tag LOCUS_19610 gene serC 51070 49997 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR4 protein_id gnl|my_center|LOCUS_19610 52179 51079 gene locus_tag LOCUS_19620 gene gcvT 52179 51079 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS3 protein_id gnl|my_center|LOCUS_19620 52335 52691 gene locus_tag LOCUS_19630 52335 52691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 53886 52729 gene locus_tag LOCUS_19640 53886 52729 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_19640 54406 53870 gene locus_tag LOCUS_19650 54406 53870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence031 19 241 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattccactatggtacgattgagag 713 450 gene locus_tag LOCUS_19660 713 450 CDS product CRISPR-associated protein Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008530231.1 protein_id gnl|my_center|LOCUS_19660 1717 713 gene locus_tag LOCUS_19670 gene cas1 1717 713 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_19670 2235 1714 gene locus_tag LOCUS_19680 2235 1714 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_19680 2792 2223 gene locus_tag LOCUS_19690 2792 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3080 2928 gene locus_tag LOCUS_19700 3080 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4329 3469 gene locus_tag LOCUS_19710 4329 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963647.1 protein_id gnl|my_center|LOCUS_19710 5123 4335 gene locus_tag LOCUS_19720 5123 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963648.1 protein_id gnl|my_center|LOCUS_19720 6356 5298 gene locus_tag LOCUS_19730 6356 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768969.1 protein_id gnl|my_center|LOCUS_19730 7769 6375 gene locus_tag LOCUS_19740 7769 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768970.1 protein_id gnl|my_center|LOCUS_19740 9950 7785 gene locus_tag LOCUS_19750 9950 7785 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202915.1 protein_id gnl|my_center|LOCUS_19750 10556 9960 gene locus_tag LOCUS_19760 10556 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768972.1 protein_id gnl|my_center|LOCUS_19760 11224 10568 gene locus_tag LOCUS_19770 11224 10568 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_19770 12196 11285 gene locus_tag LOCUS_19780 12196 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 13707 12553 gene locus_tag LOCUS_19790 13707 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_19790 14944 13772 gene locus_tag LOCUS_19800 14944 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 16361 15045 gene locus_tag LOCUS_19810 16361 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 18013 16547 gene locus_tag LOCUS_19820 18013 16547 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_19820 18230 20455 gene locus_tag LOCUS_19830 18230 20455 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_19830 21099 20485 gene locus_tag LOCUS_19840 21099 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 24214 21782 gene locus_tag LOCUS_19850 24214 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 24415 25605 gene locus_tag LOCUS_19860 gene dinB 24415 25605 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5Q4 protein_id gnl|my_center|LOCUS_19860 25637 28636 gene locus_tag LOCUS_19870 25637 28636 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 protein_id gnl|my_center|LOCUS_19870 28717 30159 gene locus_tag LOCUS_19880 28717 30159 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_19880 30357 32642 gene locus_tag LOCUS_19890 30357 32642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_19890 35051 32652 gene locus_tag LOCUS_19900 35051 32652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_19900 35828 35190 gene locus_tag LOCUS_19910 35828 35190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 37332 35854 gene locus_tag LOCUS_19920 37332 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 38192 37329 gene locus_tag LOCUS_19930 38192 37329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 38338 39618 gene locus_tag LOCUS_19940 38338 39618 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_19940 39633 40442 gene locus_tag LOCUS_19950 39633 40442 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK7 protein_id gnl|my_center|LOCUS_19950 40445 41203 gene locus_tag LOCUS_19960 40445 41203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 42516 41200 gene locus_tag LOCUS_19970 42516 41200 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_19970 44706 42517 gene locus_tag LOCUS_19980 44706 42517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_19980 44944 44768 gene locus_tag LOCUS_19990 44944 44768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 45106 48051 gene locus_tag LOCUS_20000 45106 48051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 49347 48214 gene locus_tag LOCUS_20010 49347 48214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 49912 49337 gene locus_tag LOCUS_20020 49912 49337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 51523 50483 gene locus_tag LOCUS_20030 51523 50483 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence032 2501 384 gene locus_tag LOCUS_20040 2501 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4104 2530 gene locus_tag LOCUS_20050 4104 2530 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789258.1 protein_id gnl|my_center|LOCUS_20050 4769 4254 gene locus_tag LOCUS_20060 4769 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5547 4999 gene locus_tag LOCUS_20070 5547 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5931 7412 gene locus_tag LOCUS_20080 gene crtN 5931 7412 CDS product dehydrosqualene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_20080 7686 10379 gene locus_tag LOCUS_20090 7686 10379 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_20090 10390 11205 gene locus_tag LOCUS_20100 10390 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13478 11298 gene locus_tag LOCUS_20110 gene gaa 13478 11298 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_20110 14325 13693 gene locus_tag LOCUS_20120 14325 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 15454 14528 gene locus_tag LOCUS_20130 15454 14528 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_20130 15573 16922 gene locus_tag LOCUS_20140 15573 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 18289 16937 gene locus_tag LOCUS_20150 18289 16937 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_20150 19081 18308 gene locus_tag LOCUS_20160 19081 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 19739 19083 gene locus_tag LOCUS_20170 gene alsD 19739 19083 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04777 protein_id gnl|my_center|LOCUS_20170 20529 19807 gene locus_tag LOCUS_20180 gene cutC 20529 19807 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJF2 protein_id gnl|my_center|LOCUS_20180 20797 20522 gene locus_tag LOCUS_20190 20797 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 20877 21158 gene locus_tag LOCUS_20200 20877 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 21155 23035 gene locus_tag LOCUS_20210 21155 23035 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_20210 23048 24283 gene locus_tag LOCUS_20220 23048 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108770.1 protein_id gnl|my_center|LOCUS_20220 25203 24280 gene locus_tag LOCUS_20230 25203 24280 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_20230 27870 25261 gene locus_tag LOCUS_20240 27870 25261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 28011 29966 gene locus_tag LOCUS_20250 28011 29966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 31759 30053 gene locus_tag LOCUS_20260 31759 30053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 32488 31772 gene locus_tag LOCUS_20270 32488 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_20270 33023 32574 gene locus_tag LOCUS_20280 33023 32574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 35279 33114 gene locus_tag LOCUS_20290 35279 33114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 36148 35276 gene locus_tag LOCUS_20300 36148 35276 CDS product beta-alanine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118505.1 protein_id gnl|my_center|LOCUS_20300 36470 36141 gene locus_tag LOCUS_20310 36470 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 36655 37164 gene locus_tag LOCUS_20320 36655 37164 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_20320 39251 37212 gene locus_tag LOCUS_20330 39251 37212 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109177.1 protein_id gnl|my_center|LOCUS_20330 39463 42282 gene locus_tag LOCUS_20340 39463 42282 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_20340 42287 42985 gene locus_tag LOCUS_20350 42287 42985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_20350 42972 44189 gene locus_tag LOCUS_20360 42972 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_20360 44376 46616 gene locus_tag LOCUS_20370 44376 46616 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_20370 46722 47450 gene locus_tag LOCUS_20380 46722 47450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 47443 47991 gene locus_tag LOCUS_20390 47443 47991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 48465 48082 gene locus_tag LOCUS_20400 48465 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458981.1 protein_id gnl|my_center|LOCUS_20400 48667 48437 gene locus_tag LOCUS_20410 48667 48437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 48969 48655 gene locus_tag LOCUS_20420 48969 48655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 49240 49067 gene locus_tag LOCUS_20430 49240 49067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 49572 49868 gene locus_tag LOCUS_20440 49572 49868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 50945 50142 gene locus_tag LOCUS_20450 50945 50142 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948268.1 protein_id gnl|my_center|LOCUS_20450 51307 51041 gene locus_tag LOCUS_20460 51307 51041 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence033 2206 17 gene locus_tag LOCUS_20470 2206 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107937.1 protein_id gnl|my_center|LOCUS_20470 4405 2234 gene locus_tag LOCUS_20480 4405 2234 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_20480 5445 4474 gene locus_tag LOCUS_20490 5445 4474 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_20490 6581 5562 gene locus_tag LOCUS_20500 6581 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 7369 6605 gene locus_tag LOCUS_20510 7369 6605 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_20510 8611 7409 gene locus_tag LOCUS_20520 gene pfp 8611 7409 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ41 protein_id gnl|my_center|LOCUS_20520 9419 8769 gene locus_tag LOCUS_20530 9419 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_20530 10464 9508 gene locus_tag LOCUS_20540 10464 9508 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_20540 11580 10477 gene locus_tag LOCUS_20550 11580 10477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_20550 12518 11727 gene locus_tag LOCUS_20560 12518 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 13340 14614 gene locus_tag LOCUS_20570 13340 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 14604 15212 gene locus_tag LOCUS_20580 gene rnhB 14604 15212 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_20580 15392 16957 gene locus_tag LOCUS_20590 15392 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 17060 18559 gene locus_tag LOCUS_20600 17060 18559 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_20600 20778 18619 gene locus_tag LOCUS_20610 20778 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 21713 20811 gene locus_tag LOCUS_20620 21713 20811 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053645.1 protein_id gnl|my_center|LOCUS_20620 24297 21826 gene locus_tag LOCUS_20630 24297 21826 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_20630 27567 24625 gene locus_tag LOCUS_20640 27567 24625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 28421 27693 gene locus_tag LOCUS_20650 28421 27693 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438321.1 protein_id gnl|my_center|LOCUS_20650 28995 28414 gene locus_tag LOCUS_20660 28995 28414 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459024.1 protein_id gnl|my_center|LOCUS_20660 30504 29011 gene locus_tag LOCUS_20670 gene narH 30504 29011 CDS product respiratory nitrate reductase 1 beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83RN5 protein_id gnl|my_center|LOCUS_20670 34137 30526 gene locus_tag LOCUS_20680 gene narG 34137 30526 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_20680 34999 34148 gene locus_tag LOCUS_20690 34999 34148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 35419 35000 gene locus_tag LOCUS_20700 35419 35000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 37019 35424 gene locus_tag LOCUS_20710 37019 35424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 38541 37045 gene locus_tag LOCUS_20720 38541 37045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 38704 40485 gene locus_tag LOCUS_20730 38704 40485 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_20730 40584 42734 gene locus_tag LOCUS_20740 40584 42734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107185.1 protein_id gnl|my_center|LOCUS_20740 42995 43570 gene locus_tag LOCUS_20750 42995 43570 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_20750 43567 44055 gene locus_tag LOCUS_20760 gene rnhA 43567 44055 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_20760 44121 47195 gene locus_tag LOCUS_20770 44121 47195 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_20770 47211 48623 gene locus_tag LOCUS_20780 47211 48623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 48610 50073 gene locus_tag LOCUS_20790 48610 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 51238 50066 gene locus_tag LOCUS_20800 51238 50066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence034 140 394 gene locus_tag LOCUS_20810 140 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 426 770 gene locus_tag LOCUS_20820 426 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1232 777 gene locus_tag LOCUS_20830 1232 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1533 2090 gene locus_tag LOCUS_20840 1533 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2284 2209 gene locus_tag LOCUS_t00140 2284 2209 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2376 3014 gene locus_tag LOCUS_20850 2376 3014 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_20850 3020 4039 gene locus_tag LOCUS_20860 gene pheS 3020 4039 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_20860 4453 4040 gene locus_tag LOCUS_20870 4453 4040 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_20870 4622 5332 gene locus_tag LOCUS_20880 4622 5332 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_20880 5492 6433 gene locus_tag LOCUS_20890 5492 6433 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_20890 6438 7790 gene locus_tag LOCUS_20900 6438 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 10320 7780 gene locus_tag LOCUS_20910 10320 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 11466 10444 gene locus_tag LOCUS_20920 gene ruvB 11466 10444 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 protein_id gnl|my_center|LOCUS_20920 11870 11469 gene locus_tag LOCUS_20930 11870 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 13470 11956 gene locus_tag LOCUS_20940 13470 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 14093 14533 gene locus_tag LOCUS_20950 14093 14533 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_20950 14540 15922 gene locus_tag LOCUS_20960 14540 15922 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460058.1 protein_id gnl|my_center|LOCUS_20960 16335 15928 gene locus_tag LOCUS_20970 16335 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 16386 17534 gene locus_tag LOCUS_20980 16386 17534 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_20980 18797 17529 gene locus_tag LOCUS_20990 18797 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 18906 20162 gene locus_tag LOCUS_21000 18906 20162 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_21000 20167 21039 gene locus_tag LOCUS_21010 20167 21039 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584059.1 protein_id gnl|my_center|LOCUS_21010 21039 22511 gene locus_tag LOCUS_21020 21039 22511 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_21020 22605 23039 gene locus_tag LOCUS_21030 gene dut 22605 23039 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZK3 protein_id gnl|my_center|LOCUS_21030 23051 24766 gene locus_tag LOCUS_21040 23051 24766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_21040 24747 25559 gene locus_tag LOCUS_21050 24747 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 25550 26761 gene locus_tag LOCUS_21060 25550 26761 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_21060 26843 30037 gene locus_tag LOCUS_21070 26843 30037 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_21070 30038 30457 gene locus_tag LOCUS_21080 gene ybeY 30038 30457 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M2 protein_id gnl|my_center|LOCUS_21080 30860 32734 gene locus_tag LOCUS_21090 gene mnmG 30860 32734 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_21090 32813 34465 gene locus_tag LOCUS_21100 gene ade 32813 34465 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_21100 34474 36300 gene locus_tag LOCUS_21110 gene uvrC 34474 36300 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_21110 37074 37829 gene locus_tag LOCUS_21120 37074 37829 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_21120 37850 38278 gene locus_tag LOCUS_21130 gene rnpA 37850 38278 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_21130 38518 40176 gene locus_tag LOCUS_21140 38518 40176 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_21140 40608 40177 gene locus_tag LOCUS_21150 gene moaE 40608 40177 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31705 protein_id gnl|my_center|LOCUS_21150 40847 40611 gene locus_tag LOCUS_21160 40847 40611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 41419 40850 gene locus_tag LOCUS_21170 41419 40850 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_21170 44224 41435 gene locus_tag LOCUS_21180 44224 41435 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_21180 44742 44293 gene locus_tag LOCUS_21190 44742 44293 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_21190 45105 44794 gene locus_tag LOCUS_21200 gene hlyU 45105 44794 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890716.1 protein_id gnl|my_center|LOCUS_21200 46069 45191 gene locus_tag LOCUS_21210 46069 45191 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P2 protein_id gnl|my_center|LOCUS_21210 46730 46278 gene locus_tag LOCUS_21220 gene dtd 46730 46278 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_21220 47929 47090 gene locus_tag LOCUS_21230 47929 47090 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_21230 47995 48699 gene locus_tag LOCUS_21240 47995 48699 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_21240 48799 49302 gene locus_tag LOCUS_21250 48799 49302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 49332 49802 gene locus_tag LOCUS_21260 49332 49802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence035 64 444 gene locus_tag LOCUS_21270 64 444 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_21270 930 2759 gene locus_tag LOCUS_21280 930 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2816 3259 gene locus_tag LOCUS_21290 2816 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3260 4246 gene locus_tag LOCUS_21300 3260 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4243 5994 gene locus_tag LOCUS_21310 4243 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 7833 6001 gene locus_tag LOCUS_21320 7833 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 9031 8207 gene locus_tag LOCUS_21330 9031 8207 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_21330 10340 9225 gene locus_tag LOCUS_21340 10340 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 10498 13551 gene locus_tag LOCUS_21350 10498 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 13554 14303 gene locus_tag LOCUS_21360 13554 14303 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_21360 15578 14313 gene locus_tag LOCUS_21370 15578 14313 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119301.1 protein_id gnl|my_center|LOCUS_21370 15577 16524 gene locus_tag LOCUS_21380 15577 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 16633 18981 gene locus_tag LOCUS_21390 16633 18981 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_21390 19062 22331 gene locus_tag LOCUS_21400 19062 22331 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_21400 23976 22357 gene locus_tag LOCUS_21410 23976 22357 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 protein_id gnl|my_center|LOCUS_21410 24172 24711 gene locus_tag LOCUS_21420 24172 24711 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_21420 24760 25212 gene locus_tag LOCUS_21430 24760 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 25209 25751 gene locus_tag LOCUS_21440 25209 25751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 25799 26311 gene locus_tag LOCUS_21450 25799 26311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 26541 27725 gene locus_tag LOCUS_21460 26541 27725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 28773 27730 gene locus_tag LOCUS_21470 28773 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_21470 29054 30535 gene locus_tag LOCUS_21480 29054 30535 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_21480 31963 30578 gene locus_tag LOCUS_21490 31963 30578 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_21490 34260 32065 gene locus_tag LOCUS_21500 34260 32065 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760881.1 protein_id gnl|my_center|LOCUS_21500 36031 34493 gene locus_tag LOCUS_21510 36031 34493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 36561 36187 gene locus_tag LOCUS_21520 36561 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 37310 37840 gene locus_tag LOCUS_21530 37310 37840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 37821 38546 gene locus_tag LOCUS_21540 37821 38546 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_21540 38637 39185 gene locus_tag LOCUS_21550 38637 39185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 39460 40962 gene locus_tag LOCUS_21560 gene glpK 39460 40962 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X50 protein_id gnl|my_center|LOCUS_21560 40997 42565 gene locus_tag LOCUS_21570 gene glpA 40997 42565 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_21570 42632 43984 gene locus_tag LOCUS_21580 gene rhlE 42632 43984 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_21580 43988 45367 gene locus_tag LOCUS_21590 gene cydA 43988 45367 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_21590 45369 46406 gene locus_tag LOCUS_21600 gene cydB 45369 46406 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_21600 46439 47023 gene locus_tag LOCUS_21610 46439 47023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 47082 48110 gene locus_tag LOCUS_21620 47082 48110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 48258 48956 gene locus_tag LOCUS_21630 48258 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence036 1426 47 gene locus_tag LOCUS_21640 1426 47 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_21640 3733 1727 gene locus_tag LOCUS_21650 3733 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_21650 3906 5471 gene locus_tag LOCUS_21660 3906 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 6767 5985 gene locus_tag LOCUS_21670 6767 5985 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_21670 7089 6760 gene locus_tag LOCUS_21680 7089 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 7164 8585 gene locus_tag LOCUS_21690 gene xdhA 7164 8585 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 protein_id gnl|my_center|LOCUS_21690 8582 10846 gene locus_tag LOCUS_21700 gene xdhB 8582 10846 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_21700 10843 11331 gene locus_tag LOCUS_21710 10843 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 11339 12325 gene locus_tag LOCUS_21720 11339 12325 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902575.1 protein_id gnl|my_center|LOCUS_21720 12481 15147 gene locus_tag LOCUS_21730 12481 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 15975 15172 gene locus_tag LOCUS_21740 15975 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 17088 16063 gene locus_tag LOCUS_21750 17088 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 17177 17482 gene locus_tag LOCUS_21760 17177 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 19091 17508 gene locus_tag LOCUS_21770 19091 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 20171 19104 gene locus_tag LOCUS_21780 gene cheB2 20171 19104 CDS product chemotaxis response regulator protein-glutamate methylesterase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUI8 protein_id gnl|my_center|LOCUS_21780 22719 21094 gene locus_tag LOCUS_21790 22719 21094 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266628.1 protein_id gnl|my_center|LOCUS_21790 23218 22727 gene locus_tag LOCUS_21800 23218 22727 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_21800 25320 23215 gene locus_tag LOCUS_21810 gene cheA34H 25320 23215 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_21810 25645 25328 gene locus_tag LOCUS_21820 25645 25328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 26068 25697 gene locus_tag LOCUS_21830 26068 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 26283 26065 gene locus_tag LOCUS_21840 26283 26065 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_21840 26538 27878 gene locus_tag LOCUS_21850 26538 27878 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_21850 28512 27925 gene locus_tag LOCUS_21860 28512 27925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 29933 28581 gene locus_tag LOCUS_21870 gene dbpA 29933 28581 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_21870 30138 31805 gene locus_tag LOCUS_21880 30138 31805 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_21880 32178 31900 gene locus_tag LOCUS_21890 32178 31900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 35216 32286 gene locus_tag LOCUS_21900 35216 32286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 35666 35283 gene locus_tag LOCUS_21910 35666 35283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 36436 35666 gene locus_tag LOCUS_21920 36436 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21920 36808 36518 gene locus_tag LOCUS_21930 36808 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21930 37135 38202 gene locus_tag LOCUS_21940 37135 38202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205256.1 protein_id gnl|my_center|LOCUS_21940 40872 38371 gene locus_tag LOCUS_21950 40872 38371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 41574 40885 gene locus_tag LOCUS_21960 41574 40885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 45028 41672 gene locus_tag LOCUS_21970 45028 41672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 46596 45349 gene locus_tag LOCUS_21980 46596 45349 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123037.1 protein_id gnl|my_center|LOCUS_21980 47549 46710 gene locus_tag LOCUS_21990 47549 46710 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_21990 48066 47641 gene locus_tag LOCUS_22000 48066 47641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence037 <1 528 gene locus_tag LOCUS_22010 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor 540 1469 gene locus_tag LOCUS_22020 540 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1538 2896 gene locus_tag LOCUS_22030 1538 2896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_22030 3367 6339 gene locus_tag LOCUS_22040 3367 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 6474 7058 gene locus_tag LOCUS_22050 6474 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 7055 7750 gene locus_tag LOCUS_22060 7055 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 7945 8730 gene locus_tag LOCUS_22070 7945 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 8727 8948 gene locus_tag LOCUS_22080 8727 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 11475 8935 gene locus_tag LOCUS_22090 11475 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_22090 13963 11576 gene locus_tag LOCUS_22100 13963 11576 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_22100 15872 14160 gene locus_tag LOCUS_22110 15872 14160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 16400 16786 gene locus_tag LOCUS_22120 16400 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 17261 17070 gene locus_tag LOCUS_22130 gene cspA 17261 17070 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019285.1 protein_id gnl|my_center|LOCUS_22130 17896 19305 gene locus_tag LOCUS_22140 17896 19305 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_22140 19798 19343 gene locus_tag LOCUS_22150 19798 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 21050 20187 gene locus_tag LOCUS_22160 21050 20187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 21517 21047 gene locus_tag LOCUS_22170 21517 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 21792 22190 gene locus_tag LOCUS_22180 21792 22190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 23741 22446 gene locus_tag LOCUS_22190 23741 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 23751 24872 gene locus_tag LOCUS_22200 23751 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 25039 26418 gene locus_tag LOCUS_22210 25039 26418 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_22210 26736 27899 gene locus_tag LOCUS_22220 26736 27899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 28108 27926 gene locus_tag LOCUS_22230 28108 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 28517 29731 gene locus_tag LOCUS_22240 28517 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 33063 31255 gene locus_tag LOCUS_22250 33063 31255 CDS product endochitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479087.1 protein_id gnl|my_center|LOCUS_22250 34194 33067 gene locus_tag LOCUS_22260 34194 33067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_22260 34500 36812 gene locus_tag LOCUS_22270 34500 36812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109376.1 protein_id gnl|my_center|LOCUS_22270 38681 36933 gene locus_tag LOCUS_22280 38681 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 38883 40208 gene locus_tag LOCUS_22290 38883 40208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 40205 40906 gene locus_tag LOCUS_22300 40205 40906 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_22300 41336 41169 gene locus_tag LOCUS_22310 41336 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 43240 41423 gene locus_tag LOCUS_22320 43240 41423 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748760.1 protein_id gnl|my_center|LOCUS_22320 43869 46238 gene locus_tag LOCUS_22330 43869 46238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence038 54 2354 gene locus_tag LOCUS_22340 54 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_22340 3027 2374 gene locus_tag LOCUS_22350 3027 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 5467 3047 gene locus_tag LOCUS_22360 5467 3047 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22360 6253 5477 gene locus_tag LOCUS_22370 6253 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22370 6412 8607 gene locus_tag LOCUS_22380 6412 8607 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_22380 10199 8661 gene locus_tag LOCUS_22390 10199 8661 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_22390 10339 11673 gene locus_tag LOCUS_22400 10339 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_22400 13042 11660 gene locus_tag LOCUS_22410 13042 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 13274 14044 gene locus_tag LOCUS_22420 13274 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 14041 15186 gene locus_tag LOCUS_22430 14041 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 16802 15189 gene locus_tag LOCUS_22440 16802 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 16919 19360 gene locus_tag LOCUS_22450 16919 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 19394 20422 gene locus_tag LOCUS_22460 19394 20422 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_22460 20474 22267 gene locus_tag LOCUS_22470 20474 22267 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_22470 22270 22677 gene locus_tag LOCUS_22480 22270 22677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 23570 22695 gene locus_tag LOCUS_22490 23570 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881733.1 protein_id gnl|my_center|LOCUS_22490 25019 23613 gene locus_tag LOCUS_22500 gene uxaC 25019 23613 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_22500 26267 25032 gene locus_tag LOCUS_22510 26267 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_22510 26310 27413 gene locus_tag LOCUS_22520 26310 27413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107777.1 protein_id gnl|my_center|LOCUS_22520 27404 28651 gene locus_tag LOCUS_22530 27404 28651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 29756 28656 gene locus_tag LOCUS_22540 29756 28656 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_22540 29945 30394 gene locus_tag LOCUS_22550 29945 30394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 31687 30398 gene locus_tag LOCUS_22560 31687 30398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 33437 31782 gene locus_tag LOCUS_22570 33437 31782 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_22570 34446 33847 gene locus_tag LOCUS_22580 gene hisI 34446 33847 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT3 protein_id gnl|my_center|LOCUS_22580 35216 34461 gene locus_tag LOCUS_22590 gene hisF 35216 34461 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z6 protein_id gnl|my_center|LOCUS_22590 35934 35206 gene locus_tag LOCUS_22600 gene hisA 35934 35206 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_22600 36515 35931 gene locus_tag LOCUS_22610 gene hisH 36515 35931 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_22610 37588 36515 gene locus_tag LOCUS_22620 gene hisB 37588 36515 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_22620 38671 37631 gene locus_tag LOCUS_22630 gene hisC 38671 37631 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_22630 39956 38673 gene locus_tag LOCUS_22640 gene hisD 39956 38673 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_22640 40925 40068 gene locus_tag LOCUS_22650 gene hisG 40925 40068 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_22650 44503 41114 gene locus_tag LOCUS_22660 44503 41114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 <45376 44545 gene locus_tag LOCUS_22670 <45376 44545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123802.1:NADH-dependent dehydrogenase >Feature sequence039 169 1116 gene locus_tag LOCUS_22680 gene purC 169 1116 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV7 protein_id gnl|my_center|LOCUS_22680 1116 2633 gene locus_tag LOCUS_22690 1116 2633 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_22690 3008 2724 gene locus_tag LOCUS_22700 3008 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3205 3777 gene locus_tag LOCUS_22710 3205 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3767 4513 gene locus_tag LOCUS_22720 3767 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4547 4711 gene locus_tag LOCUS_22730 4547 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 7839 4744 gene locus_tag LOCUS_22740 7839 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 8050 8655 gene locus_tag LOCUS_22750 8050 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 8675 9946 gene locus_tag LOCUS_22760 8675 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 10832 9951 gene locus_tag LOCUS_22770 10832 9951 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_22770 11199 10837 gene locus_tag LOCUS_22780 11199 10837 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_22780 11550 11993 gene locus_tag LOCUS_22790 11550 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 11984 12748 gene locus_tag LOCUS_22800 11984 12748 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_22800 12750 13949 gene locus_tag LOCUS_22810 12750 13949 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_22810 14228 15073 gene locus_tag LOCUS_22820 gene mltR 14228 15073 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_22820 15192 16685 gene locus_tag LOCUS_22830 gene crtN 15192 16685 CDS product dehydrosqualene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_22830 16699 17658 gene locus_tag LOCUS_22840 16699 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 18795 17677 gene locus_tag LOCUS_22850 18795 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 20106 18820 gene locus_tag LOCUS_22860 20106 18820 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403692.1 protein_id gnl|my_center|LOCUS_22860 20307 21698 gene locus_tag LOCUS_22870 20307 21698 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117863.1 protein_id gnl|my_center|LOCUS_22870 21703 23079 gene locus_tag LOCUS_22880 21703 23079 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_22880 23246 25609 gene locus_tag LOCUS_22890 23246 25609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_22890 27503 25629 gene locus_tag LOCUS_22900 27503 25629 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021718.1 protein_id gnl|my_center|LOCUS_22900 27916 27500 gene locus_tag LOCUS_22910 27916 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 28324 29640 gene locus_tag LOCUS_22920 28324 29640 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_22920 29767 30378 gene locus_tag LOCUS_22930 29767 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 30385 30687 gene locus_tag LOCUS_22940 30385 30687 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_22940 30693 31292 gene locus_tag LOCUS_22950 30693 31292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 31342 34170 gene locus_tag LOCUS_22960 31342 34170 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_22960 34329 34766 gene locus_tag LOCUS_22970 34329 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 35887 34925 gene locus_tag LOCUS_22980 35887 34925 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_22980 37040 35898 gene locus_tag LOCUS_22990 37040 35898 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence040 2453 225 gene locus_tag LOCUS_23000 2453 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4896 2665 gene locus_tag LOCUS_23010 4896 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 5122 5823 gene locus_tag LOCUS_23020 5122 5823 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_23020 8282 5820 gene locus_tag LOCUS_23030 8282 5820 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202184.1 protein_id gnl|my_center|LOCUS_23030 8563 8282 gene locus_tag LOCUS_23040 8563 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 8526 8774 gene locus_tag LOCUS_23050 8526 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 9161 9751 gene locus_tag LOCUS_23060 gene tdk 9161 9751 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL9 protein_id gnl|my_center|LOCUS_23060 9744 10442 gene locus_tag LOCUS_23070 gene rsmI 9744 10442 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_23070 11779 10424 gene locus_tag LOCUS_23080 gene rmuC 11779 10424 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_23080 13132 11867 gene locus_tag LOCUS_23090 13132 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_23090 14642 13122 gene locus_tag LOCUS_23100 14642 13122 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA40 protein_id gnl|my_center|LOCUS_23100 14733 15557 gene locus_tag LOCUS_23110 gene ispE 14733 15557 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA41 protein_id gnl|my_center|LOCUS_23110 15993 15610 gene locus_tag LOCUS_23120 15993 15610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 17553 16009 gene locus_tag LOCUS_23130 17553 16009 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_23130 18312 17584 gene locus_tag LOCUS_23140 gene fklB 18312 17584 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 protein_id gnl|my_center|LOCUS_23140 21796 18518 gene locus_tag LOCUS_23150 21796 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_23150 23295 21883 gene locus_tag LOCUS_23160 23295 21883 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_23160 23345 24016 gene locus_tag LOCUS_23170 23345 24016 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_23170 25390 24026 gene locus_tag LOCUS_23180 25390 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 25890 25387 gene locus_tag LOCUS_23190 25890 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 25929 26675 gene locus_tag LOCUS_23200 25929 26675 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_23200 26764 27186 gene locus_tag LOCUS_23210 26764 27186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_23210 29653 27305 gene locus_tag LOCUS_23220 29653 27305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 31995 29695 gene locus_tag LOCUS_23230 31995 29695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 34309 32099 gene locus_tag LOCUS_23240 34309 32099 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 protein_id gnl|my_center|LOCUS_23240 35705 34533 gene locus_tag LOCUS_23250 35705 34533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 37597 35804 gene locus_tag LOCUS_23260 37597 35804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 38945 37605 gene locus_tag LOCUS_23270 38945 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence041 1280 69 gene locus_tag LOCUS_23280 1280 69 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_23280 3354 2002 gene locus_tag LOCUS_23290 3354 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 5017 4025 gene locus_tag LOCUS_23300 5017 4025 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_23300 5780 6931 gene locus_tag LOCUS_23310 5780 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7367 10792 gene locus_tag LOCUS_23320 7367 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 10910 12193 gene locus_tag LOCUS_23330 10910 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 12479 12222 gene locus_tag LOCUS_23340 12479 12222 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_23340 12730 12479 gene locus_tag LOCUS_23350 12730 12479 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_23350 13197 14351 gene locus_tag LOCUS_23360 13197 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 15610 14378 gene locus_tag LOCUS_23370 15610 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 16644 15607 gene locus_tag LOCUS_23380 16644 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 18024 16822 gene locus_tag LOCUS_23390 18024 16822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 18514 18308 gene locus_tag LOCUS_23400 18514 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 19957 18677 gene locus_tag LOCUS_23410 19957 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 21100 20327 gene locus_tag LOCUS_23420 21100 20327 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_23420 22653 21376 gene locus_tag LOCUS_23430 22653 21376 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_23430 23395 22760 gene locus_tag LOCUS_23440 23395 22760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 23605 26190 gene locus_tag LOCUS_23450 23605 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 26207 28756 gene locus_tag LOCUS_23460 26207 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 28884 29477 gene locus_tag LOCUS_23470 28884 29477 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_23470 30529 29480 gene locus_tag LOCUS_23480 gene queA 30529 29480 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U1 protein_id gnl|my_center|LOCUS_23480 31423 30707 gene locus_tag LOCUS_23490 gene truB 31423 30707 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U2 protein_id gnl|my_center|LOCUS_23490 32228 31428 gene locus_tag LOCUS_23500 gene uppP 32228 31428 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 protein_id gnl|my_center|LOCUS_23500 32500 32225 gene locus_tag LOCUS_23510 gene fjo13 32500 32225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_23510 33388 32609 gene locus_tag LOCUS_23520 33388 32609 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_23520 33553 35085 gene locus_tag LOCUS_23530 33553 35085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 35131 35766 gene locus_tag LOCUS_23540 35131 35766 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942617.1 protein_id gnl|my_center|LOCUS_23540 35864 36862 gene locus_tag LOCUS_23550 gene legI 35864 36862 CDS product N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8T1 protein_id gnl|my_center|LOCUS_23550 36862 38016 gene locus_tag LOCUS_23560 36862 38016 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence042 1093 1662 gene locus_tag LOCUS_23570 1093 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 3038 1668 gene locus_tag LOCUS_23580 3038 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3127 4476 gene locus_tag LOCUS_23590 3127 4476 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_23590 4611 7373 gene locus_tag LOCUS_23600 4611 7373 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_23600 7383 9617 gene locus_tag LOCUS_23610 gene dpp4 7383 9617 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_23610 9669 12446 gene locus_tag LOCUS_23620 9669 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140280.1 protein_id gnl|my_center|LOCUS_23620 12653 12727 gene locus_tag LOCUS_t00150 12653 12727 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12996 13235 gene locus_tag LOCUS_23630 12996 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 13531 14964 gene locus_tag LOCUS_23640 13531 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 15072 15584 gene locus_tag LOCUS_23650 15072 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 15623 16120 gene locus_tag LOCUS_23660 15623 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 17840 16188 gene locus_tag LOCUS_23670 17840 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 19493 17859 gene locus_tag LOCUS_23680 19493 17859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 20109 19576 gene locus_tag LOCUS_23690 20109 19576 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_23690 20951 20100 gene locus_tag LOCUS_23700 20951 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 21658 21059 gene locus_tag LOCUS_23710 21658 21059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_23710 21738 23162 gene locus_tag LOCUS_23720 21738 23162 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_23720 23565 23149 gene locus_tag LOCUS_23730 23565 23149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_23730 25317 23569 gene locus_tag LOCUS_23740 25317 23569 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_23740 26213 25320 gene locus_tag LOCUS_23750 26213 25320 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_23750 26817 26260 gene locus_tag LOCUS_23760 gene rfbC 26817 26260 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_23760 27708 26827 gene locus_tag LOCUS_23770 gene rfbA 27708 26827 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WRV3 protein_id gnl|my_center|LOCUS_23770 28680 27712 gene locus_tag LOCUS_23780 28680 27712 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_23780 30025 28712 gene locus_tag LOCUS_23790 30025 28712 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_23790 30318 30731 gene locus_tag LOCUS_23800 30318 30731 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_23800 30742 31929 gene locus_tag LOCUS_23810 30742 31929 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 protein_id gnl|my_center|LOCUS_23810 31950 32732 gene locus_tag LOCUS_23820 31950 32732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 32729 35458 gene locus_tag LOCUS_23830 32729 35458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 35458 36789 gene locus_tag LOCUS_23840 35458 36789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence043 558 3716 gene locus_tag LOCUS_23850 558 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3720 6119 gene locus_tag LOCUS_23860 3720 6119 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_23860 6135 7676 gene locus_tag LOCUS_23870 6135 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 9762 7690 gene locus_tag LOCUS_23880 gene fusA2 9762 7690 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_23880 10002 10508 gene locus_tag LOCUS_23890 10002 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 10576 13755 gene locus_tag LOCUS_23900 10576 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 13888 14163 gene locus_tag LOCUS_23910 13888 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 14179 16371 gene locus_tag LOCUS_23920 14179 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_23920 16659 17123 gene locus_tag LOCUS_23930 16659 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 17071 17481 gene locus_tag LOCUS_23940 17071 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 17557 18423 gene locus_tag LOCUS_23950 17557 18423 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_23950 18420 19295 gene locus_tag LOCUS_23960 18420 19295 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_23960 19299 19640 gene locus_tag LOCUS_23970 19299 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 19726 20352 gene locus_tag LOCUS_23980 19726 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 20354 21967 gene locus_tag LOCUS_23990 20354 21967 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_23990 21980 23308 gene locus_tag LOCUS_24000 21980 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 23379 23870 gene locus_tag LOCUS_24010 23379 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 23880 24812 gene locus_tag LOCUS_24020 23880 24812 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_24020 24831 25256 gene locus_tag LOCUS_24030 24831 25256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 25431 26657 gene locus_tag LOCUS_24040 25431 26657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227853.1 protein_id gnl|my_center|LOCUS_24040 26688 27479 gene locus_tag LOCUS_24050 26688 27479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 28150 27503 gene locus_tag LOCUS_24060 gene fixK 28150 27503 CDS product nitrogen fixation regulation protein FixK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29286 protein_id gnl|my_center|LOCUS_24060 28329 28679 gene locus_tag LOCUS_24070 28329 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 28689 29612 gene locus_tag LOCUS_24080 28689 29612 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZV9 protein_id gnl|my_center|LOCUS_24080 29729 30595 gene locus_tag LOCUS_24090 29729 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 31621 30602 gene locus_tag LOCUS_24100 31621 30602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 34546 31652 gene locus_tag LOCUS_24110 34546 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 34756 35523 gene locus_tag LOCUS_24120 34756 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_24120 36519 35536 gene locus_tag LOCUS_24130 36519 35536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 36932 36753 gene locus_tag LOCUS_24140 36932 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence044 2660 978 gene locus_tag LOCUS_24150 2660 978 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_24150 2778 3071 gene locus_tag LOCUS_24160 2778 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109256.1 protein_id gnl|my_center|LOCUS_24160 3078 3368 gene locus_tag LOCUS_24170 3078 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 3645 5180 gene locus_tag LOCUS_24180 gene rny 3645 5180 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_24180 5211 6251 gene locus_tag LOCUS_24190 5211 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 6248 7000 gene locus_tag LOCUS_24200 6248 7000 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107904.1 protein_id gnl|my_center|LOCUS_24200 7042 10215 gene locus_tag LOCUS_24210 7042 10215 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UE7 protein_id gnl|my_center|LOCUS_24210 10653 10225 gene locus_tag LOCUS_24220 10653 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 12068 10650 gene locus_tag LOCUS_24230 12068 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 13230 12034 gene locus_tag LOCUS_24240 gene sucB 13230 12034 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_24240 16067 13254 gene locus_tag LOCUS_24250 gene sucA 16067 13254 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_24250 16317 19226 gene locus_tag LOCUS_24260 16317 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_24260 19900 19223 gene locus_tag LOCUS_24270 gene trmD 19900 19223 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_24270 20133 20582 gene locus_tag LOCUS_24280 20133 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 20760 23219 gene locus_tag LOCUS_24290 20760 23219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 23219 25552 gene locus_tag LOCUS_24300 23219 25552 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_24300 25558 27162 gene locus_tag LOCUS_24310 gene pyrG 25558 27162 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T27 protein_id gnl|my_center|LOCUS_24310 27216 29096 gene locus_tag LOCUS_24320 gene yidC 27216 29096 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_24320 29601 29101 gene locus_tag LOCUS_24330 gene ribH 29601 29101 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_24330 30323 29631 gene locus_tag LOCUS_24340 30323 29631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_24340 30581 31705 gene locus_tag LOCUS_24350 gene recF 30581 31705 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XR8 protein_id gnl|my_center|LOCUS_24350 31686 31982 gene locus_tag LOCUS_24360 31686 31982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 32459 31992 gene locus_tag LOCUS_24370 gene ndk 32459 31992 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYP5 protein_id gnl|my_center|LOCUS_24370 32474 33556 gene locus_tag LOCUS_24380 32474 33556 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_24380 33553 34083 gene locus_tag LOCUS_24390 33553 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 34277 35068 gene locus_tag LOCUS_24400 34277 35068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 35071 35520 gene locus_tag LOCUS_24410 35071 35520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 35569 36312 gene locus_tag LOCUS_24420 35569 36312 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_24420 36342 37058 gene locus_tag LOCUS_24430 36342 37058 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence045 392 1720 gene locus_tag LOCUS_24440 392 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2561 1866 gene locus_tag LOCUS_24450 2561 1866 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_24450 4033 2558 gene locus_tag LOCUS_24460 4033 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4274 5035 gene locus_tag LOCUS_24470 4274 5035 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_24470 5050 7803 gene locus_tag LOCUS_24480 5050 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_24480 8640 7846 gene locus_tag LOCUS_24490 8640 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 12080 8736 gene locus_tag LOCUS_24500 12080 8736 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_24500 12243 13274 gene locus_tag LOCUS_24510 12243 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256558.1 protein_id gnl|my_center|LOCUS_24510 13294 14061 gene locus_tag LOCUS_24520 gene ygaJ 13294 14061 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_24520 14718 14182 gene locus_tag LOCUS_24530 14718 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 15131 16183 gene locus_tag LOCUS_24540 15131 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 17038 16292 gene locus_tag LOCUS_24550 17038 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 17584 19458 gene locus_tag LOCUS_24560 17584 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 20238 19696 gene locus_tag LOCUS_24570 20238 19696 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_24570 20785 20985 gene locus_tag LOCUS_24580 20785 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 20996 21433 gene locus_tag LOCUS_24590 20996 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 21460 23142 gene locus_tag LOCUS_24600 21460 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 24947 24225 gene locus_tag LOCUS_24610 24947 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 25359 25760 gene locus_tag LOCUS_24620 25359 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 25919 26995 gene locus_tag LOCUS_24630 25919 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 27217 28197 gene locus_tag LOCUS_24640 27217 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 28176 29177 gene locus_tag LOCUS_24650 28176 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 30276 29308 gene locus_tag LOCUS_24660 30276 29308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 30625 31704 gene locus_tag LOCUS_24670 30625 31704 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_24670 31938 33479 gene locus_tag LOCUS_24680 31938 33479 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_24680 33740 34234 gene locus_tag LOCUS_24690 33740 34234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 34673 36199 gene locus_tag LOCUS_24700 34673 36199 CDS product UPF0371 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYM2 protein_id gnl|my_center|LOCUS_24700 >Feature sequence046 639 2993 gene locus_tag LOCUS_24710 639 2993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_24710 4700 3957 gene locus_tag LOCUS_24720 4700 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 4909 6144 gene locus_tag LOCUS_24730 4909 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 6276 6515 gene locus_tag LOCUS_24740 6276 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 8849 6717 gene locus_tag LOCUS_24750 8849 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 9720 12038 gene locus_tag LOCUS_24760 9720 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 12364 13425 gene locus_tag LOCUS_24770 12364 13425 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_24770 13741 14850 gene locus_tag LOCUS_24780 13741 14850 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_24780 15196 15579 gene locus_tag LOCUS_24790 15196 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 15680 16783 gene locus_tag LOCUS_24800 15680 16783 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_24800 17041 18405 gene locus_tag LOCUS_24810 17041 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 21172 18425 gene locus_tag LOCUS_24820 21172 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 21557 23653 gene locus_tag LOCUS_24830 21557 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 24184 26415 gene locus_tag LOCUS_24840 24184 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 26431 28389 gene locus_tag LOCUS_24850 gene btuB 26431 28389 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E216 protein_id gnl|my_center|LOCUS_24850 28394 30361 gene locus_tag LOCUS_24860 28394 30361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 30375 30752 gene locus_tag LOCUS_24870 30375 30752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 30753 31895 gene locus_tag LOCUS_24880 30753 31895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 32713 31991 gene locus_tag LOCUS_24890 32713 31991 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405430.1 protein_id gnl|my_center|LOCUS_24890 33748 32732 gene locus_tag LOCUS_24900 33748 32732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence047 1249 2082 gene locus_tag LOCUS_24910 gene lgt 1249 2082 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_24910 2128 3906 gene locus_tag LOCUS_24920 2128 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_24920 5114 3903 gene locus_tag LOCUS_24930 5114 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 7701 5107 gene locus_tag LOCUS_24940 7701 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 8250 7750 gene locus_tag LOCUS_24950 8250 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 8302 8886 gene locus_tag LOCUS_24960 8302 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_24960 8888 10555 gene locus_tag LOCUS_24970 8888 10555 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_24970 10564 11907 gene locus_tag LOCUS_24980 gene mtaD 10564 11907 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66851 protein_id gnl|my_center|LOCUS_24980 11915 13234 gene locus_tag LOCUS_24990 gene mtaD 11915 13234 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66851 protein_id gnl|my_center|LOCUS_24990 15245 13833 gene locus_tag LOCUS_25000 15245 13833 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR8 protein_id gnl|my_center|LOCUS_25000 15667 15242 gene locus_tag LOCUS_25010 gene aroQ 15667 15242 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3W2 protein_id gnl|my_center|LOCUS_25010 15736 16638 gene locus_tag LOCUS_25020 gene xerC 15736 16638 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_25020 16769 19495 gene locus_tag LOCUS_25030 16769 19495 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_25030 19595 20233 gene locus_tag LOCUS_25040 gene plsY 19595 20233 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H7 protein_id gnl|my_center|LOCUS_25040 21640 20558 gene locus_tag LOCUS_25050 21640 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 22431 21637 gene locus_tag LOCUS_25060 22431 21637 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_25060 23285 22431 gene locus_tag LOCUS_25070 23285 22431 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_25070 23433 23933 gene locus_tag LOCUS_25080 23433 23933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_25080 23930 25051 gene locus_tag LOCUS_25090 23930 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_25090 25075 25833 gene locus_tag LOCUS_25100 gene tpiA 25075 25833 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_25100 25907 30358 gene locus_tag LOCUS_25110 25907 30358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 31718 30348 gene locus_tag LOCUS_25120 31718 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 31834 32292 gene locus_tag LOCUS_25130 31834 32292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 32292 33005 gene locus_tag LOCUS_25140 32292 33005 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_25140 33016 34290 gene locus_tag LOCUS_25150 33016 34290 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_25150 34801 34325 gene locus_tag LOCUS_25160 34801 34325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence048 <1 1019 gene locus_tag LOCUS_25170 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933386.1:arsenical-resistance protein 1485 1102 gene locus_tag LOCUS_25180 gene crcB 1485 1102 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z03 protein_id gnl|my_center|LOCUS_25180 1780 3642 gene locus_tag LOCUS_25190 1780 3642 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_25190 3657 5594 gene locus_tag LOCUS_25200 3657 5594 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_25200 6553 5705 gene locus_tag LOCUS_25210 6553 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_25210 6624 7307 gene locus_tag LOCUS_25220 6624 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_25220 8158 7304 gene locus_tag LOCUS_25230 8158 7304 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_25230 8310 10175 gene locus_tag LOCUS_25240 8310 10175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_25240 10186 10872 gene locus_tag LOCUS_25250 10186 10872 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_25250 10923 11912 gene locus_tag LOCUS_25260 10923 11912 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_25260 11919 13088 gene locus_tag LOCUS_25270 11919 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 13481 13074 gene locus_tag LOCUS_25280 13481 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 16728 13498 gene locus_tag LOCUS_25290 16728 13498 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_25290 18271 16709 gene locus_tag LOCUS_25300 18271 16709 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_25300 18388 19278 gene locus_tag LOCUS_25310 18388 19278 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_25310 21107 19380 gene locus_tag LOCUS_25320 gene asnB 21107 19380 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_25320 22219 21311 gene locus_tag LOCUS_25330 22219 21311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 23327 22305 gene locus_tag LOCUS_25340 gene fadB5 23327 22305 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_25340 23529 24731 gene locus_tag LOCUS_25350 23529 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 26912 24717 gene locus_tag LOCUS_25360 26912 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_25360 28861 26996 gene locus_tag LOCUS_25370 28861 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 30194 28893 gene locus_tag LOCUS_25380 30194 28893 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_25380 30450 30728 gene locus_tag LOCUS_25390 30450 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 30725 31060 gene locus_tag LOCUS_25400 30725 31060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_25400 31963 31346 gene locus_tag LOCUS_25410 31963 31346 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_25410 32220 33464 gene locus_tag LOCUS_25420 gene ilvA 32220 33464 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81F25 protein_id gnl|my_center|LOCUS_25420 <34808 33520 gene locus_tag LOCUS_25430 <34808 33520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203451.1:patatin >Feature sequence049 <1 1011 gene locus_tag LOCUS_25440 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403383.1:alcohol dehydrogenase 1004 1720 gene locus_tag LOCUS_25450 1004 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_25450 2439 1690 gene locus_tag LOCUS_25460 2439 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2667 3422 gene locus_tag LOCUS_25470 2667 3422 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_25470 3607 4632 gene locus_tag LOCUS_25480 3607 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 4666 6159 gene locus_tag LOCUS_25490 4666 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 8660 6186 gene locus_tag LOCUS_25500 8660 6186 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_25500 10329 8779 gene locus_tag LOCUS_25510 gene glyQS 10329 8779 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZB5 protein_id gnl|my_center|LOCUS_25510 11992 10439 gene locus_tag LOCUS_25520 11992 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_25520 12419 13990 gene locus_tag LOCUS_25530 12419 13990 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2X1 protein_id gnl|my_center|LOCUS_25530 15004 14012 gene locus_tag LOCUS_25540 gene trpS 15004 14012 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGA3 protein_id gnl|my_center|LOCUS_25540 15099 15434 gene locus_tag LOCUS_25550 15099 15434 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_25550 15434 16675 gene locus_tag LOCUS_25560 15434 16675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_25560 17649 16636 gene locus_tag LOCUS_25570 17649 16636 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A382 protein_id gnl|my_center|LOCUS_25570 17811 18857 gene locus_tag LOCUS_25580 17811 18857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 19374 18889 gene locus_tag LOCUS_25590 19374 18889 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_25590 20940 19441 gene locus_tag LOCUS_25600 20940 19441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 21174 22088 gene locus_tag LOCUS_25610 21174 22088 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_25610 22256 22708 gene locus_tag LOCUS_25620 gene rplM 22256 22708 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_25620 22714 23100 gene locus_tag LOCUS_25630 gene rpsI 22714 23100 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_25630 23200 24039 gene locus_tag LOCUS_25640 gene rpsB 23200 24039 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P29 protein_id gnl|my_center|LOCUS_25640 24071 24901 gene locus_tag LOCUS_25650 gene tsf 24071 24901 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_25650 24985 25695 gene locus_tag LOCUS_25660 gene pyrH 24985 25695 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5J7 protein_id gnl|my_center|LOCUS_25660 25762 26325 gene locus_tag LOCUS_25670 gene frr 25762 26325 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_25670 27327 26329 gene locus_tag LOCUS_25680 27327 26329 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_25680 27439 29334 gene locus_tag LOCUS_25690 gene dxs 27439 29334 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0C2 protein_id gnl|my_center|LOCUS_25690 29407 30168 gene locus_tag LOCUS_25700 29407 30168 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_25700 30326 32554 gene locus_tag LOCUS_25710 30326 32554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence050 226 558 gene locus_tag LOCUS_25720 226 558 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR0 protein_id gnl|my_center|LOCUS_25720 935 675 gene locus_tag LOCUS_25730 935 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1053 1739 gene locus_tag LOCUS_25740 1053 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2088 1858 gene locus_tag LOCUS_25750 2088 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2259 2558 gene locus_tag LOCUS_25760 2259 2558 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933390.1 protein_id gnl|my_center|LOCUS_25760 2623 2856 gene locus_tag LOCUS_25770 2623 2856 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 protein_id gnl|my_center|LOCUS_25770 2866 3261 gene locus_tag LOCUS_25780 2866 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3264 3962 gene locus_tag LOCUS_25790 3264 3962 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_25790 4012 5328 gene locus_tag LOCUS_25800 4012 5328 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_25800 5347 6429 gene locus_tag LOCUS_25810 5347 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 6832 7605 gene locus_tag LOCUS_25820 6832 7605 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876530.1 protein_id gnl|my_center|LOCUS_25820 7712 8128 gene locus_tag LOCUS_25830 7712 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 8839 9129 gene locus_tag LOCUS_25840 8839 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 9218 10312 gene locus_tag LOCUS_25850 9218 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 12119 10857 gene locus_tag LOCUS_25860 12119 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 13546 12398 gene locus_tag LOCUS_25870 13546 12398 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_25870 18104 13536 gene locus_tag LOCUS_25880 18104 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 18212 18397 gene locus_tag LOCUS_25890 18212 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 19795 18683 gene locus_tag LOCUS_25900 19795 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 20233 22791 gene locus_tag LOCUS_25910 20233 22791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020605.1 protein_id gnl|my_center|LOCUS_25910 24186 23035 gene locus_tag LOCUS_25920 24186 23035 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_25920 25534 24212 gene locus_tag LOCUS_25930 25534 24212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_25930 26512 26195 gene locus_tag LOCUS_25940 26512 26195 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_25940 27921 27280 gene locus_tag LOCUS_25950 27921 27280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 29440 28145 gene locus_tag LOCUS_25960 29440 28145 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_25960 30215 29712 gene locus_tag LOCUS_25970 30215 29712 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_25970 30496 30212 gene locus_tag LOCUS_25980 30496 30212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_25980 31875 30721 gene locus_tag LOCUS_25990 31875 30721 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_25990 <32734 32084 gene locus_tag LOCUS_26000 <32734 32084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89Z26:tRNA modification GTPase MnmE >Feature sequence051 2173 101 gene locus_tag LOCUS_26010 2173 101 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_26010 2333 2836 gene locus_tag LOCUS_26020 2333 2836 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_26020 2826 3287 gene locus_tag LOCUS_26030 2826 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3340 3810 gene locus_tag LOCUS_26040 3340 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5771 3819 gene locus_tag LOCUS_26050 5771 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 6750 5773 gene locus_tag LOCUS_26060 6750 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 7681 6755 gene locus_tag LOCUS_26070 7681 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 8633 7683 gene locus_tag LOCUS_26080 8633 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 10315 8630 gene locus_tag LOCUS_26090 10315 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 11276 10317 gene locus_tag LOCUS_26100 11276 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 12119 11394 gene locus_tag LOCUS_26110 12119 11394 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405430.1 protein_id gnl|my_center|LOCUS_26110 12743 12123 gene locus_tag LOCUS_26120 12743 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 15599 13239 gene locus_tag LOCUS_26130 15599 13239 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_26130 15896 18295 gene locus_tag LOCUS_26140 15896 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 18319 19848 gene locus_tag LOCUS_26150 18319 19848 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_26150 19870 23001 gene locus_tag LOCUS_26160 19870 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 23020 24402 gene locus_tag LOCUS_26170 23020 24402 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_26170 24468 25667 gene locus_tag LOCUS_26180 24468 25667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 26582 25731 gene locus_tag LOCUS_26190 26582 25731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_26190 26752 27657 gene locus_tag LOCUS_26200 26752 27657 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_26200 27660 29147 gene locus_tag LOCUS_26210 27660 29147 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_26210 29253 30299 gene locus_tag LOCUS_26220 29253 30299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence052 3198 2053 gene locus_tag LOCUS_26230 3198 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4769 3201 gene locus_tag LOCUS_26240 4769 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_26240 8188 4871 gene locus_tag LOCUS_26250 8188 4871 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_26250 8403 9284 gene locus_tag LOCUS_26260 8403 9284 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882811.1 protein_id gnl|my_center|LOCUS_26260 9290 11074 gene locus_tag LOCUS_26270 9290 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 11158 12090 gene locus_tag LOCUS_26280 11158 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 12130 13107 gene locus_tag LOCUS_26290 12130 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 13325 14236 gene locus_tag LOCUS_26300 13325 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 15747 14344 gene locus_tag LOCUS_26310 15747 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_26310 18130 15794 gene locus_tag LOCUS_26320 18130 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_26320 19505 18243 gene locus_tag LOCUS_26330 19505 18243 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZK4 protein_id gnl|my_center|LOCUS_26330 19679 21910 gene locus_tag LOCUS_26340 19679 21910 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_26340 21900 24269 gene locus_tag LOCUS_26350 21900 24269 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_26350 24357 25856 gene locus_tag LOCUS_26360 gene yidK 24357 25856 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_26360 26118 26336 gene locus_tag LOCUS_26370 26118 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 26372 28999 gene locus_tag LOCUS_26380 26372 28999 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227885.1 protein_id gnl|my_center|LOCUS_26380 28980 30263 gene locus_tag LOCUS_26390 28980 30263 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence053 969 691 gene locus_tag LOCUS_26400 969 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_26400 1267 1103 gene locus_tag LOCUS_26410 1267 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2915 1278 gene locus_tag LOCUS_26420 2915 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3480 2932 gene locus_tag LOCUS_26430 gene sigH 3480 2932 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363262.1 protein_id gnl|my_center|LOCUS_26430 7041 3583 gene locus_tag LOCUS_26440 7041 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 9573 7246 gene locus_tag LOCUS_26450 9573 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 9839 10630 gene locus_tag LOCUS_26460 9839 10630 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TXK3 protein_id gnl|my_center|LOCUS_26460 10725 11258 gene locus_tag LOCUS_26470 10725 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 12569 11322 gene locus_tag LOCUS_26480 12569 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_26480 14162 12714 gene locus_tag LOCUS_26490 14162 12714 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_26490 14774 14184 gene locus_tag LOCUS_26500 14774 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 17363 15096 gene locus_tag LOCUS_26510 17363 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 17966 17478 gene locus_tag LOCUS_26520 17966 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 17920 18117 gene locus_tag LOCUS_26530 17920 18117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 18189 21014 gene locus_tag LOCUS_26540 18189 21014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 21691 21053 gene locus_tag LOCUS_26550 21691 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 23383 21737 gene locus_tag LOCUS_26560 23383 21737 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_26560 23569 25044 gene locus_tag LOCUS_26570 23569 25044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 25062 26036 gene locus_tag LOCUS_26580 25062 26036 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_26580 26211 26831 gene locus_tag LOCUS_26590 26211 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 28691 26868 gene locus_tag LOCUS_26600 28691 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 29736 28762 gene locus_tag LOCUS_26610 gene nadA 29736 28762 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_26610 30612 29806 gene locus_tag LOCUS_26620 30612 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence054 187 1077 gene locus_tag LOCUS_26630 187 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1363 1845 gene locus_tag LOCUS_26640 1363 1845 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_26640 1863 2723 gene locus_tag LOCUS_26650 1863 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2686 5220 gene locus_tag LOCUS_26660 2686 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5288 7306 gene locus_tag LOCUS_26670 5288 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 7397 8128 gene locus_tag LOCUS_26680 7397 8128 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_26680 11119 8243 gene locus_tag LOCUS_26690 11119 8243 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_26690 11646 11143 gene locus_tag LOCUS_26700 11646 11143 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_26700 12752 11736 gene locus_tag LOCUS_26710 12752 11736 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_26710 12893 14362 gene locus_tag LOCUS_26720 12893 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_26720 14445 15692 gene locus_tag LOCUS_26730 14445 15692 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_26730 15704 19252 gene locus_tag LOCUS_26740 15704 19252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 19399 20418 gene locus_tag LOCUS_26750 19399 20418 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_26750 21736 20513 gene locus_tag LOCUS_26760 gene uxuA 21736 20513 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLS2 protein_id gnl|my_center|LOCUS_26760 21825 24377 gene locus_tag LOCUS_26770 21825 24377 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_26770 26446 24497 gene locus_tag LOCUS_26780 26446 24497 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107274.1 protein_id gnl|my_center|LOCUS_26780 27932 26799 gene locus_tag LOCUS_26790 27932 26799 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_26790 29170 28454 gene locus_tag LOCUS_26800 29170 28454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 30492 29356 gene locus_tag LOCUS_26810 30492 29356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence055 546 472 gene locus_tag LOCUS_t00160 546 472 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 752 1132 gene locus_tag LOCUS_26820 752 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_26820 1182 2579 gene locus_tag LOCUS_26830 1182 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2594 4078 gene locus_tag LOCUS_26840 2594 4078 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_26840 4053 5264 gene locus_tag LOCUS_26850 4053 5264 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_26850 5242 6423 gene locus_tag LOCUS_26860 5242 6423 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_26860 6392 7651 gene locus_tag LOCUS_26870 gene ribBA 6392 7651 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_26870 7735 8670 gene locus_tag LOCUS_26880 gene fmt 7735 8670 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_26880 9643 8654 gene locus_tag LOCUS_26890 9643 8654 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_26890 9748 10224 gene locus_tag LOCUS_26900 9748 10224 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_26900 10894 10214 gene locus_tag LOCUS_26910 10894 10214 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_26910 11711 10896 gene locus_tag LOCUS_26920 gene panB 11711 10896 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_26920 11814 12842 gene locus_tag LOCUS_26930 11814 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 13030 14961 gene locus_tag LOCUS_26940 gene dnaK 13030 14961 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X01 protein_id gnl|my_center|LOCUS_26940 15206 16006 gene locus_tag LOCUS_26950 15206 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 16018 17685 gene locus_tag LOCUS_26960 16018 17685 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_26960 17757 19130 gene locus_tag LOCUS_26970 17757 19130 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y1 protein_id gnl|my_center|LOCUS_26970 19191 19391 gene locus_tag LOCUS_26980 19191 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 19546 20526 gene locus_tag LOCUS_26990 19546 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 20615 21409 gene locus_tag LOCUS_27000 gene yoxD 20615 21409 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_27000 21456 22823 gene locus_tag LOCUS_27010 21456 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 22829 23407 gene locus_tag LOCUS_27020 22829 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 25967 23421 gene locus_tag LOCUS_27030 25967 23421 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_27030 26348 25983 gene locus_tag LOCUS_27040 gene trxA 26348 25983 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51088 protein_id gnl|my_center|LOCUS_27040 26546 27961 gene locus_tag LOCUS_27050 26546 27961 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_27050 27972 28568 gene locus_tag LOCUS_27060 27972 28568 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_27060 28674 29798 gene locus_tag LOCUS_27070 28674 29798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 <30543 29802 gene locus_tag LOCUS_27080 <30543 29802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815003.1:endonuclease >Feature sequence056 914 1786 gene locus_tag LOCUS_27090 914 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 1943 2647 gene locus_tag LOCUS_27100 1943 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3901 2699 gene locus_tag LOCUS_27110 gene aspC2 3901 2699 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_27110 4495 3923 gene locus_tag LOCUS_27120 4495 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 4721 7351 gene locus_tag LOCUS_27130 gene valS 4721 7351 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_27130 7401 8255 gene locus_tag LOCUS_27140 7401 8255 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_27140 8333 9838 gene locus_tag LOCUS_27150 8333 9838 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_27150 10780 9842 gene locus_tag LOCUS_27160 gene yfkH 10780 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_27160 11628 10783 gene locus_tag LOCUS_27170 11628 10783 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_27170 11726 15460 gene locus_tag LOCUS_27180 11726 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 15972 15457 gene locus_tag LOCUS_27190 15972 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 17279 15975 gene locus_tag LOCUS_27200 gene der 17279 15975 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV3 protein_id gnl|my_center|LOCUS_27200 18198 17311 gene locus_tag LOCUS_27210 gene era 18198 17311 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A136 protein_id gnl|my_center|LOCUS_27210 18969 18214 gene locus_tag LOCUS_27220 18969 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 19080 20462 gene locus_tag LOCUS_27230 19080 20462 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_27230 20625 22130 gene locus_tag LOCUS_27240 20625 22130 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_27240 22143 23534 gene locus_tag LOCUS_27250 22143 23534 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_27250 23574 25064 gene locus_tag LOCUS_27260 23574 25064 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_27260 25194 28247 gene locus_tag LOCUS_27270 25194 28247 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_27270 28347 28664 gene locus_tag LOCUS_27280 28347 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 28676 29626 gene locus_tag LOCUS_27290 28676 29626 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence057 939 127 gene locus_tag LOCUS_27300 939 127 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_27300 1598 942 gene locus_tag LOCUS_27310 gene rpe 1598 942 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_27310 2570 1707 gene locus_tag LOCUS_27320 gene rpoD 2570 1707 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_27320 2810 4606 gene locus_tag LOCUS_27330 gene rho 2810 4606 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RC3 protein_id gnl|my_center|LOCUS_27330 4792 8319 gene locus_tag LOCUS_27340 4792 8319 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6X8 protein_id gnl|my_center|LOCUS_27340 10215 8572 gene locus_tag LOCUS_27350 gene pckA 10215 8572 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 protein_id gnl|my_center|LOCUS_27350 10365 10796 gene locus_tag LOCUS_27360 10365 10796 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_27360 10793 11353 gene locus_tag LOCUS_27370 gene def 10793 11353 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP5 protein_id gnl|my_center|LOCUS_27370 11440 11883 gene locus_tag LOCUS_27380 11440 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 12150 13517 gene locus_tag LOCUS_27390 12150 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 13627 14967 gene locus_tag LOCUS_27400 13627 14967 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_27400 14975 16420 gene locus_tag LOCUS_27410 14975 16420 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_27410 17046 16432 gene locus_tag LOCUS_27420 17046 16432 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_27420 18139 17120 gene locus_tag LOCUS_27430 18139 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 18432 18929 gene locus_tag LOCUS_27440 18432 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 18932 19882 gene locus_tag LOCUS_27450 18932 19882 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_27450 19879 20649 gene locus_tag LOCUS_27460 19879 20649 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_27460 20646 21665 gene locus_tag LOCUS_27470 20646 21665 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_27470 22567 21662 gene locus_tag LOCUS_27480 gene miaA1 22567 21662 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_27480 23618 22569 gene locus_tag LOCUS_27490 23618 22569 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_27490 24697 23693 gene locus_tag LOCUS_27500 24697 23693 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_27500 27828 24868 gene locus_tag LOCUS_27510 27828 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 28740 28009 gene locus_tag LOCUS_27520 28740 28009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence058 6069 2911 gene locus_tag LOCUS_27530 6069 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 6459 6079 gene locus_tag LOCUS_27540 6459 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 7367 6561 gene locus_tag LOCUS_27550 gene glpF 7367 6561 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18156 protein_id gnl|my_center|LOCUS_27550 7613 7401 gene locus_tag LOCUS_27560 7613 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760151.1 protein_id gnl|my_center|LOCUS_27560 7733 8836 gene locus_tag LOCUS_27570 7733 8836 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_27570 11248 8870 gene locus_tag LOCUS_27580 11248 8870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_27580 11508 12887 gene locus_tag LOCUS_27590 11508 12887 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_27590 12868 14238 gene locus_tag LOCUS_27600 12868 14238 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786408.1 protein_id gnl|my_center|LOCUS_27600 14386 15471 gene locus_tag LOCUS_27610 14386 15471 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_27610 15507 16772 gene locus_tag LOCUS_27620 15507 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 17190 16843 gene locus_tag LOCUS_27630 17190 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 19041 17479 gene locus_tag LOCUS_27640 19041 17479 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_27640 19309 20661 gene locus_tag LOCUS_27650 19309 20661 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_27650 22181 20691 gene locus_tag LOCUS_27660 22181 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 24292 22184 gene locus_tag LOCUS_27670 24292 22184 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_27670 24467 25078 gene locus_tag LOCUS_27680 24467 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 26604 25099 gene locus_tag LOCUS_27690 26604 25099 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_27690 28105 26693 gene locus_tag LOCUS_27700 28105 26693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 28776 28117 gene locus_tag LOCUS_27710 28776 28117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence059 <1 1518 gene locus_tag LOCUS_27720 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038015.1:beta-hexosaminidase 3500 2175 gene locus_tag LOCUS_27730 3500 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4760 3600 gene locus_tag LOCUS_27740 4760 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5286 4729 gene locus_tag LOCUS_27750 5286 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 5912 5283 gene locus_tag LOCUS_27760 5912 5283 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_27760 5992 6351 gene locus_tag LOCUS_27770 5992 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 6352 6915 gene locus_tag LOCUS_27780 6352 6915 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_27780 6915 7304 gene locus_tag LOCUS_27790 6915 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 7433 8746 gene locus_tag LOCUS_27800 7433 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 8872 10095 gene locus_tag LOCUS_27810 8872 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 11743 10475 gene locus_tag LOCUS_27820 11743 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 12660 11899 gene locus_tag LOCUS_27830 12660 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_27830 13617 12865 gene locus_tag LOCUS_27840 13617 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 14981 13731 gene locus_tag LOCUS_27850 14981 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 15262 15633 gene locus_tag LOCUS_27860 15262 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 15691 16137 gene locus_tag LOCUS_27870 15691 16137 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_27870 16705 16148 gene locus_tag LOCUS_27880 16705 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 16777 17610 gene locus_tag LOCUS_27890 16777 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098079.1 protein_id gnl|my_center|LOCUS_27890 17623 18567 gene locus_tag LOCUS_27900 17623 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107537.1 protein_id gnl|my_center|LOCUS_27900 18594 18833 gene locus_tag LOCUS_27910 18594 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 20061 21314 gene locus_tag LOCUS_27920 20061 21314 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_27920 21603 23849 gene locus_tag LOCUS_27930 21603 23849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 24171 25772 gene locus_tag LOCUS_27940 24171 25772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 25962 27428 gene locus_tag LOCUS_27950 25962 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 28291 27425 gene locus_tag LOCUS_27960 28291 27425 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143847.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence060 3157 23 gene locus_tag LOCUS_27970 3157 23 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_27970 7610 3468 gene locus_tag LOCUS_27980 7610 3468 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_27980 10636 7685 gene locus_tag LOCUS_27990 10636 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 12312 10675 gene locus_tag LOCUS_28000 12312 10675 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_28000 14702 12315 gene locus_tag LOCUS_28010 14702 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 16064 15267 gene locus_tag LOCUS_28020 16064 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 16584 16039 gene locus_tag LOCUS_28030 16584 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 17058 16708 gene locus_tag LOCUS_28040 17058 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 18727 17117 gene locus_tag LOCUS_28050 18727 17117 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_28050 19065 18991 gene locus_tag LOCUS_t00170 19065 18991 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19259 20317 gene locus_tag LOCUS_28060 19259 20317 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957220.1 protein_id gnl|my_center|LOCUS_28060 21243 20320 gene locus_tag LOCUS_28070 21243 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28070 21564 21250 gene locus_tag LOCUS_28080 21564 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28080 22191 21745 gene locus_tag LOCUS_28090 22191 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 22245 24155 gene locus_tag LOCUS_28100 22245 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 24365 25099 gene locus_tag LOCUS_28110 24365 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 25240 26487 gene locus_tag LOCUS_28120 25240 26487 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_28120 26730 28184 gene locus_tag LOCUS_28130 26730 28184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence061 424 2826 gene locus_tag LOCUS_28140 424 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2878 3528 gene locus_tag LOCUS_28150 gene lolD 2878 3528 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1M1 protein_id gnl|my_center|LOCUS_28150 3531 4292 gene locus_tag LOCUS_28160 3531 4292 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_28160 4571 6340 gene locus_tag LOCUS_28170 4571 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_28170 6324 7490 gene locus_tag LOCUS_28180 6324 7490 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_28180 8882 7545 gene locus_tag LOCUS_28190 8882 7545 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_28190 9066 11651 gene locus_tag LOCUS_28200 gene mutS 9066 11651 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A334 protein_id gnl|my_center|LOCUS_28200 12694 11750 gene locus_tag LOCUS_28210 12694 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 13184 22744 gene locus_tag LOCUS_28220 13184 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 22912 25779 gene locus_tag LOCUS_28230 22912 25779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 25832 26359 gene locus_tag LOCUS_28240 gene tag 25832 26359 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_28240 26435 26508 gene locus_tag LOCUS_t00180 26435 26508 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26591 26675 gene locus_tag LOCUS_t00190 26591 26675 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26787 27920 gene locus_tag LOCUS_28250 26787 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence062 965 2140 gene locus_tag LOCUS_28260 965 2140 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_28260 2234 3070 gene locus_tag LOCUS_28270 2234 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3188 3661 gene locus_tag LOCUS_28280 3188 3661 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 protein_id gnl|my_center|LOCUS_28280 4984 3734 gene locus_tag LOCUS_28290 4984 3734 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_28290 6129 5113 gene locus_tag LOCUS_28300 6129 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 6444 7379 gene locus_tag LOCUS_28310 gene thrB 6444 7379 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_28310 7389 8663 gene locus_tag LOCUS_28320 7389 8663 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_28320 8830 9852 gene locus_tag LOCUS_28330 8830 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 10161 12071 gene locus_tag LOCUS_28340 10161 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 12732 12178 gene locus_tag LOCUS_28350 12732 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 13099 12908 gene locus_tag LOCUS_28360 13099 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 14261 13086 gene locus_tag LOCUS_28370 14261 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_28370 14736 14404 gene locus_tag LOCUS_28380 14736 14404 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_28380 15031 14726 gene locus_tag LOCUS_28390 15031 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_28390 16503 15151 gene locus_tag LOCUS_28400 16503 15151 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107804.1 protein_id gnl|my_center|LOCUS_28400 17874 16513 gene locus_tag LOCUS_28410 17874 16513 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_28410 18066 19412 gene locus_tag LOCUS_28420 18066 19412 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786410.1 protein_id gnl|my_center|LOCUS_28420 19430 20689 gene locus_tag LOCUS_28430 19430 20689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_28430 20694 21380 gene locus_tag LOCUS_28440 20694 21380 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_28440 21384 23780 gene locus_tag LOCUS_28450 21384 23780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787751.1 protein_id gnl|my_center|LOCUS_28450 23808 26210 gene locus_tag LOCUS_28460 23808 26210 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107496.1 protein_id gnl|my_center|LOCUS_28460 26203 27597 gene locus_tag LOCUS_28470 26203 27597 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202703.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence063 2513 594 gene locus_tag LOCUS_28480 2513 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 4548 2635 gene locus_tag LOCUS_28490 4548 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 7463 5064 gene locus_tag LOCUS_28500 7463 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_28500 8168 7467 gene locus_tag LOCUS_28510 gene araD 8168 7467 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_28510 8890 8195 gene locus_tag LOCUS_28520 8890 8195 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_28520 10356 8929 gene locus_tag LOCUS_28530 10356 8929 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_28530 10428 12833 gene locus_tag LOCUS_28540 10428 12833 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_28540 12846 14189 gene locus_tag LOCUS_28550 12846 14189 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_28550 14203 14946 gene locus_tag LOCUS_28560 14203 14946 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_28560 14997 15566 gene locus_tag LOCUS_28570 gene efp 14997 15566 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_28570 15566 16231 gene locus_tag LOCUS_28580 15566 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 17679 16252 gene locus_tag LOCUS_28590 17679 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 18634 17687 gene locus_tag LOCUS_28600 18634 17687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 19925 18645 gene locus_tag LOCUS_28610 gene tyrS 19925 18645 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_28610 20499 19972 gene locus_tag LOCUS_28620 20499 19972 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 protein_id gnl|my_center|LOCUS_28620 20572 22086 gene locus_tag LOCUS_28630 20572 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_28630 22083 22754 gene locus_tag LOCUS_28640 22083 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 22823 23437 gene locus_tag LOCUS_28650 22823 23437 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_28650 24740 23409 gene locus_tag LOCUS_28660 24740 23409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 25719 24733 gene locus_tag LOCUS_28670 25719 24733 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence064 1470 565 gene locus_tag LOCUS_28680 1470 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1802 1473 gene locus_tag LOCUS_28690 1802 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2034 2951 gene locus_tag LOCUS_28700 2034 2951 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_28700 3033 3212 gene locus_tag LOCUS_28710 3033 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3223 4257 gene locus_tag LOCUS_28720 3223 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4254 4697 gene locus_tag LOCUS_28730 4254 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 5196 6227 gene locus_tag LOCUS_28740 5196 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6341 8197 gene locus_tag LOCUS_28750 6341 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 10847 8526 gene locus_tag LOCUS_28760 10847 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 10968 12125 gene locus_tag LOCUS_28770 10968 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 13182 12148 gene locus_tag LOCUS_28780 13182 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 13286 13453 gene locus_tag LOCUS_28790 13286 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 14035 14571 gene locus_tag LOCUS_28800 14035 14571 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_28800 14656 15417 gene locus_tag LOCUS_28810 14656 15417 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_28810 15648 18314 gene locus_tag LOCUS_28820 15648 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 18326 20143 gene locus_tag LOCUS_28830 18326 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 20255 22108 gene locus_tag LOCUS_28840 20255 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 22167 22709 gene locus_tag LOCUS_28850 22167 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 22837 24231 gene locus_tag LOCUS_28860 22837 24231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 24442 24804 gene locus_tag LOCUS_28870 24442 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence065 283 951 gene locus_tag LOCUS_28880 283 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1003 3441 gene locus_tag LOCUS_28890 1003 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3873 3457 gene locus_tag LOCUS_28900 3873 3457 CDS product deoxyribonucleoside 5'-monophosphate N-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_28900 4762 3866 gene locus_tag LOCUS_28910 4762 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6775 4859 gene locus_tag LOCUS_28920 6775 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 6890 7870 gene locus_tag LOCUS_28930 6890 7870 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_28930 10887 7894 gene locus_tag LOCUS_28940 10887 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 10999 13371 gene locus_tag LOCUS_28950 10999 13371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_28950 14374 13481 gene locus_tag LOCUS_28960 14374 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 14491 15999 gene locus_tag LOCUS_28970 14491 15999 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_28970 16010 16519 gene locus_tag LOCUS_28980 16010 16519 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790282.1 protein_id gnl|my_center|LOCUS_28980 16534 18066 gene locus_tag LOCUS_28990 16534 18066 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_28990 18106 18597 gene locus_tag LOCUS_29000 18106 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 18758 18594 gene locus_tag LOCUS_29010 18758 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 21024 19756 gene locus_tag LOCUS_29020 gene purD 21024 19756 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_29020 21698 21036 gene locus_tag LOCUS_29030 21698 21036 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767469.1 protein_id gnl|my_center|LOCUS_29030 24691 21695 gene locus_tag LOCUS_29040 24691 21695 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_29040 25865 24870 gene locus_tag LOCUS_29050 25865 24870 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence066 2552 4522 gene locus_tag LOCUS_29060 2552 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 4684 6444 gene locus_tag LOCUS_29070 4684 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 6470 8182 gene locus_tag LOCUS_29080 6470 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 8186 9310 gene locus_tag LOCUS_29090 8186 9310 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5F6 protein_id gnl|my_center|LOCUS_29090 9881 9348 gene locus_tag LOCUS_29100 9881 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 10539 9994 gene locus_tag LOCUS_29110 10539 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 10641 10841 gene locus_tag LOCUS_29120 10641 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 10771 14076 gene locus_tag LOCUS_29130 10771 14076 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_29130 14166 17498 gene locus_tag LOCUS_29140 14166 17498 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_29140 17538 18002 gene locus_tag LOCUS_29150 17538 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 19126 17999 gene locus_tag LOCUS_29160 19126 17999 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_29160 22555 19349 gene locus_tag LOCUS_29170 22555 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_29170 22967 23359 gene locus_tag LOCUS_29180 22967 23359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 23368 23784 gene locus_tag LOCUS_29190 23368 23784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 23794 24579 gene locus_tag LOCUS_29200 23794 24579 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_29200 24551 25240 gene locus_tag LOCUS_29210 24551 25240 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_29210 25266 25961 gene locus_tag LOCUS_29220 25266 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence067 3165 5282 gene locus_tag LOCUS_29230 3165 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 5402 5896 gene locus_tag LOCUS_29240 5402 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 6341 8179 gene locus_tag LOCUS_29250 gene ilvD 6341 8179 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PS6 protein_id gnl|my_center|LOCUS_29250 8210 9940 gene locus_tag LOCUS_29260 gene ilvB 8210 9940 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_29260 9983 10270 gene locus_tag LOCUS_29270 9983 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 10283 11320 gene locus_tag LOCUS_29280 gene ilvC 10283 11320 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_29280 11421 12920 gene locus_tag LOCUS_29290 gene leuA 11421 12920 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP0 protein_id gnl|my_center|LOCUS_29290 12917 14392 gene locus_tag LOCUS_29300 gene leuC 12917 14392 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_29300 14382 14972 gene locus_tag LOCUS_29310 gene leuD 14382 14972 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC30 protein_id gnl|my_center|LOCUS_29310 14982 16049 gene locus_tag LOCUS_29320 gene leuB 14982 16049 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_29320 16186 18432 gene locus_tag LOCUS_29330 16186 18432 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_29330 18449 20671 gene locus_tag LOCUS_29340 18449 20671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 22069 20717 gene locus_tag LOCUS_29350 22069 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_29350 23291 22221 gene locus_tag LOCUS_29360 23291 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 23550 23296 gene locus_tag LOCUS_29370 23550 23296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 25280 23997 gene locus_tag LOCUS_29380 25280 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence068 <1 1959 gene locus_tag LOCUS_29390 <1 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004311295.1:TonB-dependent receptor 1959 3038 gene locus_tag LOCUS_29400 1959 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_29400 3089 3292 gene locus_tag LOCUS_29410 3089 3292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_29410 4069 6336 gene locus_tag LOCUS_29420 4069 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 6977 6303 gene locus_tag LOCUS_29430 6977 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 7565 6993 gene locus_tag LOCUS_29440 7565 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 7766 8002 gene locus_tag LOCUS_29450 7766 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 9683 9994 gene locus_tag LOCUS_29460 9683 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 10168 11367 gene locus_tag LOCUS_29470 10168 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797453.1 protein_id gnl|my_center|LOCUS_29470 11357 11962 gene locus_tag LOCUS_29480 11357 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 12458 12985 gene locus_tag LOCUS_29490 12458 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 13063 14172 gene locus_tag LOCUS_29500 13063 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 14227 14496 gene locus_tag LOCUS_29510 14227 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 14816 15091 gene locus_tag LOCUS_29520 14816 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 16927 15776 gene locus_tag LOCUS_29530 16927 15776 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_29530 19047 17071 gene locus_tag LOCUS_29540 19047 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 22102 19127 gene locus_tag LOCUS_29550 22102 19127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 22824 22105 gene locus_tag LOCUS_29560 22824 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 23079 24665 gene locus_tag LOCUS_29570 23079 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence069 1140 568 gene locus_tag LOCUS_29580 1140 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_29580 2679 1162 gene locus_tag LOCUS_29590 gene gpmI 2679 1162 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A287 protein_id gnl|my_center|LOCUS_29590 3208 2753 gene locus_tag LOCUS_29600 3208 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 4013 3315 gene locus_tag LOCUS_29610 4013 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 5413 4043 gene locus_tag LOCUS_29620 5413 4043 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_29620 5583 6584 gene locus_tag LOCUS_29630 gene buk 5583 6584 CDS product putative butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CK3 protein_id gnl|my_center|LOCUS_29630 9933 6586 gene locus_tag LOCUS_29640 gene icmF 9933 6586 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_29640 11083 9944 gene locus_tag LOCUS_29650 11083 9944 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_29650 12405 11161 gene locus_tag LOCUS_29660 12405 11161 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 protein_id gnl|my_center|LOCUS_29660 13740 12412 gene locus_tag LOCUS_29670 13740 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 14562 13786 gene locus_tag LOCUS_29680 14562 13786 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291082.1 protein_id gnl|my_center|LOCUS_29680 17090 14676 gene locus_tag LOCUS_29690 17090 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 17342 17268 gene locus_tag LOCUS_t00200 17342 17268 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 17565 18701 gene locus_tag LOCUS_29700 17565 18701 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_29700 18698 19363 gene locus_tag LOCUS_29710 18698 19363 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_29710 20289 19390 gene locus_tag LOCUS_29720 20289 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 20933 20289 gene locus_tag LOCUS_29730 20933 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 21088 21978 gene locus_tag LOCUS_29740 21088 21978 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108159.1 protein_id gnl|my_center|LOCUS_29740 24267 21982 gene locus_tag LOCUS_29750 24267 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence070 1 3834 gene locus_tag LOCUS_29760 1 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 4103 4375 gene locus_tag LOCUS_29770 4103 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 5876 4494 gene locus_tag LOCUS_29780 5876 4494 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_29780 7871 6132 gene locus_tag LOCUS_29790 7871 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 9269 7965 gene locus_tag LOCUS_29800 gene nagA 9269 7965 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_29800 10717 9356 gene locus_tag LOCUS_29810 10717 9356 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_29810 11063 12619 gene locus_tag LOCUS_29820 11063 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 15839 12627 gene locus_tag LOCUS_29830 15839 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 20531 16038 gene locus_tag LOCUS_29840 20531 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 21244 20636 gene locus_tag LOCUS_29850 21244 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 21364 22233 gene locus_tag LOCUS_29860 21364 22233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_29860 22286 23506 gene locus_tag LOCUS_29870 22286 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 23687 23884 gene locus_tag LOCUS_29880 23687 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 24056 24466 gene locus_tag LOCUS_29890 24056 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 24802 24877 gene locus_tag LOCUS_t00210 24802 24877 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 152 1519 gene locus_tag LOCUS_29900 152 1519 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_29900 1748 3937 gene locus_tag LOCUS_29910 gene glnA 1748 3937 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15623 protein_id gnl|my_center|LOCUS_29910 4053 6218 gene locus_tag LOCUS_29920 4053 6218 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_29920 6242 7411 gene locus_tag LOCUS_29930 6242 7411 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_29930 7519 8595 gene locus_tag LOCUS_29940 gene prfA 7519 8595 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_29940 8601 9413 gene locus_tag LOCUS_29950 gene pyrF 8601 9413 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_29950 9468 10730 gene locus_tag LOCUS_29960 9468 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_29960 10818 11822 gene locus_tag LOCUS_29970 10818 11822 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_29970 11800 12732 gene locus_tag LOCUS_29980 11800 12732 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_29980 12746 13252 gene locus_tag LOCUS_29990 12746 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 13281 14537 gene locus_tag LOCUS_30000 13281 14537 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 protein_id gnl|my_center|LOCUS_30000 14566 15075 gene locus_tag LOCUS_30010 14566 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 15114 15821 gene locus_tag LOCUS_30020 15114 15821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 16681 15818 gene locus_tag LOCUS_30030 16681 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 16846 17115 gene locus_tag LOCUS_30040 gene rpsO 16846 17115 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A418 protein_id gnl|my_center|LOCUS_30040 17242 19440 gene locus_tag LOCUS_30050 gene pnp 17242 19440 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_30050 19492 20157 gene locus_tag LOCUS_30060 19492 20157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 20284 22008 gene locus_tag LOCUS_30070 20284 22008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108507.1 protein_id gnl|my_center|LOCUS_30070 22523 22113 gene locus_tag LOCUS_30080 22523 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 23846 22548 gene locus_tag LOCUS_30090 23846 22548 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203545.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30090 24212 23850 gene locus_tag LOCUS_30100 24212 23850 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence072 222 950 gene locus_tag LOCUS_30110 gene cysH 222 950 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_30110 953 1858 gene locus_tag LOCUS_30120 gene cysD 953 1858 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_30120 1998 3272 gene locus_tag LOCUS_30130 gene cysN 1998 3272 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_30130 3454 4626 gene locus_tag LOCUS_30140 gene thrC 3454 4626 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_30140 8578 4679 gene locus_tag LOCUS_30150 8578 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 8853 9359 gene locus_tag LOCUS_30160 8853 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_30160 9362 9811 gene locus_tag LOCUS_30170 9362 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_30170 9916 10719 gene locus_tag LOCUS_30180 9916 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 12187 10724 gene locus_tag LOCUS_30190 12187 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 13026 12253 gene locus_tag LOCUS_30200 13026 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_30200 14124 13030 gene locus_tag LOCUS_30210 14124 13030 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9D3 protein_id gnl|my_center|LOCUS_30210 14472 14137 gene locus_tag LOCUS_30220 14472 14137 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_30220 15461 14481 gene locus_tag LOCUS_30230 15461 14481 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_30230 15575 18202 gene locus_tag LOCUS_30240 gene alaS 15575 18202 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_30240 18203 20017 gene locus_tag LOCUS_30250 gene fadD 18203 20017 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_30250 21067 20021 gene locus_tag LOCUS_30260 21067 20021 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_30260 21083 22072 gene locus_tag LOCUS_30270 21083 22072 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211618.1 protein_id gnl|my_center|LOCUS_30270 22100 23884 gene locus_tag LOCUS_30280 gene fadD 22100 23884 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_30280 <24492 23885 gene locus_tag LOCUS_30290 <24492 23885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201997.1:sodium/iodide co-transporter >Feature sequence073 1198 152 gene locus_tag LOCUS_30300 1198 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2790 1306 gene locus_tag LOCUS_30310 2790 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3425 2787 gene locus_tag LOCUS_30320 3425 2787 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811441.1 protein_id gnl|my_center|LOCUS_30320 3599 4477 gene locus_tag LOCUS_30330 3599 4477 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_30330 5348 4542 gene locus_tag LOCUS_30340 5348 4542 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065078.1 protein_id gnl|my_center|LOCUS_30340 5765 5358 gene locus_tag LOCUS_30350 5765 5358 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_30350 5967 5806 gene locus_tag LOCUS_30360 5967 5806 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459942.1 protein_id gnl|my_center|LOCUS_30360 6563 5988 gene locus_tag LOCUS_30370 gene rbr 6563 5988 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_30370 7571 6588 gene locus_tag LOCUS_30380 7571 6588 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_30380 8167 7601 gene locus_tag LOCUS_30390 8167 7601 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BR6 protein_id gnl|my_center|LOCUS_30390 8565 8185 gene locus_tag LOCUS_30400 8565 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 9241 8609 gene locus_tag LOCUS_30410 9241 8609 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_30410 9457 12756 gene locus_tag LOCUS_30420 9457 12756 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_30420 13999 12740 gene locus_tag LOCUS_30430 13999 12740 CDS product alkaline ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_30430 14787 14002 gene locus_tag LOCUS_30440 14787 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860724.1 protein_id gnl|my_center|LOCUS_30440 16572 14845 gene locus_tag LOCUS_30450 16572 14845 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_30450 16930 17904 gene locus_tag LOCUS_30460 16930 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 18641 17985 gene locus_tag LOCUS_30470 gene atoA 18641 17985 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_30470 19417 18719 gene locus_tag LOCUS_30480 gene atoD 19417 18719 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_30480 20625 19468 gene locus_tag LOCUS_30490 gene acdA 20625 19468 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_30490 22633 20642 gene locus_tag LOCUS_30500 22633 20642 CDS product acyl CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947555.1 protein_id gnl|my_center|LOCUS_30500 23469 22669 gene locus_tag LOCUS_30510 23469 22669 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_30510 <24386 23488 gene locus_tag LOCUS_30520 <24386 23488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206450.1:methylcrotonoyl-CoA carboxylase >Feature sequence074 786 343 gene locus_tag LOCUS_30530 786 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1793 789 gene locus_tag LOCUS_30540 1793 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3600 1786 gene locus_tag LOCUS_30550 3600 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 5547 3721 gene locus_tag LOCUS_30560 5547 3721 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119224.1 protein_id gnl|my_center|LOCUS_30560 5831 6763 gene locus_tag LOCUS_30570 5831 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 6854 7480 gene locus_tag LOCUS_30580 6854 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 7482 10814 gene locus_tag LOCUS_30590 7482 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 10934 11590 gene locus_tag LOCUS_30600 10934 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 11587 12042 gene locus_tag LOCUS_30610 11587 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 12039 12851 gene locus_tag LOCUS_30620 12039 12851 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_30620 12874 13881 gene locus_tag LOCUS_30630 12874 13881 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_30630 14030 14983 gene locus_tag LOCUS_30640 14030 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 14964 15719 gene locus_tag LOCUS_30650 14964 15719 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_30650 18482 15840 gene locus_tag LOCUS_30660 18482 15840 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_30660 18599 20032 gene locus_tag LOCUS_30670 gene pfkC 18599 20032 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023477.1 protein_id gnl|my_center|LOCUS_30670 20092 21711 gene locus_tag LOCUS_30680 20092 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence075 147 674 gene locus_tag LOCUS_30690 147 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1845 700 gene locus_tag LOCUS_30700 1845 700 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_30700 2108 4132 gene locus_tag LOCUS_30710 2108 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 4318 5523 gene locus_tag LOCUS_30720 4318 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5691 8756 gene locus_tag LOCUS_30730 5691 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 8876 12952 gene locus_tag LOCUS_30740 8876 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 13601 13152 gene locus_tag LOCUS_30750 13601 13152 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_30750 13751 16525 gene locus_tag LOCUS_30760 13751 16525 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_30760 17933 16596 gene locus_tag LOCUS_30770 17933 16596 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_30770 19539 18136 gene locus_tag LOCUS_30780 19539 18136 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_30780 <23555 19769 gene locus_tag LOCUS_30790 <23555 19769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator >Feature sequence076 2246 1074 gene locus_tag LOCUS_30800 2246 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 2501 4966 gene locus_tag LOCUS_30810 2501 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 5110 5035 gene locus_tag LOCUS_t00220 5110 5035 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5500 5339 gene locus_tag LOCUS_30820 5500 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 5634 7061 gene locus_tag LOCUS_30830 5634 7061 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_30830 7063 8103 gene locus_tag LOCUS_30840 7063 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 9761 8820 gene locus_tag LOCUS_30850 9761 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_30850 10086 9751 gene locus_tag LOCUS_30860 10086 9751 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_30860 10292 10083 gene locus_tag LOCUS_30870 10292 10083 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_30870 12276 10903 gene locus_tag LOCUS_30880 12276 10903 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_30880 13533 12280 gene locus_tag LOCUS_30890 13533 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 13710 15272 gene locus_tag LOCUS_30900 13710 15272 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_30900 15290 16756 gene locus_tag LOCUS_30910 15290 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 16800 17522 gene locus_tag LOCUS_30920 16800 17522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_30920 17544 19094 gene locus_tag LOCUS_30930 17544 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 19107 20504 gene locus_tag LOCUS_30940 19107 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence077 1145 2491 gene locus_tag LOCUS_30950 1145 2491 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_30950 2541 3473 gene locus_tag LOCUS_30960 2541 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 4363 3509 gene locus_tag LOCUS_30970 gene msmR 4363 3509 CDS product Msm operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00753 protein_id gnl|my_center|LOCUS_30970 6258 4678 gene locus_tag LOCUS_30980 6258 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 6590 6396 gene locus_tag LOCUS_30990 6590 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6742 8151 gene locus_tag LOCUS_31000 6742 8151 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_31000 10933 8291 gene locus_tag LOCUS_31010 10933 8291 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109251.1 protein_id gnl|my_center|LOCUS_31010 11420 12280 gene locus_tag LOCUS_31020 11420 12280 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_31020 12277 13464 gene locus_tag LOCUS_31030 12277 13464 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P96 protein_id gnl|my_center|LOCUS_31030 13461 14309 gene locus_tag LOCUS_31040 gene tyrA 13461 14309 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_31040 14306 15388 gene locus_tag LOCUS_31050 14306 15388 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_31050 15480 16760 gene locus_tag LOCUS_31060 gene aroA 15480 16760 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187E3 protein_id gnl|my_center|LOCUS_31060 16827 17825 gene locus_tag LOCUS_31070 gene aroC 16827 17825 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_31070 19364 17862 gene locus_tag LOCUS_31080 19364 17862 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_31080 19619 20470 gene locus_tag LOCUS_31090 19619 20470 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_31090 21198 20539 gene locus_tag LOCUS_31100 21198 20539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 22180 21344 gene locus_tag LOCUS_31110 22180 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence078 2326 638 gene locus_tag LOCUS_31120 2326 638 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_31120 3010 2333 gene locus_tag LOCUS_31130 3010 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3283 4071 gene locus_tag LOCUS_31140 3283 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 5264 4083 gene locus_tag LOCUS_31150 5264 4083 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_31150 8589 5275 gene locus_tag LOCUS_31160 8589 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 8711 9820 gene locus_tag LOCUS_31170 8711 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764289.1 protein_id gnl|my_center|LOCUS_31170 9821 10921 gene locus_tag LOCUS_31180 9821 10921 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_31180 11023 12414 gene locus_tag LOCUS_31190 gene lpdA2 11023 12414 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_31190 12421 15255 gene locus_tag LOCUS_31200 12421 15255 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T17 protein_id gnl|my_center|LOCUS_31200 15266 15973 gene locus_tag LOCUS_31210 15266 15973 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_31210 16446 16000 gene locus_tag LOCUS_31220 gene smpB 16446 16000 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 protein_id gnl|my_center|LOCUS_31220 16479 17420 gene locus_tag LOCUS_31230 gene miaA2 16479 17420 CDS product tRNA dimethylallyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK5 protein_id gnl|my_center|LOCUS_31230 18176 17403 gene locus_tag LOCUS_31240 18176 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 20298 18256 gene locus_tag LOCUS_31250 gene ppk 20298 18256 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_31250 20807 20307 gene locus_tag LOCUS_31260 20807 20307 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_31260 21855 20818 gene locus_tag LOCUS_31270 gene pfkA3 21855 20818 CDS product ATP-dependent 6-phosphofructokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E9 protein_id gnl|my_center|LOCUS_31270 21955 22043 gene locus_tag LOCUS_t00230 21955 22043 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22159 22506 gene locus_tag LOCUS_31280 22159 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 22587 22662 gene locus_tag LOCUS_t00240 22587 22662 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 791 3892 gene locus_tag LOCUS_31290 791 3892 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_31290 5275 4163 gene locus_tag LOCUS_31300 5275 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 6482 5619 gene locus_tag LOCUS_31310 6482 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 14706 6994 gene locus_tag LOCUS_31320 14706 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 15989 16246 gene locus_tag LOCUS_31330 15989 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 16679 18016 gene locus_tag LOCUS_31340 16679 18016 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_31340 18297 18944 gene locus_tag LOCUS_31350 18297 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 20871 18973 gene locus_tag LOCUS_31360 20871 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 21086 21013 gene locus_tag LOCUS_t00250 21086 21013 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21923 21141 gene locus_tag LOCUS_31370 21923 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence080 570 1751 gene locus_tag LOCUS_31380 570 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3457 1748 gene locus_tag LOCUS_31390 3457 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 8947 3470 gene locus_tag LOCUS_31400 8947 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 9428 8958 gene locus_tag LOCUS_31410 9428 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 11017 9428 gene locus_tag LOCUS_31420 11017 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 11698 11327 gene locus_tag LOCUS_31430 11698 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 12135 11695 gene locus_tag LOCUS_31440 12135 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 15701 12477 gene locus_tag LOCUS_31450 15701 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254830.1 protein_id gnl|my_center|LOCUS_31450 16126 15704 gene locus_tag LOCUS_31460 16126 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 16619 16110 gene locus_tag LOCUS_31470 16619 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 17343 16609 gene locus_tag LOCUS_31480 17343 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 18347 17340 gene locus_tag LOCUS_31490 18347 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 19693 18350 gene locus_tag LOCUS_31500 19693 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 19968 19690 gene locus_tag LOCUS_31510 19968 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 20242 20072 gene locus_tag LOCUS_31520 20242 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 20986 20699 gene locus_tag LOCUS_31530 20986 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 22011 21526 gene locus_tag LOCUS_31540 22011 21526 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence081 <1 2003 gene locus_tag LOCUS_31550 <1 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZR4:translation initiation factor IF-2 2446 2069 gene locus_tag LOCUS_31560 gene gcvH 2446 2069 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_31560 10009 2498 gene locus_tag LOCUS_31570 gene sprA 10009 2498 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_31570 10618 10031 gene locus_tag LOCUS_31580 gene ruvA 10618 10031 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_31580 11673 10618 gene locus_tag LOCUS_31590 gene pdxA 11673 10618 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_31590 13135 11684 gene locus_tag LOCUS_31600 13135 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 13245 14357 gene locus_tag LOCUS_31610 gene mqnC 13245 14357 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66979 protein_id gnl|my_center|LOCUS_31610 15370 14354 gene locus_tag LOCUS_31620 15370 14354 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_31620 16779 15460 gene locus_tag LOCUS_31630 16779 15460 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_31630 17966 16782 gene locus_tag LOCUS_31640 gene dxr 17966 16782 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_31640 18839 17973 gene locus_tag LOCUS_31650 18839 17973 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_31650 18949 19022 gene locus_tag LOCUS_t00260 18949 19022 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19392 19120 gene locus_tag LOCUS_31660 19392 19120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 20628 19486 gene locus_tag LOCUS_31670 20628 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 21894 20863 gene locus_tag LOCUS_31680 21894 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 >Feature sequence082 819 3188 gene locus_tag LOCUS_31690 819 3188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_31690 5189 3198 gene locus_tag LOCUS_31700 5189 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 5935 5339 gene locus_tag LOCUS_31710 5935 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 6724 5942 gene locus_tag LOCUS_31720 6724 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 8745 6748 gene locus_tag LOCUS_31730 8745 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 9672 8935 gene locus_tag LOCUS_31740 9672 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 10540 9854 gene locus_tag LOCUS_31750 10540 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 11322 10987 gene locus_tag LOCUS_31760 11322 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 12757 11555 gene locus_tag LOCUS_31770 12757 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797453.1 protein_id gnl|my_center|LOCUS_31770 16375 12941 gene locus_tag LOCUS_31780 gene mfd 16375 12941 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_31780 18095 16611 gene locus_tag LOCUS_31790 18095 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 18534 18190 gene locus_tag LOCUS_31800 18534 18190 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_31800 19645 18542 gene locus_tag LOCUS_31810 19645 18542 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_31810 20992 19667 gene locus_tag LOCUS_31820 20992 19667 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence083 2855 2277 gene locus_tag LOCUS_31830 2855 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 5266 2933 gene locus_tag LOCUS_31840 5266 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_31840 6806 5256 gene locus_tag LOCUS_31850 6806 5256 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_31850 9139 6800 gene locus_tag LOCUS_31860 9139 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 10696 9200 gene locus_tag LOCUS_31870 10696 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 10885 11109 gene locus_tag LOCUS_31880 10885 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 12856 11081 gene locus_tag LOCUS_31890 12856 11081 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_31890 13570 12869 gene locus_tag LOCUS_31900 13570 12869 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_31900 14292 13567 gene locus_tag LOCUS_31910 14292 13567 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930881.1 protein_id gnl|my_center|LOCUS_31910 15090 14308 gene locus_tag LOCUS_31920 gene pstB3 15090 14308 CDS product phosphate import ATP-binding protein PstB 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63372 protein_id gnl|my_center|LOCUS_31920 15990 15094 gene locus_tag LOCUS_31930 gene pstA 15990 15094 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2P4 protein_id gnl|my_center|LOCUS_31930 16841 15990 gene locus_tag LOCUS_31940 gene pstC 16841 15990 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N1 protein_id gnl|my_center|LOCUS_31940 17938 16865 gene locus_tag LOCUS_31950 17938 16865 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABV1 protein_id gnl|my_center|LOCUS_31950 18924 17950 gene locus_tag LOCUS_31960 18924 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 19338 20678 gene locus_tag LOCUS_31970 19338 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence084 974 561 gene locus_tag LOCUS_31980 974 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962787.1 protein_id gnl|my_center|LOCUS_31980 1315 971 gene locus_tag LOCUS_31990 1315 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2107 1448 gene locus_tag LOCUS_32000 2107 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3211 2111 gene locus_tag LOCUS_32010 3211 2111 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_32010 3634 3894 gene locus_tag LOCUS_32020 3634 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 5129 4083 gene locus_tag LOCUS_32030 5129 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 5527 6258 gene locus_tag LOCUS_32040 5527 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 6261 7319 gene locus_tag LOCUS_32050 6261 7319 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_32050 7316 8068 gene locus_tag LOCUS_32060 7316 8068 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_32060 8191 9705 gene locus_tag LOCUS_32070 8191 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 9698 10384 gene locus_tag LOCUS_32080 9698 10384 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_32080 10895 10470 gene locus_tag LOCUS_32090 10895 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881282.1 protein_id gnl|my_center|LOCUS_32090 11056 13713 gene locus_tag LOCUS_32100 11056 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 13777 15144 gene locus_tag LOCUS_32110 13777 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 16386 15154 gene locus_tag LOCUS_32120 16386 15154 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_32120 18472 16388 gene locus_tag LOCUS_32130 18472 16388 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_32130 19703 18561 gene locus_tag LOCUS_32140 19703 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964256.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence085 2823 1426 gene locus_tag LOCUS_32150 gene araA 2823 1426 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y1E5 protein_id gnl|my_center|LOCUS_32150 4589 2931 gene locus_tag LOCUS_32160 4589 2931 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_32160 5712 4780 gene locus_tag LOCUS_32170 5712 4780 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_32170 5948 7345 gene locus_tag LOCUS_32180 gene nagA 5948 7345 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_32180 7566 8582 gene locus_tag LOCUS_32190 gene des 7566 8582 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34653 protein_id gnl|my_center|LOCUS_32190 8935 10311 gene locus_tag LOCUS_32200 8935 10311 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878203.1 protein_id gnl|my_center|LOCUS_32200 10341 11642 gene locus_tag LOCUS_32210 gene cysD 10341 11642 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_32210 11649 12665 gene locus_tag LOCUS_32220 gene metX 11649 12665 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_32220 12668 13867 gene locus_tag LOCUS_32230 12668 13867 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJS6 protein_id gnl|my_center|LOCUS_32230 13873 17538 gene locus_tag LOCUS_32240 gene metH 13873 17538 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_32240 17676 18629 gene locus_tag LOCUS_32250 17676 18629 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_32250 18715 19461 gene locus_tag LOCUS_32260 18715 19461 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence086 468 2774 gene locus_tag LOCUS_32270 468 2774 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_32270 3034 5424 gene locus_tag LOCUS_32280 3034 5424 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036930.1 protein_id gnl|my_center|LOCUS_32280 5438 6244 gene locus_tag LOCUS_32290 5438 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 6263 8521 gene locus_tag LOCUS_32300 6263 8521 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_32300 8628 11231 gene locus_tag LOCUS_32310 8628 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 11322 11732 gene locus_tag LOCUS_32320 11322 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 11809 12237 gene locus_tag LOCUS_32330 11809 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 13546 12251 gene locus_tag LOCUS_32340 13546 12251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 protein_id gnl|my_center|LOCUS_32340 14935 13547 gene locus_tag LOCUS_32350 14935 13547 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_32350 16366 15002 gene locus_tag LOCUS_32360 16366 15002 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_32360 17214 16474 gene locus_tag LOCUS_32370 17214 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 18634 17285 gene locus_tag LOCUS_32380 18634 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 19498 18674 gene locus_tag LOCUS_32390 19498 18674 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_32390 >Feature sequence087 1593 1961 gene locus_tag LOCUS_32400 1593 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32400 3314 2076 gene locus_tag LOCUS_32410 3314 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_32410 4232 3333 gene locus_tag LOCUS_32420 4232 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 5070 4285 gene locus_tag LOCUS_32430 5070 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_32430 7435 5141 gene locus_tag LOCUS_32440 7435 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32440 8086 7508 gene locus_tag LOCUS_32450 8086 7508 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461065.1 protein_id gnl|my_center|LOCUS_32450 8324 9703 gene locus_tag LOCUS_32460 gene cyaA 8324 9703 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_32460 9693 10853 gene locus_tag LOCUS_32470 9693 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 10863 12752 gene locus_tag LOCUS_32480 10863 12752 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602099.1 protein_id gnl|my_center|LOCUS_32480 12772 16341 gene locus_tag LOCUS_32490 12772 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 16343 16978 gene locus_tag LOCUS_32500 16343 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 16978 17907 gene locus_tag LOCUS_32510 16978 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 19048 18017 gene locus_tag LOCUS_32520 19048 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 19331 19041 gene locus_tag LOCUS_32530 19331 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence088 <1 1725 gene locus_tag LOCUS_32540 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022345.1:class I SAM-dependent DNA methyltransferase 1728 3275 gene locus_tag LOCUS_32550 1728 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3268 5763 gene locus_tag LOCUS_32560 3268 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_32560 5766 7757 gene locus_tag LOCUS_32570 5766 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_32570 8013 7816 gene locus_tag LOCUS_32580 8013 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 8471 8043 gene locus_tag LOCUS_32590 8471 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 10515 9406 gene locus_tag LOCUS_32600 10515 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 10793 10542 gene locus_tag LOCUS_32610 10793 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 11849 10956 gene locus_tag LOCUS_32620 11849 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 12185 13084 gene locus_tag LOCUS_32630 12185 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 13267 14226 gene locus_tag LOCUS_32640 13267 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 14341 16164 gene locus_tag LOCUS_32650 14341 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040060.1 protein_id gnl|my_center|LOCUS_32650 17454 16201 gene locus_tag LOCUS_32660 17454 16201 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_32660 17865 18158 gene locus_tag LOCUS_32670 17865 18158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence089 <1 1522 gene locus_tag LOCUS_32680 <1 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257017.1:peptidase M14 1531 3342 gene locus_tag LOCUS_32690 1531 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3517 4377 gene locus_tag LOCUS_32700 3517 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 4478 7780 gene locus_tag LOCUS_32710 4478 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32710 8684 7857 gene locus_tag LOCUS_32720 8684 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 11010 8695 gene locus_tag LOCUS_32730 11010 8695 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_32730 11242 12252 gene locus_tag LOCUS_32740 11242 12252 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_32740 12249 12977 gene locus_tag LOCUS_32750 12249 12977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_32750 14398 12980 gene locus_tag LOCUS_32760 gene lpd 14398 12980 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NW1 protein_id gnl|my_center|LOCUS_32760 15707 14412 gene locus_tag LOCUS_32770 15707 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 18386 15726 gene locus_tag LOCUS_32780 18386 15726 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UU96 protein_id gnl|my_center|LOCUS_32780 >Feature sequence090 532 3153 gene locus_tag LOCUS_32790 532 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32790 3374 3541 gene locus_tag LOCUS_32800 3374 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4820 3723 gene locus_tag LOCUS_32810 4820 3723 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_32810 4942 5403 gene locus_tag LOCUS_32820 4942 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 5492 9088 gene locus_tag LOCUS_32830 5492 9088 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_32830 9085 10317 gene locus_tag LOCUS_32840 9085 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 10330 12156 gene locus_tag LOCUS_32850 10330 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 12179 12526 gene locus_tag LOCUS_32860 12179 12526 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_32860 13887 12601 gene locus_tag LOCUS_32870 13887 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 14136 15602 gene locus_tag LOCUS_32880 14136 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 15876 16391 gene locus_tag LOCUS_32890 15876 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 16396 17538 gene locus_tag LOCUS_32900 16396 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence091 3 773 gene locus_tag LOCUS_32910 3 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 2536 896 gene locus_tag LOCUS_32920 2536 896 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_32920 4057 3428 gene locus_tag LOCUS_32930 4057 3428 CDS product dimethylsulfoxide reductase, chain B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213070.1 protein_id gnl|my_center|LOCUS_32930 6439 4061 gene locus_tag LOCUS_32940 6439 4061 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_32940 7172 6471 gene locus_tag LOCUS_32950 gene lipB 7172 6471 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UP8 protein_id gnl|my_center|LOCUS_32950 8039 7176 gene locus_tag LOCUS_32960 gene lipA 8039 7176 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_32960 9224 8163 gene locus_tag LOCUS_32970 9224 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 9568 11796 gene locus_tag LOCUS_32980 9568 11796 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_32980 11793 12326 gene locus_tag LOCUS_32990 11793 12326 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_32990 12346 13287 gene locus_tag LOCUS_33000 gene phsC 12346 13287 CDS product polysulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 protein_id gnl|my_center|LOCUS_33000 13313 13840 gene locus_tag LOCUS_33010 13313 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 13852 14442 gene locus_tag LOCUS_33020 13852 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 14454 15074 gene locus_tag LOCUS_33030 14454 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 16211 15081 gene locus_tag LOCUS_33040 16211 15081 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_33040 17661 16213 gene locus_tag LOCUS_33050 17661 16213 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWB6 protein_id gnl|my_center|LOCUS_33050 >Feature sequence092 3663 607 gene locus_tag LOCUS_33060 3663 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 4910 4143 gene locus_tag LOCUS_33070 4910 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_33070 5250 6023 gene locus_tag LOCUS_33080 5250 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 6849 6268 gene locus_tag LOCUS_33090 6849 6268 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_33090 7158 7805 gene locus_tag LOCUS_33100 7158 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 8281 11874 gene locus_tag LOCUS_33110 8281 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 11874 12662 gene locus_tag LOCUS_33120 11874 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 12663 12887 gene locus_tag LOCUS_33130 12663 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 12884 14050 gene locus_tag LOCUS_33140 12884 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 14071 14715 gene locus_tag LOCUS_33150 14071 14715 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_33150 16094 14736 gene locus_tag LOCUS_33160 16094 14736 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_33160 16968 16588 gene locus_tag LOCUS_33170 16968 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 17396 17324 gene locus_tag LOCUS_t00270 17396 17324 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 125 1651 gene locus_tag LOCUS_33180 125 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1670 3172 gene locus_tag LOCUS_33190 1670 3172 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_33190 3177 5252 gene locus_tag LOCUS_33200 3177 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 5274 5750 gene locus_tag LOCUS_33210 5274 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_33210 5757 6080 gene locus_tag LOCUS_33220 5757 6080 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_33220 7102 6089 gene locus_tag LOCUS_33230 7102 6089 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_33230 7188 9353 gene locus_tag LOCUS_33240 7188 9353 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_33240 9670 10566 gene locus_tag LOCUS_33250 9670 10566 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_33250 10563 10760 gene locus_tag LOCUS_33260 10563 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 10798 11469 gene locus_tag LOCUS_33270 10798 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 protein_id gnl|my_center|LOCUS_33270 11634 12647 gene locus_tag LOCUS_33280 11634 12647 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_33280 12755 12955 gene locus_tag LOCUS_33290 gene cspB 12755 12955 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059079.1 protein_id gnl|my_center|LOCUS_33290 13024 14046 gene locus_tag LOCUS_33300 13024 14046 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_33300 14128 14580 gene locus_tag LOCUS_33310 14128 14580 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_33310 16172 14631 gene locus_tag LOCUS_33320 16172 14631 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_33320 <17685 16264 gene locus_tag LOCUS_33330 <17685 16264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023304.1:dipeptidase >Feature sequence094 2073 1354 gene locus_tag LOCUS_33340 2073 1354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_33340 3023 2100 gene locus_tag LOCUS_33350 3023 2100 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_33350 4458 3133 gene locus_tag LOCUS_33360 gene tilS 4458 3133 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7D1 protein_id gnl|my_center|LOCUS_33360 5470 4469 gene locus_tag LOCUS_33370 5470 4469 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_33370 8969 5475 gene locus_tag LOCUS_33380 8969 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 10683 9037 gene locus_tag LOCUS_33390 10683 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 11409 10720 gene locus_tag LOCUS_33400 11409 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 12885 11413 gene locus_tag LOCUS_33410 gene proS 12885 11413 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_33410 13325 13627 gene locus_tag LOCUS_33420 13325 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 14351 14154 gene locus_tag LOCUS_33430 14351 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 14427 15860 gene locus_tag LOCUS_33440 14427 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 16533 15913 gene locus_tag LOCUS_33450 16533 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_33450 17567 16548 gene locus_tag LOCUS_33460 17567 16548 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2I6 protein_id gnl|my_center|LOCUS_33460 >Feature sequence095 <1 846 gene locus_tag LOCUS_33470 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107547.1:hybrid sensor histidine kinase/response regulator 1605 1147 gene locus_tag LOCUS_33480 1605 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3141 2134 gene locus_tag LOCUS_33490 3141 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3711 4754 gene locus_tag LOCUS_33500 3711 4754 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258998.1 protein_id gnl|my_center|LOCUS_33500 4818 5612 gene locus_tag LOCUS_33510 4818 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 5739 5936 gene locus_tag LOCUS_33520 5739 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 5988 6821 gene locus_tag LOCUS_33530 5988 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 6837 7319 gene locus_tag LOCUS_33540 6837 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 7589 9418 gene locus_tag LOCUS_33550 7589 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 9521 10687 gene locus_tag LOCUS_33560 9521 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 10797 12095 gene locus_tag LOCUS_33570 10797 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 12283 13512 gene locus_tag LOCUS_33580 12283 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 13662 14489 gene locus_tag LOCUS_33590 13662 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 14489 15598 gene locus_tag LOCUS_33600 14489 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 15719 17194 gene locus_tag LOCUS_33610 15719 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 17187 17468 gene locus_tag LOCUS_33620 17187 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence096 2546 1524 gene locus_tag LOCUS_33630 2546 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 4730 2571 gene locus_tag LOCUS_33640 4730 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4954 5925 gene locus_tag LOCUS_33650 4954 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 5922 6638 gene locus_tag LOCUS_33660 5922 6638 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_33660 6756 8663 gene locus_tag LOCUS_33670 6756 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 8665 9846 gene locus_tag LOCUS_33680 8665 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203574.1 protein_id gnl|my_center|LOCUS_33680 10002 10823 gene locus_tag LOCUS_33690 10002 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 10898 14206 gene locus_tag LOCUS_33700 10898 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 14576 14370 gene locus_tag LOCUS_33710 14576 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 16383 14569 gene locus_tag LOCUS_33720 16383 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence097 501 1043 gene locus_tag LOCUS_33730 501 1043 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_33730 1113 2603 gene locus_tag LOCUS_33740 1113 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3061 2600 gene locus_tag LOCUS_33750 3061 2600 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_33750 3308 3520 gene locus_tag LOCUS_33760 3308 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3537 4514 gene locus_tag LOCUS_33770 3537 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4609 6018 gene locus_tag LOCUS_33780 4609 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 6031 6594 gene locus_tag LOCUS_33790 6031 6594 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_33790 6781 8061 gene locus_tag LOCUS_33800 gene eno 6781 8061 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIR1 protein_id gnl|my_center|LOCUS_33800 8136 8690 gene locus_tag LOCUS_33810 8136 8690 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946945.1 protein_id gnl|my_center|LOCUS_33810 9351 8647 gene locus_tag LOCUS_33820 gene truC 9351 8647 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_33820 9441 10184 gene locus_tag LOCUS_33830 9441 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 10671 10321 gene locus_tag LOCUS_33840 10671 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 11432 11605 gene locus_tag LOCUS_33850 11432 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 12147 13007 gene locus_tag LOCUS_33860 12147 13007 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_33860 13966 13004 gene locus_tag LOCUS_33870 13966 13004 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438698.1 protein_id gnl|my_center|LOCUS_33870 15588 14002 gene locus_tag LOCUS_33880 15588 14002 CDS product serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122093.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence098 <1 703 gene locus_tag LOCUS_33890 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940726.1:integrase 850 5334 gene locus_tag LOCUS_33900 850 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 11093 6102 gene locus_tag LOCUS_33910 11093 6102 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403261.1 protein_id gnl|my_center|LOCUS_33910 12612 14681 gene locus_tag LOCUS_33920 12612 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence099 1028 1318 gene locus_tag LOCUS_33930 1028 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 1299 3314 gene locus_tag LOCUS_33940 1299 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 4895 3393 gene locus_tag LOCUS_33950 4895 3393 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868031.1 protein_id gnl|my_center|LOCUS_33950 5004 6542 gene locus_tag LOCUS_33960 5004 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 6973 6767 gene locus_tag LOCUS_33970 6973 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 7173 8246 gene locus_tag LOCUS_33980 7173 8246 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_33980 8243 8929 gene locus_tag LOCUS_33990 8243 8929 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_33990 9066 10439 gene locus_tag LOCUS_34000 9066 10439 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_34000 10664 11938 gene locus_tag LOCUS_34010 10664 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 11907 12866 gene locus_tag LOCUS_34020 11907 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 15441 12919 gene locus_tag LOCUS_34030 15441 12919 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107787.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence100 218 487 gene locus_tag LOCUS_34040 218 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1285 443 gene locus_tag LOCUS_34050 1285 443 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_34050 2253 1342 gene locus_tag LOCUS_34060 2253 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3383 2385 gene locus_tag LOCUS_34070 3383 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 3645 5243 gene locus_tag LOCUS_34080 3645 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 5898 5287 gene locus_tag LOCUS_34090 5898 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021157.1 protein_id gnl|my_center|LOCUS_34090 6207 8102 gene locus_tag LOCUS_34100 6207 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 11013 8209 gene locus_tag LOCUS_34110 11013 8209 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_34110 11182 12402 gene locus_tag LOCUS_34120 gene GALNS 11182 12402 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_34120 13399 12470 gene locus_tag LOCUS_34130 13399 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_34130 13715 14887 gene locus_tag LOCUS_34140 13715 14887 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_34140 14930 15529 gene locus_tag LOCUS_34150 14930 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence101 <1 1316 gene locus_tag LOCUS_34160 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863308.1:aconitate hydratase 1428 2651 gene locus_tag LOCUS_34170 gene icd 1428 2651 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_34170 2669 3991 gene locus_tag LOCUS_34180 gene gltA 2669 3991 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_34180 4010 4951 gene locus_tag LOCUS_34190 gene mdh 4010 4951 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_34190 5027 7972 gene locus_tag LOCUS_34200 5027 7972 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_34200 8741 7965 gene locus_tag LOCUS_34210 8741 7965 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704468.1 protein_id gnl|my_center|LOCUS_34210 9327 8734 gene locus_tag LOCUS_34220 9327 8734 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_34220 9894 9343 gene locus_tag LOCUS_34230 9894 9343 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_34230 11166 9961 gene locus_tag LOCUS_34240 11166 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 12620 11382 gene locus_tag LOCUS_34250 12620 11382 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_34250 14259 12559 gene locus_tag LOCUS_34260 gene ggt 14259 12559 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence102 687 3809 gene locus_tag LOCUS_34270 687 3809 CDS product multidrug efflux pump protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_34270 3814 4908 gene locus_tag LOCUS_34280 3814 4908 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107390.1 protein_id gnl|my_center|LOCUS_34280 5028 7970 gene locus_tag LOCUS_34290 5028 7970 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_34290 8202 9374 gene locus_tag LOCUS_34300 8202 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201847.1 protein_id gnl|my_center|LOCUS_34300 9433 10740 gene locus_tag LOCUS_34310 9433 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 10810 11016 gene locus_tag LOCUS_34320 10810 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 11019 12200 gene locus_tag LOCUS_34330 11019 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 12509 13294 gene locus_tag LOCUS_34340 12509 13294 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence103 1443 205 gene locus_tag LOCUS_34350 gene yeeC 1443 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34352 protein_id gnl|my_center|LOCUS_34350 3370 1436 gene locus_tag LOCUS_34360 gene yeeB 3370 1436 CDS product putative ATP-dependent helicase YeeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34469 protein_id gnl|my_center|LOCUS_34360 5111 3465 gene locus_tag LOCUS_34370 5111 3465 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706476.1 protein_id gnl|my_center|LOCUS_34370 7657 5111 gene locus_tag LOCUS_34380 gene yeeA 7657 5111 CDS product putative DNA methyltransferase YeeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31504 protein_id gnl|my_center|LOCUS_34380 8111 8260 gene locus_tag LOCUS_34390 8111 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 8457 8275 gene locus_tag LOCUS_34400 8457 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 9003 10544 gene locus_tag LOCUS_34410 9003 10544 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_34410 10554 11303 gene locus_tag LOCUS_34420 10554 11303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887034.1 protein_id gnl|my_center|LOCUS_34420 11541 12257 gene locus_tag LOCUS_34430 11541 12257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_34430 12298 12849 gene locus_tag LOCUS_34440 12298 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence104 743 1318 gene locus_tag LOCUS_34450 743 1318 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_34450 2229 1366 gene locus_tag LOCUS_34460 gene mtf2 2229 1366 CDS product fatty-acid O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RMN9 protein_id gnl|my_center|LOCUS_34460 3447 2293 gene locus_tag LOCUS_34470 gene ybhE 3447 2293 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_34470 5601 3589 gene locus_tag LOCUS_34480 5601 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 8561 5616 gene locus_tag LOCUS_34490 8561 5616 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_34490 10085 8595 gene locus_tag LOCUS_34500 10085 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 10551 11078 gene locus_tag LOCUS_34510 10551 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 11374 12543 gene locus_tag LOCUS_34520 11374 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence105 793 140 gene locus_tag LOCUS_34530 793 140 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122734.1 protein_id gnl|my_center|LOCUS_34530 1934 846 gene locus_tag LOCUS_34540 1934 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 2150 3964 gene locus_tag LOCUS_34550 2150 3964 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_34550 4791 4036 gene locus_tag LOCUS_34560 4791 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 9201 4990 gene locus_tag LOCUS_34570 9201 4990 CDS product 2-hydroxyglutaryl-CoA dehydratase activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545106.1 protein_id gnl|my_center|LOCUS_34570 9358 10074 gene locus_tag LOCUS_34580 9358 10074 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_34580 10173 10245 gene locus_tag LOCUS_t00280 10173 10245 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10273 10524 gene locus_tag LOCUS_34590 gene rpsT 10273 10524 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A276 protein_id gnl|my_center|LOCUS_34590 10667 11362 gene locus_tag LOCUS_34600 10667 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_34600 11419 12723 gene locus_tag LOCUS_34610 11419 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence106 3529 701 gene locus_tag LOCUS_34620 3529 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3597 4703 gene locus_tag LOCUS_34630 3597 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 5178 4801 gene locus_tag LOCUS_34640 5178 4801 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_34640 5347 6291 gene locus_tag LOCUS_34650 5347 6291 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_34650 6419 6847 gene locus_tag LOCUS_34660 6419 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 6876 7211 gene locus_tag LOCUS_34670 6876 7211 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_34670 7248 8261 gene locus_tag LOCUS_34680 7248 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 8258 8842 gene locus_tag LOCUS_34690 gene coaE 8258 8842 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_34690 8874 9605 gene locus_tag LOCUS_34700 8874 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 9638 10144 gene locus_tag LOCUS_34710 9638 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 10945 10154 gene locus_tag LOCUS_34720 10945 10154 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_34720 11756 10938 gene locus_tag LOCUS_34730 11756 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545134.1 protein_id gnl|my_center|LOCUS_34730 11868 12815 gene locus_tag LOCUS_34740 11868 12815 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence107 975 1199 gene locus_tag LOCUS_34750 975 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 3957 2317 gene locus_tag LOCUS_34760 3957 2317 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_34760 5230 3980 gene locus_tag LOCUS_34770 5230 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_34770 6418 5255 gene locus_tag LOCUS_34780 gene galK 6418 5255 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHD0 protein_id gnl|my_center|LOCUS_34780 6670 7722 gene locus_tag LOCUS_34790 gene galM 6670 7722 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_34790 8938 7787 gene locus_tag LOCUS_34800 gene pepC 8938 7787 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_34800 10098 8953 gene locus_tag LOCUS_34810 10098 8953 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_34810 10446 12413 gene locus_tag LOCUS_34820 10446 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence108 880 1758 gene locus_tag LOCUS_34830 880 1758 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870335.1 protein_id gnl|my_center|LOCUS_34830 1736 2332 gene locus_tag LOCUS_34840 1736 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 2332 3393 gene locus_tag LOCUS_34850 2332 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 3933 3427 gene locus_tag LOCUS_34860 3933 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 5566 3923 gene locus_tag LOCUS_34870 5566 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 9202 6122 gene locus_tag LOCUS_34880 9202 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 9425 9667 gene locus_tag LOCUS_34890 9425 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 9798 10361 gene locus_tag LOCUS_34900 9798 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 10520 11452 gene locus_tag LOCUS_34910 10520 11452 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361993.1 protein_id gnl|my_center|LOCUS_34910 12105 11671 gene locus_tag LOCUS_34920 12105 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 12509 12252 gene locus_tag LOCUS_34930 12509 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 >Feature sequence109 691 347 gene locus_tag LOCUS_34940 691 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1012 1812 gene locus_tag LOCUS_34950 1012 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 4083 2194 gene locus_tag LOCUS_34960 4083 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 4912 4178 gene locus_tag LOCUS_34970 4912 4178 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_34970 8066 4893 gene locus_tag LOCUS_34980 8066 4893 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_34980 8743 8216 gene locus_tag LOCUS_34990 8743 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 9417 8743 gene locus_tag LOCUS_35000 gene rflA 9417 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_35000 10636 9410 gene locus_tag LOCUS_35010 10636 9410 CDS product type I restriction-modification enzyme, S subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010923.2 protein_id gnl|my_center|LOCUS_35010 12125 10629 gene locus_tag LOCUS_35020 gene hsdM 12125 10629 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_35020 12513 12440 gene locus_tag LOCUS_t00290 12513 12440 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 537 860 gene locus_tag LOCUS_35030 537 860 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_35030 1025 2569 gene locus_tag LOCUS_35040 1025 2569 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_35040 3919 2633 gene locus_tag LOCUS_35050 gene gltP 3919 2633 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_35050 5349 4063 gene locus_tag LOCUS_35060 5349 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 5933 5367 gene locus_tag LOCUS_35070 5933 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 7052 5976 gene locus_tag LOCUS_35080 gene buk 7052 5976 CDS product putative butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CK3 protein_id gnl|my_center|LOCUS_35080 7978 7067 gene locus_tag LOCUS_35090 gene ptb2 7978 7067 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_35090 9201 7978 gene locus_tag LOCUS_35100 gene ackA 9201 7978 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G8 protein_id gnl|my_center|LOCUS_35100 10171 9215 gene locus_tag LOCUS_35110 gene hbd 10171 9215 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52041 protein_id gnl|my_center|LOCUS_35110 11186 10188 gene locus_tag LOCUS_35120 11186 10188 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762631.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence111 <1 1670 gene locus_tag LOCUS_35130 <1 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870106.1:homoaconitate hydratase 1824 2189 gene locus_tag LOCUS_35140 1824 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 2235 2960 gene locus_tag LOCUS_35150 2235 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3011 4786 gene locus_tag LOCUS_35160 3011 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 5033 6088 gene locus_tag LOCUS_35170 5033 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 6135 6842 gene locus_tag LOCUS_35180 6135 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 6984 10448 gene locus_tag LOCUS_35190 6984 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 10597 12417 gene locus_tag LOCUS_35200 10597 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence112 1482 1024 gene locus_tag LOCUS_35210 gene pyrI 1482 1024 CDS product aspartate carbamoyltransferase regulatory chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U75 protein_id gnl|my_center|LOCUS_35210 2422 1514 gene locus_tag LOCUS_35220 gene pyrB 2422 1514 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S3 protein_id gnl|my_center|LOCUS_35220 3119 2508 gene locus_tag LOCUS_35230 3119 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_35230 3720 3109 gene locus_tag LOCUS_35240 3720 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 4138 4065 gene locus_tag LOCUS_t00300 4138 4065 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4260 5174 gene locus_tag LOCUS_35250 4260 5174 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_35250 7942 5435 gene locus_tag LOCUS_35260 gene clpA 7942 5435 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_35260 8247 10772 gene locus_tag LOCUS_35270 gene gyrA 8247 10772 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TL9 protein_id gnl|my_center|LOCUS_35270 10864 12021 gene locus_tag LOCUS_35280 10864 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 >Feature sequence113 5029 962 gene locus_tag LOCUS_35290 5029 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 6506 5166 gene locus_tag LOCUS_35300 6506 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 7289 6588 gene locus_tag LOCUS_35310 7289 6588 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_35310 8814 7267 gene locus_tag LOCUS_35320 8814 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 9070 9828 gene locus_tag LOCUS_35330 9070 9828 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_35330 10025 10864 gene locus_tag LOCUS_35340 10025 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence114 26 886 gene locus_tag LOCUS_35350 26 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 913 1872 gene locus_tag LOCUS_35360 913 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 1874 2494 gene locus_tag LOCUS_35370 gene ydhU 1874 2494 CDS product thiosulfate reductase cytochrome B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069988.1 protein_id gnl|my_center|LOCUS_35370 2593 4608 gene locus_tag LOCUS_35380 2593 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 4650 6575 gene locus_tag LOCUS_35390 4650 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 6577 8310 gene locus_tag LOCUS_35400 6577 8310 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_35400 8317 8967 gene locus_tag LOCUS_35410 8317 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 8994 10793 gene locus_tag LOCUS_35420 8994 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_35420 >Feature sequence115 272 1585 gene locus_tag LOCUS_35430 272 1585 CDS product PhoPQ-activated pathogenicity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120441.1 protein_id gnl|my_center|LOCUS_35430 1607 2770 gene locus_tag LOCUS_35440 1607 2770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766592.1 protein_id gnl|my_center|LOCUS_35440 2760 3791 gene locus_tag LOCUS_35450 2760 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_35450 3817 5721 gene locus_tag LOCUS_35460 3817 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 5727 6647 gene locus_tag LOCUS_35470 5727 6647 CDS product N-acylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_35470 6670 7308 gene locus_tag LOCUS_35480 gene gmhA 6670 7308 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25528 protein_id gnl|my_center|LOCUS_35480 7958 8773 gene locus_tag LOCUS_35490 7958 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 8796 10352 gene locus_tag LOCUS_35500 8796 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 <11682 10366 gene locus_tag LOCUS_35510 <11682 10366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor >Feature sequence116 80 2146 gene locus_tag LOCUS_35520 80 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 2482 2159 gene locus_tag LOCUS_35530 2482 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 2667 4568 gene locus_tag LOCUS_35540 2667 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 4543 5244 gene locus_tag LOCUS_35550 gene phoP 4543 5244 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_35550 5409 7181 gene locus_tag LOCUS_35560 5409 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 8249 7653 gene locus_tag LOCUS_35570 8249 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35570 8481 8861 gene locus_tag LOCUS_35580 8481 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 9126 8851 gene locus_tag LOCUS_35590 9126 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 9325 10536 gene locus_tag LOCUS_35600 gene exuT 9325 10536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_35600 11411 10578 gene locus_tag LOCUS_35610 11411 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence117 2328 112 gene locus_tag LOCUS_35620 2328 112 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_35620 3346 2681 gene locus_tag LOCUS_35630 3346 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3669 5867 gene locus_tag LOCUS_35640 3669 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 6998 6003 gene locus_tag LOCUS_35650 6998 6003 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_35650 7473 7000 gene locus_tag LOCUS_35660 7473 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 7798 7484 gene locus_tag LOCUS_35670 7798 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 7945 8406 gene locus_tag LOCUS_35680 7945 8406 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_35680 8478 9488 gene locus_tag LOCUS_35690 gene recA 8478 9488 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_35690 9478 10563 gene locus_tag LOCUS_35700 9478 10563 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence118 <1 1068 gene locus_tag LOCUS_35710 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:magnesium chelatase 1905 1216 gene locus_tag LOCUS_35720 1905 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 2150 4540 gene locus_tag LOCUS_35730 gene hppA 2150 4540 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDT8 protein_id gnl|my_center|LOCUS_35730 5317 4580 gene locus_tag LOCUS_35740 5317 4580 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_35740 6483 5320 gene locus_tag LOCUS_35750 6483 5320 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_35750 6628 7503 gene locus_tag LOCUS_35760 gene ribF 6628 7503 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_35760 7532 8953 gene locus_tag LOCUS_35770 gene ahcY 7532 8953 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT2 protein_id gnl|my_center|LOCUS_35770 9499 9041 gene locus_tag LOCUS_35780 9499 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 9559 10005 gene locus_tag LOCUS_35790 9559 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence119 1193 738 gene locus_tag LOCUS_35800 1193 738 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107333.1 protein_id gnl|my_center|LOCUS_35800 2045 1227 gene locus_tag LOCUS_35810 2045 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_35810 2157 3050 gene locus_tag LOCUS_35820 2157 3050 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_35820 3043 3936 gene locus_tag LOCUS_35830 3043 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4080 4167 gene locus_tag LOCUS_t00310 4080 4167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4206 4290 gene locus_tag LOCUS_t00320 4206 4290 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4390 6357 gene locus_tag LOCUS_35840 gene thrS 4390 6357 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_35840 6496 6924 gene locus_tag LOCUS_35850 6496 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 6950 7147 gene locus_tag LOCUS_35860 gene rpmI 6950 7147 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP0 protein_id gnl|my_center|LOCUS_35860 7239 7592 gene locus_tag LOCUS_35870 gene rplT 7239 7592 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_35870 7777 8502 gene locus_tag LOCUS_35880 gene dapB 7777 8502 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_35880 8505 9800 gene locus_tag LOCUS_35890 8505 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence120 842 498 gene locus_tag LOCUS_35900 842 498 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_35900 1096 839 gene locus_tag LOCUS_35910 1096 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1551 3434 gene locus_tag LOCUS_35920 1551 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3431 4117 gene locus_tag LOCUS_35930 3431 4117 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_35930 4176 6320 gene locus_tag LOCUS_35940 4176 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 6871 6329 gene locus_tag LOCUS_35950 6871 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 8164 6872 gene locus_tag LOCUS_35960 8164 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 8405 8674 gene locus_tag LOCUS_35970 8405 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35970 8684 10576 gene locus_tag LOCUS_35980 8684 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence121 <1 822 gene locus_tag LOCUS_35990 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000698132.1:alpha/beta hydrolase 852 4097 gene locus_tag LOCUS_36000 gene lacZ 852 4097 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_36000 4492 4082 gene locus_tag LOCUS_36010 4492 4082 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_36010 5064 4504 gene locus_tag LOCUS_36020 5064 4504 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546058.1 protein_id gnl|my_center|LOCUS_36020 5816 5127 gene locus_tag LOCUS_36030 5816 5127 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_36030 6622 5891 gene locus_tag LOCUS_36040 6622 5891 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_36040 6883 8052 gene locus_tag LOCUS_36050 6883 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_36050 8071 8592 gene locus_tag LOCUS_36060 8071 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 9922 8561 gene locus_tag LOCUS_36070 9922 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 10661 9990 gene locus_tag LOCUS_36080 10661 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_36080 >Feature sequence122 8 877 gene locus_tag LOCUS_36090 8 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 1347 3800 gene locus_tag LOCUS_36100 1347 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3865 7065 gene locus_tag LOCUS_36110 3865 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_36110 7108 10173 gene locus_tag LOCUS_36120 7108 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence123 1699 380 gene locus_tag LOCUS_36130 1699 380 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_36130 4852 2702 gene locus_tag LOCUS_36140 4852 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 5054 7162 gene locus_tag LOCUS_36150 5054 7162 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_36150 7946 7218 gene locus_tag LOCUS_36160 7946 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_36160 8442 8071 gene locus_tag LOCUS_36170 8442 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 10063 8561 gene locus_tag LOCUS_36180 10063 8561 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence124 <1 1245 gene locus_tag LOCUS_36190 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000845175.1:D-alanyl-D-alanine carboxypeptidase 1418 3997 gene locus_tag LOCUS_36200 1418 3997 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140084.1 protein_id gnl|my_center|LOCUS_36200 4121 6442 gene locus_tag LOCUS_36210 4121 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 6648 7547 gene locus_tag LOCUS_36220 6648 7547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_36220 7544 8350 gene locus_tag LOCUS_36230 7544 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 8429 9358 gene locus_tag LOCUS_36240 gene gldA 8429 9358 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence125 359 916 gene locus_tag LOCUS_36250 359 916 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_36250 1500 934 gene locus_tag LOCUS_36260 1500 934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024403.1 protein_id gnl|my_center|LOCUS_36260 4011 1603 gene locus_tag LOCUS_36270 4011 1603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_36270 4579 4070 gene locus_tag LOCUS_36280 4579 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 5932 4622 gene locus_tag LOCUS_36290 5932 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 6067 6573 gene locus_tag LOCUS_36300 6067 6573 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_36300 6570 7289 gene locus_tag LOCUS_36310 6570 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 9366 7312 gene locus_tag LOCUS_36320 9366 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 <10226 9429 gene locus_tag LOCUS_36330 <10226 9429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence126 167 241 gene locus_tag LOCUS_t00330 167 241 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 610 1707 gene locus_tag LOCUS_36340 610 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203575.1 protein_id gnl|my_center|LOCUS_36340 1908 4358 gene locus_tag LOCUS_36350 1908 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 6184 4655 gene locus_tag LOCUS_36360 gene ccrB 6184 4655 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_36360 6347 6162 gene locus_tag LOCUS_36370 6347 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 7355 6417 gene locus_tag LOCUS_36380 7355 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 8716 9558 gene locus_tag LOCUS_36390 8716 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence127 1613 90 gene locus_tag LOCUS_36400 gene nrfA 1613 90 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA7 protein_id gnl|my_center|LOCUS_36400 2207 1638 gene locus_tag LOCUS_36410 2207 1638 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA8 protein_id gnl|my_center|LOCUS_36410 4142 2301 gene locus_tag LOCUS_36420 4142 2301 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_36420 4270 5607 gene locus_tag LOCUS_36430 4270 5607 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_36430 6780 5716 gene locus_tag LOCUS_36440 6780 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 7011 7529 gene locus_tag LOCUS_36450 7011 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 8656 7574 gene locus_tag LOCUS_36460 8656 7574 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_36460 10077 8848 gene locus_tag LOCUS_36470 10077 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence128 2356 53 gene locus_tag LOCUS_36480 2356 53 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787751.1 protein_id gnl|my_center|LOCUS_36480 2788 3336 gene locus_tag LOCUS_36490 2788 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 3299 5107 gene locus_tag LOCUS_36500 3299 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 6172 5171 gene locus_tag LOCUS_36510 6172 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 6674 6180 gene locus_tag LOCUS_36520 6674 6180 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_36520 6810 6974 gene locus_tag LOCUS_36530 6810 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 6949 8037 gene locus_tag LOCUS_36540 6949 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 8034 8741 gene locus_tag LOCUS_36550 8034 8741 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence129 <1 526 gene locus_tag LOCUS_36560 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:peptidase 782 2014 gene locus_tag LOCUS_36570 gene deaD-2 782 2014 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_36570 2371 2207 gene locus_tag LOCUS_36580 2371 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2855 2331 gene locus_tag LOCUS_36590 2855 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 3042 6203 gene locus_tag LOCUS_36600 3042 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 6304 8580 gene locus_tag LOCUS_36610 6304 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_36610 8667 8912 gene locus_tag LOCUS_36620 8667 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence130 354 1883 gene locus_tag LOCUS_36630 354 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 2967 1927 gene locus_tag LOCUS_36640 2967 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 3225 4160 gene locus_tag LOCUS_36650 3225 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4354 6018 gene locus_tag LOCUS_36660 4354 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 6023 6427 gene locus_tag LOCUS_36670 6023 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 6609 7421 gene locus_tag LOCUS_36680 6609 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 7460 8074 gene locus_tag LOCUS_36690 7460 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36690 8641 9216 gene locus_tag LOCUS_36700 8641 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36700 >Feature sequence131 2492 1044 gene locus_tag LOCUS_36710 2492 1044 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_36710 2687 4720 gene locus_tag LOCUS_36720 2687 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 4730 5596 gene locus_tag LOCUS_36730 4730 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 5643 6695 gene locus_tag LOCUS_36740 5643 6695 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_36740 6717 7646 gene locus_tag LOCUS_36750 6717 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 8307 7651 gene locus_tag LOCUS_36760 8307 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence132 1806 1216 gene locus_tag LOCUS_36770 1806 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3537 1879 gene locus_tag LOCUS_36780 3537 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 5172 4465 gene locus_tag LOCUS_36790 5172 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 5386 6363 gene locus_tag LOCUS_36800 5386 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 7020 8270 gene locus_tag LOCUS_36810 gene ltrA 7020 8270 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_36810 >Feature sequence133 2786 579 gene locus_tag LOCUS_36820 2786 579 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_36820 3041 5356 gene locus_tag LOCUS_36830 gene topA 3041 5356 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_36830 5431 6579 gene locus_tag LOCUS_36840 gene fjo29 5431 6579 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_36840 6726 7628 gene locus_tag LOCUS_36850 gene porP 6726 7628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_36850 7689 9029 gene locus_tag LOCUS_36860 gene gldK 7689 9029 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_36860 >Feature sequence134 2088 883 gene locus_tag LOCUS_36870 2088 883 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_36870 2429 2085 gene locus_tag LOCUS_36880 2429 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 2858 4645 gene locus_tag LOCUS_36890 2858 4645 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_36890 4769 5368 gene locus_tag LOCUS_36900 4769 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 5343 5492 gene locus_tag LOCUS_36910 5343 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 6936 5551 gene locus_tag LOCUS_36920 6936 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 7080 8555 gene locus_tag LOCUS_36930 7080 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence135 191 370 gene locus_tag LOCUS_36940 191 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 552 1073 gene locus_tag LOCUS_36950 552 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 1803 1195 gene locus_tag LOCUS_36960 1803 1195 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_36960 2039 3307 gene locus_tag LOCUS_36970 2039 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 3445 6963 gene locus_tag LOCUS_36980 gene ileS 3445 6963 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U07 protein_id gnl|my_center|LOCUS_36980 7037 7414 gene locus_tag LOCUS_36990 7037 7414 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_36990 7519 8148 gene locus_tag LOCUS_37000 gene lspA 7519 8148 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_37000 >Feature sequence136 278 784 gene locus_tag LOCUS_37010 278 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 799 1776 gene locus_tag LOCUS_37020 799 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_37020 1924 2259 gene locus_tag LOCUS_37030 1924 2259 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061672.1 protein_id gnl|my_center|LOCUS_37030 2459 2980 gene locus_tag LOCUS_37040 2459 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 3079 4440 gene locus_tag LOCUS_37050 3079 4440 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_37050 5676 4450 gene locus_tag LOCUS_37060 5676 4450 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119680.1 protein_id gnl|my_center|LOCUS_37060 6109 5834 gene locus_tag LOCUS_37070 6109 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 6190 7212 gene locus_tag LOCUS_37080 gene rbsR 6190 7212 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_37080 7202 8038 gene locus_tag LOCUS_37090 gene kduI 7202 8038 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 protein_id gnl|my_center|LOCUS_37090 >Feature sequence137 2690 246 gene locus_tag LOCUS_37100 2690 246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_37100 2799 3017 gene locus_tag LOCUS_37110 2799 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 3137 3748 gene locus_tag LOCUS_37120 3137 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 3753 4055 gene locus_tag LOCUS_37130 3753 4055 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174185.1 protein_id gnl|my_center|LOCUS_37130 4432 4094 gene locus_tag LOCUS_37140 gene tfoX 4432 4094 CDS product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_37140 4605 7187 gene locus_tag LOCUS_37150 4605 7187 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140762.1 protein_id gnl|my_center|LOCUS_37150 8128 7247 gene locus_tag LOCUS_37160 8128 7247 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_37160 >Feature sequence138 459 2315 gene locus_tag LOCUS_37170 459 2315 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_37170 3639 2401 gene locus_tag LOCUS_37180 3639 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_37180 4470 3685 gene locus_tag LOCUS_37190 4470 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_37190 6693 4498 gene locus_tag LOCUS_37200 6693 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37200 7233 6895 gene locus_tag LOCUS_37210 7233 6895 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_37210 7818 7240 gene locus_tag LOCUS_37220 7818 7240 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461065.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence139 183 1547 gene locus_tag LOCUS_37230 183 1547 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_37230 2111 1818 gene locus_tag LOCUS_37240 2111 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 3682 2114 gene locus_tag LOCUS_37250 3682 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 3840 4364 gene locus_tag LOCUS_37260 3840 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 5577 4378 gene locus_tag LOCUS_37270 5577 4378 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_37270 5757 7049 gene locus_tag LOCUS_37280 5757 7049 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_37280 >Feature sequence140 89 2572 gene locus_tag LOCUS_37290 89 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 2679 5252 gene locus_tag LOCUS_37300 2679 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 5601 7841 gene locus_tag LOCUS_37310 5601 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence141 1218 2228 gene locus_tag LOCUS_37320 gene hmgcL 1218 2228 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807291.1 protein_id gnl|my_center|LOCUS_37320 2240 3097 gene locus_tag LOCUS_37330 gene mvaB 2240 3097 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_37330 3316 5292 gene locus_tag LOCUS_37340 3316 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 5396 6010 gene locus_tag LOCUS_37350 5396 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 6007 6297 gene locus_tag LOCUS_37360 6007 6297 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_37360 6346 7686 gene locus_tag LOCUS_37370 6346 7686 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence142 3557 4228 gene locus_tag LOCUS_37380 3557 4228 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_37380 4246 5730 gene locus_tag LOCUS_37390 4246 5730 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_37390 5832 7649 gene locus_tag LOCUS_37400 5832 7649 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence143 1832 567 gene locus_tag LOCUS_37410 gene nqrF 1832 567 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_37410 2468 1851 gene locus_tag LOCUS_37420 gene nqrE 2468 1851 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_37420 3113 2478 gene locus_tag LOCUS_37430 gene nqrD 3113 2478 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_37430 3836 3120 gene locus_tag LOCUS_37440 gene nqrC 3836 3120 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_37440 5032 3866 gene locus_tag LOCUS_37450 gene nqrB 5032 3866 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_37450 6419 5064 gene locus_tag LOCUS_37460 gene nqrA 6419 5064 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_37460 >Feature sequence144 548 3256 gene locus_tag LOCUS_37470 548 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 5002 3257 gene locus_tag LOCUS_37480 5002 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 5433 5005 gene locus_tag LOCUS_37490 5433 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 6547 5513 gene locus_tag LOCUS_37500 6547 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence145 <1 980 gene locus_tag LOCUS_37510 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A800:diaminopimelate decarboxylase 977 2107 gene locus_tag LOCUS_37520 gene carA 977 2107 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ3 protein_id gnl|my_center|LOCUS_37520 2190 5414 gene locus_tag LOCUS_37530 2190 5414 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ4 protein_id gnl|my_center|LOCUS_37530 5589 6935 gene locus_tag LOCUS_37540 5589 6935 CDS product putative geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704136.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence146 2167 647 gene locus_tag LOCUS_37550 2167 647 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_37550 5396 2208 gene locus_tag LOCUS_37560 5396 2208 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence147 1386 2015 gene locus_tag LOCUS_37570 gene recR 1386 2015 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UM9 protein_id gnl|my_center|LOCUS_37570 2020 4002 gene locus_tag LOCUS_37580 2020 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 4070 5005 gene locus_tag LOCUS_37590 4070 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 5008 5559 gene locus_tag LOCUS_37600 5008 5559 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_37600 5855 5520 gene locus_tag LOCUS_37610 5855 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 5972 6802 gene locus_tag LOCUS_37620 5972 6802 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence148 1762 251 gene locus_tag LOCUS_37630 1762 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 3780 1885 gene locus_tag LOCUS_37640 3780 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 4047 4559 gene locus_tag LOCUS_37650 4047 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 4552 6282 gene locus_tag LOCUS_37660 4552 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 >Feature sequence149 1043 1288 gene locus_tag LOCUS_37670 1043 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 1275 1562 gene locus_tag LOCUS_37680 gene parE1 1275 1562 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T8 protein_id gnl|my_center|LOCUS_37680 1578 2846 gene locus_tag LOCUS_37690 1578 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4117 2891 gene locus_tag LOCUS_37700 4117 2891 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963526.1 protein_id gnl|my_center|LOCUS_37700 4502 4690 gene locus_tag LOCUS_37710 4502 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 4893 5906 gene locus_tag LOCUS_37720 4893 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 6292 6561 gene locus_tag LOCUS_37730 6292 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence150 >Feature sequence151 147 1157 gene locus_tag LOCUS_37740 147 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 1741 1154 gene locus_tag LOCUS_37750 1741 1154 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L3 protein_id gnl|my_center|LOCUS_37750 2567 1761 gene locus_tag LOCUS_37760 2567 1761 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_37760 3483 2539 gene locus_tag LOCUS_37770 gene lpxK 3483 2539 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_37770 5331 3571 gene locus_tag LOCUS_37780 5331 3571 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_37780 5407 5895 gene locus_tag LOCUS_37790 5407 5895 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_37790 6554 5898 gene locus_tag LOCUS_37800 gene upp 6554 5898 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence152 86 523 gene locus_tag LOCUS_37810 86 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 649 2811 gene locus_tag LOCUS_37820 649 2811 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_37820 3153 3494 gene locus_tag LOCUS_37830 3153 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3564 4037 gene locus_tag LOCUS_37840 gene argR 3564 4037 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A4 protein_id gnl|my_center|LOCUS_37840 4098 5357 gene locus_tag LOCUS_37850 gene argG 4098 5357 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2A1 protein_id gnl|my_center|LOCUS_37850 5384 6574 gene locus_tag LOCUS_37860 gene argH 5384 6574 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_229578.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence153 99 2717 gene locus_tag LOCUS_37870 99 2717 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_37870 3011 4105 gene locus_tag LOCUS_37880 3011 4105 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225122.1 protein_id gnl|my_center|LOCUS_37880 <6957 4192 gene locus_tag LOCUS_37890 <6957 4192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080136.1:alpha-galactosidase >Feature sequence154 <1 716 gene locus_tag LOCUS_37900 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878758.1:(4Fe-4S)-binding protein 961 3330 gene locus_tag LOCUS_37910 961 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3604 4176 gene locus_tag LOCUS_37920 3604 4176 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148830.1 protein_id gnl|my_center|LOCUS_37920 4251 5606 gene locus_tag LOCUS_37930 4251 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_37930 <6566 5807 gene locus_tag LOCUS_37940 <6566 5807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KQH7:3-oxoacyl-[acyl-carrier-protein] reductase FabG >Feature sequence155 1109 1489 gene locus_tag LOCUS_37950 1109 1489 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_37950 3008 1527 gene locus_tag LOCUS_37960 3008 1527 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403432.1 protein_id gnl|my_center|LOCUS_37960 3525 2995 gene locus_tag LOCUS_37970 3525 2995 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403433.1 protein_id gnl|my_center|LOCUS_37970 5883 3553 gene locus_tag LOCUS_37980 5883 3553 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence156 142 1188 gene locus_tag LOCUS_37990 142 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37990 1221 1538 gene locus_tag LOCUS_38000 1221 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 1541 1804 gene locus_tag LOCUS_38010 gene ptsH 1541 1804 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166936.1 protein_id gnl|my_center|LOCUS_38010 1806 3521 gene locus_tag LOCUS_38020 1806 3521 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ47 protein_id gnl|my_center|LOCUS_38020 3549 5165 gene locus_tag LOCUS_38030 3549 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 5581 5279 gene locus_tag LOCUS_38040 5581 5279 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_38040 5825 5574 gene locus_tag LOCUS_38050 5825 5574 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 protein_id gnl|my_center|LOCUS_38050 >Feature sequence157 300 1841 gene locus_tag LOCUS_38060 300 1841 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_38060 1851 2600 gene locus_tag LOCUS_38070 1851 2600 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887034.1 protein_id gnl|my_center|LOCUS_38070 4028 2742 gene locus_tag LOCUS_38080 gene tnpA 4028 2742 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974358.1 protein_id gnl|my_center|LOCUS_38080 4575 5141 gene locus_tag LOCUS_38090 4575 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 5529 5245 gene locus_tag LOCUS_38100 5529 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 6302 5550 gene locus_tag LOCUS_38110 6302 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38110 >Feature sequence158 4096 1712 gene locus_tag LOCUS_38120 gene ccoI 4096 1712 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_38120 4877 4080 gene locus_tag LOCUS_38130 4877 4080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_38130 5324 4884 gene locus_tag LOCUS_38140 5324 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 <6427 5376 gene locus_tag LOCUS_38150 <6427 5376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG >Feature sequence159 2143 1124 gene locus_tag LOCUS_38160 gene fbp 2143 1124 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_38160 2218 3498 gene locus_tag LOCUS_38170 gene lysC 2218 3498 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_38170 4838 3495 gene locus_tag LOCUS_38180 gene pyrC1 4838 3495 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_38180 5583 4831 gene locus_tag LOCUS_38190 5583 4831 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence160 2863 566 gene locus_tag LOCUS_38200 2863 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 2747 2992 gene locus_tag LOCUS_38210 2747 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3629 3961 gene locus_tag LOCUS_38220 3629 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 3970 4530 gene locus_tag LOCUS_38230 3970 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66416 protein_id gnl|my_center|LOCUS_38230 4595 5800 gene locus_tag LOCUS_38240 4595 5800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence161 576 1280 gene locus_tag LOCUS_38250 gene lytT 576 1280 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 protein_id gnl|my_center|LOCUS_38250 1462 4938 gene locus_tag LOCUS_38260 1462 4938 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_38260 5604 5377 gene locus_tag LOCUS_38270 5604 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 6161 6087 gene locus_tag LOCUS_t00340 6161 6087 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence162 753 1352 gene locus_tag LOCUS_38280 753 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 1535 2920 gene locus_tag LOCUS_38290 1535 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 4169 3018 gene locus_tag LOCUS_38300 4169 3018 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_38300 4181 4387 gene locus_tag LOCUS_38310 4181 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 4389 5717 gene locus_tag LOCUS_38320 4389 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence163 2547 4070 gene locus_tag LOCUS_38330 gene nhaB 2547 4070 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED79 protein_id gnl|my_center|LOCUS_38330 5089 4118 gene locus_tag LOCUS_38340 5089 4118 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_38340 <6139 5186 gene locus_tag LOCUS_38350 <6139 5186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259686.1:glycosyl transferase >Feature sequence164 1461 1267 gene locus_tag LOCUS_38360 1461 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4316 1548 gene locus_tag LOCUS_38370 4316 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 4500 5816 gene locus_tag LOCUS_38380 4500 5816 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_38380 >Feature sequence165 594 791 gene locus_tag LOCUS_38390 594 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 898 2133 gene locus_tag LOCUS_38400 898 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 3805 2357 gene locus_tag LOCUS_38410 3805 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 3816 4022 gene locus_tag LOCUS_38420 3816 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence166 <1 1380 gene locus_tag LOCUS_38430 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2T6:S-adenosylmethionine synthase 1492 1845 gene locus_tag LOCUS_38440 1492 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_38440 1990 2256 gene locus_tag LOCUS_38450 1990 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 2253 2606 gene locus_tag LOCUS_38460 2253 2606 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_38460 2731 5343 gene locus_tag LOCUS_38470 2731 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 5347 5739 gene locus_tag LOCUS_38480 5347 5739 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence167 583 1581 gene locus_tag LOCUS_38490 gene asd 583 1581 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_38490 2742 1582 gene locus_tag LOCUS_38500 2742 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3938 2739 gene locus_tag LOCUS_38510 gene hflX 3938 2739 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 protein_id gnl|my_center|LOCUS_38510 4803 4123 gene locus_tag LOCUS_38520 4803 4123 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_38520 5595 4915 gene locus_tag LOCUS_38530 5595 4915 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_38530 >Feature sequence168 372 2087 gene locus_tag LOCUS_38540 372 2087 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_38540 2245 5256 gene locus_tag LOCUS_38550 gene lacZ 2245 5256 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_38550 <5820 5272 gene locus_tag LOCUS_38560 <5820 5272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122680.1:sulfatase >Feature sequence169 190 375 gene locus_tag LOCUS_38570 190 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 417 638 gene locus_tag LOCUS_38580 417 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 668 853 gene locus_tag LOCUS_38590 668 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1775 1125 gene locus_tag LOCUS_38600 1775 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 2265 1741 gene locus_tag LOCUS_38610 2265 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 2842 5214 gene locus_tag LOCUS_38620 2842 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence170 <1 1152 gene locus_tag LOCUS_38630 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082388.1:glycoside hydrolase family 13 3035 1170 gene locus_tag LOCUS_38640 3035 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 3195 4196 gene locus_tag LOCUS_38650 3195 4196 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_38650 4534 4265 gene locus_tag LOCUS_38660 4534 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 >Feature sequence171 1372 710 gene locus_tag LOCUS_38670 1372 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 1809 1450 gene locus_tag LOCUS_38680 1809 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 2368 1802 gene locus_tag LOCUS_38690 2368 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 4191 2494 gene locus_tag LOCUS_38700 gene glnS 4191 2494 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UX42 protein_id gnl|my_center|LOCUS_38700 4348 4713 gene locus_tag LOCUS_38710 4348 4713 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PK9 protein_id gnl|my_center|LOCUS_38710 4821 4892 gene locus_tag LOCUS_t00350 4821 4892 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5443 5048 gene locus_tag LOCUS_38720 5443 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence172 <1 1233 gene locus_tag LOCUS_38730 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MI0:ribonuclease R 2349 1246 gene locus_tag LOCUS_38740 2349 1246 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_38740 3130 2351 gene locus_tag LOCUS_38750 3130 2351 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_38750 3269 3694 gene locus_tag LOCUS_38760 3269 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4906 3722 gene locus_tag LOCUS_38770 4906 3722 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_38770 5307 4909 gene locus_tag LOCUS_38780 5307 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 >Feature sequence173 420 857 gene locus_tag LOCUS_38790 420 857 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903745.1 protein_id gnl|my_center|LOCUS_38790 861 1832 gene locus_tag LOCUS_38800 861 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 1943 2542 gene locus_tag LOCUS_38810 1943 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016768.1 protein_id gnl|my_center|LOCUS_38810 2557 3843 gene locus_tag LOCUS_38820 2557 3843 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_38820 4028 5191 gene locus_tag LOCUS_38830 4028 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_603835.2 protein_id gnl|my_center|LOCUS_38830 >Feature sequence174 1976 372 gene locus_tag LOCUS_38840 1976 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2212 1988 gene locus_tag LOCUS_38850 2212 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 2425 2219 gene locus_tag LOCUS_38860 2425 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2707 3957 gene locus_tag LOCUS_38870 2707 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774553.1 protein_id gnl|my_center|LOCUS_38870 5149 4250 gene locus_tag LOCUS_38880 5149 4250 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_38880 >Feature sequence175 393 1631 gene locus_tag LOCUS_38890 393 1631 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_38890 2650 1691 gene locus_tag LOCUS_38900 2650 1691 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_38900 3026 2640 gene locus_tag LOCUS_38910 gene mgsA 3026 2640 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 protein_id gnl|my_center|LOCUS_38910 4158 3004 gene locus_tag LOCUS_38920 4158 3004 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_38920 4829 4170 gene locus_tag LOCUS_38930 4829 4170 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759973.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence176 1041 1742 gene locus_tag LOCUS_38940 gene ybbC 1041 1742 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_38940 1753 4128 gene locus_tag LOCUS_38950 1753 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 <4889 4304 gene locus_tag LOCUS_38960 <4889 4304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VBS7:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) >Feature sequence177 220 798 gene locus_tag LOCUS_38970 220 798 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_38970 1431 844 gene locus_tag LOCUS_38980 1431 844 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_38980 1793 3724 gene locus_tag LOCUS_38990 1793 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_38990 >Feature sequence178 2204 141 gene locus_tag LOCUS_39000 2204 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3095 2763 gene locus_tag LOCUS_39010 3095 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3429 3097 gene locus_tag LOCUS_39020 3429 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 3575 3880 gene locus_tag LOCUS_39030 3575 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence179 3773 1848 gene locus_tag LOCUS_39040 3773 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 <4717 3884 gene locus_tag LOCUS_39050 <4717 3884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64Y28:4-O-beta-D-mannosyl-D-glucose phosphorylase >Feature sequence180 1794 145 gene locus_tag LOCUS_39060 1794 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 3272 1791 gene locus_tag LOCUS_39070 3272 1791 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_39070 3680 4393 gene locus_tag LOCUS_39080 3680 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence181 369 701 gene locus_tag LOCUS_39090 369 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 793 2190 gene locus_tag LOCUS_39100 gene asnS 793 2190 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z8 protein_id gnl|my_center|LOCUS_39100 2233 3696 gene locus_tag LOCUS_39110 2233 3696 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence182 1063 2217 gene locus_tag LOCUS_39120 1063 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272583.1 protein_id gnl|my_center|LOCUS_39120 2342 3544 gene locus_tag LOCUS_39130 2342 3544 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085634.1 protein_id gnl|my_center|LOCUS_39130 4376 3594 gene locus_tag LOCUS_39140 gene mqnA 4376 3594 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_39140 >Feature sequence183 813 1745 gene locus_tag LOCUS_39150 gene prfB 813 1745 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_39150 3708 1750 gene locus_tag LOCUS_39160 3708 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 >Feature sequence184 1336 3255 gene locus_tag LOCUS_39170 1336 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3455 4339 gene locus_tag LOCUS_39180 3455 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence185 52 127 gene locus_tag LOCUS_t00360 52 127 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 415 726 gene locus_tag LOCUS_39190 415 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 744 1499 gene locus_tag LOCUS_39200 744 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 2478 3734 gene locus_tag LOCUS_39210 2478 3734 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_39210 3727 4281 gene locus_tag LOCUS_39220 3727 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence186 >Feature sequence187 2139 2303 gene locus_tag LOCUS_39230 2139 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 2331 4508 gene locus_tag LOCUS_39240 gene ccoN/ccoO 2331 4508 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_39240 >Feature sequence188 1370 102 gene locus_tag LOCUS_39250 1370 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4183 1628 gene locus_tag LOCUS_39260 4183 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 >Feature sequence189 1911 448 gene locus_tag LOCUS_39270 1911 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_39270 4454 1968 gene locus_tag LOCUS_39280 4454 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 >Feature sequence190 1243 2346 gene locus_tag LOCUS_39290 1243 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 2402 2692 gene locus_tag LOCUS_39300 2402 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_39300 2685 3026 gene locus_tag LOCUS_39310 2685 3026 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence191 6 2693 gene locus_tag LOCUS_39320 6 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939307.1 protein_id gnl|my_center|LOCUS_39320 >Feature sequence192 1034 120 gene locus_tag LOCUS_39330 1034 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 2806 1148 gene locus_tag LOCUS_39340 2806 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 >Feature sequence193 1452 151 gene locus_tag LOCUS_39350 1452 151 CDS product tripeptidyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108298.1 protein_id gnl|my_center|LOCUS_39350 3855 1468 gene locus_tag LOCUS_39360 3855 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 <4381 3868 gene locus_tag LOCUS_39370 <4381 3868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2H7:glutamate--tRNA ligase >Feature sequence194 3055 1130 gene locus_tag LOCUS_39380 3055 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence195 <1 1614 gene locus_tag LOCUS_39390 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107276.1:beta-mannosidase 1616 3547 gene locus_tag LOCUS_39400 1616 3547 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932828.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence196 2178 2843 gene locus_tag LOCUS_39410 2178 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 <4208 3047 gene locus_tag LOCUS_39420 <4208 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108087.1:ATPase >Feature sequence197 195 2138 gene locus_tag LOCUS_39430 195 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 2735 2238 gene locus_tag LOCUS_39440 2735 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 4167 2917 gene locus_tag LOCUS_39450 4167 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_39450 >Feature sequence198 <1 1228 gene locus_tag LOCUS_39460 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107579.1:hydrolase 1423 2142 gene locus_tag LOCUS_39470 1423 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_39470 2154 3791 gene locus_tag LOCUS_39480 2154 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 >Feature sequence199 4091 3873 gene locus_tag LOCUS_39490 4091 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence200 <1 1032 gene locus_tag LOCUS_39500 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454668.1:potassium transporter TrkA 1236 2366 gene locus_tag LOCUS_39510 gene mtnA 1236 2366 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULQ4 protein_id gnl|my_center|LOCUS_39510 2520 3173 gene locus_tag LOCUS_39520 2520 3173 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_39520 3318 3917 gene locus_tag LOCUS_39530 3318 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence201 <1 1631 gene locus_tag LOCUS_39540 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119313.1:sialidase 2742 1696 gene locus_tag LOCUS_39550 2742 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 <3972 2797 gene locus_tag LOCUS_39560 <3972 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119310.1:N-acylglucosamine 2-epimerase >Feature sequence202 3223 1523 gene locus_tag LOCUS_39570 3223 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 3633 3223 gene locus_tag LOCUS_39580 3633 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 3922 3737 gene locus_tag LOCUS_39590 3922 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence203 <1 2713 gene locus_tag LOCUS_39600 <1 2713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962756.1:T9SS C-terminal target domain-containing protein 2744 3772 gene locus_tag LOCUS_39610 2744 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence204 2117 807 gene locus_tag LOCUS_39620 2117 807 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_39620 2364 2107 gene locus_tag LOCUS_39630 2364 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 3520 2411 gene locus_tag LOCUS_39640 3520 2411 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_39640 >Feature sequence205 934 1950 gene locus_tag LOCUS_39650 gene rlmN 934 1950 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZK5 protein_id gnl|my_center|LOCUS_39650 2044 2904 gene locus_tag LOCUS_39660 2044 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence206 1483 221 gene locus_tag LOCUS_39670 1483 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 1760 1485 gene locus_tag LOCUS_39680 1760 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 2699 1821 gene locus_tag LOCUS_39690 2699 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 <3800 2711 gene locus_tag LOCUS_39700 <3800 2711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362019.1:transposase >Feature sequence207 532 401 gene locus_tag LOCUS_39710 532 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 944 1342 gene locus_tag LOCUS_39720 944 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 1332 1502 gene locus_tag LOCUS_39730 1332 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 2021 1860 gene locus_tag LOCUS_39740 2021 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 2932 3237 gene locus_tag LOCUS_39750 2932 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 >Feature sequence208 >Feature sequence209 <1 550 gene locus_tag LOCUS_39760 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H099:ribonuclease Z 605 2134 gene locus_tag LOCUS_39770 gene guaA 605 2134 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_39770 2711 2136 gene locus_tag LOCUS_39780 gene cheB2 2711 2136 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_39780 2984 2724 gene locus_tag LOCUS_39790 2984 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39790 <3577 3048 gene locus_tag LOCUS_39800 <3577 3048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002079012.1:chemotaxis protein R note possible pseudo, internal stop codon >Feature sequence210 1172 57 gene locus_tag LOCUS_39810 1172 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 3118 2147 gene locus_tag LOCUS_39820 3118 2147 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_39820 3480 3130 gene locus_tag LOCUS_39830 3480 3130 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_39830 >Feature sequence211 1813 548 gene locus_tag LOCUS_39840 1813 548 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_39840 1965 2417 gene locus_tag LOCUS_39850 1965 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 3042 2407 gene locus_tag LOCUS_39860 3042 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence212 <1 3422 gene locus_tag LOCUS_39870 <1 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899883.1:5-oxoprolinase >Feature sequence213 550 900 gene locus_tag LOCUS_39880 550 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 1166 1417 gene locus_tag LOCUS_39890 1166 1417 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_39890 1417 1674 gene locus_tag LOCUS_39900 1417 1674 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_39900 1699 2931 gene locus_tag LOCUS_39910 1699 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence214 23 304 gene locus_tag LOCUS_39920 23 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 555 1694 gene locus_tag LOCUS_39930 555 1694 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107182.1 protein_id gnl|my_center|LOCUS_39930 1699 2562 gene locus_tag LOCUS_39940 1699 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 2756 3067 gene locus_tag LOCUS_39950 2756 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence215 1976 783 gene locus_tag LOCUS_39960 1976 783 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_39960 2057 2647 gene locus_tag LOCUS_39970 2057 2647 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T9 protein_id gnl|my_center|LOCUS_39970 >Feature sequence216 666 2069 gene locus_tag LOCUS_39980 666 2069 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121006.1 protein_id gnl|my_center|LOCUS_39980 >Feature sequence217 508 774 gene locus_tag LOCUS_39990 508 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 1252 1422 gene locus_tag LOCUS_40000 1252 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 1590 2264 gene locus_tag LOCUS_40010 1590 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 2561 3097 gene locus_tag LOCUS_40020 2561 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence218 1336 245 gene locus_tag LOCUS_40030 1336 245 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_40030 1951 1379 gene locus_tag LOCUS_40040 1951 1379 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_40040 2170 2910 gene locus_tag LOCUS_40050 2170 2910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_40050 >Feature sequence219 1749 1012 gene locus_tag LOCUS_40060 1749 1012 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_40060 2809 1739 gene locus_tag LOCUS_40070 2809 1739 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_40070 >Feature sequence220 191 1696 gene locus_tag LOCUS_40080 191 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 3312 1657 gene locus_tag LOCUS_40090 3312 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 >Feature sequence221 <1 576 gene locus_tag LOCUS_40100 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706723.1:restriction endonuclease type I, S subunit 573 3014 gene locus_tag LOCUS_40110 573 3014 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_40110 >Feature sequence222 1105 299 gene locus_tag LOCUS_40120 1105 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 1436 1750 gene locus_tag LOCUS_40130 1436 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1785 2258 gene locus_tag LOCUS_40140 1785 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 2949 2368 gene locus_tag LOCUS_40150 2949 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 >Feature sequence223 656 1492 gene locus_tag LOCUS_40160 656 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103590.1 protein_id gnl|my_center|LOCUS_40160 1653 3239 gene locus_tag LOCUS_40170 1653 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence224 1509 523 gene locus_tag LOCUS_40180 1509 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 1757 2734 gene locus_tag LOCUS_40190 1757 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence225 263 1615 gene locus_tag LOCUS_40200 263 1615 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 protein_id gnl|my_center|LOCUS_40200 1695 2828 gene locus_tag LOCUS_40210 gene acrE 1695 2828 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976146.1 protein_id gnl|my_center|LOCUS_40210 >Feature sequence226 <1 569 gene locus_tag LOCUS_40220 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203535.1:cell envelope biogenesis protein TonB 1373 624 gene locus_tag LOCUS_40230 1373 624 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_40230 <3218 1396 gene locus_tag LOCUS_40240 <3218 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase >Feature sequence227 <3210 2210 gene locus_tag LOCUS_40250 <3210 2210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123572.1:N-acetylgalactosamine-6-sulfatase >Feature sequence228 330 1205 gene locus_tag LOCUS_40260 330 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence229 27 815 gene locus_tag LOCUS_40270 27 815 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_40270 846 2054 gene locus_tag LOCUS_40280 846 2054 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence230 <1 632 gene locus_tag LOCUS_40290 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979857.1:4Fe-4S ferredoxin 629 1807 gene locus_tag LOCUS_40300 629 1807 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705817.1 protein_id gnl|my_center|LOCUS_40300 >Feature sequence231 326 2158 gene locus_tag LOCUS_40310 326 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence232 1354 923 gene locus_tag LOCUS_40320 1354 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 <3037 1437 gene locus_tag LOCUS_40330 <3037 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6F149:chaperone protein DnaK >Feature sequence233 280 1665 gene locus_tag LOCUS_40340 280 1665 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545725.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence234 2904 2038 gene locus_tag LOCUS_40350 gene folD 2904 2038 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_40350 >Feature sequence235 2388 16 gene locus_tag LOCUS_40360 2388 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence236 227 1741 gene locus_tag LOCUS_40370 227 1741 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_40370 <2906 2270 gene locus_tag LOCUS_40380 <2906 2270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962262.1:peptidase M1 >Feature sequence237 1192 260 gene locus_tag LOCUS_40390 1192 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 1404 2621 gene locus_tag LOCUS_40400 gene adh 1404 2621 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123801.1 protein_id gnl|my_center|LOCUS_40400 2808 2662 gene locus_tag LOCUS_40410 2808 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence238 <1 743 gene locus_tag LOCUS_40420 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403922.1:amidohydrolase 799 2193 gene locus_tag LOCUS_40430 799 2193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767094.1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence239 <1 524 gene locus_tag LOCUS_40440 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766056.1:serine/threonine protein phosphatase 1021 560 gene locus_tag LOCUS_40450 1021 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 1898 1011 gene locus_tag LOCUS_40460 gene prmC 1898 1011 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_40460 >Feature sequence240 >Feature sequence241 2487 499 gene locus_tag LOCUS_40470 2487 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence242 147 659 gene locus_tag LOCUS_40480 147 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 2126 816 gene locus_tag LOCUS_40490 2126 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 2628 2281 gene locus_tag LOCUS_40500 2628 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence243 1087 2010 gene locus_tag LOCUS_40510 gene phoR 1087 2010 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_40510 >Feature sequence244 530 1495 gene locus_tag LOCUS_40520 530 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 1596 2243 gene locus_tag LOCUS_40530 gene nth 1596 2243 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_40530 >Feature sequence245 842 2224 gene locus_tag LOCUS_40540 842 2224 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence246 2094 1540 gene locus_tag LOCUS_40550 2094 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence247 >Feature sequence248 676 933 gene locus_tag LOCUS_40560 676 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 <2580 1612 gene locus_tag LOCUS_40570 <2580 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203247.1:nucleotidyltransferase >Feature sequence249 1207 380 gene locus_tag LOCUS_40580 gene arsM 1207 380 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_40580 1541 1242 gene locus_tag LOCUS_40590 1541 1242 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933390.1 protein_id gnl|my_center|LOCUS_40590 >Feature sequence250 1320 541 gene locus_tag LOCUS_40600 1320 541 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_40600 <2577 1313 gene locus_tag LOCUS_40610 <2577 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase >Feature sequence251 976 1494 gene locus_tag LOCUS_40620 976 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence252 >Feature sequence253 1585 152 gene locus_tag LOCUS_40630 1585 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence254 216 1319 gene locus_tag LOCUS_40640 216 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 1402 1875 gene locus_tag LOCUS_40650 gene greA 1402 1875 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4N4 protein_id gnl|my_center|LOCUS_40650 >Feature sequence255 762 2030 gene locus_tag LOCUS_40660 762 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence256 929 273 gene locus_tag LOCUS_40670 929 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 2226 910 gene locus_tag LOCUS_40680 2226 910 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_40680 >Feature sequence257 >Feature sequence258 >Feature sequence259 2 523 gene locus_tag LOCUS_40690 2 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence260 2069 471 gene locus_tag LOCUS_40700 2069 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence261 <1 611 gene locus_tag LOCUS_40710 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786228.1:peptidase C69 700 1098 gene locus_tag LOCUS_40720 gene rplS 700 1098 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4V8 protein_id gnl|my_center|LOCUS_40720 1586 1137 gene locus_tag LOCUS_40730 1586 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence262 <1 2110 gene locus_tag LOCUS_40740 <1 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119311.1:sodium:solute symporter >Feature sequence263 <2400 1711 gene locus_tag LOCUS_40750 <2400 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203495.1:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence264 889 560 gene locus_tag LOCUS_40760 889 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 2186 999 gene locus_tag LOCUS_40770 2186 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence265 595 443 gene locus_tag LOCUS_40780 595 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 1708 875 gene locus_tag LOCUS_40790 1708 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 2156 1692 gene locus_tag LOCUS_40800 2156 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 >Feature sequence266 <1 1499 gene locus_tag LOCUS_40810 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:multidrug transporter AcrB 1513 1890 gene locus_tag LOCUS_40820 1513 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 1890 2216 gene locus_tag LOCUS_40830 1890 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence267 <1 1671 gene locus_tag LOCUS_40840 <1 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6L0:retaining alpha-galactosidase 2300 1731 gene locus_tag LOCUS_40850 2300 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence268 928 545 gene locus_tag LOCUS_40860 928 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 >Feature sequence269 262 116 gene locus_tag LOCUS_40870 262 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 <2296 341 gene locus_tag LOCUS_40880 <2296 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000875702.1:thermolysin >Feature sequence270 >Feature sequence271 <1 502 gene locus_tag LOCUS_40890 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001048226.1:peptide-binding protein 1203 499 gene locus_tag LOCUS_40900 1203 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 2201 1197 gene locus_tag LOCUS_40910 2201 1197 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 protein_id gnl|my_center|LOCUS_40910 >Feature sequence272 >Feature sequence273 <1 1417 gene locus_tag LOCUS_40920 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter 2220 1546 gene locus_tag LOCUS_40930 2220 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 >Feature sequence274 692 1966 gene locus_tag LOCUS_40940 692 1966 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_40940 >Feature sequence275 1029 1274 gene locus_tag LOCUS_40950 1029 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence276 1159 104 gene locus_tag LOCUS_40960 1159 104 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_40960 <2195 1146 gene locus_tag LOCUS_40970 <2195 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786228.1:peptidase C69 >Feature sequence277 380 1561 gene locus_tag LOCUS_40980 380 1561 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence278 477 1427 gene locus_tag LOCUS_40990 477 1427 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_40990 >Feature sequence279 >Feature sequence280 >Feature sequence281 776 375 gene locus_tag LOCUS_41000 776 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 >Feature sequence282 179 667 gene locus_tag LOCUS_41010 179 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_41010 1000 662 gene locus_tag LOCUS_41020 1000 662 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321975.1 protein_id gnl|my_center|LOCUS_41020 1429 1088 gene locus_tag LOCUS_41030 1429 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 <2085 1451 gene locus_tag LOCUS_41040 <2085 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203427.1:LruC domain-containing protein >Feature sequence283 >Feature sequence284 <2051 886 gene locus_tag LOCUS_41050 <2051 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P22:adenylosuccinate lyase >Feature sequence285 <1 828 gene locus_tag LOCUS_41060 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760476.1:sodium:proton antiporter 902 1171 gene locus_tag LOCUS_41070 902 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 <2008 1168 gene locus_tag LOCUS_41080 <2008 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64X44:FAD:protein FMN transferase >Feature sequence286 1451 324 gene locus_tag LOCUS_41090 1451 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 >Feature sequence287 448 951 gene locus_tag LOCUS_41100 448 951 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_41100 1029 1445 gene locus_tag LOCUS_41110 1029 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 >Feature sequence288 >Feature sequence289 >Feature sequence290 <1974 652 gene locus_tag LOCUS_41120 <1974 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZY1:cysteine--tRNA ligase >Feature sequence291 1797 1387 gene locus_tag LOCUS_41130 1797 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence292 1878 823 gene locus_tag LOCUS_41140 1878 823 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_41140 >Feature sequence293 1457 126 gene locus_tag LOCUS_41150 gene pepP 1457 126 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44881 protein_id gnl|my_center|LOCUS_41150 >Feature sequence294 989 1795 gene locus_tag LOCUS_41160 989 1795 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_41160 >Feature sequence295 142 645 gene locus_tag LOCUS_41170 142 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 680 1231 gene locus_tag LOCUS_41180 680 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1487 1882 gene locus_tag LOCUS_41190 1487 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence296 >Feature sequence297 <1 1320 gene locus_tag LOCUS_41200 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107804.1:sensor histidine kinase >Feature sequence298 1622 963 gene locus_tag LOCUS_41210 1622 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_41210 >Feature sequence299 1039 203 gene locus_tag LOCUS_41220 1039 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 <1809 1260 gene locus_tag LOCUS_41230 <1809 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963527.1:DNA-binding response regulator >Feature sequence300 1661 123 gene locus_tag LOCUS_41240 1661 123 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence301 >Feature sequence302 >Feature sequence303 >Feature sequence304 >Feature sequence305 >Feature sequence306 1068 175 gene locus_tag LOCUS_41250 gene gldN 1068 175 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_41250 >Feature sequence307 4 1284 gene locus_tag LOCUS_41260 gene fumC 4 1284 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_41260 >Feature sequence308 >Feature sequence309 1058 258 gene locus_tag LOCUS_41270 1058 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence310 212 1453 gene locus_tag LOCUS_41280 212 1453 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_41280 >Feature sequence311 >Feature sequence312 244 996 gene locus_tag LOCUS_41290 244 996 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108713.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence313 1290 4 gene locus_tag LOCUS_41300 1290 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 >Feature sequence314 >Feature sequence315 104 1417 gene locus_tag LOCUS_41310 104 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence316 >Feature sequence317 <1561 492 gene locus_tag LOCUS_41320 <1561 492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111339.1:L-serine dehydratase >Feature sequence318 357 1460 gene locus_tag LOCUS_41330 357 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence319 <1 627 gene locus_tag LOCUS_41340 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203531.1:GntR family transcriptional regulator >Feature sequence320 <1510 838 gene locus_tag LOCUS_41350 <1510 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759703.1:membrane protein >Feature sequence321 <1 750 gene locus_tag LOCUS_41360 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256905.1:molybdopterin oxidoreductase