>Feature sequence001 207 1640 gene locus_tag LOCUS_00010 207 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2278 1637 gene locus_tag LOCUS_00020 2278 1637 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708516.1 protein_id gnl|my_center|LOCUS_00020 3593 2475 gene locus_tag LOCUS_00030 3593 2475 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 protein_id gnl|my_center|LOCUS_00030 4521 3595 gene locus_tag LOCUS_00040 4521 3595 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_00040 5458 4535 gene locus_tag LOCUS_00050 gene ilvE 5458 4535 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_00050 8376 5482 gene locus_tag LOCUS_00060 gene glnE 8376 5482 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_00060 8452 9603 gene locus_tag LOCUS_00070 8452 9603 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_00070 9819 11672 gene locus_tag LOCUS_00080 gene dsbD2 9819 11672 CDS product thiol:disulfide interchange protein DsbD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I104 protein_id gnl|my_center|LOCUS_00080 11669 12196 gene locus_tag LOCUS_00090 11669 12196 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_00090 12356 12805 gene locus_tag LOCUS_00100 gene aroQ1 12356 12805 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_00100 12829 13266 gene locus_tag LOCUS_00110 gene accB 12829 13266 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 protein_id gnl|my_center|LOCUS_00110 13276 14619 gene locus_tag LOCUS_00120 gene accC 13276 14619 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_00120 14616 15518 gene locus_tag LOCUS_00130 gene prmA 14616 15518 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_00130 15534 16337 gene locus_tag LOCUS_00140 15534 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16595 17578 gene locus_tag LOCUS_00150 gene dusB 16595 17578 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E262 protein_id gnl|my_center|LOCUS_00150 17578 17880 gene locus_tag LOCUS_00160 17578 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17925 19484 gene locus_tag LOCUS_00170 gene purH 17925 19484 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFA6 protein_id gnl|my_center|LOCUS_00170 19661 20977 gene locus_tag LOCUS_00180 gene purD 19661 20977 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_00180 21428 20985 gene locus_tag LOCUS_00190 21428 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23028 21529 gene locus_tag LOCUS_00200 23028 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 25793 23025 gene locus_tag LOCUS_00210 25793 23025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 <1 1540 gene locus_tag LOCUS_00220 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83IW7:DNA helicase 2282 1740 gene locus_tag LOCUS_00230 2282 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2503 3312 gene locus_tag LOCUS_00240 gene norQ 2503 3312 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_00240 3313 5505 gene locus_tag LOCUS_00250 3313 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 5602 5678 gene locus_tag LOCUS_t00010 5602 5678 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5731 6030 gene locus_tag LOCUS_00260 5731 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 6592 6125 gene locus_tag LOCUS_00270 6592 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 7451 8167 gene locus_tag LOCUS_00280 7451 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8814 8311 gene locus_tag LOCUS_00290 8814 8311 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_00290 10126 8834 gene locus_tag LOCUS_00300 10126 8834 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_00300 10692 12086 gene locus_tag LOCUS_00310 gene eutB 10692 12086 CDS product ethanolamine ammonia-lyase heavy chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_00310 12098 12865 gene locus_tag LOCUS_00320 gene eutC 12098 12865 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX02 protein_id gnl|my_center|LOCUS_00320 12935 14488 gene locus_tag LOCUS_00330 12935 14488 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529187.1 protein_id gnl|my_center|LOCUS_00330 14509 15915 gene locus_tag LOCUS_00340 14509 15915 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706587.1 protein_id gnl|my_center|LOCUS_00340 16126 16311 gene locus_tag LOCUS_00350 16126 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00350 16603 17691 gene locus_tag LOCUS_00360 16603 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038986.1 protein_id gnl|my_center|LOCUS_00360 17753 18523 gene locus_tag LOCUS_00370 17753 18523 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_00370 19023 19454 gene locus_tag LOCUS_00380 19023 19454 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027434.1 protein_id gnl|my_center|LOCUS_00380 19564 19770 gene locus_tag LOCUS_00390 19564 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 20616 21866 gene locus_tag LOCUS_00400 20616 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence003 102 950 gene locus_tag LOCUS_00410 102 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 2124 1012 gene locus_tag LOCUS_00420 2124 1012 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_00420 2575 4458 gene locus_tag LOCUS_00430 2575 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 6142 4523 gene locus_tag LOCUS_00440 6142 4523 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_00440 6377 7900 gene locus_tag LOCUS_00450 6377 7900 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_00450 9412 7925 gene locus_tag LOCUS_00460 9412 7925 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_00460 9652 10056 gene locus_tag LOCUS_00470 9652 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 10046 10864 gene locus_tag LOCUS_00480 10046 10864 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389028.1 protein_id gnl|my_center|LOCUS_00480 13537 11252 gene locus_tag LOCUS_00490 13537 11252 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 protein_id gnl|my_center|LOCUS_00490 15666 13549 gene locus_tag LOCUS_00500 15666 13549 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_00500 16666 15677 gene locus_tag LOCUS_00510 gene ala 16666 15677 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence004 1290 958 gene locus_tag LOCUS_00520 gene yajC 1290 958 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_00520 2465 1350 gene locus_tag LOCUS_00530 gene tgt 2465 1350 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_00530 3561 2518 gene locus_tag LOCUS_00540 gene queA 3561 2518 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH8 protein_id gnl|my_center|LOCUS_00540 3645 3729 gene locus_tag LOCUS_t00020 3645 3729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4007 3789 gene locus_tag LOCUS_00550 4007 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4617 4294 gene locus_tag LOCUS_00560 4617 4294 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 protein_id gnl|my_center|LOCUS_00560 5399 5620 gene locus_tag LOCUS_00570 5399 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 6462 6190 gene locus_tag LOCUS_00580 6462 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 7467 6577 gene locus_tag LOCUS_00590 gene saxA 7467 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103734.1 protein_id gnl|my_center|LOCUS_00590 7860 8285 gene locus_tag LOCUS_00600 7860 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8322 8747 gene locus_tag LOCUS_00610 8322 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10708 8864 gene locus_tag LOCUS_00620 10708 8864 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_00620 11351 10944 gene locus_tag LOCUS_00630 gene vapC 11351 10944 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 protein_id gnl|my_center|LOCUS_00630 11581 11351 gene locus_tag LOCUS_00640 gene vapB1 11581 11351 CDS product antitoxin VapB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57534 protein_id gnl|my_center|LOCUS_00640 12031 11684 gene locus_tag LOCUS_00650 12031 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 12411 12106 gene locus_tag LOCUS_00660 12411 12106 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142739.1 protein_id gnl|my_center|LOCUS_00660 13847 12408 gene locus_tag LOCUS_00670 13847 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 15004 13844 gene locus_tag LOCUS_00680 15004 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 16454 15012 gene locus_tag LOCUS_00690 16454 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065354.1 protein_id gnl|my_center|LOCUS_00690 >Feature sequence005 301 2019 gene locus_tag LOCUS_00700 gene ggt 301 2019 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089891.1 protein_id gnl|my_center|LOCUS_00700 2567 4003 gene locus_tag LOCUS_00710 2567 4003 CDS product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_00710 4000 5304 gene locus_tag LOCUS_00720 4000 5304 CDS product exported copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538040.1 protein_id gnl|my_center|LOCUS_00720 5712 5461 gene locus_tag LOCUS_00730 5712 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5629 7980 gene locus_tag LOCUS_00740 5629 7980 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085961.1 protein_id gnl|my_center|LOCUS_00740 8124 9137 gene locus_tag LOCUS_00750 8124 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063668.1 protein_id gnl|my_center|LOCUS_00750 9137 9748 gene locus_tag LOCUS_00760 9137 9748 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_00760 10050 9745 gene locus_tag LOCUS_00770 10050 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10130 11962 gene locus_tag LOCUS_00780 10130 11962 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_00780 12023 12694 gene locus_tag LOCUS_00790 12023 12694 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_00790 12903 13211 gene locus_tag LOCUS_00800 12903 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532516.1 protein_id gnl|my_center|LOCUS_00800 13222 13617 gene locus_tag LOCUS_00810 13222 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532899.1 protein_id gnl|my_center|LOCUS_00810 13643 13813 gene locus_tag LOCUS_00820 13643 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 13810 15192 gene locus_tag LOCUS_00830 13810 15192 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067500.1 protein_id gnl|my_center|LOCUS_00830 15208 15888 gene locus_tag LOCUS_00840 15208 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 15879 16196 gene locus_tag LOCUS_00850 15879 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532903.1 protein_id gnl|my_center|LOCUS_00850 >Feature sequence006 <1 890 gene locus_tag LOCUS_00860 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389794.1:aspartate aminotransferase family protein 1103 1795 gene locus_tag LOCUS_00870 1103 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204507.1 protein_id gnl|my_center|LOCUS_00870 1845 2420 gene locus_tag LOCUS_00880 1845 2420 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731337.1 protein_id gnl|my_center|LOCUS_00880 2417 2701 gene locus_tag LOCUS_00890 2417 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3809 2769 gene locus_tag LOCUS_00900 3809 2769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_00900 4532 5056 gene locus_tag LOCUS_00910 4532 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 protein_id gnl|my_center|LOCUS_00910 5095 5454 gene locus_tag LOCUS_00920 5095 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 5471 5974 gene locus_tag LOCUS_00930 5471 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6327 7490 gene locus_tag LOCUS_00940 gene yqiG 6327 7490 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_00940 7779 7480 gene locus_tag LOCUS_00950 7779 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 8012 9007 gene locus_tag LOCUS_00960 8012 9007 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225353.1 protein_id gnl|my_center|LOCUS_00960 10162 9530 gene locus_tag LOCUS_00970 10162 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 10869 12077 gene locus_tag LOCUS_00980 10869 12077 CDS product salicylate 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088821.1 protein_id gnl|my_center|LOCUS_00980 12786 14429 gene locus_tag LOCUS_00990 12786 14429 CDS product steroid monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228901.1 protein_id gnl|my_center|LOCUS_00990 <16828 14701 gene locus_tag LOCUS_01000 <16828 14701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704962.1:methyl-accepting chemotaxis protein >Feature sequence007 125 1114 gene locus_tag LOCUS_01010 gene pstS 125 1114 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_01010 1160 3457 gene locus_tag LOCUS_01020 1160 3457 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_01020 3444 5105 gene locus_tag LOCUS_01030 gene pstA 3444 5105 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_01030 5092 5976 gene locus_tag LOCUS_01040 gene pstB2 5092 5976 CDS product phosphate import ATP-binding protein PstB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA7 protein_id gnl|my_center|LOCUS_01040 6014 6742 gene locus_tag LOCUS_01050 gene phoU 6014 6742 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_01050 8079 6739 gene locus_tag LOCUS_01060 gene phoR 8079 6739 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245011.1 protein_id gnl|my_center|LOCUS_01060 8850 8158 gene locus_tag LOCUS_01070 gene phoB 8850 8158 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_01070 9102 9377 gene locus_tag LOCUS_01080 gene comEA 9102 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005913333.1 protein_id gnl|my_center|LOCUS_01080 9539 12154 gene locus_tag LOCUS_01090 gene leuS 9539 12154 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN90 protein_id gnl|my_center|LOCUS_01090 12154 12690 gene locus_tag LOCUS_01100 12154 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 12680 13717 gene locus_tag LOCUS_01110 gene holA 12680 13717 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_01110 13727 14986 gene locus_tag LOCUS_01120 gene proA 13727 14986 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_01120 14967 15623 gene locus_tag LOCUS_01130 gene nadD 14967 15623 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_01130 15676 16038 gene locus_tag LOCUS_01140 gene rsfS 15676 16038 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_01140 >Feature sequence008 776 1687 gene locus_tag LOCUS_01150 776 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01150 5145 1684 gene locus_tag LOCUS_01160 gene aas 5145 1684 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_01160 7201 5594 gene locus_tag LOCUS_01170 7201 5594 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_01170 7335 7886 gene locus_tag LOCUS_01180 gene ycbK 7335 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418984.1 protein_id gnl|my_center|LOCUS_01180 7899 8564 gene locus_tag LOCUS_01190 7899 8564 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_01190 8714 9985 gene locus_tag LOCUS_01200 8714 9985 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704364.1 protein_id gnl|my_center|LOCUS_01200 9991 11403 gene locus_tag LOCUS_01210 9991 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 11482 12357 gene locus_tag LOCUS_01220 11482 12357 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_01220 12397 14007 gene locus_tag LOCUS_01230 12397 14007 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence009 1834 575 gene locus_tag LOCUS_01240 gene lolC 1834 575 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244213.1 protein_id gnl|my_center|LOCUS_01240 2419 1889 gene locus_tag LOCUS_01250 gene btuE 2419 1889 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI2 protein_id gnl|my_center|LOCUS_01250 2551 3183 gene locus_tag LOCUS_01260 gene msrA 2551 3183 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_01260 4424 3255 gene locus_tag LOCUS_01270 gene rosB 4424 3255 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957591.1 protein_id gnl|my_center|LOCUS_01270 5187 4684 gene locus_tag LOCUS_01280 5187 4684 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_01280 5954 5226 gene locus_tag LOCUS_01290 5954 5226 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887207.1 protein_id gnl|my_center|LOCUS_01290 7632 6007 gene locus_tag LOCUS_01300 7632 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 7742 8071 gene locus_tag LOCUS_01310 gene qacF 7742 8071 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_01310 8139 9140 gene locus_tag LOCUS_01320 8139 9140 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R742 protein_id gnl|my_center|LOCUS_01320 9162 10016 gene locus_tag LOCUS_01330 9162 10016 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_01330 10018 10407 gene locus_tag LOCUS_01340 10018 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 10484 10930 gene locus_tag LOCUS_01350 10484 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 10949 13363 gene locus_tag LOCUS_01360 10949 13363 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_01360 13360 13800 gene locus_tag LOCUS_01370 13360 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 13797 14585 gene locus_tag LOCUS_01380 13797 14585 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086727.1 protein_id gnl|my_center|LOCUS_01380 14622 15560 gene locus_tag LOCUS_01390 14622 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence010 363 959 gene locus_tag LOCUS_01400 363 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_01400 1753 962 gene locus_tag LOCUS_01410 1753 962 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 protein_id gnl|my_center|LOCUS_01410 1836 2486 gene locus_tag LOCUS_01420 gene pyrE 1836 2486 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD7 protein_id gnl|my_center|LOCUS_01420 2581 3207 gene locus_tag LOCUS_01430 2581 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3823 3200 gene locus_tag LOCUS_01440 gene slmA 3823 3200 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_01440 4731 3820 gene locus_tag LOCUS_01450 gene argB 4731 3820 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_01450 7168 4748 gene locus_tag LOCUS_01460 7168 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8450 7206 gene locus_tag LOCUS_01470 gene coaBC 8450 7206 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_01470 8515 9189 gene locus_tag LOCUS_01480 8515 9189 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_01480 9270 9506 gene locus_tag LOCUS_01490 gene rpmB 9270 9506 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_01490 9515 9670 gene locus_tag LOCUS_01500 gene rpmG 9515 9670 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57187 protein_id gnl|my_center|LOCUS_01500 10931 9744 gene locus_tag LOCUS_01510 10931 9744 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_01510 11198 12007 gene locus_tag LOCUS_01520 11198 12007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_01520 12013 12756 gene locus_tag LOCUS_01530 12013 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12746 14071 gene locus_tag LOCUS_01540 12746 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_01540 14064 14882 gene locus_tag LOCUS_01550 gene mutM 14064 14882 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH6 protein_id gnl|my_center|LOCUS_01550 >Feature sequence011 2833 1157 gene locus_tag LOCUS_01560 gene caiA 2833 1157 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_01560 3107 3877 gene locus_tag LOCUS_01570 3107 3877 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_01570 3874 4839 gene locus_tag LOCUS_01580 3874 4839 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_01580 4884 5567 gene locus_tag LOCUS_01590 gene cofC 4884 5567 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZM4 protein_id gnl|my_center|LOCUS_01590 5599 8046 gene locus_tag LOCUS_01600 gene fbiC 5599 8046 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228669.1 protein_id gnl|my_center|LOCUS_01600 8088 9299 gene locus_tag LOCUS_01610 8088 9299 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_01610 9460 10557 gene locus_tag LOCUS_01620 9460 10557 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_01620 10627 11961 gene locus_tag LOCUS_01630 10627 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 12007 13335 gene locus_tag LOCUS_01640 12007 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13429 14445 gene locus_tag LOCUS_01650 13429 14445 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence012 <1 2685 gene locus_tag LOCUS_01660 <1 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887262.1:metalloprotease 2699 3163 gene locus_tag LOCUS_01670 2699 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 4548 3142 gene locus_tag LOCUS_01680 4548 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4639 5730 gene locus_tag LOCUS_01690 4639 5730 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143926.1 protein_id gnl|my_center|LOCUS_01690 5800 6732 gene locus_tag LOCUS_01700 5800 6732 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_01700 6729 7178 gene locus_tag LOCUS_01710 6729 7178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_01710 7261 8022 gene locus_tag LOCUS_01720 7261 8022 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_01720 8115 9110 gene locus_tag LOCUS_01730 8115 9110 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_01730 9239 11248 gene locus_tag LOCUS_01740 gene deaD 9239 11248 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_01740 12622 11300 gene locus_tag LOCUS_01750 gene fadE1 12622 11300 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400917.1 protein_id gnl|my_center|LOCUS_01750 12984 12643 gene locus_tag LOCUS_01760 12984 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 13279 13986 gene locus_tag LOCUS_01770 13279 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence013 161 730 gene locus_tag LOCUS_01780 161 730 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813755.1 protein_id gnl|my_center|LOCUS_01780 959 1681 gene locus_tag LOCUS_01790 959 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1986 3200 gene locus_tag LOCUS_01800 1986 3200 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039911.1 protein_id gnl|my_center|LOCUS_01800 4674 3358 gene locus_tag LOCUS_01810 4674 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 5533 5327 gene locus_tag LOCUS_01820 5533 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01820 6717 5530 gene locus_tag LOCUS_01830 6717 5530 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_01830 6823 7791 gene locus_tag LOCUS_01840 6823 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 9409 8063 gene locus_tag LOCUS_01850 gene pcaB 9409 8063 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31385 protein_id gnl|my_center|LOCUS_01850 10647 9436 gene locus_tag LOCUS_01860 10647 9436 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969829.1 protein_id gnl|my_center|LOCUS_01860 11167 10640 gene locus_tag LOCUS_01870 gene pcaG 11167 10640 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_01870 11771 11169 gene locus_tag LOCUS_01880 gene pcaH 11771 11169 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083749.1 protein_id gnl|my_center|LOCUS_01880 12535 11867 gene locus_tag LOCUS_01890 12535 11867 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_01890 13200 12532 gene locus_tag LOCUS_01900 gene catI 13200 12532 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence014 1488 604 gene locus_tag LOCUS_01910 gene pyrK 1488 604 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL9 protein_id gnl|my_center|LOCUS_01910 2771 1485 gene locus_tag LOCUS_01920 gene pyrC 2771 1485 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V98 protein_id gnl|my_center|LOCUS_01920 3747 2773 gene locus_tag LOCUS_01930 gene pyrB 3747 2773 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59653 protein_id gnl|my_center|LOCUS_01930 4351 3827 gene locus_tag LOCUS_01940 gene pyrR 4351 3827 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 protein_id gnl|my_center|LOCUS_01940 4773 4348 gene locus_tag LOCUS_01950 4773 4348 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_01950 5327 4770 gene locus_tag LOCUS_01960 gene yqgE 5327 4770 CDS product UPF0301 protein YqgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3V2 protein_id gnl|my_center|LOCUS_01960 6353 5379 gene locus_tag LOCUS_01970 gene tonB 6353 5379 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_01970 7306 6371 gene locus_tag LOCUS_01980 gene gshB 7306 6371 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EKZ8 protein_id gnl|my_center|LOCUS_01980 7432 8370 gene locus_tag LOCUS_01990 gene hemC 7432 8370 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_01990 8380 9186 gene locus_tag LOCUS_02000 gene hemD 8380 9186 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889975.1 protein_id gnl|my_center|LOCUS_02000 9257 10198 gene locus_tag LOCUS_02010 9257 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 10195 11433 gene locus_tag LOCUS_02020 10195 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_02020 12311 11430 gene locus_tag LOCUS_02030 12311 11430 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRP1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence015 286 891 gene locus_tag LOCUS_02040 286 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_02040 968 1750 gene locus_tag LOCUS_02050 gene fabG 968 1750 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_02050 1743 2291 gene locus_tag LOCUS_02060 1743 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 2603 3484 gene locus_tag LOCUS_02070 2603 3484 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_02070 4437 3505 gene locus_tag LOCUS_02080 4437 3505 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036057.1 protein_id gnl|my_center|LOCUS_02080 4669 7074 gene locus_tag LOCUS_02090 4669 7074 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_02090 8217 7147 gene locus_tag LOCUS_02100 8217 7147 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400502.1 protein_id gnl|my_center|LOCUS_02100 9110 8265 gene locus_tag LOCUS_02110 9110 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_02110 9291 10397 gene locus_tag LOCUS_02120 9291 10397 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_02120 10394 10579 gene locus_tag LOCUS_02130 10394 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence016 <1 813 gene locus_tag LOCUS_02140 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920187.1:acyl-CoA dehydrogenase 1086 1475 gene locus_tag LOCUS_02150 1086 1475 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975038.1 protein_id gnl|my_center|LOCUS_02150 1591 2055 gene locus_tag LOCUS_02160 1591 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6410 2103 gene locus_tag LOCUS_02170 6410 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7466 6477 gene locus_tag LOCUS_02180 7466 6477 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_02180 7684 8775 gene locus_tag LOCUS_02190 7684 8775 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_02190 8818 9897 gene locus_tag LOCUS_02200 8818 9897 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_02200 10041 11120 gene locus_tag LOCUS_02210 10041 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11400 12401 gene locus_tag LOCUS_02220 11400 12401 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808221.1 protein_id gnl|my_center|LOCUS_02220 <13605 12535 gene locus_tag LOCUS_02230 <13605 12535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919684.1:cyclohexanone monooxygenase >Feature sequence017 438 1847 gene locus_tag LOCUS_02240 gene glnA 438 1847 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUD3 protein_id gnl|my_center|LOCUS_02240 1949 2488 gene locus_tag LOCUS_02250 1949 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2678 3745 gene locus_tag LOCUS_02260 gene ntrB 2678 3745 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_02260 3742 5166 gene locus_tag LOCUS_02270 gene ntrC 3742 5166 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_02270 6502 5258 gene locus_tag LOCUS_02280 6502 5258 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977776.1 protein_id gnl|my_center|LOCUS_02280 7079 8221 gene locus_tag LOCUS_02290 7079 8221 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_02290 9499 8489 gene locus_tag LOCUS_02300 gene hemB 9499 8489 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q41 protein_id gnl|my_center|LOCUS_02300 10188 9517 gene locus_tag LOCUS_02310 gene lptA 10188 9517 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_02310 10782 10252 gene locus_tag LOCUS_02320 gene gmhB 10782 10252 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_02320 12866 10791 gene locus_tag LOCUS_02330 gene glyS 12866 10791 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEJ9 protein_id gnl|my_center|LOCUS_02330 <13435 12863 gene locus_tag LOCUS_02340 <13435 12863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFD4:glycine--tRNA ligase alpha subunit >Feature sequence018 948 133 gene locus_tag LOCUS_02350 948 133 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267692.1 protein_id gnl|my_center|LOCUS_02350 1460 945 gene locus_tag LOCUS_02360 gene np20 1460 945 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_02360 1592 2383 gene locus_tag LOCUS_02370 1592 2383 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_02370 2476 3669 gene locus_tag LOCUS_02380 2476 3669 CDS product amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_02380 5053 3632 gene locus_tag LOCUS_02390 5053 3632 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_02390 5607 5044 gene locus_tag LOCUS_02400 5607 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_02400 5687 6544 gene locus_tag LOCUS_02410 gene aguB 5687 6544 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_02410 6653 7033 gene locus_tag LOCUS_02420 6653 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7030 8289 gene locus_tag LOCUS_02430 7030 8289 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726824.1 protein_id gnl|my_center|LOCUS_02430 8286 9560 gene locus_tag LOCUS_02440 8286 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02440 9514 10368 gene locus_tag LOCUS_02450 9514 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02450 11905 10541 gene locus_tag LOCUS_02460 11905 10541 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114138.1 protein_id gnl|my_center|LOCUS_02460 <13393 11975 gene locus_tag LOCUS_02470 <13393 11975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205737.1:aminotransferase >Feature sequence019 1830 304 gene locus_tag LOCUS_02480 1830 304 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945845.1 protein_id gnl|my_center|LOCUS_02480 2377 1841 gene locus_tag LOCUS_02490 2377 1841 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_02490 2637 3590 gene locus_tag LOCUS_02500 2637 3590 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW41 protein_id gnl|my_center|LOCUS_02500 3772 4380 gene locus_tag LOCUS_02510 gene queE 3772 4380 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45097 protein_id gnl|my_center|LOCUS_02510 4516 5604 gene locus_tag LOCUS_02520 4516 5604 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_02520 5912 5643 gene locus_tag LOCUS_02530 5912 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6331 6029 gene locus_tag LOCUS_02540 6331 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6542 8623 gene locus_tag LOCUS_02550 6542 8623 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_02550 8627 10423 gene locus_tag LOCUS_02560 8627 10423 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_02560 11188 10394 gene locus_tag LOCUS_02570 11188 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 11455 12681 gene locus_tag LOCUS_02580 11455 12681 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence020 350 1561 gene locus_tag LOCUS_02590 gene bamB 350 1561 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_02590 1618 3027 gene locus_tag LOCUS_02600 gene der 1618 3027 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX19 protein_id gnl|my_center|LOCUS_02600 3797 3036 gene locus_tag LOCUS_02610 3797 3036 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_02610 5006 3807 gene locus_tag LOCUS_02620 5006 3807 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064176.1 protein_id gnl|my_center|LOCUS_02620 6004 5102 gene locus_tag LOCUS_02630 gene dapA 6004 5102 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_02630 6126 6704 gene locus_tag LOCUS_02640 gene gcvR 6126 6704 CDS product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_02640 6772 8190 gene locus_tag LOCUS_02650 6772 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_02650 8294 9811 gene locus_tag LOCUS_02660 8294 9811 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_02660 9808 10566 gene locus_tag LOCUS_02670 9808 10566 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_02670 10574 11644 gene locus_tag LOCUS_02680 gene queG 10574 11644 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_02680 12664 11927 gene locus_tag LOCUS_02690 12664 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence021 <1 1108 gene locus_tag LOCUS_02700 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083824.1:amidohydrolase 1155 1478 gene locus_tag LOCUS_02710 1155 1478 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_02710 2111 1590 gene locus_tag LOCUS_02720 2111 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4122 2689 gene locus_tag LOCUS_02730 4122 2689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268749.1 protein_id gnl|my_center|LOCUS_02730 4272 5177 gene locus_tag LOCUS_02740 4272 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339638.1 protein_id gnl|my_center|LOCUS_02740 5240 5533 gene locus_tag LOCUS_02750 5240 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339639.1 protein_id gnl|my_center|LOCUS_02750 5530 6513 gene locus_tag LOCUS_02760 5530 6513 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339640.1 protein_id gnl|my_center|LOCUS_02760 6788 6943 gene locus_tag LOCUS_02770 6788 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6940 7212 gene locus_tag LOCUS_02780 6940 7212 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_02780 7634 8314 gene locus_tag LOCUS_02790 7634 8314 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819924.1 protein_id gnl|my_center|LOCUS_02790 8431 9672 gene locus_tag LOCUS_02800 8431 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 10342 9827 gene locus_tag LOCUS_02810 10342 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 12555 10342 gene locus_tag LOCUS_02820 12555 10342 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence022 1305 640 gene locus_tag LOCUS_02830 gene tal 1305 640 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJE8 protein_id gnl|my_center|LOCUS_02830 2965 1319 gene locus_tag LOCUS_02840 2965 1319 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064121.1 protein_id gnl|my_center|LOCUS_02840 3170 3736 gene locus_tag LOCUS_02850 3170 3736 CDS product raiA ribosome-associated inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_02850 4070 4906 gene locus_tag LOCUS_02860 4070 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4951 5394 gene locus_tag LOCUS_02870 4951 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 5876 5391 gene locus_tag LOCUS_02880 5876 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6047 6373 gene locus_tag LOCUS_02890 6047 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8259 6463 gene locus_tag LOCUS_02900 8259 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 8851 8234 gene locus_tag LOCUS_02910 8851 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9125 10645 gene locus_tag LOCUS_02920 9125 10645 CDS product monoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 protein_id gnl|my_center|LOCUS_02920 11479 10697 gene locus_tag LOCUS_02930 gene guaA 11479 10697 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 protein_id gnl|my_center|LOCUS_02930 12284 11517 gene locus_tag LOCUS_02940 12284 11517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808732.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence023 1371 922 gene locus_tag LOCUS_02950 1371 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 2360 1368 gene locus_tag LOCUS_02960 2360 1368 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957810.1 protein_id gnl|my_center|LOCUS_02960 2544 3434 gene locus_tag LOCUS_02970 gene attM 2544 3434 CDS product N-acyl homoserine lactonase AttM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3U0 protein_id gnl|my_center|LOCUS_02970 3456 4214 gene locus_tag LOCUS_02980 3456 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 4211 4912 gene locus_tag LOCUS_02990 4211 4912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_02990 4914 6434 gene locus_tag LOCUS_03000 4914 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_03000 6443 7090 gene locus_tag LOCUS_03010 6443 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 7102 8133 gene locus_tag LOCUS_03020 7102 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 8229 9800 gene locus_tag LOCUS_03030 8229 9800 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089528.1 protein_id gnl|my_center|LOCUS_03030 9887 10786 gene locus_tag LOCUS_03040 9887 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_03040 <12431 10916 gene locus_tag LOCUS_03050 <12431 10916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941764.1:AMP-binding protein >Feature sequence024 1495 671 gene locus_tag LOCUS_03060 1495 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_03060 3682 1607 gene locus_tag LOCUS_03070 gene pbpC 3682 1607 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002102274.1 protein_id gnl|my_center|LOCUS_03070 9624 3769 gene locus_tag LOCUS_03080 9624 3769 CDS product peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015947.1 protein_id gnl|my_center|LOCUS_03080 11542 9830 gene locus_tag LOCUS_03090 gene cysI 11542 9830 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_03090 <12263 11544 gene locus_tag LOCUS_03100 <12263 11544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KNK9:sulfite reductase [NADPH] flavoprotein alpha-component >Feature sequence025 2411 369 gene locus_tag LOCUS_03110 2411 369 CDS product NADH:flavin oxidoreductase / NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064589.1 protein_id gnl|my_center|LOCUS_03110 2608 3567 gene locus_tag LOCUS_03120 2608 3567 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_03120 4583 3564 gene locus_tag LOCUS_03130 4583 3564 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ1 protein_id gnl|my_center|LOCUS_03130 4800 6041 gene locus_tag LOCUS_03140 4800 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6127 6996 gene locus_tag LOCUS_03150 6127 6996 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_03150 6996 7484 gene locus_tag LOCUS_03160 6996 7484 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_03160 7477 9753 gene locus_tag LOCUS_03170 7477 9753 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_03170 9761 10009 gene locus_tag LOCUS_03180 9761 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10697 10083 gene locus_tag LOCUS_03190 gene litR 10697 10083 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262617.1 protein_id gnl|my_center|LOCUS_03190 10885 11910 gene locus_tag LOCUS_03200 10885 11910 CDS product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720017.1 protein_id gnl|my_center|LOCUS_03200 11907 12206 gene locus_tag LOCUS_03210 11907 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence026 <1 984 gene locus_tag LOCUS_03220 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096404.1:alginate biosynthesis protein AlgZ/FimS 965 1693 gene locus_tag LOCUS_03230 gene algR 965 1693 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038604.1 protein_id gnl|my_center|LOCUS_03230 2422 1697 gene locus_tag LOCUS_03240 2422 1697 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 protein_id gnl|my_center|LOCUS_03240 2479 2928 gene locus_tag LOCUS_03250 2479 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262783.1 protein_id gnl|my_center|LOCUS_03250 3338 2925 gene locus_tag LOCUS_03260 gene rsd 3338 2925 CDS product regulator of sigma D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDC2 protein_id gnl|my_center|LOCUS_03260 3631 6093 gene locus_tag LOCUS_03270 3631 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6080 9388 gene locus_tag LOCUS_03280 6080 9388 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_03280 10841 9441 gene locus_tag LOCUS_03290 10841 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 <11905 11000 gene locus_tag LOCUS_03300 <11905 11000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8I6:RNA polymerase-binding transcription factor DksA >Feature sequence027 1147 1683 gene locus_tag LOCUS_03310 1147 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 1683 2270 gene locus_tag LOCUS_03320 1683 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2300 2872 gene locus_tag LOCUS_03330 2300 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 2889 3338 gene locus_tag LOCUS_03340 2889 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4375 3560 gene locus_tag LOCUS_03350 gene paaG 4375 3560 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_03350 4683 6164 gene locus_tag LOCUS_03360 4683 6164 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729200.1 protein_id gnl|my_center|LOCUS_03360 6223 7008 gene locus_tag LOCUS_03370 6223 7008 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085429.1 protein_id gnl|my_center|LOCUS_03370 7167 8129 gene locus_tag LOCUS_03380 7167 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 9048 8167 gene locus_tag LOCUS_03390 9048 8167 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_03390 9546 9199 gene locus_tag LOCUS_03400 9546 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03400 9999 10184 gene locus_tag LOCUS_03410 9999 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10918 10322 gene locus_tag LOCUS_03420 10918 10322 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence028 75 899 gene locus_tag LOCUS_03430 gene folE2 75 899 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_03430 1741 959 gene locus_tag LOCUS_03440 1741 959 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 protein_id gnl|my_center|LOCUS_03440 1857 2492 gene locus_tag LOCUS_03450 1857 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_03450 2771 3067 gene locus_tag LOCUS_03460 2771 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4116 3142 gene locus_tag LOCUS_03470 4116 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_03470 4535 4140 gene locus_tag LOCUS_03480 4535 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5096 4575 gene locus_tag LOCUS_03490 gene moaB 5096 4575 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC70 protein_id gnl|my_center|LOCUS_03490 5168 5554 gene locus_tag LOCUS_03500 gene hslR 5168 5554 CDS product heat-shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_03500 6279 5551 gene locus_tag LOCUS_03510 6279 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10367 6486 gene locus_tag LOCUS_03520 gene hrpA 10367 6486 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706074.1 protein_id gnl|my_center|LOCUS_03520 <11771 10364 gene locus_tag LOCUS_03530 <11771 10364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599478.1:di- and tricarboxylate transporter >Feature sequence029 2816 3589 gene locus_tag LOCUS_03540 2816 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4037 4882 gene locus_tag LOCUS_03550 4037 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4970 5305 gene locus_tag LOCUS_03560 4970 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6456 5317 gene locus_tag LOCUS_03570 6456 5317 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 protein_id gnl|my_center|LOCUS_03570 7932 7504 gene locus_tag LOCUS_03580 7932 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8207 8578 gene locus_tag LOCUS_03590 8207 8578 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_03590 8584 9927 gene locus_tag LOCUS_03600 gene gudP 8584 9927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088610.1 protein_id gnl|my_center|LOCUS_03600 <11491 10033 gene locus_tag LOCUS_03610 <11491 10033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085722.1:cyclohexanone monooxygenase >Feature sequence030 2114 1068 gene locus_tag LOCUS_03620 gene prfB 2114 1068 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK6 protein_id gnl|my_center|LOCUS_03620 4058 2328 gene locus_tag LOCUS_03630 gene recJ 4058 2328 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_03630 5041 4052 gene locus_tag LOCUS_03640 5041 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6209 5073 gene locus_tag LOCUS_03650 gene thrC 6209 5073 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_03650 7525 6206 gene locus_tag LOCUS_03660 7525 6206 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY1 protein_id gnl|my_center|LOCUS_03660 8755 7553 gene locus_tag LOCUS_03670 8755 7553 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813076.1 protein_id gnl|my_center|LOCUS_03670 8859 10310 gene locus_tag LOCUS_03680 8859 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_03680 <11462 10354 gene locus_tag LOCUS_03690 <11462 10354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114372.1:glycolate oxidase >Feature sequence031 <1 957 gene locus_tag LOCUS_03700 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919030.1:dTDP-glucose 4,6-dehydratase 960 1316 gene locus_tag LOCUS_03710 960 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 1758 1333 gene locus_tag LOCUS_03720 1758 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3124 1775 gene locus_tag LOCUS_03730 gene fliI 3124 1775 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767000.1 protein_id gnl|my_center|LOCUS_03730 3776 3114 gene locus_tag LOCUS_03740 3776 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4787 3777 gene locus_tag LOCUS_03750 4787 3777 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT4 protein_id gnl|my_center|LOCUS_03750 6353 4791 gene locus_tag LOCUS_03760 gene fliF 6353 4791 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884X8 protein_id gnl|my_center|LOCUS_03760 6879 6550 gene locus_tag LOCUS_03770 gene fliE 6879 6550 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUN2 protein_id gnl|my_center|LOCUS_03770 8274 6901 gene locus_tag LOCUS_03780 gene flrC 8274 6901 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_03780 9431 8271 gene locus_tag LOCUS_03790 gene fleS 9431 8271 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_03790 11082 9631 gene locus_tag LOCUS_03800 gene fleQ 11082 9631 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946589.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence032 1493 381 gene locus_tag LOCUS_03810 1493 381 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144044.1 protein_id gnl|my_center|LOCUS_03810 2712 1543 gene locus_tag LOCUS_03820 2712 1543 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_03820 2899 4344 gene locus_tag LOCUS_03830 2899 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 4272 4793 gene locus_tag LOCUS_03840 4272 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03840 5996 4812 gene locus_tag LOCUS_03850 5996 4812 CDS product thiamine pyrophosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_03850 6887 6150 gene locus_tag LOCUS_03860 6887 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205421.1 protein_id gnl|my_center|LOCUS_03860 7890 6889 gene locus_tag LOCUS_03870 7890 6889 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_03870 8701 8009 gene locus_tag LOCUS_03880 8701 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 9822 8737 gene locus_tag LOCUS_03890 9822 8737 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_03890 9974 9898 gene locus_tag LOCUS_t00030 9974 9898 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10981 9983 gene locus_tag LOCUS_03900 gene ispB 10981 9983 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence033 784 2682 gene locus_tag LOCUS_03910 gene mnmG 784 2682 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8A9 protein_id gnl|my_center|LOCUS_03910 2716 3369 gene locus_tag LOCUS_03920 gene rsmG 2716 3369 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PJ7 protein_id gnl|my_center|LOCUS_03920 3458 4261 gene locus_tag LOCUS_03930 3458 4261 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_03930 4258 5127 gene locus_tag LOCUS_03940 gene spoOJ 4258 5127 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_03940 5220 5636 gene locus_tag LOCUS_03950 5220 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5687 6505 gene locus_tag LOCUS_03960 gene atpB-1 5687 6505 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFU7 protein_id gnl|my_center|LOCUS_03960 6556 6834 gene locus_tag LOCUS_03970 gene atpE-1 6556 6834 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFX6 protein_id gnl|my_center|LOCUS_03970 6877 7347 gene locus_tag LOCUS_03980 gene atpF 6877 7347 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR9 protein_id gnl|my_center|LOCUS_03980 7363 7902 gene locus_tag LOCUS_03990 gene atpH 7363 7902 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT1 protein_id gnl|my_center|LOCUS_03990 7960 9501 gene locus_tag LOCUS_04000 gene atpA2 7960 9501 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_04000 9521 10381 gene locus_tag LOCUS_04010 gene atpG 9521 10381 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ6 protein_id gnl|my_center|LOCUS_04010 >Feature sequence034 1849 1043 gene locus_tag LOCUS_04020 1849 1043 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_04020 2788 1898 gene locus_tag LOCUS_04030 2788 1898 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_04030 4182 3235 gene locus_tag LOCUS_04040 4182 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 4934 4365 gene locus_tag LOCUS_04050 4934 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5479 5018 gene locus_tag LOCUS_04060 gene rimI 5479 5018 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_04060 6225 5518 gene locus_tag LOCUS_04070 6225 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 7075 6269 gene locus_tag LOCUS_04080 gene pssA 7075 6269 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_04080 8200 7178 gene locus_tag LOCUS_04090 gene ilvC 8200 7178 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP6 protein_id gnl|my_center|LOCUS_04090 8762 8268 gene locus_tag LOCUS_04100 gene ilvH 8762 8268 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_04100 10494 8764 gene locus_tag LOCUS_04110 gene ilvI 10494 8764 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP8 protein_id gnl|my_center|LOCUS_04110 >Feature sequence035 351 584 gene locus_tag LOCUS_04120 351 584 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_04120 581 982 gene locus_tag LOCUS_04130 gene vapC 581 982 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 protein_id gnl|my_center|LOCUS_04130 1601 1179 gene locus_tag LOCUS_04140 gene vapC 1601 1179 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI02 protein_id gnl|my_center|LOCUS_04140 1843 1598 gene locus_tag LOCUS_04150 1843 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3202 2312 gene locus_tag LOCUS_04160 gene xerC 3202 2312 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_04160 3929 3207 gene locus_tag LOCUS_04170 3929 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_04170 4771 3926 gene locus_tag LOCUS_04180 gene dapF 4771 3926 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H5 protein_id gnl|my_center|LOCUS_04180 5867 4827 gene locus_tag LOCUS_04190 gene nagZ 5867 4827 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0Z5 protein_id gnl|my_center|LOCUS_04190 6697 5900 gene locus_tag LOCUS_04200 6697 5900 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020924.1 protein_id gnl|my_center|LOCUS_04200 7614 6694 gene locus_tag LOCUS_04210 7614 6694 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_04210 7772 8266 gene locus_tag LOCUS_04220 7772 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9111 8638 gene locus_tag LOCUS_04230 9111 8638 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_04230 10622 9126 gene locus_tag LOCUS_04240 10622 9126 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence036 18 605 gene locus_tag LOCUS_04250 18 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 982 602 gene locus_tag LOCUS_04260 982 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1647 1351 gene locus_tag LOCUS_04270 1647 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2486 1665 gene locus_tag LOCUS_04280 2486 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3006 4199 gene locus_tag LOCUS_04290 3006 4199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_04290 4295 4690 gene locus_tag LOCUS_04300 4295 4690 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227887.1 protein_id gnl|my_center|LOCUS_04300 4909 5586 gene locus_tag LOCUS_04310 4909 5586 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_04310 5590 6474 gene locus_tag LOCUS_04320 gene prpB 5590 6474 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW1 protein_id gnl|my_center|LOCUS_04320 6517 7671 gene locus_tag LOCUS_04330 gene prpC 6517 7671 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_04330 7691 10285 gene locus_tag LOCUS_04340 7691 10285 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267428.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence037 <1 1908 gene locus_tag LOCUS_04350 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933715.1:hybrid sensor histidine kinase/response regulator 1978 2178 gene locus_tag LOCUS_04360 1978 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2255 2641 gene locus_tag LOCUS_04370 2255 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3457 2807 gene locus_tag LOCUS_04380 3457 2807 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_04380 3674 5092 gene locus_tag LOCUS_04390 3674 5092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763651.1 protein_id gnl|my_center|LOCUS_04390 5089 6474 gene locus_tag LOCUS_04400 5089 6474 CDS product GTPase SAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 protein_id gnl|my_center|LOCUS_04400 8083 6491 gene locus_tag LOCUS_04410 gene opgD 8083 6491 CDS product glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C6 protein_id gnl|my_center|LOCUS_04410 9284 8070 gene locus_tag LOCUS_04420 gene rlmI 9284 8070 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYN3 protein_id gnl|my_center|LOCUS_04420 <10797 9523 gene locus_tag LOCUS_04430 <10797 9523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888160.1:phenylacetate--CoA ligase >Feature sequence038 401 317 gene locus_tag LOCUS_t00040 401 317 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 915 505 gene locus_tag LOCUS_04440 915 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1678 938 gene locus_tag LOCUS_04450 gene tpiA 1678 938 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ3 protein_id gnl|my_center|LOCUS_04450 2899 1757 gene locus_tag LOCUS_04460 2899 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3228 3464 gene locus_tag LOCUS_04470 3228 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4552 3851 gene locus_tag LOCUS_04480 4552 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5389 4556 gene locus_tag LOCUS_04490 5389 4556 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_04490 6597 5386 gene locus_tag LOCUS_04500 gene trpS 6597 5386 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_04500 7261 6644 gene locus_tag LOCUS_04510 7261 6644 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_04510 7905 7273 gene locus_tag LOCUS_04520 7905 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_04520 8166 7924 gene locus_tag LOCUS_04530 8166 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8059 8511 gene locus_tag LOCUS_04540 8059 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8516 8815 gene locus_tag LOCUS_04550 8516 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_04550 8812 9096 gene locus_tag LOCUS_04560 8812 9096 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_04560 9173 9910 gene locus_tag LOCUS_04570 gene dpnIIB 9173 9910 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7D2 protein_id gnl|my_center|LOCUS_04570 >Feature sequence039 <1 1683 gene locus_tag LOCUS_04580 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112499.1:ABC transporter ATP-binding protein/permease 1789 2409 gene locus_tag LOCUS_04590 gene cmoA 1789 2409 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43985 protein_id gnl|my_center|LOCUS_04590 2478 3677 gene locus_tag LOCUS_04600 2478 3677 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_04600 3954 3769 gene locus_tag LOCUS_04610 3954 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5679 4060 gene locus_tag LOCUS_04620 gene alkK 5679 4060 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_04620 6950 5730 gene locus_tag LOCUS_04630 6950 5730 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085640.1 protein_id gnl|my_center|LOCUS_04630 7377 7078 gene locus_tag LOCUS_04640 7377 7078 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898315.1 protein_id gnl|my_center|LOCUS_04640 7478 8362 gene locus_tag LOCUS_04650 7478 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8372 9160 gene locus_tag LOCUS_04660 gene gctB 8372 9160 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_04660 10007 9255 gene locus_tag LOCUS_04670 10007 9255 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM3 protein_id gnl|my_center|LOCUS_04670 <10621 10019 gene locus_tag LOCUS_04680 <10621 10019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919707.1:alpha-methylacyl-CoA racemase >Feature sequence040 406 3027 gene locus_tag LOCUS_04690 gene alaS 406 3027 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UBU3 protein_id gnl|my_center|LOCUS_04690 3053 4273 gene locus_tag LOCUS_04700 3053 4273 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_04700 4363 4716 gene locus_tag LOCUS_04710 4363 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4778 4870 gene locus_tag LOCUS_t00050 4778 4870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5976 5146 gene locus_tag LOCUS_04720 5976 5146 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087704.1 protein_id gnl|my_center|LOCUS_04720 6618 7466 gene locus_tag LOCUS_04730 6618 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 7649 10474 gene locus_tag LOCUS_04740 7649 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176614.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence041 365 763 gene locus_tag LOCUS_04750 365 763 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_04750 1029 1349 gene locus_tag LOCUS_04760 1029 1349 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787472.1 protein_id gnl|my_center|LOCUS_04760 1716 1907 gene locus_tag LOCUS_04770 1716 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2248 2934 gene locus_tag LOCUS_04780 gene fabG 2248 2934 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_04780 3019 3960 gene locus_tag LOCUS_04790 gene argC 3019 3960 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PX8 protein_id gnl|my_center|LOCUS_04790 4677 4018 gene locus_tag LOCUS_04800 4677 4018 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731404.1 protein_id gnl|my_center|LOCUS_04800 5656 4841 gene locus_tag LOCUS_04810 5656 4841 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_04810 6576 5653 gene locus_tag LOCUS_04820 6576 5653 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229099.1 protein_id gnl|my_center|LOCUS_04820 7406 6639 gene locus_tag LOCUS_04830 7406 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 7507 8601 gene locus_tag LOCUS_04840 7507 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 8676 10325 gene locus_tag LOCUS_04850 8676 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence042 1964 2770 gene locus_tag LOCUS_04860 1964 2770 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZW4 protein_id gnl|my_center|LOCUS_04860 2791 4068 gene locus_tag LOCUS_04870 2791 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_04870 4921 4061 gene locus_tag LOCUS_04880 4921 4061 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809822.1 protein_id gnl|my_center|LOCUS_04880 5103 6497 gene locus_tag LOCUS_04890 5103 6497 CDS product MmgE/Prp family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_04890 6509 7333 gene locus_tag LOCUS_04900 6509 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7335 7907 gene locus_tag LOCUS_04910 7335 7907 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ03 protein_id gnl|my_center|LOCUS_04910 7904 8593 gene locus_tag LOCUS_04920 7904 8593 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_04920 8590 9513 gene locus_tag LOCUS_04930 8590 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9542 10102 gene locus_tag LOCUS_04940 9542 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence043 402 827 gene locus_tag LOCUS_04950 402 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 881 2662 gene locus_tag LOCUS_04960 881 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2659 3471 gene locus_tag LOCUS_04970 2659 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3804 4580 gene locus_tag LOCUS_04980 3804 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4582 5316 gene locus_tag LOCUS_04990 4582 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5425 6138 gene locus_tag LOCUS_05000 5425 6138 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_05000 6140 6895 gene locus_tag LOCUS_05010 6140 6895 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387878.1 protein_id gnl|my_center|LOCUS_05010 6959 7654 gene locus_tag LOCUS_05020 6959 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8057 7632 gene locus_tag LOCUS_05030 8057 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_05030 8171 8833 gene locus_tag LOCUS_05040 gene vfr 8171 8833 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_05040 9419 9495 gene locus_tag LOCUS_t00060 9419 9495 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10106 9693 gene locus_tag LOCUS_05050 10106 9693 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence044 1234 902 gene locus_tag LOCUS_05060 1234 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1513 1586 gene locus_tag LOCUS_t00070 1513 1586 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2033 1854 gene locus_tag LOCUS_05070 2033 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2640 2017 gene locus_tag LOCUS_05080 2640 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4379 2640 gene locus_tag LOCUS_05090 gene argS 4379 2640 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A98 protein_id gnl|my_center|LOCUS_05090 6897 4693 gene locus_tag LOCUS_05100 gene priA 6897 4693 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CL19 protein_id gnl|my_center|LOCUS_05100 7592 6897 gene locus_tag LOCUS_05110 7592 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 10056 7624 gene locus_tag LOCUS_05120 gene mrcA 10056 7624 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_05120 >Feature sequence045 475 1071 gene locus_tag LOCUS_05130 475 1071 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 protein_id gnl|my_center|LOCUS_05130 1068 2234 gene locus_tag LOCUS_05140 1068 2234 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_05140 2296 3966 gene locus_tag LOCUS_05150 2296 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3966 4646 gene locus_tag LOCUS_05160 3966 4646 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_05160 5474 4659 gene locus_tag LOCUS_05170 5474 4659 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_05170 5757 5506 gene locus_tag LOCUS_05180 5757 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6066 6908 gene locus_tag LOCUS_05190 6066 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 6901 7653 gene locus_tag LOCUS_05200 6901 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence046 163 1419 gene locus_tag LOCUS_05210 163 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1459 2565 gene locus_tag LOCUS_05220 1459 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2667 3098 gene locus_tag LOCUS_05230 2667 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5316 3658 gene locus_tag LOCUS_05240 gene groL 5316 3658 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 protein_id gnl|my_center|LOCUS_05240 5651 5364 gene locus_tag LOCUS_05250 gene groS 5651 5364 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19422 protein_id gnl|my_center|LOCUS_05250 5790 6356 gene locus_tag LOCUS_05260 5790 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6454 7101 gene locus_tag LOCUS_05270 gene crp 6454 7101 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACK0 protein_id gnl|my_center|LOCUS_05270 7312 9114 gene locus_tag LOCUS_05280 7312 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9218 9838 gene locus_tag LOCUS_05290 9218 9838 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706359.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence047 2151 1846 gene locus_tag LOCUS_05300 gene nuoK 2151 1846 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VM3 protein_id gnl|my_center|LOCUS_05300 2753 2148 gene locus_tag LOCUS_05310 gene nuoJ 2753 2148 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769059.1 protein_id gnl|my_center|LOCUS_05310 3267 2779 gene locus_tag LOCUS_05320 gene nuoI 3267 2779 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA21 protein_id gnl|my_center|LOCUS_05320 4372 3284 gene locus_tag LOCUS_05330 gene nuoH 4372 3284 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU5 protein_id gnl|my_center|LOCUS_05330 6741 4369 gene locus_tag LOCUS_05340 gene nuoG 6741 4369 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU4 protein_id gnl|my_center|LOCUS_05340 8057 6756 gene locus_tag LOCUS_05350 gene nuoF 8057 6756 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948473.1 protein_id gnl|my_center|LOCUS_05350 8548 8054 gene locus_tag LOCUS_05360 gene nuoE 8548 8054 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_05360 9821 8568 gene locus_tag LOCUS_05370 gene nuoD 9821 8568 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZQ2 protein_id gnl|my_center|LOCUS_05370 >Feature sequence048 245 598 gene locus_tag LOCUS_05380 245 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2377 647 gene locus_tag LOCUS_05390 2377 647 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_05390 2966 2388 gene locus_tag LOCUS_05400 2966 2388 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229024.1 protein_id gnl|my_center|LOCUS_05400 3440 2967 gene locus_tag LOCUS_05410 3440 2967 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808064.1 protein_id gnl|my_center|LOCUS_05410 4211 3516 gene locus_tag LOCUS_05420 4211 3516 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_05420 5273 4260 gene locus_tag LOCUS_05430 5273 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53218 protein_id gnl|my_center|LOCUS_05430 6252 5413 gene locus_tag LOCUS_05440 6252 5413 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731381.1 protein_id gnl|my_center|LOCUS_05440 7669 6236 gene locus_tag LOCUS_05450 7669 6236 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_05450 7860 9410 gene locus_tag LOCUS_05460 7860 9410 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_05460 9605 9934 gene locus_tag LOCUS_05470 9605 9934 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI43 protein_id gnl|my_center|LOCUS_05470 >Feature sequence049 1606 401 gene locus_tag LOCUS_05480 gene ftsZ 1606 401 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPW8 protein_id gnl|my_center|LOCUS_05480 2975 1740 gene locus_tag LOCUS_05490 gene ftsA 2975 1740 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47203 protein_id gnl|my_center|LOCUS_05490 3786 3007 gene locus_tag LOCUS_05500 gene ftsQ 3786 3007 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ7 protein_id gnl|my_center|LOCUS_05500 4733 3783 gene locus_tag LOCUS_05510 gene ddlB 4733 3783 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_05510 5680 4730 gene locus_tag LOCUS_05520 gene murB 5680 4730 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_05520 7122 5713 gene locus_tag LOCUS_05530 gene murC 7122 5713 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P8 protein_id gnl|my_center|LOCUS_05530 8188 7115 gene locus_tag LOCUS_05540 gene murG 8188 7115 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_05540 9329 8181 gene locus_tag LOCUS_05550 gene ftsW 9329 8181 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCY0 protein_id gnl|my_center|LOCUS_05550 <10119 9413 gene locus_tag LOCUS_05560 <10119 9413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVZ9:UDP-N-acetylmuramoylalanine--D-glutamate ligase >Feature sequence050 104 691 gene locus_tag LOCUS_05570 104 691 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUU7 protein_id gnl|my_center|LOCUS_05570 1395 709 gene locus_tag LOCUS_05580 1395 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2486 1407 gene locus_tag LOCUS_05590 2486 1407 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_05590 3908 2622 gene locus_tag LOCUS_05600 3908 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3879 4961 gene locus_tag LOCUS_05610 3879 4961 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_05610 6180 5050 gene locus_tag LOCUS_05620 6180 5050 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 protein_id gnl|my_center|LOCUS_05620 8397 6352 gene locus_tag LOCUS_05630 gene hppA 8397 6352 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 protein_id gnl|my_center|LOCUS_05630 9842 8571 gene locus_tag LOCUS_05640 gene pfp 9842 8571 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_05640 >Feature sequence051 1723 185 gene locus_tag LOCUS_05650 gene wcbQ 1723 185 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811237.1 protein_id gnl|my_center|LOCUS_05650 2656 1883 gene locus_tag LOCUS_05660 gene wcbP 2656 1883 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811236.1 protein_id gnl|my_center|LOCUS_05660 3906 2653 gene locus_tag LOCUS_05670 gene wcbO 3906 2653 CDS product capsular polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063856.1 protein_id gnl|my_center|LOCUS_05670 6095 3903 gene locus_tag LOCUS_05680 6095 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7320 6178 gene locus_tag LOCUS_05690 7320 6178 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194378.1 protein_id gnl|my_center|LOCUS_05690 7628 8872 gene locus_tag LOCUS_05700 7628 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 <10066 8889 gene locus_tag LOCUS_05710 <10066 8889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037492.1:FAD-dependent oxidoreductase >Feature sequence052 <1 1122 gene locus_tag LOCUS_05720 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113855.1:resistance-nodulation-cell division efflux membrane fusion protein 1132 4224 gene locus_tag LOCUS_05730 1132 4224 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_05730 4232 5032 gene locus_tag LOCUS_05740 4232 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5073 5915 gene locus_tag LOCUS_05750 5073 5915 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 protein_id gnl|my_center|LOCUS_05750 5964 6200 gene locus_tag LOCUS_05760 5964 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6223 6726 gene locus_tag LOCUS_05770 6223 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6828 7910 gene locus_tag LOCUS_05780 6828 7910 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_05780 8488 7904 gene locus_tag LOCUS_05790 8488 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9088 8510 gene locus_tag LOCUS_05800 9088 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 9279 9866 gene locus_tag LOCUS_05810 9279 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence053 1818 718 gene locus_tag LOCUS_05820 1818 718 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225667.1 protein_id gnl|my_center|LOCUS_05820 3055 1847 gene locus_tag LOCUS_05830 3055 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3444 3052 gene locus_tag LOCUS_05840 3444 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3717 4436 gene locus_tag LOCUS_05850 3717 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4494 5144 gene locus_tag LOCUS_05860 4494 5144 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_05860 5929 5168 gene locus_tag LOCUS_05870 5929 5168 CDS product enoyl CoA dehydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_05870 6441 6028 gene locus_tag LOCUS_05880 6441 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7597 6446 gene locus_tag LOCUS_05890 7597 6446 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_05890 8934 7768 gene locus_tag LOCUS_05900 8934 7768 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence054 1092 1343 gene locus_tag LOCUS_05910 1092 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_05910 1351 2190 gene locus_tag LOCUS_05920 1351 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2187 3050 gene locus_tag LOCUS_05930 2187 3050 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_05930 3083 4315 gene locus_tag LOCUS_05940 3083 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403758.1 protein_id gnl|my_center|LOCUS_05940 6137 4341 gene locus_tag LOCUS_05950 6137 4341 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194643.1 protein_id gnl|my_center|LOCUS_05950 7740 6319 gene locus_tag LOCUS_05960 7740 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8498 7737 gene locus_tag LOCUS_05970 8498 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9502 8495 gene locus_tag LOCUS_05980 gene galE 9502 8495 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence055 1756 578 gene locus_tag LOCUS_05990 1756 578 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_05990 3166 1955 gene locus_tag LOCUS_06000 3166 1955 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265979.1 protein_id gnl|my_center|LOCUS_06000 3577 3248 gene locus_tag LOCUS_06010 3577 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4034 3624 gene locus_tag LOCUS_06020 4034 3624 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259266.1 protein_id gnl|my_center|LOCUS_06020 4116 5237 gene locus_tag LOCUS_06030 4116 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6118 5234 gene locus_tag LOCUS_06040 gene ubiA 6118 5234 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F93 protein_id gnl|my_center|LOCUS_06040 8204 6099 gene locus_tag LOCUS_06050 gene recG 8204 6099 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ6 protein_id gnl|my_center|LOCUS_06050 8611 8219 gene locus_tag LOCUS_06060 8611 8219 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367486.1 protein_id gnl|my_center|LOCUS_06060 9558 8761 gene locus_tag LOCUS_06070 9558 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348532.1 protein_id gnl|my_center|LOCUS_06070 9850 9566 gene locus_tag LOCUS_06080 9850 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence056 <1 1081 gene locus_tag LOCUS_06090 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000953509.1:hemolysin 1194 4643 gene locus_tag LOCUS_06100 1194 4643 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVC3 protein_id gnl|my_center|LOCUS_06100 5901 4654 gene locus_tag LOCUS_06110 5901 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6590 5946 gene locus_tag LOCUS_06120 6590 5946 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_06120 6767 7297 gene locus_tag LOCUS_06130 6767 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 protein_id gnl|my_center|LOCUS_06130 7324 7791 gene locus_tag LOCUS_06140 7324 7791 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_06140 8777 7818 gene locus_tag LOCUS_06150 8777 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence057 908 222 gene locus_tag LOCUS_06160 gene rplY 908 222 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC62 protein_id gnl|my_center|LOCUS_06160 1945 980 gene locus_tag LOCUS_06170 gene prs 1945 980 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUH1 protein_id gnl|my_center|LOCUS_06170 2038 1964 gene locus_tag LOCUS_t00080 2038 1964 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2908 2054 gene locus_tag LOCUS_06180 gene ispE 2908 2054 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKS0 protein_id gnl|my_center|LOCUS_06180 3513 2905 gene locus_tag LOCUS_06190 gene lolB 3513 2905 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C4 protein_id gnl|my_center|LOCUS_06190 5300 3513 gene locus_tag LOCUS_06200 5300 3513 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_06200 5422 6696 gene locus_tag LOCUS_06210 gene hemA 5422 6696 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_06210 6693 7781 gene locus_tag LOCUS_06220 gene prfA 6693 7781 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_06220 7774 8634 gene locus_tag LOCUS_06230 gene prmC 7774 8634 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_06230 8671 9426 gene locus_tag LOCUS_06240 8671 9426 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266735.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence058 1104 715 gene locus_tag LOCUS_06250 1104 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1774 1094 gene locus_tag LOCUS_06260 1774 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2408 1785 gene locus_tag LOCUS_06270 2408 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3592 2405 gene locus_tag LOCUS_06280 3592 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4718 3720 gene locus_tag LOCUS_06290 gene gpsA 4718 3720 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDY0 protein_id gnl|my_center|LOCUS_06290 5219 4734 gene locus_tag LOCUS_06300 gene secB 5219 4734 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF07 protein_id gnl|my_center|LOCUS_06300 5740 5276 gene locus_tag LOCUS_06310 gene yibN 5740 5276 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001368341.1 protein_id gnl|my_center|LOCUS_06310 5934 7496 gene locus_tag LOCUS_06320 gene gpmI 5934 7496 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_06320 7611 8990 gene locus_tag LOCUS_06330 7611 8990 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_06330 <9549 8987 gene locus_tag LOCUS_06340 <9549 8987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FM82:putative protein kinase UbiB >Feature sequence059 949 53 gene locus_tag LOCUS_06350 gene purC 949 53 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6R0 protein_id gnl|my_center|LOCUS_06350 2199 982 gene locus_tag LOCUS_06360 2199 982 CDS product 2-octaprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705607.1 protein_id gnl|my_center|LOCUS_06360 3397 2186 gene locus_tag LOCUS_06370 3397 2186 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 protein_id gnl|my_center|LOCUS_06370 4706 3387 gene locus_tag LOCUS_06380 gene pepP 4706 3387 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_06380 5278 4715 gene locus_tag LOCUS_06390 5278 4715 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 protein_id gnl|my_center|LOCUS_06390 5427 5648 gene locus_tag LOCUS_06400 5427 5648 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_06400 5725 6063 gene locus_tag LOCUS_06410 gene zapA 5725 6063 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_06410 6318 6782 gene locus_tag LOCUS_06420 6318 6782 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_06420 6970 8118 gene locus_tag LOCUS_06430 6970 8118 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527988.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence060 1928 1482 gene locus_tag LOCUS_06440 1928 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2436 2011 gene locus_tag LOCUS_06450 2436 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3222 2899 gene locus_tag LOCUS_06460 3222 2899 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_06460 5868 3331 gene locus_tag LOCUS_06470 gene mutS 5868 3331 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB5 protein_id gnl|my_center|LOCUS_06470 6246 5875 gene locus_tag LOCUS_06480 6246 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 6520 8403 gene locus_tag LOCUS_06490 gene htpG 6520 8403 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y9 protein_id gnl|my_center|LOCUS_06490 8443 9357 gene locus_tag LOCUS_06500 gene prmB 8443 9357 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1I9 protein_id gnl|my_center|LOCUS_06500 >Feature sequence061 <1 1307 gene locus_tag LOCUS_06510 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVV6:amidophosphoribosyltransferase 1354 2538 gene locus_tag LOCUS_06520 gene metZ 1354 2538 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_06520 2686 3867 gene locus_tag LOCUS_06530 2686 3867 CDS product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709136.1 protein_id gnl|my_center|LOCUS_06530 3999 4481 gene locus_tag LOCUS_06540 3999 4481 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_06540 4520 5977 gene locus_tag LOCUS_06550 4520 5977 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_06550 5990 6703 gene locus_tag LOCUS_06560 5990 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6704 7375 gene locus_tag LOCUS_06570 6704 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7674 7492 gene locus_tag LOCUS_06580 7674 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 <9421 7671 gene locus_tag LOCUS_06590 <9421 7671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110509.1:carbon starvation protein A >Feature sequence062 2314 3912 gene locus_tag LOCUS_06600 2314 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 protein_id gnl|my_center|LOCUS_06600 4051 5895 gene locus_tag LOCUS_06610 gene exbB2 4051 5895 CDS product transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_06610 5888 6298 gene locus_tag LOCUS_06620 gene exbD2 5888 6298 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_06620 6304 6942 gene locus_tag LOCUS_06630 6304 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6960 8723 gene locus_tag LOCUS_06640 6960 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence063 942 1925 gene locus_tag LOCUS_06650 gene mch 942 1925 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE77 protein_id gnl|my_center|LOCUS_06650 1906 2865 gene locus_tag LOCUS_06660 1906 2865 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 protein_id gnl|my_center|LOCUS_06660 2862 3803 gene locus_tag LOCUS_06670 2862 3803 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532035.1 protein_id gnl|my_center|LOCUS_06670 3865 4377 gene locus_tag LOCUS_06680 3865 4377 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_06680 5186 4461 gene locus_tag LOCUS_06690 5186 4461 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532037.1 protein_id gnl|my_center|LOCUS_06690 5258 6310 gene locus_tag LOCUS_06700 5258 6310 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 protein_id gnl|my_center|LOCUS_06700 6301 7704 gene locus_tag LOCUS_06710 6301 7704 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 protein_id gnl|my_center|LOCUS_06710 7679 8278 gene locus_tag LOCUS_06720 7679 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence064 1008 517 gene locus_tag LOCUS_06730 1008 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2753 1122 gene locus_tag LOCUS_06740 2753 1122 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_06740 2857 3042 gene locus_tag LOCUS_06750 2857 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3319 4182 gene locus_tag LOCUS_06760 3319 4182 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022593.1 protein_id gnl|my_center|LOCUS_06760 5844 4396 gene locus_tag LOCUS_06770 5844 4396 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_06770 6989 5841 gene locus_tag LOCUS_06780 6989 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8813 7617 gene locus_tag LOCUS_06790 8813 7617 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_06790 9052 8876 gene locus_tag LOCUS_06800 9052 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence065 1502 1242 gene locus_tag LOCUS_06810 gene relE 1502 1242 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_06810 1756 1499 gene locus_tag LOCUS_06820 1756 1499 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B94 protein_id gnl|my_center|LOCUS_06820 1944 2636 gene locus_tag LOCUS_06830 1944 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3434 2646 gene locus_tag LOCUS_06840 gene surE 3434 2646 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBU3 protein_id gnl|my_center|LOCUS_06840 4212 3496 gene locus_tag LOCUS_06850 4212 3496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405550.1 protein_id gnl|my_center|LOCUS_06850 5354 4209 gene locus_tag LOCUS_06860 gene acrE 5354 4209 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_06860 5711 9001 gene locus_tag LOCUS_06870 5711 9001 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence066 1146 2609 gene locus_tag LOCUS_06880 1146 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4727 2991 gene locus_tag LOCUS_06890 4727 2991 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_06890 5498 5043 gene locus_tag LOCUS_06900 5498 5043 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_06900 6415 6579 gene locus_tag LOCUS_06910 6415 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6594 6842 gene locus_tag LOCUS_06920 6594 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6842 7336 gene locus_tag LOCUS_06930 6842 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7424 7969 gene locus_tag LOCUS_06940 7424 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 <9279 8592 gene locus_tag LOCUS_06950 <9279 8592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123886.1:formamidopyrimidine-DNA glycosylase >Feature sequence067 871 2916 gene locus_tag LOCUS_06960 gene tktA 871 2916 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_06960 2972 3988 gene locus_tag LOCUS_06970 gene hexC 2972 3988 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5W0 protein_id gnl|my_center|LOCUS_06970 3990 5162 gene locus_tag LOCUS_06980 gene pgk 3990 5162 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2J0 protein_id gnl|my_center|LOCUS_06980 5262 6287 gene locus_tag LOCUS_06990 5262 6287 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_06990 6567 7379 gene locus_tag LOCUS_07000 6567 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7427 7708 gene locus_tag LOCUS_07010 7427 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 7718 7903 gene locus_tag LOCUS_07020 7718 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence068 230 1609 gene locus_tag LOCUS_07030 230 1609 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_07030 2766 1621 gene locus_tag LOCUS_07040 2766 1621 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_07040 5408 2886 gene locus_tag LOCUS_07050 5408 2886 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_07050 6190 5405 gene locus_tag LOCUS_07060 6190 5405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_07060 6406 7131 gene locus_tag LOCUS_07070 6406 7131 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_07070 7553 8986 gene locus_tag LOCUS_07080 gene amt 7553 8986 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE9 protein_id gnl|my_center|LOCUS_07080 >Feature sequence069 1065 880 gene locus_tag LOCUS_07090 1065 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_07090 1943 1080 gene locus_tag LOCUS_07100 gene hflC 1943 1080 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ7 protein_id gnl|my_center|LOCUS_07100 3118 1940 gene locus_tag LOCUS_07110 gene hflK 3118 1940 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_07110 4501 3197 gene locus_tag LOCUS_07120 gene hflX 4501 3197 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_07120 4768 4517 gene locus_tag LOCUS_07130 gene hfq 4768 4517 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_07130 5842 4880 gene locus_tag LOCUS_07140 gene miaA 5842 4880 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_07140 7544 5829 gene locus_tag LOCUS_07150 7544 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9020 7578 gene locus_tag LOCUS_07160 gene amiB 9020 7578 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence070 <1 1570 gene locus_tag LOCUS_07170 <1 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114341.1:adenylate cyclase 1634 2512 gene locus_tag LOCUS_07180 1634 2512 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_07180 2509 3069 gene locus_tag LOCUS_07190 2509 3069 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_07190 3066 3860 gene locus_tag LOCUS_07200 3066 3860 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 protein_id gnl|my_center|LOCUS_07200 4488 3802 gene locus_tag LOCUS_07210 4488 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7874 4485 gene locus_tag LOCUS_07220 gene mfd 7874 4485 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_07220 8685 7984 gene locus_tag LOCUS_07230 gene pyrF 8685 7984 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43812 protein_id gnl|my_center|LOCUS_07230 >Feature sequence071 83 865 gene locus_tag LOCUS_07240 83 865 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQU8 protein_id gnl|my_center|LOCUS_07240 869 1999 gene locus_tag LOCUS_07250 gene flhB 869 1999 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_07250 2046 4157 gene locus_tag LOCUS_07260 gene flhA 2046 4157 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705285.1 protein_id gnl|my_center|LOCUS_07260 4197 5381 gene locus_tag LOCUS_07270 gene flhF 4197 5381 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 protein_id gnl|my_center|LOCUS_07270 5378 6259 gene locus_tag LOCUS_07280 5378 6259 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV2 protein_id gnl|my_center|LOCUS_07280 6256 6996 gene locus_tag LOCUS_07290 gene fliA 6256 6996 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884V7 protein_id gnl|my_center|LOCUS_07290 7037 7432 gene locus_tag LOCUS_07300 gene cheY 7037 7432 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_07300 7468 8139 gene locus_tag LOCUS_07310 gene cheZ 7468 8139 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI22 protein_id gnl|my_center|LOCUS_07310 >Feature sequence072 368 1573 gene locus_tag LOCUS_07320 368 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_07320 1573 1767 gene locus_tag LOCUS_07330 1573 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2596 1901 gene locus_tag LOCUS_07340 gene alkB 2596 1901 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815451.1 protein_id gnl|my_center|LOCUS_07340 3360 2593 gene locus_tag LOCUS_07350 3360 2593 CDS product prolyl 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188398.1 protein_id gnl|my_center|LOCUS_07350 4499 3357 gene locus_tag LOCUS_07360 4499 3357 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208972.1 protein_id gnl|my_center|LOCUS_07360 5075 5893 gene locus_tag LOCUS_07370 5075 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6851 5940 gene locus_tag LOCUS_07380 6851 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8835 7276 gene locus_tag LOCUS_07390 8835 7276 CDS product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence073 769 936 gene locus_tag LOCUS_07400 769 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1391 1720 gene locus_tag LOCUS_07410 1391 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1717 2229 gene locus_tag LOCUS_07420 1717 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_07420 2455 2246 gene locus_tag LOCUS_07430 2455 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2865 2502 gene locus_tag LOCUS_tm00010 2865 2502 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3436 2957 gene locus_tag LOCUS_07440 gene smpB 3436 2957 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRP1 protein_id gnl|my_center|LOCUS_07440 3645 4079 gene locus_tag LOCUS_07450 3645 4079 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_07450 4066 4338 gene locus_tag LOCUS_07460 4066 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5019 4348 gene locus_tag LOCUS_07470 5019 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 5288 5698 gene locus_tag LOCUS_07480 gene fur 5288 5698 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_07480 7363 5708 gene locus_tag LOCUS_07490 gene recN 7363 5708 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_07490 8208 7357 gene locus_tag LOCUS_07500 gene nadK 8208 7357 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRQ7 protein_id gnl|my_center|LOCUS_07500 >Feature sequence074 <1 667 gene locus_tag LOCUS_07510 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036210.1:membrane protein 664 2637 gene locus_tag LOCUS_07520 gene tgpA 664 2637 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_07520 2772 3179 gene locus_tag LOCUS_07530 2772 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3485 3198 gene locus_tag LOCUS_07540 3485 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3682 4830 gene locus_tag LOCUS_07550 3682 4830 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_07550 6310 4841 gene locus_tag LOCUS_07560 6310 4841 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701275.1 protein_id gnl|my_center|LOCUS_07560 6940 8259 gene locus_tag LOCUS_07570 6940 8259 CDS product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence075 1753 956 gene locus_tag LOCUS_07580 1753 956 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089969.1 protein_id gnl|my_center|LOCUS_07580 1970 3376 gene locus_tag LOCUS_07590 gene amiD 1970 3376 CDS product putative amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ93 protein_id gnl|my_center|LOCUS_07590 3746 4300 gene locus_tag LOCUS_07600 3746 4300 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039522.1 protein_id gnl|my_center|LOCUS_07600 4290 5741 gene locus_tag LOCUS_07610 4290 5741 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_07610 5754 6989 gene locus_tag LOCUS_07620 gene emrA 5754 6989 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 protein_id gnl|my_center|LOCUS_07620 6995 8569 gene locus_tag LOCUS_07630 6995 8569 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence076 384 1688 gene locus_tag LOCUS_07640 384 1688 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_07640 1678 3198 gene locus_tag LOCUS_07650 gene czcB 1678 3198 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197872.1 protein_id gnl|my_center|LOCUS_07650 3213 6371 gene locus_tag LOCUS_07660 gene czcA 3213 6371 CDS product resistance-nodulation-cell division divalent metal cation efflux transporter CzcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_07660 6789 6968 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgaacagttcgggacacccactttcc 7382 7849 gene locus_tag LOCUS_07670 7382 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence077 1430 405 gene locus_tag LOCUS_07680 1430 405 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_07680 2223 1489 gene locus_tag LOCUS_07690 2223 1489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_07690 3098 2301 gene locus_tag LOCUS_07700 3098 2301 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_07700 3549 3115 gene locus_tag LOCUS_07710 3549 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 protein_id gnl|my_center|LOCUS_07710 4252 3581 gene locus_tag LOCUS_07720 4252 3581 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040363.1 protein_id gnl|my_center|LOCUS_07720 5238 4318 gene locus_tag LOCUS_07730 gene hemF 5238 4318 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4U8 protein_id gnl|my_center|LOCUS_07730 5333 5926 gene locus_tag LOCUS_07740 gene hisB 5333 5926 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSY9 protein_id gnl|my_center|LOCUS_07740 5946 6596 gene locus_tag LOCUS_07750 gene hisH 5946 6596 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG1 protein_id gnl|my_center|LOCUS_07750 6655 7161 gene locus_tag LOCUS_07760 6655 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8206 7178 gene locus_tag LOCUS_07770 8206 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55684 protein_id gnl|my_center|LOCUS_07770 >Feature sequence078 1011 364 gene locus_tag LOCUS_07780 gene adk 1011 364 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886R8 protein_id gnl|my_center|LOCUS_07780 1122 1514 gene locus_tag LOCUS_07790 1122 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2530 1673 gene locus_tag LOCUS_07800 2530 1673 CDS product lipoprotein NlpD/LppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45682 protein_id gnl|my_center|LOCUS_07800 2493 2711 gene locus_tag LOCUS_07810 2493 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3374 2715 gene locus_tag LOCUS_07820 gene pcm 3374 2715 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_07820 4122 3385 gene locus_tag LOCUS_07830 gene surE 4122 3385 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUI9 protein_id gnl|my_center|LOCUS_07830 5050 4136 gene locus_tag LOCUS_07840 gene argF 5050 4136 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_07840 6246 5047 gene locus_tag LOCUS_07850 gene argD 6246 5047 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTX5 protein_id gnl|my_center|LOCUS_07850 6860 6333 gene locus_tag LOCUS_07860 6860 6333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_07860 7067 6909 gene locus_tag LOCUS_07870 7067 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7215 7526 gene locus_tag LOCUS_07880 7215 7526 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V8 protein_id gnl|my_center|LOCUS_07880 8249 7533 gene locus_tag LOCUS_07890 gene dnaQ 8249 7533 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_07890 8743 8276 gene locus_tag LOCUS_07900 gene rnhA 8743 8276 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V99 protein_id gnl|my_center|LOCUS_07900 >Feature sequence079 210 2033 gene locus_tag LOCUS_07910 210 2033 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_07910 2232 3704 gene locus_tag LOCUS_07920 gene putA 2232 3704 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_07920 3824 4744 gene locus_tag LOCUS_07930 3824 4744 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090617.1 protein_id gnl|my_center|LOCUS_07930 6360 4819 gene locus_tag LOCUS_07940 6360 4819 CDS product putative amino acid permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701696.1 protein_id gnl|my_center|LOCUS_07940 7228 6554 gene locus_tag LOCUS_07950 7228 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_07950 7701 7489 gene locus_tag LOCUS_07960 7701 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence080 342 1703 gene locus_tag LOCUS_07970 342 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1869 2258 gene locus_tag LOCUS_07980 1869 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2255 4528 gene locus_tag LOCUS_07990 2255 4528 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_07990 4957 6171 gene locus_tag LOCUS_08000 4957 6171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_08000 6240 7100 gene locus_tag LOCUS_08010 6240 7100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937713.1 protein_id gnl|my_center|LOCUS_08010 <8668 7112 gene locus_tag LOCUS_08020 <8668 7112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477482.1:ABC transporter ATP-binding protein >Feature sequence081 549 929 gene locus_tag LOCUS_08030 549 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1101 1961 gene locus_tag LOCUS_08040 1101 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2115 2573 gene locus_tag LOCUS_08050 2115 2573 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_08050 3224 2676 gene locus_tag LOCUS_08060 3224 2676 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_08060 4837 4762 gene locus_tag LOCUS_t00090 4837 4762 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5410 5739 gene locus_tag LOCUS_08070 5410 5739 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929971.1 protein_id gnl|my_center|LOCUS_08070 5882 7669 gene locus_tag LOCUS_08080 gene aspS 5882 7669 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y31 protein_id gnl|my_center|LOCUS_08080 >Feature sequence082 473 841 gene locus_tag LOCUS_08090 473 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 878 1732 gene locus_tag LOCUS_08100 878 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703681.1 protein_id gnl|my_center|LOCUS_08100 1749 2198 gene locus_tag LOCUS_08110 1749 2198 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256727.1 protein_id gnl|my_center|LOCUS_08110 2191 3426 gene locus_tag LOCUS_08120 2191 3426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_08120 3503 4330 gene locus_tag LOCUS_08130 3503 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_08130 4561 5340 gene locus_tag LOCUS_08140 4561 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5494 6639 gene locus_tag LOCUS_08150 5494 6639 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_08150 6781 7584 gene locus_tag LOCUS_08160 6781 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967308.1 protein_id gnl|my_center|LOCUS_08160 7603 8127 gene locus_tag LOCUS_08170 7603 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence083 954 289 gene locus_tag LOCUS_08180 954 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2981 1392 gene locus_tag LOCUS_08190 2981 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_08190 3701 3015 gene locus_tag LOCUS_08200 3701 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112732.1 protein_id gnl|my_center|LOCUS_08200 4315 3698 gene locus_tag LOCUS_08210 gene lexA 4315 3698 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q44069 protein_id gnl|my_center|LOCUS_08210 5198 4842 gene locus_tag LOCUS_08220 5198 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6118 5192 gene locus_tag LOCUS_08230 6118 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 8459 6120 gene locus_tag LOCUS_08240 8459 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence084 555 217 gene locus_tag LOCUS_08250 555 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086461.1 protein_id gnl|my_center|LOCUS_08250 1655 552 gene locus_tag LOCUS_08260 1655 552 CDS product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086460.1 protein_id gnl|my_center|LOCUS_08260 2680 1652 gene locus_tag LOCUS_08270 2680 1652 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 protein_id gnl|my_center|LOCUS_08270 4447 2783 gene locus_tag LOCUS_08280 4447 2783 CDS product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337804.1 protein_id gnl|my_center|LOCUS_08280 4628 4978 gene locus_tag LOCUS_08290 4628 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5734 4982 gene locus_tag LOCUS_08300 5734 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 7239 5815 gene locus_tag LOCUS_08310 gene mntH 7239 5815 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y773 protein_id gnl|my_center|LOCUS_08310 7332 7541 gene locus_tag LOCUS_08320 7332 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 <8571 7527 gene locus_tag LOCUS_08330 <8571 7527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390852.1:PEP-CTERM-box response regulator transcription factor >Feature sequence085 421 1119 gene locus_tag LOCUS_08340 gene gacA.3 421 1119 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772817.1 protein_id gnl|my_center|LOCUS_08340 1331 1116 gene locus_tag LOCUS_08350 1331 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1727 1341 gene locus_tag LOCUS_08360 1727 1341 CDS product endoribonuclease L-PSP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 protein_id gnl|my_center|LOCUS_08360 2842 1739 gene locus_tag LOCUS_08370 2842 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_08370 4910 3297 gene locus_tag LOCUS_08380 4910 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203819.1 protein_id gnl|my_center|LOCUS_08380 5144 4914 gene locus_tag LOCUS_08390 5144 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6576 5206 gene locus_tag LOCUS_08400 gene oprM 6576 5206 CDS product outer membrane protein OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51487 protein_id gnl|my_center|LOCUS_08400 <8571 6788 gene locus_tag LOCUS_08410 <8571 6788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937372.1:multidrug efflux RND transporter permease subunit >Feature sequence086 854 102 gene locus_tag LOCUS_08420 854 102 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_08420 1720 851 gene locus_tag LOCUS_08430 gene panC 1720 851 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_08430 2496 1813 gene locus_tag LOCUS_08440 2496 1813 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_08440 2987 2493 gene locus_tag LOCUS_08450 gene folK-2 2987 2493 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_08450 4349 2994 gene locus_tag LOCUS_08460 gene pcnB 4349 2994 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP05 protein_id gnl|my_center|LOCUS_08460 4529 4603 gene locus_tag LOCUS_t00100 4529 4603 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5056 6033 gene locus_tag LOCUS_08470 5056 6033 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220497.1 protein_id gnl|my_center|LOCUS_08470 6837 6061 gene locus_tag LOCUS_08480 6837 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813551.1 protein_id gnl|my_center|LOCUS_08480 7229 7660 gene locus_tag LOCUS_08490 7229 7660 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 protein_id gnl|my_center|LOCUS_08490 <8328 7673 gene locus_tag LOCUS_08500 <8328 7673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948329.1:LPS export ABC transporter permease LptG >Feature sequence087 78 4418 gene locus_tag LOCUS_08510 78 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4429 5520 gene locus_tag LOCUS_08520 4429 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5511 6287 gene locus_tag LOCUS_08530 5511 6287 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_08530 6375 7463 gene locus_tag LOCUS_08540 6375 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence088 1739 1110 gene locus_tag LOCUS_08550 1739 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2496 1750 gene locus_tag LOCUS_08560 gene ubiE 2496 1750 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_08560 2876 2508 gene locus_tag LOCUS_08570 2876 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_08570 4234 2888 gene locus_tag LOCUS_08580 gene hslU 4234 2888 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU0 protein_id gnl|my_center|LOCUS_08580 4696 4238 gene locus_tag LOCUS_08590 gene hslV 4696 4238 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_08590 4986 5531 gene locus_tag LOCUS_08600 gene def1 4986 5531 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0Q0 protein_id gnl|my_center|LOCUS_08600 5582 5959 gene locus_tag LOCUS_08610 5582 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_08610 6026 7234 gene locus_tag LOCUS_08620 6026 7234 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_08620 7280 8044 gene locus_tag LOCUS_08630 7280 8044 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence089 59 1402 gene locus_tag LOCUS_08640 gene secY 59 1402 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P78283 protein_id gnl|my_center|LOCUS_08640 1608 1453 gene locus_tag LOCUS_08650 1608 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1567 1926 gene locus_tag LOCUS_08660 gene rpsM 1567 1926 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF42 protein_id gnl|my_center|LOCUS_08660 1946 2347 gene locus_tag LOCUS_08670 gene rpsK 1946 2347 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44379 protein_id gnl|my_center|LOCUS_08670 2366 2989 gene locus_tag LOCUS_08680 gene rpsD 2366 2989 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U7 protein_id gnl|my_center|LOCUS_08680 3011 4018 gene locus_tag LOCUS_08690 gene rpoA 3011 4018 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_08690 4101 4430 gene locus_tag LOCUS_08700 gene rplQ 4101 4430 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP09 protein_id gnl|my_center|LOCUS_08700 5921 4485 gene locus_tag LOCUS_08710 gene gatB 5921 4485 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM8 protein_id gnl|my_center|LOCUS_08710 7387 5924 gene locus_tag LOCUS_08720 gene gatA 7387 5924 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_08720 7677 7387 gene locus_tag LOCUS_08730 gene gatC 7677 7387 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAA2 protein_id gnl|my_center|LOCUS_08730 >Feature sequence090 1447 272 gene locus_tag LOCUS_08740 1447 272 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_08740 1617 2060 gene locus_tag LOCUS_08750 1617 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 3306 2053 gene locus_tag LOCUS_08760 3306 2053 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_08760 3877 3320 gene locus_tag LOCUS_08770 gene greB 3877 3320 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P8 protein_id gnl|my_center|LOCUS_08770 7082 3996 gene locus_tag LOCUS_08780 gene dnaE2 7082 3996 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_08780 7205 7654 gene locus_tag LOCUS_08790 7205 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence091 80 331 gene locus_tag LOCUS_08800 gene rpsR 80 331 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_08800 393 1274 gene locus_tag LOCUS_08810 393 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_08810 1344 1817 gene locus_tag LOCUS_08820 gene rplI 1344 1817 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC0 protein_id gnl|my_center|LOCUS_08820 1903 3303 gene locus_tag LOCUS_08830 gene dnaB 1903 3303 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXJ3 protein_id gnl|my_center|LOCUS_08830 3300 4367 gene locus_tag LOCUS_08840 gene alr 3300 4367 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUZ4 protein_id gnl|my_center|LOCUS_08840 4364 5716 gene locus_tag LOCUS_08850 gene radA 4364 5716 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB3 protein_id gnl|my_center|LOCUS_08850 7032 5725 gene locus_tag LOCUS_08860 7032 5725 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_08860 7838 7038 gene locus_tag LOCUS_08870 7838 7038 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence092 1504 1169 gene locus_tag LOCUS_08880 1504 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1986 1513 gene locus_tag LOCUS_08890 1986 1513 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083537.1 protein_id gnl|my_center|LOCUS_08890 3109 2021 gene locus_tag LOCUS_08900 3109 2021 CDS product branched-chain alpha-keto acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 protein_id gnl|my_center|LOCUS_08900 4143 3130 gene locus_tag LOCUS_08910 gene acoB 4143 3130 CDS product acetoin catabolism protein AcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_08910 5124 4156 gene locus_tag LOCUS_08920 5124 4156 CDS product dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_08920 5404 6330 gene locus_tag LOCUS_08930 5404 6330 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence093 302 733 gene locus_tag LOCUS_08940 302 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 733 1080 gene locus_tag LOCUS_08950 733 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_08950 1183 2721 gene locus_tag LOCUS_08960 1183 2721 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602857.1 protein_id gnl|my_center|LOCUS_08960 2673 2981 gene locus_tag LOCUS_08970 2673 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3550 3050 gene locus_tag LOCUS_08980 3550 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3792 3547 gene locus_tag LOCUS_08990 3792 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4448 3804 gene locus_tag LOCUS_09000 4448 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4681 4451 gene locus_tag LOCUS_09010 4681 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5481 4678 gene locus_tag LOCUS_09020 5481 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 6005 5481 gene locus_tag LOCUS_09030 6005 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7002 5992 gene locus_tag LOCUS_09040 7002 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7511 7002 gene locus_tag LOCUS_09050 7511 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7774 7508 gene locus_tag LOCUS_09060 7774 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence094 1843 2787 gene locus_tag LOCUS_09070 1843 2787 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_09070 2851 3810 gene locus_tag LOCUS_09080 2851 3810 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_09080 4389 3811 gene locus_tag LOCUS_09090 gene maf-2 4389 3811 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG5 protein_id gnl|my_center|LOCUS_09090 4469 4972 gene locus_tag LOCUS_09100 4469 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_09100 4995 5171 gene locus_tag LOCUS_09110 gene rpmF 4995 5171 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E41 protein_id gnl|my_center|LOCUS_09110 5222 6238 gene locus_tag LOCUS_09120 gene plsX 5222 6238 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_09120 6238 7179 gene locus_tag LOCUS_09130 gene fabD 6238 7179 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7J5 protein_id gnl|my_center|LOCUS_09130 7184 7924 gene locus_tag LOCUS_09140 gene fabG 7184 7924 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008539.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence095 <1 746 gene locus_tag LOCUS_09150 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63QM1:glutamate 5-kinase 1020 757 gene locus_tag LOCUS_09160 gene rpsT 1020 757 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E8 protein_id gnl|my_center|LOCUS_09160 1310 2725 gene locus_tag LOCUS_09170 gene mviN 1310 2725 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_09170 2754 3686 gene locus_tag LOCUS_09180 gene ribF 2754 3686 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJE0 protein_id gnl|my_center|LOCUS_09180 3679 4179 gene locus_tag LOCUS_09190 gene lspA 3679 4179 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WI4 protein_id gnl|my_center|LOCUS_09190 4226 5194 gene locus_tag LOCUS_09200 gene ispH 4226 5194 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_09200 5617 5228 gene locus_tag LOCUS_09210 5617 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6177 5692 gene locus_tag LOCUS_09220 gene pilE 6177 5692 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_09220 <7940 6204 gene locus_tag LOCUS_09230 <7940 6204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545300.1:pilus assembly protein PilY >Feature sequence096 240 1433 gene locus_tag LOCUS_09240 240 1433 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_09240 1712 1467 gene locus_tag LOCUS_09250 1712 1467 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKJ5 protein_id gnl|my_center|LOCUS_09250 1869 3515 gene locus_tag LOCUS_09260 1869 3515 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083751.1 protein_id gnl|my_center|LOCUS_09260 7596 3598 gene locus_tag LOCUS_09270 7596 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7931 7593 gene locus_tag LOCUS_09280 7931 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence097 1056 187 gene locus_tag LOCUS_09290 1056 187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_09290 1687 1124 gene locus_tag LOCUS_09300 1687 1124 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 protein_id gnl|my_center|LOCUS_09300 1913 2815 gene locus_tag LOCUS_09310 1913 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2853 3329 gene locus_tag LOCUS_09320 2853 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4236 3418 gene locus_tag LOCUS_09330 4236 3418 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 protein_id gnl|my_center|LOCUS_09330 4931 4233 gene locus_tag LOCUS_09340 4931 4233 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812656.1 protein_id gnl|my_center|LOCUS_09340 5713 4970 gene locus_tag LOCUS_09350 5713 4970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812658.1 protein_id gnl|my_center|LOCUS_09350 7395 6070 gene locus_tag LOCUS_09360 7395 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence098 513 2564 gene locus_tag LOCUS_09370 513 2564 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_09370 2731 4515 gene locus_tag LOCUS_09380 2731 4515 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_09380 4803 5297 gene locus_tag LOCUS_09390 4803 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09390 5339 6625 gene locus_tag LOCUS_09400 5339 6625 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence099 365 964 gene locus_tag LOCUS_09410 gene ruvA 365 964 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_09410 1028 2074 gene locus_tag LOCUS_09420 gene ruvB 1028 2074 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66756 protein_id gnl|my_center|LOCUS_09420 2071 2490 gene locus_tag LOCUS_09430 2071 2490 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_09430 2480 3154 gene locus_tag LOCUS_09440 gene tolQ 2480 3154 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 protein_id gnl|my_center|LOCUS_09440 3158 3607 gene locus_tag LOCUS_09450 gene tolR 3158 3607 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242259.1 protein_id gnl|my_center|LOCUS_09450 3620 4618 gene locus_tag LOCUS_09460 3620 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4618 5910 gene locus_tag LOCUS_09470 gene tolB 4618 5910 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_09470 6106 6525 gene locus_tag LOCUS_09480 6106 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 6563 7582 gene locus_tag LOCUS_09490 6563 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence100 6 1727 gene locus_tag LOCUS_09500 6 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1767 4934 gene locus_tag LOCUS_09510 gene mexF 1767 4934 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 protein_id gnl|my_center|LOCUS_09510 4931 6349 gene locus_tag LOCUS_09520 4931 6349 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925807.1 protein_id gnl|my_center|LOCUS_09520 <7831 6426 gene locus_tag LOCUS_09530 <7831 6426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337798.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence101 2 184 gene locus_tag LOCUS_09540 2 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 208 597 gene locus_tag LOCUS_09550 208 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 594 1643 gene locus_tag LOCUS_09560 594 1643 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704394.1 protein_id gnl|my_center|LOCUS_09560 1631 4282 gene locus_tag LOCUS_09570 1631 4282 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704393.1 protein_id gnl|my_center|LOCUS_09570 4400 4756 gene locus_tag LOCUS_09580 4400 4756 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWJ2 protein_id gnl|my_center|LOCUS_09580 5753 4869 gene locus_tag LOCUS_09590 5753 4869 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706023.1 protein_id gnl|my_center|LOCUS_09590 6880 5831 gene locus_tag LOCUS_09600 gene motB 6880 5831 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038737.1 protein_id gnl|my_center|LOCUS_09600 7756 6902 gene locus_tag LOCUS_09610 gene motA 7756 6902 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence102 855 1211 gene locus_tag LOCUS_09620 855 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2755 1340 gene locus_tag LOCUS_09630 2755 1340 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730128.1 protein_id gnl|my_center|LOCUS_09630 3677 2868 gene locus_tag LOCUS_09640 gene ahyR 3677 2868 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037943.1 protein_id gnl|my_center|LOCUS_09640 4476 4249 gene locus_tag LOCUS_09650 4476 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4731 5000 gene locus_tag LOCUS_09660 4731 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5520 6458 gene locus_tag LOCUS_09670 5520 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6580 7587 gene locus_tag LOCUS_09680 6580 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence103 <1 1200 gene locus_tag LOCUS_09690 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51561:DNA-directed RNA polymerase subunit beta 1247 5479 gene locus_tag LOCUS_09700 gene rpoC 1247 5479 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_09700 5767 6189 gene locus_tag LOCUS_09710 gene rpsL 5767 6189 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYP8 protein_id gnl|my_center|LOCUS_09710 6233 6703 gene locus_tag LOCUS_09720 gene rpsG 6233 6703 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence104 <1 846 gene locus_tag LOCUS_09730 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035273.1:radical SAM protein 3002 843 gene locus_tag LOCUS_09740 3002 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3181 4281 gene locus_tag LOCUS_09750 gene zapE 3181 4281 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_09750 4386 4589 gene locus_tag LOCUS_09760 4386 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5057 5989 gene locus_tag LOCUS_09770 5057 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 6020 6337 gene locus_tag LOCUS_09780 6020 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09780 >Feature sequence105 1749 364 gene locus_tag LOCUS_09790 1749 364 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_09790 2697 3521 gene locus_tag LOCUS_09800 gene lgt 2697 3521 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_09800 3518 4312 gene locus_tag LOCUS_09810 gene thyA 3518 4312 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G35 protein_id gnl|my_center|LOCUS_09810 4327 4845 gene locus_tag LOCUS_09820 4327 4845 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS5 protein_id gnl|my_center|LOCUS_09820 5654 4842 gene locus_tag LOCUS_09830 gene apaH 5654 4842 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1B2 protein_id gnl|my_center|LOCUS_09830 6070 5702 gene locus_tag LOCUS_09840 gene apaG 6070 5702 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 protein_id gnl|my_center|LOCUS_09840 7689 6154 gene locus_tag LOCUS_09850 7689 6154 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence106 3745 1436 gene locus_tag LOCUS_09860 gene cheA-1 3745 1436 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_09860 4049 3765 gene locus_tag LOCUS_09870 4049 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4440 4072 gene locus_tag LOCUS_09880 gene cheY-1 4440 4072 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_09880 5617 4451 gene locus_tag LOCUS_09890 5617 4451 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_09890 7082 5835 gene locus_tag LOCUS_09900 7082 5835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088779.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence107 <1 1070 gene locus_tag LOCUS_09910 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726824.1:(2Fe-2S)-binding protein 1252 1902 gene locus_tag LOCUS_09920 1252 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2472 1966 gene locus_tag LOCUS_09930 2472 1966 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_09930 3238 2825 gene locus_tag LOCUS_09940 3238 2825 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088400.1 protein_id gnl|my_center|LOCUS_09940 6170 3492 gene locus_tag LOCUS_09950 6170 3492 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLV8 protein_id gnl|my_center|LOCUS_09950 6297 6770 gene locus_tag LOCUS_09960 6297 6770 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 protein_id gnl|my_center|LOCUS_09960 7503 6856 gene locus_tag LOCUS_09970 7503 6856 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_09970 >Feature sequence108 612 806 gene locus_tag LOCUS_09980 612 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 859 2151 gene locus_tag LOCUS_09990 859 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2141 3229 gene locus_tag LOCUS_10000 2141 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3226 4236 gene locus_tag LOCUS_10010 3226 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 4276 5073 gene locus_tag LOCUS_10020 4276 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 6071 5151 gene locus_tag LOCUS_10030 6071 5151 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_10030 6444 6115 gene locus_tag LOCUS_10040 6444 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7505 6447 gene locus_tag LOCUS_10050 gene mphP 7505 6447 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_10050 >Feature sequence109 1204 323 gene locus_tag LOCUS_10060 1204 323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085040.1 protein_id gnl|my_center|LOCUS_10060 3204 1261 gene locus_tag LOCUS_10070 gene yoaA 3204 1261 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_10070 3689 3201 gene locus_tag LOCUS_10080 3689 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4629 3775 gene locus_tag LOCUS_10090 gene epmA 4629 3775 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KY6 protein_id gnl|my_center|LOCUS_10090 5306 4734 gene locus_tag LOCUS_10100 gene efp 5306 4734 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_10100 5311 6345 gene locus_tag LOCUS_10110 5311 6345 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_10110 6999 6355 gene locus_tag LOCUS_10120 6999 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence110 664 335 gene locus_tag LOCUS_10130 664 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1112 1879 gene locus_tag LOCUS_10140 1112 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2499 1876 gene locus_tag LOCUS_10150 2499 1876 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917909.1 protein_id gnl|my_center|LOCUS_10150 3437 2496 gene locus_tag LOCUS_10160 3437 2496 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_10160 4363 3449 gene locus_tag LOCUS_10170 4363 3449 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533046.1 protein_id gnl|my_center|LOCUS_10170 5130 4360 gene locus_tag LOCUS_10180 5130 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 5866 5108 gene locus_tag LOCUS_10190 gene fabG 5866 5108 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_10190 6711 5866 gene locus_tag LOCUS_10200 6711 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064422.1 protein_id gnl|my_center|LOCUS_10200 <7597 6730 gene locus_tag LOCUS_10210 <7597 6730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FL44:histidinol dehydrogenase >Feature sequence111 2834 1317 gene locus_tag LOCUS_10220 gene mmsA-3 2834 1317 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104588.1 protein_id gnl|my_center|LOCUS_10220 3112 2894 gene locus_tag LOCUS_10230 3112 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3111 3395 gene locus_tag LOCUS_10240 3111 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3459 3638 gene locus_tag LOCUS_10250 3459 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3635 4690 gene locus_tag LOCUS_10260 3635 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_10260 5191 4793 gene locus_tag LOCUS_10270 5191 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5401 6273 gene locus_tag LOCUS_10280 gene bcpA 5401 6273 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_10280 6376 7491 gene locus_tag LOCUS_10290 6376 7491 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104430.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence112 1266 760 gene locus_tag LOCUS_10300 1266 760 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_10300 2531 1263 gene locus_tag LOCUS_10310 gene hcaE 2531 1263 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808134.1 protein_id gnl|my_center|LOCUS_10310 3442 2543 gene locus_tag LOCUS_10320 3442 2543 CDS product iron-dependent extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_10320 3561 4244 gene locus_tag LOCUS_10330 3561 4244 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_10330 4241 5044 gene locus_tag LOCUS_10340 4241 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_10340 5041 5676 gene locus_tag LOCUS_10350 5041 5676 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_10350 <7570 5781 gene locus_tag LOCUS_10360 <7570 5781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073766.1:methyl-accepting chemotaxis protein >Feature sequence113 303 112 gene locus_tag LOCUS_10370 303 112 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXJ8 protein_id gnl|my_center|LOCUS_10370 1318 284 gene locus_tag LOCUS_10380 gene lpxK 1318 284 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D83 protein_id gnl|my_center|LOCUS_10380 1745 1326 gene locus_tag LOCUS_10390 1745 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2380 1742 gene locus_tag LOCUS_10400 2380 1742 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_10400 4829 2553 gene locus_tag LOCUS_10410 gene comA 4829 2553 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_10410 5068 5514 gene locus_tag LOCUS_10420 5068 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6218 5511 gene locus_tag LOCUS_10430 gene lolD 6218 5511 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57031 protein_id gnl|my_center|LOCUS_10430 7059 6211 gene locus_tag LOCUS_10440 7059 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10440 7454 7005 gene locus_tag LOCUS_10450 7454 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 >Feature sequence114 438 1769 gene locus_tag LOCUS_10460 gene glmU 438 1769 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C2 protein_id gnl|my_center|LOCUS_10460 1861 2340 gene locus_tag LOCUS_10470 1861 2340 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J86 protein_id gnl|my_center|LOCUS_10470 2348 3166 gene locus_tag LOCUS_10480 2348 3166 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_10480 3270 3527 gene locus_tag LOCUS_10490 3270 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3540 4235 gene locus_tag LOCUS_10500 gene phoP 3540 4235 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_10500 4245 5633 gene locus_tag LOCUS_10510 gene phoQ 4245 5633 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_10510 5689 6243 gene locus_tag LOCUS_10520 gene fabA 5689 6243 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 protein_id gnl|my_center|LOCUS_10520 <7529 6272 gene locus_tag LOCUS_10530 <7529 6272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNA0:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence115 2703 157 gene locus_tag LOCUS_10540 gene topA 2703 157 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_10540 3240 2761 gene locus_tag LOCUS_10550 gene smg 3240 2761 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ77 protein_id gnl|my_center|LOCUS_10550 4446 3334 gene locus_tag LOCUS_10560 4446 3334 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935893.1 protein_id gnl|my_center|LOCUS_10560 5592 4492 gene locus_tag LOCUS_10570 5592 4492 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266133.1 protein_id gnl|my_center|LOCUS_10570 5729 6232 gene locus_tag LOCUS_10580 gene def-1 5729 6232 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX0 protein_id gnl|my_center|LOCUS_10580 6309 7238 gene locus_tag LOCUS_10590 gene fmt 6309 7238 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EMB1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence116 2012 1248 gene locus_tag LOCUS_10600 gene cobM 2012 1248 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_10600 2410 2009 gene locus_tag LOCUS_10610 2410 2009 CDS product cobalamin biosynthesis protein CbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531079.1 protein_id gnl|my_center|LOCUS_10610 3645 2392 gene locus_tag LOCUS_10620 gene cobL 3645 2392 CDS product precorrin-6Y methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972573.1 protein_id gnl|my_center|LOCUS_10620 3644 4411 gene locus_tag LOCUS_10630 3644 4411 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_10630 5151 4375 gene locus_tag LOCUS_10640 gene cobJ 5151 4375 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970291.1 protein_id gnl|my_center|LOCUS_10640 5867 5136 gene locus_tag LOCUS_10650 gene cobI 5867 5136 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709475.1 protein_id gnl|my_center|LOCUS_10650 6490 5864 gene locus_tag LOCUS_10660 gene cobH 6490 5864 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 protein_id gnl|my_center|LOCUS_10660 7497 6490 gene locus_tag LOCUS_10670 7497 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence117 310 2193 gene locus_tag LOCUS_10680 310 2193 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_10680 2230 3357 gene locus_tag LOCUS_10690 2230 3357 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_10690 3348 3698 gene locus_tag LOCUS_10700 3348 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3686 4663 gene locus_tag LOCUS_10710 3686 4663 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_10710 4648 5643 gene locus_tag LOCUS_10720 4648 5643 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence118 3367 1664 gene locus_tag LOCUS_10730 3367 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3379 5601 gene locus_tag LOCUS_10740 gene glgB 3379 5601 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 protein_id gnl|my_center|LOCUS_10740 7172 5619 gene locus_tag LOCUS_10750 7172 5619 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141198.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence119 148 2034 gene locus_tag LOCUS_10760 148 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10760 2041 3213 gene locus_tag LOCUS_10770 2041 3213 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_10770 3477 3746 gene locus_tag LOCUS_10780 3477 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3743 4999 gene locus_tag LOCUS_10790 3743 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5377 5036 gene locus_tag LOCUS_10800 5377 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5456 6694 gene locus_tag LOCUS_10810 gene avtA 5456 6694 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260902.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence120 298 531 gene locus_tag LOCUS_10820 298 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1069 851 gene locus_tag LOCUS_10830 1069 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1780 1490 gene locus_tag LOCUS_10840 1780 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3220 2360 gene locus_tag LOCUS_10850 3220 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3637 4713 gene locus_tag LOCUS_10860 3637 4713 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_10860 4710 5588 gene locus_tag LOCUS_10870 gene rmlA 4710 5588 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C760 protein_id gnl|my_center|LOCUS_10870 5585 6127 gene locus_tag LOCUS_10880 gene rmlC 5585 6127 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU21 protein_id gnl|my_center|LOCUS_10880 6124 7023 gene locus_tag LOCUS_10890 6124 7023 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence121 432 1112 gene locus_tag LOCUS_10900 432 1112 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257634.1 protein_id gnl|my_center|LOCUS_10900 1766 1485 gene locus_tag LOCUS_10910 1766 1485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_10910 2404 3486 gene locus_tag LOCUS_10920 gene dinB 2404 3486 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW8 protein_id gnl|my_center|LOCUS_10920 5750 3513 gene locus_tag LOCUS_10930 gene parC 5750 3513 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_10930 <7368 5772 gene locus_tag LOCUS_10940 <7368 5772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUJ8:DNA topoisomerase 4 subunit B >Feature sequence122 <1 632 gene locus_tag LOCUS_10950 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:protein kinase 648 1478 gene locus_tag LOCUS_10960 648 1478 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_10960 1488 2204 gene locus_tag LOCUS_10970 1488 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4483 2234 gene locus_tag LOCUS_10980 gene gidA 4483 2234 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_10980 4885 4565 gene locus_tag LOCUS_10990 gene spoIIAA 4885 4565 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1N6 protein_id gnl|my_center|LOCUS_10990 5342 4923 gene locus_tag LOCUS_11000 5342 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5940 5515 gene locus_tag LOCUS_11010 5940 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_11010 6602 5946 gene locus_tag LOCUS_11020 gene nth 6602 5946 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRK1 protein_id gnl|my_center|LOCUS_11020 <7300 6599 gene locus_tag LOCUS_11030 <7300 6599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KLJ3:electron transport complex subunit B >Feature sequence123 <1 1273 gene locus_tag LOCUS_11040 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268063.1:monoamine oxidase 1292 1813 gene locus_tag LOCUS_11050 gene tdcF 1292 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 protein_id gnl|my_center|LOCUS_11050 4765 1844 gene locus_tag LOCUS_11060 4765 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5003 6400 gene locus_tag LOCUS_11070 5003 6400 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728113.1 protein_id gnl|my_center|LOCUS_11070 <7292 6518 gene locus_tag LOCUS_11080 <7292 6518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728613.1:monooxygenase >Feature sequence124 257 1903 gene locus_tag LOCUS_11090 257 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2089 5754 gene locus_tag LOCUS_11100 2089 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence125 <1 805 gene locus_tag LOCUS_11110 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O87712:chaperone protein DnaK 896 2023 gene locus_tag LOCUS_11120 gene dnaJ 896 2023 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_11120 2020 2838 gene locus_tag LOCUS_11130 gene dapB 2020 2838 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_11130 2937 3539 gene locus_tag LOCUS_11140 2937 3539 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085826.1 protein_id gnl|my_center|LOCUS_11140 3555 4220 gene locus_tag LOCUS_11150 3555 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4395 5375 gene locus_tag LOCUS_11160 gene gnnA 4395 5375 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_11160 5750 5376 gene locus_tag LOCUS_11170 5750 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5916 7058 gene locus_tag LOCUS_11180 gene carA 5916 7058 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38098 protein_id gnl|my_center|LOCUS_11180 >Feature sequence126 820 2466 gene locus_tag LOCUS_11190 820 2466 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_11190 3204 2578 gene locus_tag LOCUS_11200 3204 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_11200 3448 4365 gene locus_tag LOCUS_11210 3448 4365 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_11210 6952 4484 gene locus_tag LOCUS_11220 6952 4484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence127 474 2024 gene locus_tag LOCUS_11230 gene nusA 474 2024 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_11230 2027 4597 gene locus_tag LOCUS_11240 gene infB 2027 4597 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_11240 4617 4964 gene locus_tag LOCUS_11250 gene rbfA 4617 4964 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU79 protein_id gnl|my_center|LOCUS_11250 4964 5929 gene locus_tag LOCUS_11260 gene truB 4964 5929 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI9 protein_id gnl|my_center|LOCUS_11260 6027 6296 gene locus_tag LOCUS_11270 gene rpsO 6027 6296 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN0 protein_id gnl|my_center|LOCUS_11270 >Feature sequence128 1133 333 gene locus_tag LOCUS_11280 gene paaG 1133 333 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_11280 2576 1140 gene locus_tag LOCUS_11290 2576 1140 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090487.1 protein_id gnl|my_center|LOCUS_11290 2828 3832 gene locus_tag LOCUS_11300 2828 3832 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_11300 4781 3996 gene locus_tag LOCUS_11310 gene dltE 4781 3996 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_11310 5162 4839 gene locus_tag LOCUS_11320 gene arsR 5162 4839 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426919.1 protein_id gnl|my_center|LOCUS_11320 6769 5354 gene locus_tag LOCUS_11330 6769 5354 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701275.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence129 1185 235 gene locus_tag LOCUS_11340 gene thrB 1185 235 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4W557 protein_id gnl|my_center|LOCUS_11340 1554 1204 gene locus_tag LOCUS_11350 1554 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_11350 1676 4408 gene locus_tag LOCUS_11360 gene polA 1676 4408 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_11360 4513 5253 gene locus_tag LOCUS_11370 gene hisA 4513 5253 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPK3 protein_id gnl|my_center|LOCUS_11370 5328 6089 gene locus_tag LOCUS_11380 gene hisF 5328 6089 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_11380 6086 6469 gene locus_tag LOCUS_11390 gene hisI 6086 6469 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY9 protein_id gnl|my_center|LOCUS_11390 6486 6812 gene locus_tag LOCUS_11400 gene hisE 6486 6812 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE7 protein_id gnl|my_center|LOCUS_11400 6868 7089 gene locus_tag LOCUS_11410 6868 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence130 406 894 gene locus_tag LOCUS_11420 406 894 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369890.1 protein_id gnl|my_center|LOCUS_11420 1014 1502 gene locus_tag LOCUS_11430 1014 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1635 2057 gene locus_tag LOCUS_11440 1635 2057 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729322.1 protein_id gnl|my_center|LOCUS_11440 2069 2971 gene locus_tag LOCUS_11450 2069 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2984 3796 gene locus_tag LOCUS_11460 2984 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3843 6167 gene locus_tag LOCUS_11470 3843 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence131 <1 716 gene locus_tag LOCUS_11480 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393278.1:2-keto-4-pentenoate hydratase 730 1644 gene locus_tag LOCUS_11490 gene mhpF 730 1644 CDS product acetaldehyde dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4S7 protein_id gnl|my_center|LOCUS_11490 1644 2672 gene locus_tag LOCUS_11500 gene mhpE 1644 2672 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 protein_id gnl|my_center|LOCUS_11500 2665 3465 gene locus_tag LOCUS_11510 2665 3465 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528547.1 protein_id gnl|my_center|LOCUS_11510 3499 4431 gene locus_tag LOCUS_11520 3499 4431 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978715.1 protein_id gnl|my_center|LOCUS_11520 4597 4890 gene locus_tag LOCUS_11530 4597 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4887 5891 gene locus_tag LOCUS_11540 gene mphL 4887 5891 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_11540 5893 6168 gene locus_tag LOCUS_11550 5893 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence132 <1 1845 gene locus_tag LOCUS_11560 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391701.1:aldehyde ferredoxin oxidoreductase 1848 2129 gene locus_tag LOCUS_11570 1848 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3652 2156 gene locus_tag LOCUS_11580 gene hvsT 3652 2156 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880808.1 protein_id gnl|my_center|LOCUS_11580 3795 6716 gene locus_tag LOCUS_11590 3795 6716 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence133 108 485 gene locus_tag LOCUS_11600 108 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_11600 3002 492 gene locus_tag LOCUS_11610 3002 492 CDS product inner membrane transport permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_11610 3670 2999 gene locus_tag LOCUS_11620 3670 2999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_11620 3657 4298 gene locus_tag LOCUS_11630 gene tesA 3657 4298 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 protein_id gnl|my_center|LOCUS_11630 4295 4870 gene locus_tag LOCUS_11640 4295 4870 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_11640 4999 5343 gene locus_tag LOCUS_11650 4999 5343 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_11650 6654 5398 gene locus_tag LOCUS_11660 gene rho 6654 5398 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence134 181 855 gene locus_tag LOCUS_11670 181 855 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560165.1 protein_id gnl|my_center|LOCUS_11670 1953 877 gene locus_tag LOCUS_11680 1953 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2363 3079 gene locus_tag LOCUS_11690 2363 3079 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_11690 3438 4721 gene locus_tag LOCUS_11700 3438 4721 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339255.1 protein_id gnl|my_center|LOCUS_11700 4725 5423 gene locus_tag LOCUS_11710 4725 5423 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_11710 5420 6628 gene locus_tag LOCUS_11720 5420 6628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_11720 6792 6877 gene locus_tag LOCUS_t00110 6792 6877 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 1257 2051 gene locus_tag LOCUS_11730 1257 2051 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061715.1 protein_id gnl|my_center|LOCUS_11730 2058 2984 gene locus_tag LOCUS_11740 2058 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3037 4161 gene locus_tag LOCUS_11750 3037 4161 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_11750 4241 6433 gene locus_tag LOCUS_11760 4241 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence136 310 1014 gene locus_tag LOCUS_11770 310 1014 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815479.1 protein_id gnl|my_center|LOCUS_11770 2406 1177 gene locus_tag LOCUS_11780 2406 1177 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089177.1 protein_id gnl|my_center|LOCUS_11780 2694 4400 gene locus_tag LOCUS_11790 gene mdlC 2694 4400 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_11790 5206 4487 gene locus_tag LOCUS_11800 gene ubiE 5206 4487 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_11800 6364 5210 gene locus_tag LOCUS_11810 6364 5210 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence137 307 1164 gene locus_tag LOCUS_11820 gene mshO 307 1164 CDS product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_11820 1161 1574 gene locus_tag LOCUS_11830 1161 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2056 1592 gene locus_tag LOCUS_11840 gene trmL 2056 1592 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH4 protein_id gnl|my_center|LOCUS_11840 2073 3053 gene locus_tag LOCUS_11850 gene pyrD 2073 3053 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C3 protein_id gnl|my_center|LOCUS_11850 3375 3043 gene locus_tag LOCUS_11860 3375 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811313.1 protein_id gnl|my_center|LOCUS_11860 4770 3394 gene locus_tag LOCUS_11870 4770 3394 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_11870 <7024 4767 gene locus_tag LOCUS_11880 <7024 4767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929884.1:two-component sensor histidine kinase >Feature sequence138 366 1139 gene locus_tag LOCUS_11890 gene xthA1 366 1139 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_11890 1216 1584 gene locus_tag LOCUS_11900 1216 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1653 1856 gene locus_tag LOCUS_11910 gene rpmE 1653 1856 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS9 protein_id gnl|my_center|LOCUS_11910 2704 2057 gene locus_tag LOCUS_11920 gene engB 2704 2057 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8H0 protein_id gnl|my_center|LOCUS_11920 2948 3448 gene locus_tag LOCUS_11930 2948 3448 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_11930 3539 4168 gene locus_tag LOCUS_11940 3539 4168 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT1 protein_id gnl|my_center|LOCUS_11940 4219 5934 gene locus_tag LOCUS_11950 4219 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6393 5974 gene locus_tag LOCUS_11960 6393 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence139 <1 800 gene locus_tag LOCUS_11970 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920431.1:enoyl-CoA hydratase 2809 878 gene locus_tag LOCUS_11980 2809 878 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_11980 3741 2842 gene locus_tag LOCUS_11990 gene cysD 3741 2842 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4V5 protein_id gnl|my_center|LOCUS_11990 5134 3947 gene locus_tag LOCUS_12000 5134 3947 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_12000 5484 5918 gene locus_tag LOCUS_12010 5484 5918 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_12010 6127 6603 gene locus_tag LOCUS_12020 6127 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence140 3885 2626 gene locus_tag LOCUS_12030 3885 2626 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_12030 5226 3979 gene locus_tag LOCUS_12040 5226 3979 CDS product 2-polyprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_12040 6740 6063 gene locus_tag LOCUS_12050 6740 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence141 420 1130 gene locus_tag LOCUS_12060 420 1130 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_12060 1823 1134 gene locus_tag LOCUS_12070 1823 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2902 1916 gene locus_tag LOCUS_12080 2902 1916 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_12080 3206 2934 gene locus_tag LOCUS_12090 3206 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3428 4912 gene locus_tag LOCUS_12100 3428 4912 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_12100 4964 5380 gene locus_tag LOCUS_12110 4964 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 5392 6141 gene locus_tag LOCUS_12120 gene cobB1 5392 6141 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_12120 <6980 6138 gene locus_tag LOCUS_12130 <6980 6138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096587.1:chromate transporter >Feature sequence142 2372 3394 gene locus_tag LOCUS_12140 2372 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3622 4662 gene locus_tag LOCUS_12150 3622 4662 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_12150 4883 5560 gene locus_tag LOCUS_12160 4883 5560 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_12160 6537 5614 gene locus_tag LOCUS_12170 6537 5614 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence143 1581 484 gene locus_tag LOCUS_12180 gene mnmA 1581 484 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A1 protein_id gnl|my_center|LOCUS_12180 2067 1594 gene locus_tag LOCUS_12190 2067 1594 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_12190 5875 2090 gene locus_tag LOCUS_12200 5875 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 <6815 5885 gene locus_tag LOCUS_12210 <6815 5885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094386.1:axial filament protein >Feature sequence144 1663 470 gene locus_tag LOCUS_12220 1663 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3719 2046 gene locus_tag LOCUS_12230 3719 2046 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525042.1 protein_id gnl|my_center|LOCUS_12230 4111 5397 gene locus_tag LOCUS_12240 4111 5397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_12240 5897 6508 gene locus_tag LOCUS_12250 5897 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 6803 6642 gene locus_tag LOCUS_12260 6803 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence145 16 252 gene locus_tag LOCUS_12270 16 252 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_12270 893 411 gene locus_tag LOCUS_12280 893 411 CDS product anthranilate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190860.1 protein_id gnl|my_center|LOCUS_12280 2155 884 gene locus_tag LOCUS_12290 2155 884 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190694.1 protein_id gnl|my_center|LOCUS_12290 2305 2538 gene locus_tag LOCUS_12300 2305 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3463 2693 gene locus_tag LOCUS_12310 3463 2693 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_12310 4021 3803 gene locus_tag LOCUS_12320 4021 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4258 5202 gene locus_tag LOCUS_12330 4258 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5209 6168 gene locus_tag LOCUS_12340 5209 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence146 1521 640 gene locus_tag LOCUS_12350 1521 640 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_12350 3681 1546 gene locus_tag LOCUS_12360 3681 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5159 3678 gene locus_tag LOCUS_12370 5159 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5330 6625 gene locus_tag LOCUS_12380 gene icd 5330 6625 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_12380 >Feature sequence147 677 1819 gene locus_tag LOCUS_12390 gene lldA 677 1819 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104946.1 protein_id gnl|my_center|LOCUS_12390 3262 2042 gene locus_tag LOCUS_12400 3262 2042 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087254.1 protein_id gnl|my_center|LOCUS_12400 3938 3462 gene locus_tag LOCUS_12410 3938 3462 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_12410 6100 3974 gene locus_tag LOCUS_12420 6100 3974 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence148 3 78 gene locus_tag LOCUS_t00120 3 78 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 128 505 gene locus_tag LOCUS_12430 gene secE 128 505 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y4 protein_id gnl|my_center|LOCUS_12430 512 1045 gene locus_tag LOCUS_12440 gene nusG 512 1045 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_12440 1128 1559 gene locus_tag LOCUS_12450 gene rplK 1128 1559 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 protein_id gnl|my_center|LOCUS_12450 1563 2264 gene locus_tag LOCUS_12460 gene rplA 1563 2264 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC6 protein_id gnl|my_center|LOCUS_12460 2559 3086 gene locus_tag LOCUS_12470 gene rplJ 2559 3086 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET2 protein_id gnl|my_center|LOCUS_12470 3126 3503 gene locus_tag LOCUS_12480 gene rplL 3126 3503 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8S3 protein_id gnl|my_center|LOCUS_12480 >Feature sequence149 1043 3 gene locus_tag LOCUS_12490 1043 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2441 1125 gene locus_tag LOCUS_12500 2441 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4210 3020 gene locus_tag LOCUS_12510 4210 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3418 3344 gene locus_tag LOCUS_t00130 3418 3344 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4549 5592 gene locus_tag LOCUS_12520 4549 5592 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 protein_id gnl|my_center|LOCUS_12520 6519 5878 gene locus_tag LOCUS_12530 6519 5878 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266297.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence150 <1 1470 gene locus_tag LOCUS_12540 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705799.1:2-oxoglutarate dehydrogenase subunit E1 1521 2708 gene locus_tag LOCUS_12550 gene sucB 1521 2708 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZP6 protein_id gnl|my_center|LOCUS_12550 2717 3961 gene locus_tag LOCUS_12560 2717 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 3877 4134 gene locus_tag LOCUS_12570 3877 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 4466 4972 gene locus_tag LOCUS_12580 4466 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 protein_id gnl|my_center|LOCUS_12580 <6663 5026 gene locus_tag LOCUS_12590 <6663 5026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q746Y3:phosphoenolpyruvate carboxykinase [GTP] >Feature sequence151 <1 805 gene locus_tag LOCUS_12600 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728413.1:carboxylesterase 1037 2206 gene locus_tag LOCUS_12610 1037 2206 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_12610 2239 3729 gene locus_tag LOCUS_12620 2239 3729 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707191.1 protein_id gnl|my_center|LOCUS_12620 3814 4920 gene locus_tag LOCUS_12630 3814 4920 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533412.1 protein_id gnl|my_center|LOCUS_12630 4992 5933 gene locus_tag LOCUS_12640 4992 5933 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence152 2268 1159 gene locus_tag LOCUS_12650 gene flgI 2268 1159 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_12650 3057 2290 gene locus_tag LOCUS_12660 gene flgH 3057 2290 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_12660 3894 3109 gene locus_tag LOCUS_12670 gene flgG 3894 3109 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW66 protein_id gnl|my_center|LOCUS_12670 4668 3931 gene locus_tag LOCUS_12680 gene flgF 4668 3931 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_12680 5905 4694 gene locus_tag LOCUS_12690 gene flgE 5905 4694 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B6 protein_id gnl|my_center|LOCUS_12690 <6631 5954 gene locus_tag LOCUS_12700 <6631 5954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZW69:basal-body rod modification protein FlgD >Feature sequence153 556 1749 gene locus_tag LOCUS_12710 556 1749 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_12710 2288 2770 gene locus_tag LOCUS_12720 2288 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12720 2774 3163 gene locus_tag LOCUS_12730 2774 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12730 3411 4043 gene locus_tag LOCUS_12740 3411 4043 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_12740 4075 4743 gene locus_tag LOCUS_12750 4075 4743 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727713.1 protein_id gnl|my_center|LOCUS_12750 4839 5447 gene locus_tag LOCUS_12760 4839 5447 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_12760 5540 6265 gene locus_tag LOCUS_12770 5540 6265 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089892.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence154 431 634 gene locus_tag LOCUS_12780 431 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 994 1287 gene locus_tag LOCUS_12790 994 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_12790 1277 1546 gene locus_tag LOCUS_12800 1277 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887084.1 protein_id gnl|my_center|LOCUS_12800 1749 1958 gene locus_tag LOCUS_12810 1749 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3033 2143 gene locus_tag LOCUS_12820 3033 2143 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388653.1 protein_id gnl|my_center|LOCUS_12820 4144 3026 gene locus_tag LOCUS_12830 4144 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388654.1 protein_id gnl|my_center|LOCUS_12830 4914 4141 gene locus_tag LOCUS_12840 4914 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388655.1 protein_id gnl|my_center|LOCUS_12840 6077 4911 gene locus_tag LOCUS_12850 6077 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388656.1 protein_id gnl|my_center|LOCUS_12850 6212 6484 gene locus_tag LOCUS_12860 6212 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence155 878 2047 gene locus_tag LOCUS_12870 878 2047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_12870 3642 2356 gene locus_tag LOCUS_12880 3642 2356 CDS product 2-polyprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_12880 3718 4335 gene locus_tag LOCUS_12890 gene pmtA 3718 4335 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_12890 5309 4392 gene locus_tag LOCUS_12900 5309 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 <6515 5512 gene locus_tag LOCUS_12910 <6515 5512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729610.1:alcohol dehydrogenase >Feature sequence156 1560 634 gene locus_tag LOCUS_12920 1560 634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103396.1 protein_id gnl|my_center|LOCUS_12920 1733 2209 gene locus_tag LOCUS_12930 1733 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3326 2721 gene locus_tag LOCUS_12940 3326 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4052 3678 gene locus_tag LOCUS_12950 4052 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5694 4480 gene locus_tag LOCUS_12960 5694 4480 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBY4 protein_id gnl|my_center|LOCUS_12960 6494 5859 gene locus_tag LOCUS_12970 6494 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence157 2155 1718 gene locus_tag LOCUS_12980 gene pilE 2155 1718 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_12980 3725 2415 gene locus_tag LOCUS_12990 gene pilR 3725 2415 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_12990 5364 3733 gene locus_tag LOCUS_13000 gene pilS 5364 3733 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_13000 5566 5345 gene locus_tag LOCUS_13010 5566 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence158 563 2824 gene locus_tag LOCUS_13020 563 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2982 3644 gene locus_tag LOCUS_13030 2982 3644 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_13030 3637 4065 gene locus_tag LOCUS_13040 3637 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4079 4507 gene locus_tag LOCUS_13050 4079 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4528 5751 gene locus_tag LOCUS_13060 4528 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence159 488 2164 gene locus_tag LOCUS_13070 gene yidC 488 2164 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_13070 2246 3529 gene locus_tag LOCUS_13080 gene mnmE 2246 3529 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT07 protein_id gnl|my_center|LOCUS_13080 3581 4498 gene locus_tag LOCUS_13090 3581 4498 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_13090 4551 5315 gene locus_tag LOCUS_13100 4551 5315 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389886.1 protein_id gnl|my_center|LOCUS_13100 <6469 5318 gene locus_tag LOCUS_13110 <6469 5318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZDH0:putative polysaccharide polymerase >Feature sequence160 <1 1021 gene locus_tag LOCUS_13120 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115243.1:resistance-nodulation-cell division efflux membrane fusion protein 1018 4068 gene locus_tag LOCUS_13130 1018 4068 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_13130 4095 4871 gene locus_tag LOCUS_13140 4095 4871 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence161 <1 1545 gene locus_tag LOCUS_13150 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085732.1:acyl-CoA synthetase 2496 1711 gene locus_tag LOCUS_13160 2496 1711 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086229.1 protein_id gnl|my_center|LOCUS_13160 3410 2493 gene locus_tag LOCUS_13170 3410 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3964 3422 gene locus_tag LOCUS_13180 gene blc 3964 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_13180 4007 4771 gene locus_tag LOCUS_13190 4007 4771 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B5 protein_id gnl|my_center|LOCUS_13190 5375 4860 gene locus_tag LOCUS_13200 gene glcG 5375 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284399.1 protein_id gnl|my_center|LOCUS_13200 6185 5400 gene locus_tag LOCUS_13210 gene menB 6185 5400 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 protein_id gnl|my_center|LOCUS_13210 6433 6200 gene locus_tag LOCUS_13220 6433 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence162 <1 793 gene locus_tag LOCUS_13230 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEH6:aminotransferase 3559 1094 gene locus_tag LOCUS_13240 3559 1094 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_13240 4131 4793 gene locus_tag LOCUS_13250 4131 4793 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_13250 6208 4790 gene locus_tag LOCUS_13260 6208 4790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_13260 6423 6187 gene locus_tag LOCUS_13270 6423 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence163 1322 243 gene locus_tag LOCUS_13280 gene paaE 1322 243 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199195.1 protein_id gnl|my_center|LOCUS_13280 1817 1329 gene locus_tag LOCUS_13290 gene paaJ 1817 1329 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709130.1 protein_id gnl|my_center|LOCUS_13290 2605 1814 gene locus_tag LOCUS_13300 gene paaC 2605 1814 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199193.1 protein_id gnl|my_center|LOCUS_13300 2901 2611 gene locus_tag LOCUS_13310 gene paaB 2901 2611 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_13310 3924 2914 gene locus_tag LOCUS_13320 gene paaA 3924 2914 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523130.1 protein_id gnl|my_center|LOCUS_13320 5265 3955 gene locus_tag LOCUS_13330 gene paaK 5265 3955 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4S0 protein_id gnl|my_center|LOCUS_13330 5725 5282 gene locus_tag LOCUS_13340 gene paaI 5725 5282 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_13340 <6404 5803 gene locus_tag LOCUS_13350 <6404 5803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63YG6:stress response kinase A >Feature sequence164 1681 230 gene locus_tag LOCUS_13360 1681 230 CDS product 4-hydroxyphenylacetate 3-monooxygenase oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJP8 protein_id gnl|my_center|LOCUS_13360 3017 1746 gene locus_tag LOCUS_13370 3017 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3119 3847 gene locus_tag LOCUS_13380 3119 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4743 3832 gene locus_tag LOCUS_13390 4743 3832 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_13390 5370 4981 gene locus_tag LOCUS_13400 5370 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5520 5954 gene locus_tag LOCUS_13410 5520 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence165 24 212 gene locus_tag LOCUS_13420 24 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 755 141 gene locus_tag LOCUS_13430 755 141 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 protein_id gnl|my_center|LOCUS_13430 1363 752 gene locus_tag LOCUS_13440 1363 752 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268173.1 protein_id gnl|my_center|LOCUS_13440 2999 1911 gene locus_tag LOCUS_13450 2999 1911 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090352.1 protein_id gnl|my_center|LOCUS_13450 3948 3418 gene locus_tag LOCUS_13460 3948 3418 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_13460 4079 4666 gene locus_tag LOCUS_13470 4079 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106223.1 protein_id gnl|my_center|LOCUS_13470 4906 5556 gene locus_tag LOCUS_13480 4906 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5578 5940 gene locus_tag LOCUS_13490 5578 5940 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AJ7 protein_id gnl|my_center|LOCUS_13490 >Feature sequence166 1078 3462 gene locus_tag LOCUS_13500 1078 3462 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_13500 4105 3599 gene locus_tag LOCUS_13510 gene purE 4105 3599 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL75 protein_id gnl|my_center|LOCUS_13510 5259 4102 gene locus_tag LOCUS_13520 gene purK 5259 4102 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_13520 6046 5384 gene locus_tag LOCUS_13530 gene chrR 6046 5384 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_13530 >Feature sequence167 <1 955 gene locus_tag LOCUS_13540 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388481.1:NAD/FAD-binding protein 952 1710 gene locus_tag LOCUS_13550 952 1710 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_13550 1703 2926 gene locus_tag LOCUS_13560 1703 2926 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_13560 3422 2946 gene locus_tag LOCUS_13570 3422 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_13570 4165 3419 gene locus_tag LOCUS_13580 4165 3419 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_13580 4739 5335 gene locus_tag LOCUS_13590 4739 5335 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976133.1 protein_id gnl|my_center|LOCUS_13590 5347 5658 gene locus_tag LOCUS_13600 5347 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 5658 6008 gene locus_tag LOCUS_13610 5658 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13610 >Feature sequence168 1267 599 gene locus_tag LOCUS_13620 gene hisG 1267 599 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV4 protein_id gnl|my_center|LOCUS_13620 2561 1302 gene locus_tag LOCUS_13630 gene murA 2561 1302 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_13630 2855 2574 gene locus_tag LOCUS_13640 2855 2574 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_13640 3486 2869 gene locus_tag LOCUS_13650 3486 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3984 3589 gene locus_tag LOCUS_13660 gene gloA 3984 3589 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118996.1 protein_id gnl|my_center|LOCUS_13660 5213 4002 gene locus_tag LOCUS_13670 gene purT 5213 4002 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E56 protein_id gnl|my_center|LOCUS_13670 6346 5210 gene locus_tag LOCUS_13680 gene pdxB 6346 5210 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W9 protein_id gnl|my_center|LOCUS_13680 >Feature sequence169 3970 1520 gene locus_tag LOCUS_13690 3970 1520 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 protein_id gnl|my_center|LOCUS_13690 4175 5413 gene locus_tag LOCUS_13700 4175 5413 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_13700 6256 5618 gene locus_tag LOCUS_13710 6256 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence170 <1 1516 gene locus_tag LOCUS_13720 <1 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113365.1:thiosulfate sulfurtransferase 2511 1576 gene locus_tag LOCUS_13730 2511 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233315.2 protein_id gnl|my_center|LOCUS_13730 3630 2758 gene locus_tag LOCUS_13740 3630 2758 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_13740 4279 3833 gene locus_tag LOCUS_13750 4279 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4682 5440 gene locus_tag LOCUS_13760 4682 5440 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_13760 <6236 5552 gene locus_tag LOCUS_13770 <6236 5552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921140.1:alpha/beta hydrolase >Feature sequence171 185 1471 gene locus_tag LOCUS_13780 gene amt-1 185 1471 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_13780 1724 1488 gene locus_tag LOCUS_13790 1724 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1860 2960 gene locus_tag LOCUS_13800 1860 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2992 3810 gene locus_tag LOCUS_13810 gene aroE 2992 3810 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1W5 protein_id gnl|my_center|LOCUS_13810 4679 3876 gene locus_tag LOCUS_13820 gene rsmA 4679 3876 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A46 protein_id gnl|my_center|LOCUS_13820 5608 4676 gene locus_tag LOCUS_13830 gene pdxA 5608 4676 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT9 protein_id gnl|my_center|LOCUS_13830 <6233 5673 gene locus_tag LOCUS_13840 <6233 5673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZMG7:chaperone SurA >Feature sequence172 2087 657 gene locus_tag LOCUS_13850 2087 657 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_13850 2772 2554 gene locus_tag LOCUS_13860 2772 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2677 3132 gene locus_tag LOCUS_13870 2677 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3248 3733 gene locus_tag LOCUS_13880 3248 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3893 6151 gene locus_tag LOCUS_13890 3893 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence173 <1 677 gene locus_tag LOCUS_13900 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728663.1:cyclohexanone monooxygenase 700 1611 gene locus_tag LOCUS_13910 700 1611 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461644.1 protein_id gnl|my_center|LOCUS_13910 1990 1616 gene locus_tag LOCUS_13920 1990 1616 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315610.1 protein_id gnl|my_center|LOCUS_13920 3000 2206 gene locus_tag LOCUS_13930 gene paaG 3000 2206 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_13930 3227 3814 gene locus_tag LOCUS_13940 3227 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4023 3889 gene locus_tag LOCUS_13950 4023 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4084 4935 gene locus_tag LOCUS_13960 4084 4935 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_13960 4980 5588 gene locus_tag LOCUS_13970 4980 5588 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence174 2470 416 gene locus_tag LOCUS_13980 2470 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3353 2655 gene locus_tag LOCUS_13990 3353 2655 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_13990 3588 4568 gene locus_tag LOCUS_14000 gene kdsD 3588 4568 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_14000 4565 5104 gene locus_tag LOCUS_14010 4565 5104 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_14010 5101 5691 gene locus_tag LOCUS_14020 5101 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence175 <1 1326 gene locus_tag LOCUS_14030 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:RND transporter 1323 2408 gene locus_tag LOCUS_14040 1323 2408 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_14040 2669 2911 gene locus_tag LOCUS_14050 2669 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3996 3178 gene locus_tag LOCUS_14060 3996 3178 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140939.1 protein_id gnl|my_center|LOCUS_14060 4333 3989 gene locus_tag LOCUS_14070 4333 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4584 5210 gene locus_tag LOCUS_14080 4584 5210 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence176 807 547 gene locus_tag LOCUS_14090 807 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 997 2502 gene locus_tag LOCUS_14100 997 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2690 3736 gene locus_tag LOCUS_14110 2690 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64832 protein_id gnl|my_center|LOCUS_14110 4056 4892 gene locus_tag LOCUS_14120 4056 4892 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_14120 <6126 5016 gene locus_tag LOCUS_14130 <6126 5016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000203404.1:MFS transporter >Feature sequence177 603 1676 gene locus_tag LOCUS_14140 603 1676 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_14140 4313 1695 gene locus_tag LOCUS_14150 4313 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_14150 5223 6044 gene locus_tag LOCUS_14160 gene lpxA 5223 6044 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y776 protein_id gnl|my_center|LOCUS_14160 >Feature sequence178 316 1062 gene locus_tag LOCUS_14170 316 1062 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 protein_id gnl|my_center|LOCUS_14170 1059 1229 gene locus_tag LOCUS_14180 1059 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1226 1678 gene locus_tag LOCUS_14190 gene ccmE 1226 1678 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR01 protein_id gnl|my_center|LOCUS_14190 1675 3642 gene locus_tag LOCUS_14200 gene ccmF 1675 3642 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_14200 3647 4177 gene locus_tag LOCUS_14210 gene dsbE 3647 4177 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_14210 4177 4632 gene locus_tag LOCUS_14220 gene cycL 4177 4632 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037371.1 protein_id gnl|my_center|LOCUS_14220 4629 5834 gene locus_tag LOCUS_14230 gene cycH 4629 5834 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_14230 6110 5847 gene locus_tag LOCUS_14240 6110 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence179 651 418 gene locus_tag LOCUS_14250 651 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 741 1340 gene locus_tag LOCUS_14260 gene trpG 741 1340 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_14260 1353 2384 gene locus_tag LOCUS_14270 gene trpD 1353 2384 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_14270 2381 3199 gene locus_tag LOCUS_14280 gene trpC 2381 3199 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_14280 3622 3188 gene locus_tag LOCUS_14290 3622 3188 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_14290 4259 3603 gene locus_tag LOCUS_14300 4259 3603 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528133.1 protein_id gnl|my_center|LOCUS_14300 5745 4231 gene locus_tag LOCUS_14310 gene ilvA2 5745 4231 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I418 protein_id gnl|my_center|LOCUS_14310 >Feature sequence180 432 52 gene locus_tag LOCUS_14320 432 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 594 2387 gene locus_tag LOCUS_14330 594 2387 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_14330 3275 2436 gene locus_tag LOCUS_14340 3275 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3429 4310 gene locus_tag LOCUS_14350 3429 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4329 5348 gene locus_tag LOCUS_14360 4329 5348 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_14360 5903 5361 gene locus_tag LOCUS_14370 5903 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence181 512 360 gene locus_tag LOCUS_14380 512 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 492 629 gene locus_tag LOCUS_14390 492 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 912 1949 gene locus_tag LOCUS_14400 912 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039058.1 protein_id gnl|my_center|LOCUS_14400 3060 2056 gene locus_tag LOCUS_14410 gene nosX 3060 2056 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ4 protein_id gnl|my_center|LOCUS_14410 3821 3081 gene locus_tag LOCUS_14420 3821 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4290 3808 gene locus_tag LOCUS_14430 4290 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5704 4343 gene locus_tag LOCUS_14440 5704 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_14440 >Feature sequence182 2282 1458 gene locus_tag LOCUS_14450 2282 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2984 4915 gene locus_tag LOCUS_14460 2984 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4920 5297 gene locus_tag LOCUS_14470 4920 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence183 788 468 gene locus_tag LOCUS_14480 788 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1035 793 gene locus_tag LOCUS_14490 1035 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 1703 1053 gene locus_tag LOCUS_14500 1703 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14500 3631 2438 gene locus_tag LOCUS_14510 3631 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4921 4232 gene locus_tag LOCUS_14520 4921 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5421 5648 gene locus_tag LOCUS_14530 5421 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence184 <1 3306 gene locus_tag LOCUS_14540 <1 3306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000732543.1:cell envelope biogenesis protein AsmA 3381 3881 gene locus_tag LOCUS_14550 3381 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3862 4929 gene locus_tag LOCUS_14560 gene mutY 3862 4929 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_14560 4926 5201 gene locus_tag LOCUS_14570 4926 5201 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU80 protein_id gnl|my_center|LOCUS_14570 <5978 5209 gene locus_tag LOCUS_14580 <5978 5209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532424.1:metal-binding protein >Feature sequence185 1956 181 gene locus_tag LOCUS_14590 1956 181 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 protein_id gnl|my_center|LOCUS_14590 2023 3048 gene locus_tag LOCUS_14600 2023 3048 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527058.1 protein_id gnl|my_center|LOCUS_14600 3156 4004 gene locus_tag LOCUS_14610 3156 4004 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence186 1047 748 gene locus_tag LOCUS_14620 1047 748 CDS product phage DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202809.1 protein_id gnl|my_center|LOCUS_14620 1348 1049 gene locus_tag LOCUS_14630 1348 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204767.1 protein_id gnl|my_center|LOCUS_14630 2012 1476 gene locus_tag LOCUS_14640 2012 1476 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 protein_id gnl|my_center|LOCUS_14640 2661 2017 gene locus_tag LOCUS_14650 gene leuD 2661 2017 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8T3 protein_id gnl|my_center|LOCUS_14650 4067 2664 gene locus_tag LOCUS_14660 gene leuC 4067 2664 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEZ0 protein_id gnl|my_center|LOCUS_14660 4333 4608 gene locus_tag LOCUS_14670 4333 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4983 5882 gene locus_tag LOCUS_14680 4983 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence187 1307 552 gene locus_tag LOCUS_14690 gene rlmB 1307 552 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_14690 3495 1315 gene locus_tag LOCUS_14700 gene vacB 3495 1315 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZB9 protein_id gnl|my_center|LOCUS_14700 3536 3620 gene locus_tag LOCUS_t00140 3536 3620 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4039 4839 gene locus_tag LOCUS_14710 gene uppP2 4039 4839 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RM9 protein_id gnl|my_center|LOCUS_14710 >Feature sequence188 2263 1268 gene locus_tag LOCUS_14720 gene mucB 2263 1268 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813793.1 protein_id gnl|my_center|LOCUS_14720 2856 2260 gene locus_tag LOCUS_14730 2856 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3480 2869 gene locus_tag LOCUS_14740 3480 2869 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_14740 3582 5192 gene locus_tag LOCUS_14750 gene nadB 3582 5192 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_14750 >Feature sequence189 664 1914 gene locus_tag LOCUS_14760 664 1914 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_14760 2693 1929 gene locus_tag LOCUS_14770 2693 1929 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_14770 3072 2719 gene locus_tag LOCUS_14780 3072 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4335 3313 gene locus_tag LOCUS_14790 4335 3313 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141659.1 protein_id gnl|my_center|LOCUS_14790 5126 4335 gene locus_tag LOCUS_14800 5126 4335 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence190 <1 648 gene locus_tag LOCUS_14810 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090631.1:hydrolase 884 1666 gene locus_tag LOCUS_14820 884 1666 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_14820 2053 1919 gene locus_tag LOCUS_14830 2053 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3420 3061 gene locus_tag LOCUS_14840 3420 3061 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_14840 3718 3410 gene locus_tag LOCUS_14850 3718 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_14850 <5886 4304 gene locus_tag LOCUS_14860 <5886 4304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KJS0:GMP synthase [glutamine-hydrolyzing] >Feature sequence191 3 803 gene locus_tag LOCUS_14870 3 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 907 2277 gene locus_tag LOCUS_14880 907 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3052 3207 gene locus_tag LOCUS_14890 3052 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3222 3686 gene locus_tag LOCUS_14900 3222 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4073 5668 gene locus_tag LOCUS_14910 4073 5668 CDS product oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205184.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence192 1518 769 gene locus_tag LOCUS_14920 1518 769 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919230.1 protein_id gnl|my_center|LOCUS_14920 2725 1682 gene locus_tag LOCUS_14930 2725 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14930 3022 2747 gene locus_tag LOCUS_14940 3022 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4110 3049 gene locus_tag LOCUS_14950 4110 3049 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066799.1 protein_id gnl|my_center|LOCUS_14950 4771 5055 gene locus_tag LOCUS_14960 4771 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence193 1239 481 gene locus_tag LOCUS_14970 1239 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1359 2075 gene locus_tag LOCUS_14980 1359 2075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190866.1 protein_id gnl|my_center|LOCUS_14980 2072 3745 gene locus_tag LOCUS_14990 2072 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3789 4997 gene locus_tag LOCUS_15000 3789 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence194 <1 1078 gene locus_tag LOCUS_15010 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067514.1:aminomethyltransferase 1752 2066 gene locus_tag LOCUS_15020 1752 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15020 2220 4553 gene locus_tag LOCUS_15030 2220 4553 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229397.1 protein_id gnl|my_center|LOCUS_15030 4554 5381 gene locus_tag LOCUS_15040 4554 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence195 1910 525 gene locus_tag LOCUS_15050 1910 525 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930676.1 protein_id gnl|my_center|LOCUS_15050 2888 1914 gene locus_tag LOCUS_15060 gene oppB 2888 1914 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_15060 5032 2888 gene locus_tag LOCUS_15070 gene hbpA 5032 2888 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence196 <1 1667 gene locus_tag LOCUS_15080 <1 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731294.1:glutamate synthase 1660 3105 gene locus_tag LOCUS_15090 gene gltD 1660 3105 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_15090 3098 4153 gene locus_tag LOCUS_15100 gene hemE 3098 4153 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_15100 4628 4164 gene locus_tag LOCUS_15110 4628 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5417 4653 gene locus_tag LOCUS_15120 gene pbpG 5417 4653 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689270.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence197 288 470 gene locus_tag LOCUS_15130 288 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1736 513 gene locus_tag LOCUS_15140 1736 513 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_15140 2039 2788 gene locus_tag LOCUS_15150 2039 2788 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529425.1 protein_id gnl|my_center|LOCUS_15150 2791 3726 gene locus_tag LOCUS_15160 2791 3726 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_15160 3764 5395 gene locus_tag LOCUS_15170 3764 5395 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_15170 5409 5732 gene locus_tag LOCUS_15180 gene fdx 5409 5732 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383628.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence198 420 1088 gene locus_tag LOCUS_15190 420 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1275 3194 gene locus_tag LOCUS_15200 1275 3194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_15200 3733 3269 gene locus_tag LOCUS_15210 3733 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 <5796 3801 gene locus_tag LOCUS_15220 <5796 3801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258126.1:5-oxoprolinase >Feature sequence199 1902 1426 gene locus_tag LOCUS_15230 1902 1426 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIW4 protein_id gnl|my_center|LOCUS_15230 2236 3063 gene locus_tag LOCUS_15240 2236 3063 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence200 2265 1327 gene locus_tag LOCUS_15250 2265 1327 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_15250 2607 2266 gene locus_tag LOCUS_15260 2607 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2896 2594 gene locus_tag LOCUS_15270 2896 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence201 1304 489 gene locus_tag LOCUS_15280 1304 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 protein_id gnl|my_center|LOCUS_15280 1785 1306 gene locus_tag LOCUS_15290 1785 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2641 1775 gene locus_tag LOCUS_15300 2641 1775 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_15300 2725 3396 gene locus_tag LOCUS_15310 2725 3396 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544852.1 protein_id gnl|my_center|LOCUS_15310 4255 3905 gene locus_tag LOCUS_15320 4255 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4476 4252 gene locus_tag LOCUS_15330 4476 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_15330 5337 5173 gene locus_tag LOCUS_15340 5337 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence202 1712 1494 gene locus_tag LOCUS_15350 1712 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2671 1715 gene locus_tag LOCUS_15360 2671 1715 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_15360 4362 2704 gene locus_tag LOCUS_15370 4362 2704 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_15370 5375 4359 gene locus_tag LOCUS_15380 5375 4359 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706476.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence203 1543 50 gene locus_tag LOCUS_15390 1543 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1831 3264 gene locus_tag LOCUS_15400 1831 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_15400 3290 4492 gene locus_tag LOCUS_15410 3290 4492 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_15410 4555 5700 gene locus_tag LOCUS_15420 gene acd 4555 5700 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence204 953 81 gene locus_tag LOCUS_15430 gene tfdA 953 81 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930493.1 protein_id gnl|my_center|LOCUS_15430 2126 984 gene locus_tag LOCUS_15440 2126 984 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887960.1 protein_id gnl|my_center|LOCUS_15440 2278 3255 gene locus_tag LOCUS_15450 2278 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4128 3352 gene locus_tag LOCUS_15460 4128 3352 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_15460 <5702 4224 gene locus_tag LOCUS_15470 <5702 4224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083165.1:alcohol dehydrogenase >Feature sequence205 1574 561 gene locus_tag LOCUS_15480 1574 561 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_15480 1817 2926 gene locus_tag LOCUS_15490 1817 2926 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400502.1 protein_id gnl|my_center|LOCUS_15490 4404 3055 gene locus_tag LOCUS_15500 4404 3055 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_15500 <5692 4404 gene locus_tag LOCUS_15510 <5692 4404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089033.1:peptidase C39 >Feature sequence206 <1 648 gene locus_tag LOCUS_15520 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730147.1:2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase 645 1589 gene locus_tag LOCUS_15530 gene mhpB 645 1589 CDS product 2,3-dihydroxyphenylpropionate/2,3-dihydroxicinnamic acid 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1T3 protein_id gnl|my_center|LOCUS_15530 1747 2568 gene locus_tag LOCUS_15540 1747 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2786 3991 gene locus_tag LOCUS_15550 2786 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence207 2 298 gene locus_tag LOCUS_15560 2 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 295 981 gene locus_tag LOCUS_15570 295 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1017 1442 gene locus_tag LOCUS_15580 1017 1442 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE73 protein_id gnl|my_center|LOCUS_15580 1921 1439 gene locus_tag LOCUS_15590 gene moaC 1921 1439 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_15590 1998 2255 gene locus_tag LOCUS_15600 1998 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2245 2700 gene locus_tag LOCUS_15610 2245 2700 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_15610 2720 3655 gene locus_tag LOCUS_15620 gene pqqB 2720 3655 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEB9 protein_id gnl|my_center|LOCUS_15620 4936 3668 gene locus_tag LOCUS_15630 gene moeA 4936 3668 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_15630 5604 4933 gene locus_tag LOCUS_15640 5604 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15640 >Feature sequence208 2588 321 gene locus_tag LOCUS_15650 2588 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2883 3647 gene locus_tag LOCUS_15660 gene hpcH 2883 3647 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_15660 4620 3754 gene locus_tag LOCUS_15670 4620 3754 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_15670 4723 4959 gene locus_tag LOCUS_15680 4723 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 <5641 4926 gene locus_tag LOCUS_15690 <5641 4926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083901.1:benzoyl-CoA oxygenase subunit B >Feature sequence209 314 57 gene locus_tag LOCUS_15700 314 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 971 1348 gene locus_tag LOCUS_15710 971 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2586 1600 gene locus_tag LOCUS_15720 2586 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 3820 3026 gene locus_tag LOCUS_15730 3820 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4216 3947 gene locus_tag LOCUS_15740 4216 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4417 4857 gene locus_tag LOCUS_15750 4417 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence210 2 835 gene locus_tag LOCUS_15760 2 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 832 1833 gene locus_tag LOCUS_15770 832 1833 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_15770 1830 2687 gene locus_tag LOCUS_15780 1830 2687 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_15780 2684 3064 gene locus_tag LOCUS_15790 2684 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4200 3100 gene locus_tag LOCUS_15800 gene aguA 4200 3100 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6J9 protein_id gnl|my_center|LOCUS_15800 <5625 4451 gene locus_tag LOCUS_15810 <5625 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071612.1:helicase >Feature sequence211 354 770 gene locus_tag LOCUS_15820 354 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1438 2640 gene locus_tag LOCUS_15830 1438 2640 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_15830 2642 3232 gene locus_tag LOCUS_15840 2642 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3229 4206 gene locus_tag LOCUS_15850 3229 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4696 5559 gene locus_tag LOCUS_15860 4696 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970274.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence212 2914 329 gene locus_tag LOCUS_15870 gene cphA 2914 329 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_15870 5104 2960 gene locus_tag LOCUS_15880 gene cphA 5104 2960 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813560.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence213 <5614 4673 gene locus_tag LOCUS_15890 <5614 4673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706135.1:ABC transporter ATP-binding protein >Feature sequence214 312 830 gene locus_tag LOCUS_15900 312 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 978 1757 gene locus_tag LOCUS_15910 978 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4007 1776 gene locus_tag LOCUS_15920 4007 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4247 4537 gene locus_tag LOCUS_15930 4247 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_15930 4815 5225 gene locus_tag LOCUS_15940 4815 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence215 543 1940 gene locus_tag LOCUS_15950 543 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_15950 2109 3800 gene locus_tag LOCUS_15960 2109 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4433 3810 gene locus_tag LOCUS_15970 gene yrbC 4433 3810 CDS product organic solvent ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 protein_id gnl|my_center|LOCUS_15970 5505 4621 gene locus_tag LOCUS_15980 5505 4621 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001772481.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence216 624 1349 gene locus_tag LOCUS_15990 624 1349 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYP6 protein_id gnl|my_center|LOCUS_15990 1457 1783 gene locus_tag LOCUS_16000 1457 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1784 2215 gene locus_tag LOCUS_16010 1784 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2237 3007 gene locus_tag LOCUS_16020 2237 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3658 3020 gene locus_tag LOCUS_16030 3658 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_16030 4383 3655 gene locus_tag LOCUS_16040 4383 3655 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_16040 5288 4356 gene locus_tag LOCUS_16050 5288 4356 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence217 958 146 gene locus_tag LOCUS_16060 958 146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_16060 1904 963 gene locus_tag LOCUS_16070 1904 963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_16070 3144 1918 gene locus_tag LOCUS_16080 3144 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4390 3299 gene locus_tag LOCUS_16090 4390 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence218 907 8 gene locus_tag LOCUS_16100 907 8 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090617.1 protein_id gnl|my_center|LOCUS_16100 1089 904 gene locus_tag LOCUS_16110 1089 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081984.1 protein_id gnl|my_center|LOCUS_16110 1953 1120 gene locus_tag LOCUS_16120 1953 1120 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_16120 3133 2078 gene locus_tag LOCUS_16130 3133 2078 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS43 protein_id gnl|my_center|LOCUS_16130 4222 3245 gene locus_tag LOCUS_16140 4222 3245 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_16140 5123 4263 gene locus_tag LOCUS_16150 5123 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence219 274 705 gene locus_tag LOCUS_16160 gene infC 274 705 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65138 protein_id gnl|my_center|LOCUS_16160 727 924 gene locus_tag LOCUS_16170 gene rpmI 727 924 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D02 protein_id gnl|my_center|LOCUS_16170 951 1310 gene locus_tag LOCUS_16180 gene rplT 951 1310 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDW8 protein_id gnl|my_center|LOCUS_16180 1401 2399 gene locus_tag LOCUS_16190 gene pheS 1401 2399 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 protein_id gnl|my_center|LOCUS_16190 2440 4809 gene locus_tag LOCUS_16200 gene pheT 2440 4809 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 protein_id gnl|my_center|LOCUS_16200 4812 5114 gene locus_tag LOCUS_16210 gene ihfA 4812 5114 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T9 protein_id gnl|my_center|LOCUS_16210 5092 5448 gene locus_tag LOCUS_16220 5092 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_16220 >Feature sequence220 628 119 gene locus_tag LOCUS_16230 628 119 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404550.1 protein_id gnl|my_center|LOCUS_16230 1344 625 gene locus_tag LOCUS_16240 1344 625 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_16240 2843 1497 gene locus_tag LOCUS_16250 2843 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16250 3353 2889 gene locus_tag LOCUS_16260 3353 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16260 4373 3441 gene locus_tag LOCUS_16270 4373 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_16270 <5463 4396 gene locus_tag LOCUS_16280 <5463 4396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269376.1:CoA transferase >Feature sequence221 803 1474 gene locus_tag LOCUS_16290 803 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3015 1489 gene locus_tag LOCUS_16300 gene fumB 3015 1489 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAR2 protein_id gnl|my_center|LOCUS_16300 3748 3104 gene locus_tag LOCUS_16310 3748 3104 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_16310 4173 3856 gene locus_tag LOCUS_16320 4173 3856 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708200.1 protein_id gnl|my_center|LOCUS_16320 <5445 4254 gene locus_tag LOCUS_16330 <5445 4254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085615.1:oxidoreductase >Feature sequence222 1626 283 gene locus_tag LOCUS_16340 gene tig 1626 283 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_16340 1788 1704 gene locus_tag LOCUS_t00150 1788 1704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1989 2501 gene locus_tag LOCUS_16350 1989 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2522 2959 gene locus_tag LOCUS_16360 2522 2959 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_16360 3971 2991 gene locus_tag LOCUS_16370 gene fcl 3971 2991 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AMR4 protein_id gnl|my_center|LOCUS_16370 5109 3988 gene locus_tag LOCUS_16380 gene gmd 5109 3988 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV56 protein_id gnl|my_center|LOCUS_16380 >Feature sequence223 1394 567 gene locus_tag LOCUS_16390 gene kdsA 1394 567 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA3 protein_id gnl|my_center|LOCUS_16390 3036 1381 gene locus_tag LOCUS_16400 gene pyrG 3036 1381 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_16400 3340 5013 gene locus_tag LOCUS_16410 gene fhs 3340 5013 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J047 protein_id gnl|my_center|LOCUS_16410 >Feature sequence224 1401 1802 gene locus_tag LOCUS_16420 1401 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1854 2564 gene locus_tag LOCUS_16430 1854 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2561 4165 gene locus_tag LOCUS_16440 2561 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4568 4143 gene locus_tag LOCUS_16450 gene crcB 4568 4143 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW19 protein_id gnl|my_center|LOCUS_16450 4939 4565 gene locus_tag LOCUS_16460 4939 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence225 224 1660 gene locus_tag LOCUS_16470 224 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1819 4209 gene locus_tag LOCUS_16480 1819 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence226 <1 900 gene locus_tag LOCUS_16490 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037414.1:N-ethylammeline chlorohydrolase 1566 904 gene locus_tag LOCUS_16500 gene rnt 1566 904 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ7 protein_id gnl|my_center|LOCUS_16500 1593 3095 gene locus_tag LOCUS_16510 1593 3095 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUG3 protein_id gnl|my_center|LOCUS_16510 3109 3621 gene locus_tag LOCUS_16520 3109 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3621 4490 gene locus_tag LOCUS_16530 3621 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence227 1497 262 gene locus_tag LOCUS_16540 1497 262 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_16540 1691 2704 gene locus_tag LOCUS_16550 1691 2704 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 protein_id gnl|my_center|LOCUS_16550 2756 3430 gene locus_tag LOCUS_16560 2756 3430 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_16560 4975 3434 gene locus_tag LOCUS_16570 4975 3434 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence228 410 1804 gene locus_tag LOCUS_16580 410 1804 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_16580 1929 2627 gene locus_tag LOCUS_16590 1929 2627 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888042.1 protein_id gnl|my_center|LOCUS_16590 2781 3146 gene locus_tag LOCUS_16600 2781 3146 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_16600 3883 3194 gene locus_tag LOCUS_16610 3883 3194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_16610 4334 4588 gene locus_tag LOCUS_16620 4334 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence229 2090 534 gene locus_tag LOCUS_16630 2090 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918281.1 protein_id gnl|my_center|LOCUS_16630 2264 3520 gene locus_tag LOCUS_16640 2264 3520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_16640 4085 3546 gene locus_tag LOCUS_16650 4085 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4698 4285 gene locus_tag LOCUS_16660 4698 4285 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence230 1519 323 gene locus_tag LOCUS_16670 gene tyrS 1519 323 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX7 protein_id gnl|my_center|LOCUS_16670 2220 3284 gene locus_tag LOCUS_16680 2220 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3344 4417 gene locus_tag LOCUS_16690 gene anmK 3344 4417 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P473 protein_id gnl|my_center|LOCUS_16690 4785 4435 gene locus_tag LOCUS_16700 gene erpA 4785 4435 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 protein_id gnl|my_center|LOCUS_16700 5243 4824 gene locus_tag LOCUS_16710 5243 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence231 3395 1569 gene locus_tag LOCUS_16720 3395 1569 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_16720 3637 4617 gene locus_tag LOCUS_16730 3637 4617 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887575.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence232 2795 1584 gene locus_tag LOCUS_16740 2795 1584 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 protein_id gnl|my_center|LOCUS_16740 2957 3535 gene locus_tag LOCUS_16750 2957 3535 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWR1 protein_id gnl|my_center|LOCUS_16750 4798 3602 gene locus_tag LOCUS_16760 4798 3602 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947550.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence233 2579 162 gene locus_tag LOCUS_16770 2579 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4618 2543 gene locus_tag LOCUS_16780 4618 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence234 265 777 gene locus_tag LOCUS_16790 265 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 965 2326 gene locus_tag LOCUS_16800 gene yeiM 965 2326 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_16800 2527 4050 gene locus_tag LOCUS_16810 2527 4050 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083030.1 protein_id gnl|my_center|LOCUS_16810 4198 3980 gene locus_tag LOCUS_16820 4198 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4890 4243 gene locus_tag LOCUS_16830 4890 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence235 721 410 gene locus_tag LOCUS_16840 721 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1418 732 gene locus_tag LOCUS_16850 1418 732 CDS product periplasmic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687105.1 protein_id gnl|my_center|LOCUS_16850 1882 1421 gene locus_tag LOCUS_16860 1882 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2687 1908 gene locus_tag LOCUS_16870 2687 1908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 protein_id gnl|my_center|LOCUS_16870 3496 2684 gene locus_tag LOCUS_16880 gene mlaF 3496 2684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_16880 3717 4730 gene locus_tag LOCUS_16890 3717 4730 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence236 <1 592 gene locus_tag LOCUS_16900 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941764.1:AMP-binding protein 644 970 gene locus_tag LOCUS_16910 644 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2267 1059 gene locus_tag LOCUS_16920 2267 1059 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083717.1 protein_id gnl|my_center|LOCUS_16920 2569 3711 gene locus_tag LOCUS_16930 2569 3711 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063762.1 protein_id gnl|my_center|LOCUS_16930 4914 3829 gene locus_tag LOCUS_16940 4914 3829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942611.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence237 1161 139 gene locus_tag LOCUS_16950 1161 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 protein_id gnl|my_center|LOCUS_16950 1233 2309 gene locus_tag LOCUS_16960 gene purM 1233 2309 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R55 protein_id gnl|my_center|LOCUS_16960 3080 2319 gene locus_tag LOCUS_16970 gene trmJ 3080 2319 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX37 protein_id gnl|my_center|LOCUS_16970 3194 3991 gene locus_tag LOCUS_16980 gene suhB 3194 3991 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_16980 4952 4047 gene locus_tag LOCUS_16990 4952 4047 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence238 1428 3107 gene locus_tag LOCUS_17000 gene glnS 1428 3107 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_17000 3147 3221 gene locus_tag LOCUS_t00160 3147 3221 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3407 3931 gene locus_tag LOCUS_17010 3407 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5142 4225 gene locus_tag LOCUS_17020 5142 4225 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence239 971 321 gene locus_tag LOCUS_17030 971 321 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_17030 1331 999 gene locus_tag LOCUS_17040 1331 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1988 1419 gene locus_tag LOCUS_17050 1988 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2223 2747 gene locus_tag LOCUS_17060 2223 2747 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_17060 3745 2783 gene locus_tag LOCUS_17070 gene hslO 3745 2783 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFC8 protein_id gnl|my_center|LOCUS_17070 3994 3803 gene locus_tag LOCUS_17080 3994 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4157 4969 gene locus_tag LOCUS_17090 4157 4969 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932886.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence240 1750 725 gene locus_tag LOCUS_17100 1750 725 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_17100 1913 3130 gene locus_tag LOCUS_17110 1913 3130 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186626.1 protein_id gnl|my_center|LOCUS_17110 3627 3262 gene locus_tag LOCUS_17120 3627 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3596 4657 gene locus_tag LOCUS_17130 3596 4657 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence241 1147 236 gene locus_tag LOCUS_17140 1147 236 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_17140 2364 1159 gene locus_tag LOCUS_17150 gene ivd 2364 1159 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_17150 3213 2443 gene locus_tag LOCUS_17160 3213 2443 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096756.1 protein_id gnl|my_center|LOCUS_17160 3583 3236 gene locus_tag LOCUS_17170 3583 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4620 3601 gene locus_tag LOCUS_17180 4620 3601 CDS product tyrosine protein kinase:aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence242 236 559 gene locus_tag LOCUS_17190 236 559 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185759.1 protein_id gnl|my_center|LOCUS_17190 593 958 gene locus_tag LOCUS_17200 593 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2818 989 gene locus_tag LOCUS_17210 2818 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3671 2958 gene locus_tag LOCUS_17220 3671 2958 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_17220 4848 4144 gene locus_tag LOCUS_17230 4848 4144 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_17230 5130 4906 gene locus_tag LOCUS_17240 5130 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence243 1704 2249 gene locus_tag LOCUS_17250 1704 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2324 2839 gene locus_tag LOCUS_17260 2324 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3287 2817 gene locus_tag LOCUS_17270 3287 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4714 3284 gene locus_tag LOCUS_17280 gene phr 4714 3284 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence244 143 997 gene locus_tag LOCUS_17290 gene tesB 143 997 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_17290 1059 2852 gene locus_tag LOCUS_17300 1059 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3392 2859 gene locus_tag LOCUS_17310 3392 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3806 3480 gene locus_tag LOCUS_17320 3806 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207525.2 protein_id gnl|my_center|LOCUS_17320 4937 4116 gene locus_tag LOCUS_17330 4937 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence245 480 953 gene locus_tag LOCUS_17340 480 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 959 1483 gene locus_tag LOCUS_17350 959 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1565 2002 gene locus_tag LOCUS_17360 1565 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205089.1 protein_id gnl|my_center|LOCUS_17360 2010 2672 gene locus_tag LOCUS_17370 gene tpm 2010 2672 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT3 protein_id gnl|my_center|LOCUS_17370 3688 2909 gene locus_tag LOCUS_17380 gene bdhA 3688 2909 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_17380 3903 4883 gene locus_tag LOCUS_17390 3903 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence246 2234 3019 gene locus_tag LOCUS_17400 gene truA 2234 3019 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R5 protein_id gnl|my_center|LOCUS_17400 3115 3747 gene locus_tag LOCUS_17410 gene trpF 3115 3747 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_17410 3734 4972 gene locus_tag LOCUS_17420 gene trpB 3734 4972 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9Z8 protein_id gnl|my_center|LOCUS_17420 >Feature sequence247 316 1173 gene locus_tag LOCUS_17430 316 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015601.1 protein_id gnl|my_center|LOCUS_17430 2518 1367 gene locus_tag LOCUS_17440 2518 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 3017 2448 gene locus_tag LOCUS_17450 3017 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17450 4119 4673 gene locus_tag LOCUS_17460 4119 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence248 2809 407 gene locus_tag LOCUS_17470 2809 407 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_17470 3298 2819 gene locus_tag LOCUS_17480 3298 2819 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_17480 4191 3295 gene locus_tag LOCUS_17490 4191 3295 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807629.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence249 859 416 gene locus_tag LOCUS_17500 859 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1067 1879 gene locus_tag LOCUS_17510 1067 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1914 2765 gene locus_tag LOCUS_17520 1914 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2755 3993 gene locus_tag LOCUS_17530 2755 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3993 4553 gene locus_tag LOCUS_17540 3993 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence250 <1 993 gene locus_tag LOCUS_17550 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918307.1:aldehyde dehydrogenase 1928 1296 gene locus_tag LOCUS_17560 1928 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2908 4332 gene locus_tag LOCUS_17570 2908 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4871 4425 gene locus_tag LOCUS_17580 4871 4425 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence251 1025 570 gene locus_tag LOCUS_17590 1025 570 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 protein_id gnl|my_center|LOCUS_17590 1264 2097 gene locus_tag LOCUS_17600 gene queF 1264 2097 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0J1 protein_id gnl|my_center|LOCUS_17600 2593 2288 gene locus_tag LOCUS_17610 2593 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2852 2580 gene locus_tag LOCUS_17620 2852 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4099 2849 gene locus_tag LOCUS_17630 4099 2849 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_17630 <4994 4167 gene locus_tag LOCUS_17640 <4994 4167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941578.1:aldehyde ferredoxin oxidoreductase >Feature sequence252 917 39 gene locus_tag LOCUS_17650 917 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1344 2018 gene locus_tag LOCUS_17660 1344 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251636.2 protein_id gnl|my_center|LOCUS_17660 2142 3026 gene locus_tag LOCUS_17670 2142 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3831 3586 gene locus_tag LOCUS_17680 3831 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence253 1715 1071 gene locus_tag LOCUS_17690 1715 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4597 1712 gene locus_tag LOCUS_17700 4597 1712 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence254 2368 983 gene locus_tag LOCUS_17710 2368 983 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_17710 3169 2375 gene locus_tag LOCUS_17720 3169 2375 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_17720 3382 3197 gene locus_tag LOCUS_17730 3382 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3553 3897 gene locus_tag LOCUS_17740 3553 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 <4882 4255 gene locus_tag LOCUS_17750 <4882 4255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728383.1:amidase >Feature sequence255 <1 1083 gene locus_tag LOCUS_17760 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P7V1:polyribonucleotide nucleotidyltransferase 1849 1250 gene locus_tag LOCUS_17770 1849 1250 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGK7 protein_id gnl|my_center|LOCUS_17770 1971 2219 gene locus_tag LOCUS_17780 gene rpsP 1971 2219 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBU7 protein_id gnl|my_center|LOCUS_17780 2243 2815 gene locus_tag LOCUS_17790 gene rimM 2243 2815 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC2 protein_id gnl|my_center|LOCUS_17790 2817 3581 gene locus_tag LOCUS_17800 gene trmD 2817 3581 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4I5 protein_id gnl|my_center|LOCUS_17800 3624 3986 gene locus_tag LOCUS_17810 gene rplS 3624 3986 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH7 protein_id gnl|my_center|LOCUS_17810 4318 4043 gene locus_tag LOCUS_17820 4318 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence256 <1 1122 gene locus_tag LOCUS_17830 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963893.1:TonB-dependent receptor 1623 2585 gene locus_tag LOCUS_17840 1623 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2599 3312 gene locus_tag LOCUS_17850 gene exbB 2599 3312 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039565.1 protein_id gnl|my_center|LOCUS_17850 3344 3793 gene locus_tag LOCUS_17860 3344 3793 CDS product transport-related membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence257 1193 729 gene locus_tag LOCUS_17870 1193 729 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070496.1 protein_id gnl|my_center|LOCUS_17870 2080 1244 gene locus_tag LOCUS_17880 2080 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2633 2112 gene locus_tag LOCUS_17890 2633 2112 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_17890 3282 2740 gene locus_tag LOCUS_17900 3282 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_17900 4200 3334 gene locus_tag LOCUS_17910 4200 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 <4819 4231 gene locus_tag LOCUS_17920 <4819 4231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198339.1:ionic transporter y4hA >Feature sequence258 604 792 gene locus_tag LOCUS_17930 604 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 801 1589 gene locus_tag LOCUS_17940 801 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1661 1837 gene locus_tag LOCUS_17950 1661 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1919 2140 gene locus_tag LOCUS_17960 1919 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2219 2803 gene locus_tag LOCUS_17970 2219 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2800 3039 gene locus_tag LOCUS_17980 2800 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4816 3137 gene locus_tag LOCUS_17990 4816 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence259 420 953 gene locus_tag LOCUS_18000 420 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1706 1323 gene locus_tag LOCUS_18010 gene doc 1706 1323 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_18010 1930 1751 gene locus_tag LOCUS_18020 1930 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3471 4160 gene locus_tag LOCUS_18030 3471 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4199 4588 gene locus_tag LOCUS_18040 4199 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence260 1698 235 gene locus_tag LOCUS_18050 gene guaB 1698 235 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_18050 1804 3153 gene locus_tag LOCUS_18060 gene xseA 1804 3153 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 protein_id gnl|my_center|LOCUS_18060 3981 3226 gene locus_tag LOCUS_18070 3981 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_18070 <4790 4021 gene locus_tag LOCUS_18080 <4790 4021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CN60:lipoyl synthase >Feature sequence261 1928 1083 gene locus_tag LOCUS_18090 1928 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4206 1966 gene locus_tag LOCUS_18100 4206 1966 CDS product hydantoinase B/oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 protein_id gnl|my_center|LOCUS_18100 <4789 4232 gene locus_tag LOCUS_18110 <4789 4232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528126.1:5-oxoprolinase >Feature sequence262 503 1339 gene locus_tag LOCUS_18120 503 1339 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_18120 1733 2008 gene locus_tag LOCUS_18130 1733 2008 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM64 protein_id gnl|my_center|LOCUS_18130 2005 2349 gene locus_tag LOCUS_18140 2005 2349 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888121.1 protein_id gnl|my_center|LOCUS_18140 2510 2701 gene locus_tag LOCUS_18150 2510 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2894 3346 gene locus_tag LOCUS_18160 2894 3346 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_18160 4148 3849 gene locus_tag LOCUS_18170 4148 3849 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_18170 4439 4161 gene locus_tag LOCUS_18180 4439 4161 CDS product protein killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103035.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence263 1308 649 gene locus_tag LOCUS_18190 1308 649 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KN9 protein_id gnl|my_center|LOCUS_18190 2662 1625 gene locus_tag LOCUS_18200 gene ephA 2662 1625 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 protein_id gnl|my_center|LOCUS_18200 4134 3049 gene locus_tag LOCUS_18210 4134 3049 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957819.1 protein_id gnl|my_center|LOCUS_18210 4543 4181 gene locus_tag LOCUS_18220 4543 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence264 856 2127 gene locus_tag LOCUS_18230 gene dadA 856 2127 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_18230 2128 2511 gene locus_tag LOCUS_18240 2128 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2648 3499 gene locus_tag LOCUS_18250 2648 3499 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728436.1 protein_id gnl|my_center|LOCUS_18250 3525 4505 gene locus_tag LOCUS_18260 gene corA 3525 4505 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAG5 protein_id gnl|my_center|LOCUS_18260 >Feature sequence265 1420 194 gene locus_tag LOCUS_18270 1420 194 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808413.1 protein_id gnl|my_center|LOCUS_18270 1532 3955 gene locus_tag LOCUS_18280 1532 3955 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence266 2398 2916 gene locus_tag LOCUS_18290 2398 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2951 3181 gene locus_tag LOCUS_18300 2951 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3560 4309 gene locus_tag LOCUS_18310 3560 4309 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence267 1489 464 gene locus_tag LOCUS_18320 1489 464 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_18320 1616 2671 gene locus_tag LOCUS_18330 1616 2671 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_18330 3767 2772 gene locus_tag LOCUS_18340 3767 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107935.1 protein_id gnl|my_center|LOCUS_18340 3911 4609 gene locus_tag LOCUS_18350 gene yoxD 3911 4609 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_18350 >Feature sequence268 2216 1044 gene locus_tag LOCUS_18360 2216 1044 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_18360 2759 3907 gene locus_tag LOCUS_18370 2759 3907 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_18370 4265 3924 gene locus_tag LOCUS_18380 4265 3924 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312612.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence269 1285 902 gene locus_tag LOCUS_18390 1285 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3666 1282 gene locus_tag LOCUS_18400 3666 1282 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_18400 4131 3727 gene locus_tag LOCUS_18410 4131 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence270 1500 241 gene locus_tag LOCUS_18420 1500 241 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_18420 2213 1497 gene locus_tag LOCUS_18430 2213 1497 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_18430 2713 2210 gene locus_tag LOCUS_18440 2713 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 protein_id gnl|my_center|LOCUS_18440 3966 2890 gene locus_tag LOCUS_18450 3966 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 <4690 3970 gene locus_tag LOCUS_18460 <4690 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728068.1:isovaleryl-CoA dehydrogenase >Feature sequence271 462 1283 gene locus_tag LOCUS_18470 462 1283 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_18470 1718 1278 gene locus_tag LOCUS_18480 1718 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1846 2025 gene locus_tag LOCUS_18490 1846 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2109 2501 gene locus_tag LOCUS_18500 gene sdhC 2109 2501 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_18500 2498 2881 gene locus_tag LOCUS_18510 gene sdhD 2498 2881 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_18510 2885 4672 gene locus_tag LOCUS_18520 gene sdhA 2885 4672 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V4 protein_id gnl|my_center|LOCUS_18520 >Feature sequence272 547 1608 gene locus_tag LOCUS_18530 gene mtnA 547 1608 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ92 protein_id gnl|my_center|LOCUS_18530 1692 4289 gene locus_tag LOCUS_18540 gene gyrA 1692 4289 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 protein_id gnl|my_center|LOCUS_18540 >Feature sequence273 979 587 gene locus_tag LOCUS_18550 979 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1301 2866 gene locus_tag LOCUS_18560 gene glpA 1301 2866 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_18560 3623 3015 gene locus_tag LOCUS_18570 3623 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268174.1 protein_id gnl|my_center|LOCUS_18570 <4647 3620 gene locus_tag LOCUS_18580 <4647 3620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400549.1:mammalian cell entry protein >Feature sequence274 1331 552 gene locus_tag LOCUS_18590 1331 552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_18590 3663 1288 gene locus_tag LOCUS_18600 3663 1288 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_18600 4446 3682 gene locus_tag LOCUS_18610 4446 3682 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence275 685 170 gene locus_tag LOCUS_18620 685 170 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889280.1 protein_id gnl|my_center|LOCUS_18620 2198 744 gene locus_tag LOCUS_18630 2198 744 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812308.1 protein_id gnl|my_center|LOCUS_18630 3601 2195 gene locus_tag LOCUS_18640 3601 2195 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_18640 4542 3598 gene locus_tag LOCUS_18650 gene cobD 4542 3598 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WA0 protein_id gnl|my_center|LOCUS_18650 >Feature sequence276 <1 2462 gene locus_tag LOCUS_18660 <1 2462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887549.1:hybrid sensor histidine kinase/response regulator 3021 2572 gene locus_tag LOCUS_18670 3021 2572 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_18670 4127 3018 gene locus_tag LOCUS_18680 4127 3018 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence277 1532 762 gene locus_tag LOCUS_18690 1532 762 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_18690 2361 1537 gene locus_tag LOCUS_18700 2361 1537 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_18700 2469 3377 gene locus_tag LOCUS_18710 2469 3377 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948420.1 protein_id gnl|my_center|LOCUS_18710 4370 3393 gene locus_tag LOCUS_18720 4370 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4633 4424 gene locus_tag LOCUS_18730 4633 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence278 339 1544 gene locus_tag LOCUS_18740 gene argJ 339 1544 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCM9 protein_id gnl|my_center|LOCUS_18740 1570 2601 gene locus_tag LOCUS_18750 1570 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_18750 3399 2581 gene locus_tag LOCUS_18760 gene zapD 3399 2581 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67690 protein_id gnl|my_center|LOCUS_18760 4032 3409 gene locus_tag LOCUS_18770 gene coaE 4032 3409 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPW0 protein_id gnl|my_center|LOCUS_18770 <4618 4029 gene locus_tag LOCUS_18780 <4618 4029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPV9:type 4 prepilin-like proteins leader peptide-processing enzyme >Feature sequence279 3930 3280 gene locus_tag LOCUS_18790 3930 3280 CDS product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530752.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence280 494 778 gene locus_tag LOCUS_18800 494 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 878 3043 gene locus_tag LOCUS_18810 gene spoT 878 3043 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_18810 3219 4112 gene locus_tag LOCUS_18820 3219 4112 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064999.1 protein_id gnl|my_center|LOCUS_18820 4122 4496 gene locus_tag LOCUS_18830 4122 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence281 1253 2599 gene locus_tag LOCUS_18840 1253 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2630 3586 gene locus_tag LOCUS_18850 2630 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3586 4167 gene locus_tag LOCUS_18860 3586 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence282 1109 723 gene locus_tag LOCUS_18870 1109 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1343 3178 gene locus_tag LOCUS_18880 1343 3178 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_18880 4217 3450 gene locus_tag LOCUS_18890 4217 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence283 1169 126 gene locus_tag LOCUS_18900 1169 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968354.1 protein_id gnl|my_center|LOCUS_18900 2150 1188 gene locus_tag LOCUS_18910 2150 1188 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532895.1 protein_id gnl|my_center|LOCUS_18910 2758 2147 gene locus_tag LOCUS_18920 2758 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 protein_id gnl|my_center|LOCUS_18920 4444 3440 gene locus_tag LOCUS_18930 4444 3440 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence284 138 1973 gene locus_tag LOCUS_18940 138 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3311 1989 gene locus_tag LOCUS_18950 gene ampG 3311 1989 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence285 736 257 gene locus_tag LOCUS_18960 736 257 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_18960 1514 813 gene locus_tag LOCUS_18970 gene bioD 1514 813 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y24 protein_id gnl|my_center|LOCUS_18970 2371 1517 gene locus_tag LOCUS_18980 gene bioC 2371 1517 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF5 protein_id gnl|my_center|LOCUS_18980 3566 2391 gene locus_tag LOCUS_18990 gene bioF 3566 2391 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_18990 <4529 3563 gene locus_tag LOCUS_19000 <4529 3563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FY64:biotin synthase >Feature sequence286 <1 850 gene locus_tag LOCUS_19010 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007651015.1:rod shape-determining protein 894 1733 gene locus_tag LOCUS_19020 gene mreC 894 1733 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BN3 protein_id gnl|my_center|LOCUS_19020 1730 2224 gene locus_tag LOCUS_19030 gene mreD 1730 2224 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_19030 2221 4095 gene locus_tag LOCUS_19040 2221 4095 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence287 994 23 gene locus_tag LOCUS_19050 994 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1876 1004 gene locus_tag LOCUS_19060 1876 1004 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187690.1 protein_id gnl|my_center|LOCUS_19060 3266 1905 gene locus_tag LOCUS_19070 3266 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3399 4193 gene locus_tag LOCUS_19080 3399 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19080 >Feature sequence288 1289 447 gene locus_tag LOCUS_19090 1289 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1505 2554 gene locus_tag LOCUS_19100 1505 2554 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_19100 3691 2639 gene locus_tag LOCUS_19110 3691 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 <4518 3702 gene locus_tag LOCUS_19120 <4518 3702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073071.1:perosamine synthetase-related protein >Feature sequence289 <1 1282 gene locus_tag LOCUS_19130 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958177.1:Fe-S cluster assembly protein SufB 1303 2052 gene locus_tag LOCUS_19140 gene ynhD 1303 2052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_19140 2052 3353 gene locus_tag LOCUS_19150 2052 3353 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141372.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence290 226 2079 gene locus_tag LOCUS_19160 gene atuA 226 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_19160 2073 3545 gene locus_tag LOCUS_19170 2073 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3585 4082 gene locus_tag LOCUS_19180 3585 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence291 <1 620 gene locus_tag LOCUS_19190 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P20580:anthranilate synthase component 1 note possible pseudo, frameshifted 820 1422 gene locus_tag LOCUS_19200 820 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2220 1468 gene locus_tag LOCUS_19210 gene fabG 2220 1468 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_19210 2450 4174 gene locus_tag LOCUS_19220 2450 4174 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence292 <1 2666 gene locus_tag LOCUS_19230 <1 2666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3I6:chromosome partition protein Smc 2708 3568 gene locus_tag LOCUS_19240 gene zipA 2708 3568 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I5 protein_id gnl|my_center|LOCUS_19240 >Feature sequence293 2 1216 gene locus_tag LOCUS_19250 2 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1213 2064 gene locus_tag LOCUS_19260 gene fdhD 1213 2064 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_19260 2071 2298 gene locus_tag LOCUS_19270 2071 2298 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067107.1 protein_id gnl|my_center|LOCUS_19270 4106 2352 gene locus_tag LOCUS_19280 4106 2352 CDS product 2,4-dichlorophenol 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533091.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence294 2407 767 gene locus_tag LOCUS_19290 2407 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2651 2818 gene locus_tag LOCUS_19300 2651 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 3405 3665 gene locus_tag LOCUS_19310 3405 3665 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140360.1 protein_id gnl|my_center|LOCUS_19310 3665 3985 gene locus_tag LOCUS_19320 3665 3985 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140361.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence295 1156 449 gene locus_tag LOCUS_19330 1156 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_19330 1213 1824 gene locus_tag LOCUS_19340 1213 1824 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R9 protein_id gnl|my_center|LOCUS_19340 2735 1821 gene locus_tag LOCUS_19350 gene gluQ 2735 1821 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_19350 3483 2740 gene locus_tag LOCUS_19360 gene cysZ 3483 2740 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF4 protein_id gnl|my_center|LOCUS_19360 >Feature sequence296 1013 2149 gene locus_tag LOCUS_19370 1013 2149 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_19370 2146 3405 gene locus_tag LOCUS_19380 2146 3405 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_19380 <4396 3561 gene locus_tag LOCUS_19390 <4396 3561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925892.1:acetyl-CoA acetyltransferase >Feature sequence297 2260 1289 gene locus_tag LOCUS_19400 2260 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3809 2361 gene locus_tag LOCUS_19410 3809 2361 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142772.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence298 1267 44 gene locus_tag LOCUS_19420 1267 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119225.1 protein_id gnl|my_center|LOCUS_19420 1415 2545 gene locus_tag LOCUS_19430 1415 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3350 2634 gene locus_tag LOCUS_19440 3350 2634 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038030.1 protein_id gnl|my_center|LOCUS_19440 3769 3368 gene locus_tag LOCUS_19450 3769 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3894 4205 gene locus_tag LOCUS_19460 3894 4205 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_19460 >Feature sequence299 984 601 gene locus_tag LOCUS_19470 984 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1334 1011 gene locus_tag LOCUS_19480 1334 1011 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_19480 2132 1347 gene locus_tag LOCUS_19490 gene pcaD 2132 1347 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_19490 2555 2151 gene locus_tag LOCUS_19500 gene mscL 2555 2151 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRZ6 protein_id gnl|my_center|LOCUS_19500 3460 2585 gene locus_tag LOCUS_19510 3460 2585 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889058.1 protein_id gnl|my_center|LOCUS_19510 4059 3457 gene locus_tag LOCUS_19520 4059 3457 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence300 2478 1675 gene locus_tag LOCUS_19530 gene map 2478 1675 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_19530 2662 3522 gene locus_tag LOCUS_19540 gene rpsB 2662 3522 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T12 protein_id gnl|my_center|LOCUS_19540 >Feature sequence301 1246 137 gene locus_tag LOCUS_19550 1246 137 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_19550 1166 1897 gene locus_tag LOCUS_19560 1166 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2037 3644 gene locus_tag LOCUS_19570 2037 3644 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_19570 <4330 3707 gene locus_tag LOCUS_19580 <4330 3707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038189.1:membrane protein >Feature sequence302 493 1725 gene locus_tag LOCUS_19590 493 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2193 1729 gene locus_tag LOCUS_19600 2193 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 protein_id gnl|my_center|LOCUS_19600 3589 2216 gene locus_tag LOCUS_19610 gene cysS 3589 2216 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 protein_id gnl|my_center|LOCUS_19610 <4310 3783 gene locus_tag LOCUS_19620 <4310 3783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63PT2:adenosylhomocysteinase >Feature sequence303 1316 282 gene locus_tag LOCUS_19630 1316 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1508 2386 gene locus_tag LOCUS_19640 1508 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2403 2789 gene locus_tag LOCUS_19650 2403 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168738.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence304 2495 1254 gene locus_tag LOCUS_19660 2495 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19660 2666 3670 gene locus_tag LOCUS_19670 2666 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence305 <1 1267 gene locus_tag LOCUS_19680 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389694.1:3-methylcrotonyl-CoA carboxylase subunit alpha 1270 1992 gene locus_tag LOCUS_19690 1270 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_19690 3024 2032 gene locus_tag LOCUS_19700 3024 2032 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929940.1 protein_id gnl|my_center|LOCUS_19700 3088 3903 gene locus_tag LOCUS_19710 3088 3903 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 protein_id gnl|my_center|LOCUS_19710 3890 4291 gene locus_tag LOCUS_19720 3890 4291 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence306 <1 1113 gene locus_tag LOCUS_19730 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ35:penicillin-binding protein 1B 1731 1513 gene locus_tag LOCUS_19740 1731 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3136 1823 gene locus_tag LOCUS_19750 3136 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3241 4134 gene locus_tag LOCUS_19760 3241 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4210 4286 gene locus_tag LOCUS_t00170 4210 4286 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence307 557 69 gene locus_tag LOCUS_19770 557 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1108 641 gene locus_tag LOCUS_19780 1108 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2457 1231 gene locus_tag LOCUS_19790 gene mshG 2457 1231 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_19790 4220 2457 gene locus_tag LOCUS_19800 4220 2457 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence308 1369 512 gene locus_tag LOCUS_19810 1369 512 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_19810 1602 2129 gene locus_tag LOCUS_19820 1602 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2299 2081 gene locus_tag LOCUS_19830 2299 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2689 3747 gene locus_tag LOCUS_19840 2689 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4089 3754 gene locus_tag LOCUS_19850 4089 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence309 3144 1468 gene locus_tag LOCUS_19860 3144 1468 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_19860 <4257 3250 gene locus_tag LOCUS_19870 <4257 3250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119574.1:porin >Feature sequence310 310 98 gene locus_tag LOCUS_19880 310 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 967 383 gene locus_tag LOCUS_19890 967 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_19890 2314 971 gene locus_tag LOCUS_19900 2314 971 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_19900 2847 2428 gene locus_tag LOCUS_19910 2847 2428 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_19910 3108 3338 gene locus_tag LOCUS_19920 gene xseB 3108 3338 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT36 protein_id gnl|my_center|LOCUS_19920 3328 4218 gene locus_tag LOCUS_19930 gene ispA 3328 4218 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence311 96 863 gene locus_tag LOCUS_19940 96 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 877 1212 gene locus_tag LOCUS_19950 877 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1209 1931 gene locus_tag LOCUS_19960 gene ispD 1209 1931 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57707 protein_id gnl|my_center|LOCUS_19960 1922 2392 gene locus_tag LOCUS_19970 gene ispF 1922 2392 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_19970 3218 2394 gene locus_tag LOCUS_19980 3218 2394 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_19980 3827 3243 gene locus_tag LOCUS_19990 3827 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence312 1160 3259 gene locus_tag LOCUS_20000 1160 3259 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088785.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence313 3668 750 gene locus_tag LOCUS_20010 3668 750 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_20010 4218 3661 gene locus_tag LOCUS_20020 4218 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence314 2642 3247 gene locus_tag LOCUS_20030 2642 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence315 1005 817 gene locus_tag LOCUS_20040 1005 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2135 3880 gene locus_tag LOCUS_20050 2135 3880 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence316 2646 370 gene locus_tag LOCUS_20060 2646 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3642 2761 gene locus_tag LOCUS_20070 3642 2761 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730867.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence317 989 1477 gene locus_tag LOCUS_20080 989 1477 CDS product bile-acid 7-alpha-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224714.1 protein_id gnl|my_center|LOCUS_20080 1547 2935 gene locus_tag LOCUS_20090 1547 2935 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479410.1 protein_id gnl|my_center|LOCUS_20090 4190 3192 gene locus_tag LOCUS_20100 4190 3192 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence318 518 324 gene locus_tag LOCUS_20110 518 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 813 622 gene locus_tag LOCUS_20120 813 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 931 1362 gene locus_tag LOCUS_20130 931 1362 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086163.1 protein_id gnl|my_center|LOCUS_20130 1379 1759 gene locus_tag LOCUS_20140 gene gcvH 1379 1759 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV0 protein_id gnl|my_center|LOCUS_20140 1948 2217 gene locus_tag LOCUS_20150 1948 2217 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 protein_id gnl|my_center|LOCUS_20150 <4191 3047 gene locus_tag LOCUS_20160 <4191 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B6P0:histidine kinase >Feature sequence319 <1 812 gene locus_tag LOCUS_20170 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X038:pseudouridine synthase 823 1230 gene locus_tag LOCUS_20180 823 1230 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224150.1 protein_id gnl|my_center|LOCUS_20180 1227 1913 gene locus_tag LOCUS_20190 1227 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_20190 2777 1974 gene locus_tag LOCUS_20200 2777 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_20200 3400 2798 gene locus_tag LOCUS_20210 3400 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3458 4054 gene locus_tag LOCUS_20220 3458 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence320 218 1480 gene locus_tag LOCUS_20230 218 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1613 2215 gene locus_tag LOCUS_20240 1613 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence321 <1 2782 gene locus_tag LOCUS_20250 <1 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58943:carbamoyl-phosphate synthase large chain 2782 3258 gene locus_tag LOCUS_20260 gene greA 2782 3258 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43881 protein_id gnl|my_center|LOCUS_20260 3304 3924 gene locus_tag LOCUS_20270 gene rlmE 3304 3924 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence322 2290 1733 gene locus_tag LOCUS_20280 2290 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 <4133 2527 gene locus_tag LOCUS_20290 <4133 2527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090269.1:ATP-binding protein >Feature sequence323 1513 2952 gene locus_tag LOCUS_20300 1513 2952 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_20300 3768 3001 gene locus_tag LOCUS_20310 3768 3001 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG0 protein_id gnl|my_center|LOCUS_20310 >Feature sequence324 470 991 gene locus_tag LOCUS_20320 470 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 995 1993 gene locus_tag LOCUS_20330 995 1993 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_20330 2089 2832 gene locus_tag LOCUS_20340 2089 2832 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence325 1314 466 gene locus_tag LOCUS_20350 1314 466 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_20350 2201 1440 gene locus_tag LOCUS_20360 2201 1440 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_20360 2337 3170 gene locus_tag LOCUS_20370 2337 3170 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence326 804 154 gene locus_tag LOCUS_20380 804 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 899 1156 gene locus_tag LOCUS_20390 899 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1153 1602 gene locus_tag LOCUS_20400 1153 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1736 3583 gene locus_tag LOCUS_20410 gene recQ 1736 3583 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205272.1 protein_id gnl|my_center|LOCUS_20410 3712 4053 gene locus_tag LOCUS_20420 gene phnA 3712 4053 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence327 182 586 gene locus_tag LOCUS_20430 182 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20430 611 817 gene locus_tag LOCUS_20440 611 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 814 1356 gene locus_tag LOCUS_20450 814 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_20450 1356 2597 gene locus_tag LOCUS_20460 1356 2597 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_20460 2622 3155 gene locus_tag LOCUS_20470 2622 3155 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_20470 3506 3165 gene locus_tag LOCUS_20480 3506 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence328 1166 426 gene locus_tag LOCUS_20490 gene coaX 1166 426 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XZ2 protein_id gnl|my_center|LOCUS_20490 2143 1166 gene locus_tag LOCUS_20500 gene birA 2143 1166 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E226 protein_id gnl|my_center|LOCUS_20500 3631 2237 gene locus_tag LOCUS_20510 3631 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence329 <1 1202 gene locus_tag LOCUS_20520 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124229.1:acetyl-CoA carboxylase biotin carboxylase subunit 1208 2668 gene locus_tag LOCUS_20530 1208 2668 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_20530 2665 3846 gene locus_tag LOCUS_20540 2665 3846 CDS product putative acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704185.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence330 305 81 gene locus_tag LOCUS_20550 305 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_20550 816 1562 gene locus_tag LOCUS_20560 816 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2218 1613 gene locus_tag LOCUS_20570 2218 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_20570 3068 2220 gene locus_tag LOCUS_20580 3068 2220 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence331 1742 552 gene locus_tag LOCUS_20590 1742 552 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731466.1 protein_id gnl|my_center|LOCUS_20590 3259 1739 gene locus_tag LOCUS_20600 3259 1739 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_20600 <4102 3273 gene locus_tag LOCUS_20610 <4102 3273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947961.1:glutamine synthetase >Feature sequence332 93 365 gene locus_tag LOCUS_20620 gene rpsS 93 365 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK64 protein_id gnl|my_center|LOCUS_20620 385 723 gene locus_tag LOCUS_20630 gene rplV 385 723 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU6 protein_id gnl|my_center|LOCUS_20630 727 1407 gene locus_tag LOCUS_20640 gene rpsC 727 1407 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_20640 1420 1833 gene locus_tag LOCUS_20650 gene rplP 1420 1833 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC43 protein_id gnl|my_center|LOCUS_20650 1833 2027 gene locus_tag LOCUS_20660 gene rpmC 1833 2027 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER8 protein_id gnl|my_center|LOCUS_20660 2024 2293 gene locus_tag LOCUS_20670 gene rpsQ 2024 2293 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_20670 2322 2690 gene locus_tag LOCUS_20680 gene rplN 2322 2690 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF31 protein_id gnl|my_center|LOCUS_20680 2707 3024 gene locus_tag LOCUS_20690 gene rplX 2707 3024 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER5 protein_id gnl|my_center|LOCUS_20690 3044 3583 gene locus_tag LOCUS_20700 gene rplE 3044 3583 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V9 protein_id gnl|my_center|LOCUS_20700 3589 3894 gene locus_tag LOCUS_20710 gene rpsN 3589 3894 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 protein_id gnl|my_center|LOCUS_20710 >Feature sequence333 <1 1209 gene locus_tag LOCUS_20720 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089133.1:CoA transferase 1243 2223 gene locus_tag LOCUS_20730 1243 2223 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_20730 2372 2989 gene locus_tag LOCUS_20740 2372 2989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216652.1 protein_id gnl|my_center|LOCUS_20740 3151 4065 gene locus_tag LOCUS_20750 3151 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence334 408 1733 gene locus_tag LOCUS_20760 gene argA 408 1733 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR2 protein_id gnl|my_center|LOCUS_20760 4042 1772 gene locus_tag LOCUS_20770 4042 1772 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence335 1451 1209 gene locus_tag LOCUS_20780 1451 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3691 1610 gene locus_tag LOCUS_20790 3691 1610 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence336 1587 301 gene locus_tag LOCUS_20800 gene bioA 1587 301 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y234 protein_id gnl|my_center|LOCUS_20800 2648 1602 gene locus_tag LOCUS_20810 gene pyrC 2648 1602 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5N6 protein_id gnl|my_center|LOCUS_20810 3186 2707 gene locus_tag LOCUS_20820 3186 2707 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063809.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence337 1608 241 gene locus_tag LOCUS_20830 1608 241 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194658.1 protein_id gnl|my_center|LOCUS_20830 3127 1841 gene locus_tag LOCUS_20840 3127 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3451 3538 gene locus_tag LOCUS_t00180 3451 3538 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence338 2304 787 gene locus_tag LOCUS_20850 gene opgG 2304 787 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BU4 protein_id gnl|my_center|LOCUS_20850 3951 2503 gene locus_tag LOCUS_20860 3951 2503 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence339 3862 803 gene locus_tag LOCUS_20870 3862 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence340 2640 238 gene locus_tag LOCUS_20880 gene lon 2640 238 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_20880 <4008 2791 gene locus_tag LOCUS_20890 <4008 2791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2U0:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence341 <1 1854 gene locus_tag LOCUS_20900 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037108.1:flagellar hook protein FlgK 1858 3060 gene locus_tag LOCUS_20910 gene flgL 1858 3060 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_20910 <3997 3128 gene locus_tag LOCUS_20920 <3997 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2V099:flagellar hook-associated protein 2 >Feature sequence342 1345 167 gene locus_tag LOCUS_20930 1345 167 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_20930 1519 3033 gene locus_tag LOCUS_20940 1519 3033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 protein_id gnl|my_center|LOCUS_20940 3141 3662 gene locus_tag LOCUS_20950 3141 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence343 101 1813 gene locus_tag LOCUS_20960 101 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1810 2277 gene locus_tag LOCUS_20970 1810 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_20970 3193 2321 gene locus_tag LOCUS_20980 3193 2321 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_20980 3344 3502 gene locus_tag LOCUS_20990 3344 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3579 3977 gene locus_tag LOCUS_21000 3579 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267535.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence344 2470 1160 gene locus_tag LOCUS_21010 2470 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2663 3394 gene locus_tag LOCUS_21020 gene dsbC 2663 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence345 2134 1589 gene locus_tag LOCUS_21030 2134 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3051 2122 gene locus_tag LOCUS_21040 3051 2122 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_21040 <3960 3123 gene locus_tag LOCUS_21050 <3960 3123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970398.1:MFS transporter >Feature sequence346 2468 105 gene locus_tag LOCUS_21060 2468 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3927 2503 gene locus_tag LOCUS_21070 gene wcbE 3927 2503 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522161.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence347 109 495 gene locus_tag LOCUS_21080 109 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 492 815 gene locus_tag LOCUS_21090 492 815 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE9 protein_id gnl|my_center|LOCUS_21090 855 1448 gene locus_tag LOCUS_21100 gene recR 855 1448 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL54 protein_id gnl|my_center|LOCUS_21100 1477 2025 gene locus_tag LOCUS_21110 gene orn 1477 2025 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY8 protein_id gnl|my_center|LOCUS_21110 2022 3494 gene locus_tag LOCUS_21120 2022 3494 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI9 protein_id gnl|my_center|LOCUS_21120 >Feature sequence348 325 708 gene locus_tag LOCUS_21130 325 708 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 protein_id gnl|my_center|LOCUS_21130 705 1433 gene locus_tag LOCUS_21140 705 1433 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_21140 1611 3143 gene locus_tag LOCUS_21150 1611 3143 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_21150 3605 3162 gene locus_tag LOCUS_21160 3605 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640624.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence349 <1 994 gene locus_tag LOCUS_21170 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094928.1:superfamily I DNA and RNA helicase 2279 1077 gene locus_tag LOCUS_21180 2279 1077 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_21180 3574 2375 gene locus_tag LOCUS_21190 3574 2375 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702146.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence350 1877 1452 gene locus_tag LOCUS_21200 1877 1452 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_21200 3382 1889 gene locus_tag LOCUS_21210 gene pepA2 3382 1889 CDS product putative cytosol aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH62 protein_id gnl|my_center|LOCUS_21210 >Feature sequence351 1299 283 gene locus_tag LOCUS_21220 1299 283 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_21220 <3933 1570 gene locus_tag LOCUS_21230 <3933 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JRR6:UvrABC system protein A >Feature sequence352 <1 587 gene locus_tag LOCUS_21240 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929991.1:hydantoin utilization protein B 664 1899 gene locus_tag LOCUS_21250 664 1899 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530554.1 protein_id gnl|my_center|LOCUS_21250 1940 3733 gene locus_tag LOCUS_21260 1940 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence353 787 299 gene locus_tag LOCUS_21270 787 299 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919960.1 protein_id gnl|my_center|LOCUS_21270 858 1838 gene locus_tag LOCUS_21280 858 1838 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_21280 1851 2654 gene locus_tag LOCUS_21290 1851 2654 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_21290 3165 2821 gene locus_tag LOCUS_21300 3165 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3268 3681 gene locus_tag LOCUS_21310 3268 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence354 657 178 gene locus_tag LOCUS_21320 657 178 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268085.1 protein_id gnl|my_center|LOCUS_21320 943 2058 gene locus_tag LOCUS_21330 943 2058 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_21330 2569 2156 gene locus_tag LOCUS_21340 gene speH 2569 2156 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHM2 protein_id gnl|my_center|LOCUS_21340 3432 2569 gene locus_tag LOCUS_21350 gene speE 3432 2569 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence355 143 394 gene locus_tag LOCUS_21360 143 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 391 804 gene locus_tag LOCUS_21370 gene vapC 391 804 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SG6 protein_id gnl|my_center|LOCUS_21370 1231 1389 gene locus_tag LOCUS_21380 1231 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1386 1715 gene locus_tag LOCUS_21390 1386 1715 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967294.1 protein_id gnl|my_center|LOCUS_21390 3059 1773 gene locus_tag LOCUS_21400 3059 1773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104352.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence356 1885 2463 gene locus_tag LOCUS_21410 gene yfhC 1885 2463 CDS product putative NAD(P)H nitroreductase YfhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31571 protein_id gnl|my_center|LOCUS_21410 2542 2826 gene locus_tag LOCUS_21420 2542 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_21420 <3882 2823 gene locus_tag LOCUS_21430 <3882 2823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EBZ7:ferrochelatase 2 >Feature sequence357 <1 917 gene locus_tag LOCUS_21440 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZN70:exopolyphosphatase 2977 923 gene locus_tag LOCUS_21450 gene ppk 2977 923 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_21450 >Feature sequence358 <1 740 gene locus_tag LOCUS_21460 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086302.1:short-chain dehydrogenase 842 2665 gene locus_tag LOCUS_21470 842 2665 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence359 1012 536 gene locus_tag LOCUS_21480 1012 536 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 protein_id gnl|my_center|LOCUS_21480 1113 2000 gene locus_tag LOCUS_21490 gene aroK 1113 2000 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VG9 protein_id gnl|my_center|LOCUS_21490 2018 3694 gene locus_tag LOCUS_21500 2018 3694 CDS product benzoyl-CoA-dihydrodiol lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083900.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence360 <1 704 gene locus_tag LOCUS_21510 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KP48:coenzyme PQQ synthesis protein E 1563 715 gene locus_tag LOCUS_21520 1563 715 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I0 protein_id gnl|my_center|LOCUS_21520 2515 1556 gene locus_tag LOCUS_21530 2515 1556 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH7 protein_id gnl|my_center|LOCUS_21530 3504 2710 gene locus_tag LOCUS_21540 3504 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence361 3501 3169 gene locus_tag LOCUS_21550 3501 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence362 548 1420 gene locus_tag LOCUS_21560 548 1420 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_21560 1879 2931 gene locus_tag LOCUS_21570 1879 2931 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence363 687 2384 gene locus_tag LOCUS_21580 687 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence364 261 2120 gene locus_tag LOCUS_21590 261 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2708 2412 gene locus_tag LOCUS_21600 2708 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2849 3502 gene locus_tag LOCUS_21610 2849 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence365 1149 568 gene locus_tag LOCUS_21620 1149 568 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888853.1 protein_id gnl|my_center|LOCUS_21620 2915 1662 gene locus_tag LOCUS_21630 2915 1662 CDS product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103359.1 protein_id gnl|my_center|LOCUS_21630 3505 2927 gene locus_tag LOCUS_21640 3505 2927 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388649.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence366 1121 594 gene locus_tag LOCUS_21650 gene dsbB 1121 594 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_21650 2165 1134 gene locus_tag LOCUS_21660 2165 1134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_21660 3084 2143 gene locus_tag LOCUS_21670 3084 2143 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198416.1 protein_id gnl|my_center|LOCUS_21670 3341 3081 gene locus_tag LOCUS_21680 3341 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence367 2 250 gene locus_tag LOCUS_21690 2 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 265 1053 gene locus_tag LOCUS_21700 265 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_21700 1096 2232 gene locus_tag LOCUS_21710 gene dacC 1096 2232 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_21710 3070 2285 gene locus_tag LOCUS_21720 3070 2285 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUD2 protein_id gnl|my_center|LOCUS_21720 <3802 3081 gene locus_tag LOCUS_21730 <3802 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090885.1:ABC transporter ATP-binding protein >Feature sequence368 2306 1245 gene locus_tag LOCUS_21740 gene aroG 2306 1245 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_21740 <3797 2406 gene locus_tag LOCUS_21750 <3797 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3W8:isocitrate dehydrogenase kinase/phosphatase >Feature sequence369 364 630 gene locus_tag LOCUS_21760 364 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 758 2383 gene locus_tag LOCUS_21770 758 2383 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186811.1 protein_id gnl|my_center|LOCUS_21770 2430 2558 gene locus_tag LOCUS_21780 2430 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2569 2817 gene locus_tag LOCUS_21790 2569 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3682 3410 gene locus_tag LOCUS_21800 3682 3410 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence370 1573 2694 gene locus_tag LOCUS_21810 1573 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3266 2703 gene locus_tag LOCUS_21820 3266 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence371 111 1025 gene locus_tag LOCUS_21830 gene era 111 1025 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_21830 1053 1769 gene locus_tag LOCUS_21840 gene recO 1053 1769 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7H5 protein_id gnl|my_center|LOCUS_21840 1840 2580 gene locus_tag LOCUS_21850 gene pdxJ 1840 2580 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQE2 protein_id gnl|my_center|LOCUS_21850 2577 2957 gene locus_tag LOCUS_21860 gene acpS 2577 2957 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKK7 protein_id gnl|my_center|LOCUS_21860 >Feature sequence372 1477 404 gene locus_tag LOCUS_21870 gene cheB-1 1477 404 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH22 protein_id gnl|my_center|LOCUS_21870 1971 1474 gene locus_tag LOCUS_21880 gene cheD 1971 1474 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888V7 protein_id gnl|my_center|LOCUS_21880 2790 1975 gene locus_tag LOCUS_21890 gene cheR-1 2790 1975 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888V6 protein_id gnl|my_center|LOCUS_21890 3353 2850 gene locus_tag LOCUS_21900 3353 2850 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence373 <1 1437 gene locus_tag LOCUS_21910 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114282.1:chemotaxis protein CheA 1462 1953 gene locus_tag LOCUS_21920 1462 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1950 2696 gene locus_tag LOCUS_21930 gene motC 1950 2696 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_21930 2693 3640 gene locus_tag LOCUS_21940 gene motD 2693 3640 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence374 169 1125 gene locus_tag LOCUS_21950 169 1125 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197236.1 protein_id gnl|my_center|LOCUS_21950 1157 2392 gene locus_tag LOCUS_21960 gene cca 1157 2392 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V3 protein_id gnl|my_center|LOCUS_21960 3002 2379 gene locus_tag LOCUS_21970 gene msrA 3002 2379 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_21970 <3742 3060 gene locus_tag LOCUS_21980 <3742 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064710.1:SAM-dependent methyltransferase >Feature sequence375 <1 2119 gene locus_tag LOCUS_21990 <1 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063786.1:large subunit of N,N-dimethylformamidase 2194 3324 gene locus_tag LOCUS_22000 gene luxA 2194 3324 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263741.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence376 3249 1450 gene locus_tag LOCUS_22010 3249 1450 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence377 1445 666 gene locus_tag LOCUS_22020 gene pilF 1445 666 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_22020 2532 1438 gene locus_tag LOCUS_22030 gene rlmN 2532 1438 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_22030 2977 2552 gene locus_tag LOCUS_22040 gene ndk 2977 2552 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_22040 3643 3083 gene locus_tag LOCUS_22050 3643 3083 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence378 >Feature sequence379 1521 166 gene locus_tag LOCUS_22060 gene gor 1521 166 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_22060 1687 2598 gene locus_tag LOCUS_22070 1687 2598 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence380 1721 387 gene locus_tag LOCUS_22080 gene rimO 1721 387 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS95 protein_id gnl|my_center|LOCUS_22080 3422 1770 gene locus_tag LOCUS_22090 3422 1770 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence381 326 1129 gene locus_tag LOCUS_22100 326 1129 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_22100 1691 1185 gene locus_tag LOCUS_22110 1691 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence382 1172 870 gene locus_tag LOCUS_22120 1172 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1217 1423 gene locus_tag LOCUS_22130 1217 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1710 2966 gene locus_tag LOCUS_22140 1710 2966 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940951.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence383 655 83 gene locus_tag LOCUS_22150 655 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040628.1 protein_id gnl|my_center|LOCUS_22150 1709 828 gene locus_tag LOCUS_22160 1709 828 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 protein_id gnl|my_center|LOCUS_22160 2929 2429 gene locus_tag LOCUS_22170 2929 2429 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_22170 3252 2926 gene locus_tag LOCUS_22180 3252 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3296 3454 gene locus_tag LOCUS_22190 3296 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence384 1538 636 gene locus_tag LOCUS_22200 1538 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_22200 2278 1772 gene locus_tag LOCUS_22210 2278 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence385 453 1775 gene locus_tag LOCUS_22220 453 1775 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_22220 1772 2374 gene locus_tag LOCUS_22230 1772 2374 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 protein_id gnl|my_center|LOCUS_22230 2371 2868 gene locus_tag LOCUS_22240 gene coaD 2371 2868 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 protein_id gnl|my_center|LOCUS_22240 2880 3137 gene locus_tag LOCUS_22250 gene fdx1 2880 3137 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence386 1588 2082 gene locus_tag LOCUS_22260 1588 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2218 3561 gene locus_tag LOCUS_22270 2218 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence387 527 3100 gene locus_tag LOCUS_22280 gene clpB 527 3100 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_22280 >Feature sequence388 1770 454 gene locus_tag LOCUS_22290 1770 454 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367224.1 protein_id gnl|my_center|LOCUS_22290 2502 1810 gene locus_tag LOCUS_22300 gene fwdC 2502 1810 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_22300 3433 2513 gene locus_tag LOCUS_22310 3433 2513 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267556.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence389 49 384 gene locus_tag LOCUS_22320 49 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355701.1 protein_id gnl|my_center|LOCUS_22320 381 1127 gene locus_tag LOCUS_22330 381 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1127 2557 gene locus_tag LOCUS_22340 1127 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2550 3353 gene locus_tag LOCUS_22350 2550 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence390 430 137 gene locus_tag LOCUS_22360 430 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 2126 438 gene locus_tag LOCUS_22370 2126 438 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_22370 3388 2141 gene locus_tag LOCUS_22380 3388 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence391 <1 1565 gene locus_tag LOCUS_22390 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMI4:valine--tRNA ligase 1771 1580 gene locus_tag LOCUS_22400 1771 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719749.1 protein_id gnl|my_center|LOCUS_22400 1858 2565 gene locus_tag LOCUS_22410 gene cysE 1858 2565 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_22410 2666 3139 gene locus_tag LOCUS_22420 gene iscR 2666 3139 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_22420 3160 3483 gene locus_tag LOCUS_22430 gene iscA 3160 3483 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ0 protein_id gnl|my_center|LOCUS_22430 >Feature sequence392 890 309 gene locus_tag LOCUS_22440 890 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1331 1891 gene locus_tag LOCUS_22450 1331 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1913 2446 gene locus_tag LOCUS_22460 1913 2446 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886918.1 protein_id gnl|my_center|LOCUS_22460 2475 3449 gene locus_tag LOCUS_22470 gene qor 2475 3449 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence393 2856 1942 gene locus_tag LOCUS_22480 2856 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_22480 3437 2865 gene locus_tag LOCUS_22490 3437 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence394 124 576 gene locus_tag LOCUS_22500 124 576 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_22500 801 604 gene locus_tag LOCUS_22510 801 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1470 2609 gene locus_tag LOCUS_22520 1470 2609 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_22520 <3582 2741 gene locus_tag LOCUS_22530 <3582 2741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088916.1:acetyl-CoA acetyltransferase >Feature sequence395 1338 151 gene locus_tag LOCUS_22540 gene yjiB 1338 151 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_22540 1435 2667 gene locus_tag LOCUS_22550 1435 2667 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_22550 2664 3410 gene locus_tag LOCUS_22560 2664 3410 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225832.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence396 142 819 gene locus_tag LOCUS_22570 gene rpe 142 819 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A31 protein_id gnl|my_center|LOCUS_22570 816 1490 gene locus_tag LOCUS_22580 gene gph 816 1490 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_22580 1561 2133 gene locus_tag LOCUS_22590 1561 2133 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389625.1 protein_id gnl|my_center|LOCUS_22590 2130 2909 gene locus_tag LOCUS_22600 2130 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence397 2572 593 gene locus_tag LOCUS_22610 2572 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 <3550 2649 gene locus_tag LOCUS_22620 <3550 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056962.1:urea ABC transporter substrate-binding protein >Feature sequence398 774 100 gene locus_tag LOCUS_22630 gene mip 774 100 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_22630 2459 873 gene locus_tag LOCUS_22640 2459 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3271 2699 gene locus_tag LOCUS_22650 3271 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence399 1790 810 gene locus_tag LOCUS_22660 1790 810 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_22660 3406 1787 gene locus_tag LOCUS_22670 3406 1787 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence400 1663 245 gene locus_tag LOCUS_22680 gene amiD 1663 245 CDS product putative amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ93 protein_id gnl|my_center|LOCUS_22680 1796 2980 gene locus_tag LOCUS_22690 1796 2980 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence401 1180 1497 gene locus_tag LOCUS_22700 1180 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2470 1508 gene locus_tag LOCUS_22710 2470 1508 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_22710 3424 2480 gene locus_tag LOCUS_22720 3424 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence402 <1 604 gene locus_tag LOCUS_22730 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186177.1:aminoglycoside phosphotransferase 2833 1217 gene locus_tag LOCUS_22740 2833 1217 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence403 976 1263 gene locus_tag LOCUS_22750 gene parD-4 976 1263 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_22750 1284 1586 gene locus_tag LOCUS_22760 1284 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence404 167 457 gene locus_tag LOCUS_22770 167 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 846 1709 gene locus_tag LOCUS_22780 846 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_22780 1762 2718 gene locus_tag LOCUS_22790 1762 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence405 99 587 gene locus_tag LOCUS_22800 99 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 684 3158 gene locus_tag LOCUS_22810 gene hrpB 684 3158 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035530.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence406 <1 834 gene locus_tag LOCUS_22820 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P5L9:phosphomethylpyrimidine synthase 1857 862 gene locus_tag LOCUS_22830 gene dusA 1857 862 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRT5 protein_id gnl|my_center|LOCUS_22830 2549 1854 gene locus_tag LOCUS_22840 gene mutH 2549 1854 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG28 protein_id gnl|my_center|LOCUS_22840 <3484 2542 gene locus_tag LOCUS_22850 <3484 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886P5:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence407 <1 1140 gene locus_tag LOCUS_22860 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206172.1:4-hydroxyacetophenone monooxygenase 2183 1203 gene locus_tag LOCUS_22870 2183 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence408 441 1313 gene locus_tag LOCUS_22880 441 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2507 1380 gene locus_tag LOCUS_22890 2507 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 <3466 2517 gene locus_tag LOCUS_22900 <3466 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729678.1:long-chain-fatty-acid--CoA ligase >Feature sequence409 408 2024 gene locus_tag LOCUS_22910 408 2024 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730160.1 protein_id gnl|my_center|LOCUS_22910 2052 2453 gene locus_tag LOCUS_22920 2052 2453 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896278.1 protein_id gnl|my_center|LOCUS_22920 2467 3357 gene locus_tag LOCUS_22930 2467 3357 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence410 127 522 gene locus_tag LOCUS_22940 127 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1581 937 gene locus_tag LOCUS_22950 1581 937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185643.1 protein_id gnl|my_center|LOCUS_22950 2424 1642 gene locus_tag LOCUS_22960 2424 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence411 524 1447 gene locus_tag LOCUS_22970 524 1447 CDS product branched-chain amino acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_22970 1473 1970 gene locus_tag LOCUS_22980 1473 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2050 3123 gene locus_tag LOCUS_22990 gene ilvE 2050 3123 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence412 81 656 gene locus_tag LOCUS_23000 gene pilN 81 656 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038334.1 protein_id gnl|my_center|LOCUS_23000 653 1279 gene locus_tag LOCUS_23010 gene pilO 653 1279 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_23010 1276 1842 gene locus_tag LOCUS_23020 gene pilP 1276 1842 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence413 551 694 gene locus_tag LOCUS_23030 551 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 946 656 gene locus_tag LOCUS_23040 946 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2064 1126 gene locus_tag LOCUS_23050 2064 1126 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence414 1827 973 gene locus_tag LOCUS_23060 1827 973 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWS2 protein_id gnl|my_center|LOCUS_23060 2406 3434 gene locus_tag LOCUS_23070 2406 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence415 2482 1733 gene locus_tag LOCUS_23080 2482 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3237 2494 gene locus_tag LOCUS_23090 3237 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence416 127 1386 gene locus_tag LOCUS_23100 127 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1456 2151 gene locus_tag LOCUS_23110 1456 2151 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence417 3 533 gene locus_tag LOCUS_23120 3 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 539 1336 gene locus_tag LOCUS_23130 gene cobS 539 1336 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI17 protein_id gnl|my_center|LOCUS_23130 1390 1836 gene locus_tag LOCUS_23140 1390 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2359 1892 gene locus_tag LOCUS_23150 2359 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2875 2381 gene locus_tag LOCUS_23160 2875 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence418 2404 560 gene locus_tag LOCUS_23170 2404 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 <3404 2433 gene locus_tag LOCUS_23180 <3404 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256631.1:selenium-binding protein >Feature sequence419 1031 378 gene locus_tag LOCUS_23190 gene ccmA 1031 378 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJZ1 protein_id gnl|my_center|LOCUS_23190 1488 1075 gene locus_tag LOCUS_23200 1488 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1668 2678 gene locus_tag LOCUS_23210 gene uge 1668 2678 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence420 1746 1066 gene locus_tag LOCUS_23220 gene cmk 1746 1066 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_23220 3047 1743 gene locus_tag LOCUS_23230 gene aroA 3047 1743 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA95 protein_id gnl|my_center|LOCUS_23230 >Feature sequence421 228 141 gene locus_tag LOCUS_t00190 228 141 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 861 373 gene locus_tag LOCUS_23240 861 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23240 1112 846 gene locus_tag LOCUS_23250 1112 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23250 1272 1940 gene locus_tag LOCUS_23260 gene yccA 1272 1940 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_23260 1947 2183 gene locus_tag LOCUS_23270 1947 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 <3387 2207 gene locus_tag LOCUS_23280 <3387 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87ZS9:serine--tRNA ligase >Feature sequence422 <1 849 gene locus_tag LOCUS_23290 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87TT8:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1033 1320 gene locus_tag LOCUS_23300 1033 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence423 <1 614 gene locus_tag LOCUS_23310 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957378.1:nicotinate-nucleotide diphosphorylase (carboxylating) 1234 611 gene locus_tag LOCUS_23320 1234 611 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198967.1 protein_id gnl|my_center|LOCUS_23320 1355 2251 gene locus_tag LOCUS_23330 gene mtdA 1355 2251 CDS product MtdA bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_23330 2281 3006 gene locus_tag LOCUS_23340 2281 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence424 184 615 gene locus_tag LOCUS_23350 184 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 823 2271 gene locus_tag LOCUS_23360 823 2271 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205688.1 protein_id gnl|my_center|LOCUS_23360 2340 2912 gene locus_tag LOCUS_23370 2340 2912 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence425 683 351 gene locus_tag LOCUS_23380 683 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23380 1225 674 gene locus_tag LOCUS_23390 1225 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 1418 1552 gene locus_tag LOCUS_23400 1418 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1904 2671 gene locus_tag LOCUS_23410 1904 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence426 876 1910 gene locus_tag LOCUS_23420 876 1910 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_23420 2854 2099 gene locus_tag LOCUS_23430 2854 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence427 2521 239 gene locus_tag LOCUS_23440 gene maeB 2521 239 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 protein_id gnl|my_center|LOCUS_23440 <3359 2583 gene locus_tag LOCUS_23450 <3359 2583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FK19:signal recognition particle protein >Feature sequence428 <1 1046 gene locus_tag LOCUS_23460 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089722.1:cyclohexanone monooxygenase 1345 2322 gene locus_tag LOCUS_23470 1345 2322 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence429 1245 445 gene locus_tag LOCUS_23480 1245 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1819 1361 gene locus_tag LOCUS_23490 1819 1361 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377717.1 protein_id gnl|my_center|LOCUS_23490 <3346 1835 gene locus_tag LOCUS_23500 <3346 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525369.1:methyl-accepting chemotaxis protein >Feature sequence430 <1 668 gene locus_tag LOCUS_23510 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P478:cytochrome c oxidase subunit 2 727 2325 gene locus_tag LOCUS_23520 gene coxA 727 2325 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_23520 2442 3020 gene locus_tag LOCUS_23530 2442 3020 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence431 >Feature sequence432 146 325 gene locus_tag LOCUS_23540 146 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 408 1097 gene locus_tag LOCUS_23550 408 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2607 1264 gene locus_tag LOCUS_23560 2607 1264 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706251.1 protein_id gnl|my_center|LOCUS_23560 <3300 2604 gene locus_tag LOCUS_23570 <3300 2604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245931.1:alpha/beta hydrolase >Feature sequence433 1047 772 gene locus_tag LOCUS_23580 1047 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1676 1101 gene locus_tag LOCUS_23590 1676 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_23590 2497 1673 gene locus_tag LOCUS_23600 gene proC 2497 1673 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P757 protein_id gnl|my_center|LOCUS_23600 3238 2555 gene locus_tag LOCUS_23610 3238 2555 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_23610 >Feature sequence434 580 1857 gene locus_tag LOCUS_23620 gene glgC 580 1857 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_23620 3295 1868 gene locus_tag LOCUS_23630 3295 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence435 1224 1430 gene locus_tag LOCUS_23640 1224 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1447 1629 gene locus_tag LOCUS_23650 1447 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3104 2271 gene locus_tag LOCUS_23660 3104 2271 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202010.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence436 <1 809 gene locus_tag LOCUS_23670 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940384.1:lipoprotein 1248 3134 gene locus_tag LOCUS_23680 1248 3134 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence437 1849 839 gene locus_tag LOCUS_23690 1849 839 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390764.1 protein_id gnl|my_center|LOCUS_23690 2047 2715 gene locus_tag LOCUS_23700 gene fabG 2047 2715 CDS product 3-oxoacyl-(ACP) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence438 <1 1042 gene locus_tag LOCUS_23710 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091546.1:cation acetate symporter 1601 1101 gene locus_tag LOCUS_23720 gene ybcL 1601 1101 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 protein_id gnl|my_center|LOCUS_23720 3063 1660 gene locus_tag LOCUS_23730 gene pntB 3063 1660 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGU1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence439 1373 408 gene locus_tag LOCUS_23740 gene mcl1 1373 408 CDS product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L6 protein_id gnl|my_center|LOCUS_23740 1698 2918 gene locus_tag LOCUS_23750 1698 2918 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence440 2783 1620 gene locus_tag LOCUS_23760 2783 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence441 1881 250 gene locus_tag LOCUS_23770 1881 250 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_23770 <3244 2525 gene locus_tag LOCUS_23780 <3244 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888073.1:aspartate aminotransferase family protein >Feature sequence442 147 1394 gene locus_tag LOCUS_23790 147 1394 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_23790 1454 1990 gene locus_tag LOCUS_23800 1454 1990 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887565.1 protein_id gnl|my_center|LOCUS_23800 1999 3168 gene locus_tag LOCUS_23810 1999 3168 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence443 1390 1181 gene locus_tag LOCUS_23820 1390 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2556 1537 gene locus_tag LOCUS_23830 2556 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence444 693 1640 gene locus_tag LOCUS_23840 693 1640 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_23840 1637 3004 gene locus_tag LOCUS_23850 1637 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence445 1215 217 gene locus_tag LOCUS_23860 1215 217 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_23860 1823 1221 gene locus_tag LOCUS_23870 1823 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2614 1826 gene locus_tag LOCUS_23880 2614 1826 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7I1 protein_id gnl|my_center|LOCUS_23880 2629 2838 gene locus_tag LOCUS_23890 2629 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence446 1248 283 gene locus_tag LOCUS_23900 gene rluD 1248 283 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_23900 1344 2150 gene locus_tag LOCUS_23910 1344 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 <3230 2170 gene locus_tag LOCUS_23920 <3230 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704658.1:NAD+ synthase >Feature sequence447 1355 231 gene locus_tag LOCUS_23930 1355 231 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_23930 2788 1355 gene locus_tag LOCUS_23940 2788 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence448 2259 973 gene locus_tag LOCUS_23950 2259 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 <3201 2340 gene locus_tag LOCUS_23960 <3201 2340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926642.1:amidohydrolase >Feature sequence449 <1 501 gene locus_tag LOCUS_23970 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001120888.1:IS91 family transposase 1179 544 gene locus_tag LOCUS_23980 1179 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2443 2850 gene locus_tag LOCUS_23990 2443 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228908.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence450 500 1039 gene locus_tag LOCUS_24000 500 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1691 1050 gene locus_tag LOCUS_24010 1691 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence451 2989 1610 gene locus_tag LOCUS_24020 2989 1610 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence452 2092 950 gene locus_tag LOCUS_24030 2092 950 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_24030 2226 3050 gene locus_tag LOCUS_24040 gene ubiG 2226 3050 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence453 <1 643 gene locus_tag LOCUS_24050 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400502.1:luciferase 1888 797 gene locus_tag LOCUS_24060 1888 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 <3168 1885 gene locus_tag LOCUS_24070 <3168 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071301.1:amino acid ABC transporter permease >Feature sequence454 161 1723 gene locus_tag LOCUS_24080 161 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 <3165 2058 gene locus_tag LOCUS_24090 <3165 2058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143424.1:(2Fe-2S)-binding protein >Feature sequence455 >Feature sequence456 562 182 gene locus_tag LOCUS_24100 562 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_24100 2357 915 gene locus_tag LOCUS_24110 2357 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 <3146 2480 gene locus_tag LOCUS_24120 <3146 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921011.1:short-chain dehydrogenase >Feature sequence457 2204 417 gene locus_tag LOCUS_24130 gene hyuB 2204 417 CDS product hydantoin utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929991.1 protein_id gnl|my_center|LOCUS_24130 <3144 2258 gene locus_tag LOCUS_24140 <3144 2258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393465.1:5-oxoprolinase >Feature sequence458 1193 258 gene locus_tag LOCUS_24150 1193 258 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267404.1 protein_id gnl|my_center|LOCUS_24150 2574 1243 gene locus_tag LOCUS_24160 gene pmbA 2574 1243 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence459 1571 2716 gene locus_tag LOCUS_24170 gene dusC 1571 2716 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ95 protein_id gnl|my_center|LOCUS_24170 >Feature sequence460 2152 290 gene locus_tag LOCUS_24180 gene kup 2152 290 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63US0 protein_id gnl|my_center|LOCUS_24180 2674 2240 gene locus_tag LOCUS_24190 gene blrB 2674 2240 CDS product blue-light sensor BLUF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338827.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence461 870 2363 gene locus_tag LOCUS_24200 gene mltD 870 2363 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245218.1 protein_id gnl|my_center|LOCUS_24200 2476 2991 gene locus_tag LOCUS_24210 gene apt 2476 2991 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UR74 protein_id gnl|my_center|LOCUS_24210 >Feature sequence462 275 1930 gene locus_tag LOCUS_24220 275 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2076 2924 gene locus_tag LOCUS_24230 2076 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence463 412 693 gene locus_tag LOCUS_24240 412 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 738 1613 gene locus_tag LOCUS_24250 738 1613 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727715.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence464 1285 587 gene locus_tag LOCUS_24260 1285 587 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_24260 2494 1586 gene locus_tag LOCUS_24270 2494 1586 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040591.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence465 <1 984 gene locus_tag LOCUS_24280 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073814.1:pilus (MSHA type) biogenesis protein MshL 1019 1963 gene locus_tag LOCUS_24290 gene mshM 1019 1963 CDS product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence466 1373 2026 gene locus_tag LOCUS_24300 gene pcm 1373 2026 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_24300 2031 2345 gene locus_tag LOCUS_24310 2031 2345 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687228.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence467 <1 1065 gene locus_tag LOCUS_24320 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63JQ3:L-seryl-tRNA(Sec) selenium transferase 1062 2993 gene locus_tag LOCUS_24330 gene selB 1062 2993 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102294.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence468 2074 1784 gene locus_tag LOCUS_24340 2074 1784 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887076.1 protein_id gnl|my_center|LOCUS_24340 2343 2074 gene locus_tag LOCUS_24350 2343 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2540 2725 gene locus_tag LOCUS_24360 2540 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence469 <1 642 gene locus_tag LOCUS_24370 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969570.1:ABC transporter substrate-binding protein 673 1620 gene locus_tag LOCUS_24380 673 1620 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969569.1 protein_id gnl|my_center|LOCUS_24380 2461 1808 gene locus_tag LOCUS_24390 2461 1808 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_24390 2810 2511 gene locus_tag LOCUS_24400 2810 2511 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089871.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence470 <1 1950 gene locus_tag LOCUS_24410 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091593.1:tail-specific protease 2084 3049 gene locus_tag LOCUS_24420 gene acuC 2084 3049 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141968.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence471 <1 724 gene locus_tag LOCUS_24430 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D5CE32:pyrimidine monooxygenase RutA 2010 1012 gene locus_tag LOCUS_24440 2010 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2801 2007 gene locus_tag LOCUS_24450 2801 2007 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence472 959 183 gene locus_tag LOCUS_24460 959 183 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088800.1 protein_id gnl|my_center|LOCUS_24460 2044 1073 gene locus_tag LOCUS_24470 2044 1073 CDS product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104421.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence473 2021 924 gene locus_tag LOCUS_24480 2021 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2644 2018 gene locus_tag LOCUS_24490 gene xcpW 2644 2018 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_24490 >Feature sequence474 >Feature sequence475 <1 1348 gene locus_tag LOCUS_24500 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZD74:elongation factor 4 1345 2121 gene locus_tag LOCUS_24510 gene lepB-1 1345 2121 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_24510 2138 2542 gene locus_tag LOCUS_24520 2138 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence476 2 967 gene locus_tag LOCUS_24530 2 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 964 1989 gene locus_tag LOCUS_24540 gene ascD 964 1989 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence477 42 1070 gene locus_tag LOCUS_24550 42 1070 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196954.1 protein_id gnl|my_center|LOCUS_24550 1067 2488 gene locus_tag LOCUS_24560 1067 2488 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence478 1667 192 gene locus_tag LOCUS_24570 1667 192 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 protein_id gnl|my_center|LOCUS_24570 1885 2064 gene locus_tag LOCUS_24580 1885 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence479 747 1136 gene locus_tag LOCUS_24590 747 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1290 1790 gene locus_tag LOCUS_24600 1290 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1808 2572 gene locus_tag LOCUS_24610 1808 2572 CDS product UPF0162 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYI6 protein_id gnl|my_center|LOCUS_24610 >Feature sequence480 1749 58 gene locus_tag LOCUS_24620 1749 58 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_24620 2088 1780 gene locus_tag LOCUS_24630 2088 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_24630 <2979 2091 gene locus_tag LOCUS_24640 <2979 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72G53:asparagine--tRNA ligase >Feature sequence481 1927 1286 gene locus_tag LOCUS_24650 1927 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2207 2653 gene locus_tag LOCUS_24660 2207 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550170.1 protein_id gnl|my_center|LOCUS_24660 2650 2952 gene locus_tag LOCUS_24670 2650 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence482 1321 161 gene locus_tag LOCUS_24680 1321 161 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 protein_id gnl|my_center|LOCUS_24680 1787 1984 gene locus_tag LOCUS_24690 1787 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence483 <1 622 gene locus_tag LOCUS_24700 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62FC0:histidinol-phosphate aminotransferase 2 1391 702 gene locus_tag LOCUS_24710 1391 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2483 1482 gene locus_tag LOCUS_24720 2483 1482 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence484 1683 472 gene locus_tag LOCUS_24730 1683 472 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191282.1 protein_id gnl|my_center|LOCUS_24730 2082 1687 gene locus_tag LOCUS_24740 2082 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence485 1323 595 gene locus_tag LOCUS_24750 1323 595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811383.1 protein_id gnl|my_center|LOCUS_24750 1526 2269 gene locus_tag LOCUS_24760 1526 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence486 441 683 gene locus_tag LOCUS_24770 441 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24770 735 1013 gene locus_tag LOCUS_24780 735 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1946 1083 gene locus_tag LOCUS_24790 1946 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2274 1975 gene locus_tag LOCUS_24800 2274 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2887 2267 gene locus_tag LOCUS_24810 2887 2267 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268110.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence487 1070 1579 gene locus_tag LOCUS_24820 1070 1579 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPL2 protein_id gnl|my_center|LOCUS_24820 1644 2267 gene locus_tag LOCUS_24830 1644 2267 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_24830 <2936 2303 gene locus_tag LOCUS_24840 <2936 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UJ69:dihydroxy-acid dehydratase >Feature sequence488 1412 399 gene locus_tag LOCUS_24850 1412 399 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence489 641 426 gene locus_tag LOCUS_24860 641 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1199 972 gene locus_tag LOCUS_24870 1199 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1565 1720 gene locus_tag LOCUS_24880 1565 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1794 2621 gene locus_tag LOCUS_24890 1794 2621 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence490 1306 155 gene locus_tag LOCUS_24900 gene rhlE 1306 155 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_24900 2148 1333 gene locus_tag LOCUS_24910 2148 1333 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038631.1 protein_id gnl|my_center|LOCUS_24910 2667 2410 gene locus_tag LOCUS_24920 2667 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence491 268 648 gene locus_tag LOCUS_24930 268 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 740 1219 gene locus_tag LOCUS_24940 740 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2280 1432 gene locus_tag LOCUS_24950 2280 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence492 2580 1468 gene locus_tag LOCUS_24960 2580 1468 CDS product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence493 306 118 gene locus_tag LOCUS_24970 306 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24970 463 1626 gene locus_tag LOCUS_24980 463 1626 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_24980 1639 2238 gene locus_tag LOCUS_24990 1639 2238 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence494 163 1353 gene locus_tag LOCUS_25000 gene argG 163 1353 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_25000 2415 2167 gene locus_tag LOCUS_25010 2415 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence495 959 1447 gene locus_tag LOCUS_25020 959 1447 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence496 <1 932 gene locus_tag LOCUS_25030 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087775.1:CysB family transcriptional regulator 1229 918 gene locus_tag LOCUS_25040 1229 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087777.1 protein_id gnl|my_center|LOCUS_25040 1383 2231 gene locus_tag LOCUS_25050 1383 2231 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence497 820 1878 gene locus_tag LOCUS_25060 gene phbC 820 1878 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_25060 2425 2045 gene locus_tag LOCUS_25070 2425 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence498 <1 688 gene locus_tag LOCUS_25080 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390862.1:polysaccharide deacetylase 685 1746 gene locus_tag LOCUS_25090 685 1746 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence499 2348 1572 gene locus_tag LOCUS_25100 2348 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence500 1247 2227 gene locus_tag LOCUS_25110 1247 2227 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730748.1 protein_id gnl|my_center|LOCUS_25110 2383 2234 gene locus_tag LOCUS_25120 2383 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence501 174 1442 gene locus_tag LOCUS_25130 gene kdtA 174 1442 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_25130 1573 2139 gene locus_tag LOCUS_25140 1573 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2706 2131 gene locus_tag LOCUS_25150 2706 2131 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence502 147 701 gene locus_tag LOCUS_25160 147 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 984 2090 gene locus_tag LOCUS_25170 984 2090 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHU9 protein_id gnl|my_center|LOCUS_25170 >Feature sequence503 935 228 gene locus_tag LOCUS_25180 935 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1913 969 gene locus_tag LOCUS_25190 1913 969 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_25190 2670 1888 gene locus_tag LOCUS_25200 2670 1888 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence504 168 353 gene locus_tag LOCUS_25210 168 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 350 1522 gene locus_tag LOCUS_25220 350 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2489 1662 gene locus_tag LOCUS_25230 2489 1662 CDS product salicylate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence505 1896 1264 gene locus_tag LOCUS_25240 gene lolA 1896 1264 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA29 protein_id gnl|my_center|LOCUS_25240 <2849 1901 gene locus_tag LOCUS_25250 <2849 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0M3:DNA translocase FtsK >Feature sequence506 2208 649 gene locus_tag LOCUS_25260 2208 649 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence507 6 218 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgggtgtcctcgatttccc 282 1085 gene locus_tag LOCUS_25270 282 1085 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_25270 1270 1151 gene locus_tag LOCUS_25280 1270 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2146 1304 gene locus_tag LOCUS_25290 2146 1304 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence508 392 1669 gene locus_tag LOCUS_25300 gene purA 392 1669 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_25300 1680 2288 gene locus_tag LOCUS_25310 gene pdxH 1680 2288 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_25310 >Feature sequence509 30 1226 gene locus_tag LOCUS_25320 30 1226 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_25320 2226 1459 gene locus_tag LOCUS_25330 2226 1459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259466.1 protein_id gnl|my_center|LOCUS_25330 2325 2711 gene locus_tag LOCUS_25340 2325 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence510 <1 870 gene locus_tag LOCUS_25350 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035732.1:hybrid sensor histidine kinase/response regulator 974 1348 gene locus_tag LOCUS_25360 974 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1925 1437 gene locus_tag LOCUS_25370 1925 1437 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 protein_id gnl|my_center|LOCUS_25370 2644 1922 gene locus_tag LOCUS_25380 2644 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence511 1034 240 gene locus_tag LOCUS_25390 1034 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1895 1134 gene locus_tag LOCUS_25400 gene fabG-2 1895 1134 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence512 1096 227 gene locus_tag LOCUS_25410 1096 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1231 1752 gene locus_tag LOCUS_25420 1231 1752 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_25420 1827 2096 gene locus_tag LOCUS_25430 1827 2096 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHQ3 protein_id gnl|my_center|LOCUS_25430 2093 2764 gene locus_tag LOCUS_25440 gene lipB 2093 2764 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNA1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence513 213 701 gene locus_tag LOCUS_25450 213 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 694 1680 gene locus_tag LOCUS_25460 694 1680 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267199.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence514 2189 1740 gene locus_tag LOCUS_25470 2189 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence515 <1 799 gene locus_tag LOCUS_25480 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701052.1:putative amidohydrolase 824 1393 gene locus_tag LOCUS_25490 824 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1424 2590 gene locus_tag LOCUS_25500 1424 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence516 741 433 gene locus_tag LOCUS_25510 741 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1773 925 gene locus_tag LOCUS_25520 1773 925 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525644.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence517 1640 2200 gene locus_tag LOCUS_25530 1640 2200 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence518 536 1657 gene locus_tag LOCUS_25540 536 1657 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940269.1 protein_id gnl|my_center|LOCUS_25540 2116 2411 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq accgaggacacccactttcc >Feature sequence519 1975 692 gene locus_tag LOCUS_25550 1975 692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546679.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence520 23 844 gene locus_tag LOCUS_25560 gene dapD 23 844 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JB3 protein_id gnl|my_center|LOCUS_25560 2232 862 gene locus_tag LOCUS_25570 gene glmM 2232 862 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_25570 2766 2341 gene locus_tag LOCUS_25580 2766 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence521 590 279 gene locus_tag LOCUS_25590 590 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_25590 1146 721 gene locus_tag LOCUS_25600 1146 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1873 1256 gene locus_tag LOCUS_25610 1873 1256 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337021.1 protein_id gnl|my_center|LOCUS_25610 1998 2639 gene locus_tag LOCUS_25620 1998 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence522 <1 685 gene locus_tag LOCUS_25630 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942594.1:adenylyltransferase 852 2069 gene locus_tag LOCUS_25640 852 2069 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730847.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence523 933 412 gene locus_tag LOCUS_25650 933 412 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 protein_id gnl|my_center|LOCUS_25650 1493 930 gene locus_tag LOCUS_25660 1493 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 <2755 1679 gene locus_tag LOCUS_25670 <2755 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083824.1:amidohydrolase >Feature sequence524 887 573 gene locus_tag LOCUS_25680 gene yjcH 887 573 CDS product inner membrane protein YjcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AF55 protein_id gnl|my_center|LOCUS_25680 2592 895 gene locus_tag LOCUS_25690 2592 895 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence525 1354 626 gene locus_tag LOCUS_25700 gene aat 1354 626 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_25700 2514 1357 gene locus_tag LOCUS_25710 2514 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence526 1928 390 gene locus_tag LOCUS_25720 gene acs 1928 390 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227161.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence527 1 426 gene locus_tag LOCUS_25730 1 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 426 2012 gene locus_tag LOCUS_25740 gene iorB 426 2012 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence528 <1 1058 gene locus_tag LOCUS_25750 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140537.1:cobalamin biosynthesis protein CobW 1863 1102 gene locus_tag LOCUS_25760 gene cobA 1863 1102 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W4 protein_id gnl|my_center|LOCUS_25760 2716 2276 gene locus_tag LOCUS_25770 2716 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence529 2278 770 gene locus_tag LOCUS_25780 2278 770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012257.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence530 233 1036 gene locus_tag LOCUS_25790 gene thiG 233 1036 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 protein_id gnl|my_center|LOCUS_25790 1062 1742 gene locus_tag LOCUS_25800 gene trmB 1062 1742 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_25800 2424 1750 gene locus_tag LOCUS_25810 2424 1750 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence531 <1 1585 gene locus_tag LOCUS_25820 <1 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971127.1:methanol dehydrogenase <2695 1677 gene locus_tag LOCUS_25830 <2695 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63MZ1:2-aminoethylphosphonate--pyruvate transaminase >Feature sequence532 1 132 gene locus_tag LOCUS_25840 1 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 162 728 gene locus_tag LOCUS_25850 gene dcd 162 728 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN2 protein_id gnl|my_center|LOCUS_25850 989 741 gene locus_tag LOCUS_25860 989 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1384 986 gene locus_tag LOCUS_25870 gene msrB 1384 986 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_25870 1576 2256 gene locus_tag LOCUS_25880 1576 2256 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence533 1415 897 gene locus_tag LOCUS_25890 gene nrdR 1415 897 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH2 protein_id gnl|my_center|LOCUS_25890 <2689 1423 gene locus_tag LOCUS_25900 <2689 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ59:serine hydroxymethyltransferase >Feature sequence534 2230 146 gene locus_tag LOCUS_25910 2230 146 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence535 141 1322 gene locus_tag LOCUS_25920 141 1322 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_25920 1383 2081 gene locus_tag LOCUS_25930 gene modB 1383 2081 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038307.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence536 1113 721 gene locus_tag LOCUS_25940 1113 721 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_25940 2345 1542 gene locus_tag LOCUS_25950 gene hetN 2345 1542 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence537 1013 525 gene locus_tag LOCUS_25960 1013 525 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_25960 1437 1024 gene locus_tag LOCUS_25970 1437 1024 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_25970 2438 1635 gene locus_tag LOCUS_25980 2438 1635 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence538 <1 667 gene locus_tag LOCUS_25990 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524570.1:fatty oxidation complex subunit alpha 2047 911 gene locus_tag LOCUS_26000 2047 911 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence539 943 458 gene locus_tag LOCUS_26010 943 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2110 1073 gene locus_tag LOCUS_26020 2110 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 <2652 2128 gene locus_tag LOCUS_26030 <2652 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P702:UPF0271 protein >Feature sequence540 <1 624 gene locus_tag LOCUS_26040 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P47205:UDP-3-O-acyl-N-acetylglucosamine deacetylase 952 641 gene locus_tag LOCUS_26050 952 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence541 506 582 gene locus_tag LOCUS_t00200 506 582 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 614 690 gene locus_tag LOCUS_t00210 614 690 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 760 835 gene locus_tag LOCUS_t00220 760 835 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 864 939 gene locus_tag LOCUS_t00230 864 939 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1213 1671 gene locus_tag LOCUS_26060 1213 1671 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_26060 2013 2450 gene locus_tag LOCUS_26070 gene hspA 2013 2450 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence542 1836 1540 gene locus_tag LOCUS_26080 1836 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence543 1662 1210 gene locus_tag LOCUS_26090 1662 1210 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_26090 1920 1705 gene locus_tag LOCUS_26100 gene rpsU 1920 1705 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57165 protein_id gnl|my_center|LOCUS_26100 >Feature sequence544 <1 611 gene locus_tag LOCUS_26110 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KHH9:acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha 628 1995 gene locus_tag LOCUS_26120 gene tilS 628 1995 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_26120 >Feature sequence545 1474 20 gene locus_tag LOCUS_26130 1474 20 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_26130 <2603 1594 gene locus_tag LOCUS_26140 <2603 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5F9:Lon protease >Feature sequence546 557 1246 gene locus_tag LOCUS_26150 557 1246 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194706.1 protein_id gnl|my_center|LOCUS_26150 1246 2562 gene locus_tag LOCUS_26160 1246 2562 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence547 159 581 gene locus_tag LOCUS_26170 159 581 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021028.1 protein_id gnl|my_center|LOCUS_26170 805 611 gene locus_tag LOCUS_26180 805 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1950 958 gene locus_tag LOCUS_26190 1950 958 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230322.1 protein_id gnl|my_center|LOCUS_26190 <2574 1954 gene locus_tag LOCUS_26200 <2574 1954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259305.1:aldehyde dehydrogenase >Feature sequence548 1840 248 gene locus_tag LOCUS_26210 1840 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 <2574 1812 gene locus_tag LOCUS_26220 <2574 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261163.1:MSHA biogenesis protein MshG >Feature sequence549 1363 593 gene locus_tag LOCUS_26230 gene gst 1363 593 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039034.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence550 721 335 gene locus_tag LOCUS_26240 gene fliS 721 335 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV3 protein_id gnl|my_center|LOCUS_26240 988 1995 gene locus_tag LOCUS_26250 gene wbjB 988 1995 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence551 >Feature sequence552 <1 970 gene locus_tag LOCUS_26260 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208227.1:type IV-A pilus assembly ATPase PilB 974 2197 gene locus_tag LOCUS_26270 gene pilC 974 2197 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence553 <1 2072 gene locus_tag LOCUS_26280 <1 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036697.1:methionine synthase >Feature sequence554 >Feature sequence555 959 54 gene locus_tag LOCUS_26290 959 54 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086143.1 protein_id gnl|my_center|LOCUS_26290 2398 1088 gene locus_tag LOCUS_26300 2398 1088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence556 1995 994 gene locus_tag LOCUS_26310 1995 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence557 1497 2354 gene locus_tag LOCUS_26320 1497 2354 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence558 2350 1100 gene locus_tag LOCUS_26330 2350 1100 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530256.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence559 553 1107 gene locus_tag LOCUS_26340 553 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1138 1983 gene locus_tag LOCUS_26350 1138 1983 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ00 protein_id gnl|my_center|LOCUS_26350 >Feature sequence560 214 1359 gene locus_tag LOCUS_26360 214 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 1425 2324 gene locus_tag LOCUS_26370 1425 2324 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence561 1163 120 gene locus_tag LOCUS_26380 1163 120 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_26380 2323 1160 gene locus_tag LOCUS_26390 2323 1160 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039693.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence562 <1 916 gene locus_tag LOCUS_26400 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038655.1:oxidoreductase 1697 2143 gene locus_tag LOCUS_26410 1697 2143 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067111.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence563 1810 68 gene locus_tag LOCUS_26420 1810 68 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_26420 2164 1859 gene locus_tag LOCUS_26430 2164 1859 CDS product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408073.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence564 <1 1154 gene locus_tag LOCUS_26440 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222574.1:luciferase 1926 1327 gene locus_tag LOCUS_26450 1926 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 <2483 1982 gene locus_tag LOCUS_26460 <2483 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085669.1:poly-beta-hydroxybutyrate polymerase >Feature sequence565 1957 884 gene locus_tag LOCUS_26470 1957 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023621.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence566 1839 121 gene locus_tag LOCUS_26480 gene pepM 1839 121 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188554.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence567 1385 789 gene locus_tag LOCUS_26490 1385 789 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037707.1 protein_id gnl|my_center|LOCUS_26490 2249 1791 gene locus_tag LOCUS_26500 2249 1791 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225720.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence568 371 24 gene locus_tag LOCUS_26510 371 24 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817043.1 protein_id gnl|my_center|LOCUS_26510 440 1300 gene locus_tag LOCUS_26520 440 1300 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_26520 <2468 1395 gene locus_tag LOCUS_26530 <2468 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PDA2:homogentisate 1,2-dioxygenase >Feature sequence569 <1 560 gene locus_tag LOCUS_26540 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002213218.1:transposase 638 1198 gene locus_tag LOCUS_26550 638 1198 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_26550 1602 1880 gene locus_tag LOCUS_26560 1602 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1955 2401 gene locus_tag LOCUS_26570 1955 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence570 2036 9 gene locus_tag LOCUS_26580 gene uvrB 2036 9 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_26580 2237 2312 gene locus_tag LOCUS_t00240 2237 2312 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence571 1770 481 gene locus_tag LOCUS_26590 gene aceA 1770 481 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104513.1 protein_id gnl|my_center|LOCUS_26590 2137 2457 gene locus_tag LOCUS_26600 gene clpS 2137 2457 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 protein_id gnl|my_center|LOCUS_26600 >Feature sequence572 192 917 gene locus_tag LOCUS_26610 192 917 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_26610 1964 936 gene locus_tag LOCUS_26620 1964 936 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088202.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence573 399 800 gene locus_tag LOCUS_26630 399 800 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263648.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence574 >Feature sequence575 128 907 gene locus_tag LOCUS_26640 128 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1448 2107 gene locus_tag LOCUS_26650 1448 2107 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence576 <1 1264 gene locus_tag LOCUS_26660 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118478.1:diguanylate cyclase <2427 1261 gene locus_tag LOCUS_26670 <2427 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389696.1:propionyl-CoA carboxylase >Feature sequence577 2154 721 gene locus_tag LOCUS_26680 gene hldE 2154 721 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG9 protein_id gnl|my_center|LOCUS_26680 >Feature sequence578 553 2355 gene locus_tag LOCUS_26690 553 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence579 31 318 gene locus_tag LOCUS_26700 31 318 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence580 287 1108 gene locus_tag LOCUS_26710 287 1108 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_26710 1105 1287 gene locus_tag LOCUS_26720 1105 1287 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314023.1 protein_id gnl|my_center|LOCUS_26720 1310 2098 gene locus_tag LOCUS_26730 1310 2098 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence581 >Feature sequence582 <1 804 gene locus_tag LOCUS_26740 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEM4:tRNA 2-thiocytidine biosynthesis protein TtcA >Feature sequence583 863 249 gene locus_tag LOCUS_26750 863 249 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888318.1 protein_id gnl|my_center|LOCUS_26750 1187 879 gene locus_tag LOCUS_26760 1187 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2098 1205 gene locus_tag LOCUS_26770 2098 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence584 779 853 gene locus_tag LOCUS_t00250 779 853 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence585 768 103 gene locus_tag LOCUS_26780 768 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence586 1395 220 gene locus_tag LOCUS_26790 1395 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence587 1324 560 gene locus_tag LOCUS_26800 1324 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525542.1 protein_id gnl|my_center|LOCUS_26800 2046 1321 gene locus_tag LOCUS_26810 2046 1321 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence588 2206 1307 gene locus_tag LOCUS_26820 2206 1307 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728075.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence589 553 1101 gene locus_tag LOCUS_26830 gene ppa 553 1101 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3Z2 protein_id gnl|my_center|LOCUS_26830 1593 2237 gene locus_tag LOCUS_26840 1593 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence590 556 1104 gene locus_tag LOCUS_26850 556 1104 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729589.1 protein_id gnl|my_center|LOCUS_26850 1381 1214 gene locus_tag LOCUS_26860 1381 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence591 266 631 gene locus_tag LOCUS_26870 266 631 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_26870 1420 770 gene locus_tag LOCUS_26880 1420 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265992.1 protein_id gnl|my_center|LOCUS_26880 <2358 1554 gene locus_tag LOCUS_26890 <2358 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003901694.1:cysteine synthase >Feature sequence592 723 2144 gene locus_tag LOCUS_26900 723 2144 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence593 1945 221 gene locus_tag LOCUS_26910 1945 221 CDS product IS1634 family transposase ISMac10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence594 >Feature sequence595 575 114 gene locus_tag LOCUS_26920 gene irr 575 114 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968450.1 protein_id gnl|my_center|LOCUS_26920 750 1361 gene locus_tag LOCUS_26930 750 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1358 1948 gene locus_tag LOCUS_26940 1358 1948 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence596 <2350 829 gene locus_tag LOCUS_26950 <2350 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89P00:60 kDa chaperonin 4 >Feature sequence597 657 1940 gene locus_tag LOCUS_26960 657 1940 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940951.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence598 197 979 gene locus_tag LOCUS_26970 197 979 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_26970 1234 1743 gene locus_tag LOCUS_26980 1234 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2154 1882 gene locus_tag LOCUS_26990 2154 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence599 470 1849 gene locus_tag LOCUS_27000 gene rseP 470 1849 CDS product regulator of sigma E protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9A4 protein_id gnl|my_center|LOCUS_27000 >Feature sequence600 <1 2048 gene locus_tag LOCUS_27010 <1 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVD6:pyruvate dehydrogenase E1 component >Feature sequence601 296 1174 gene locus_tag LOCUS_27020 296 1174 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089536.1 protein_id gnl|my_center|LOCUS_27020 1177 2307 gene locus_tag LOCUS_27030 1177 2307 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence602 >Feature sequence603 1710 742 gene locus_tag LOCUS_27040 1710 742 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence604 928 1437 gene locus_tag LOCUS_27050 928 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_27050 <2306 1475 gene locus_tag LOCUS_27060 <2306 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367567.1:ABC-F family ATPase >Feature sequence605 <1 593 gene locus_tag LOCUS_27070 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D981:FMN-dependent NADH-azoreductase >Feature sequence606 >Feature sequence607 538 1164 gene locus_tag LOCUS_27080 gene tmk 538 1164 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX2 protein_id gnl|my_center|LOCUS_27080 1161 2150 gene locus_tag LOCUS_27090 gene holB 1161 2150 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence608 1489 614 gene locus_tag LOCUS_27100 gene sucD 1489 614 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_27100 <2289 1489 gene locus_tag LOCUS_27110 <2289 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ84:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence609 >Feature sequence610 1058 627 gene locus_tag LOCUS_27120 1058 627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_27120 <2275 1668 gene locus_tag LOCUS_27130 <2275 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125726.1:MFS transporter >Feature sequence611 1627 1001 gene locus_tag LOCUS_27140 1627 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence612 2132 999 gene locus_tag LOCUS_27150 2132 999 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q58 protein_id gnl|my_center|LOCUS_27150 >Feature sequence613 980 384 gene locus_tag LOCUS_27160 gene plsY 980 384 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAX7 protein_id gnl|my_center|LOCUS_27160 1081 1440 gene locus_tag LOCUS_27170 gene folB 1081 1440 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_27170 1437 1967 gene locus_tag LOCUS_27180 1437 1967 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence614 2082 1285 gene locus_tag LOCUS_27190 2082 1285 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727762.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence615 766 1422 gene locus_tag LOCUS_27200 766 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1537 1827 gene locus_tag LOCUS_27210 1537 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1824 2015 gene locus_tag LOCUS_27220 1824 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence616 143 382 gene locus_tag LOCUS_27230 143 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 411 1214 gene locus_tag LOCUS_27240 411 1214 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_27240 2251 1913 gene locus_tag LOCUS_27250 2251 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence617 1285 329 gene locus_tag LOCUS_27260 1285 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_27260 <2250 1414 gene locus_tag LOCUS_27270 <2250 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YKK8:D-3-phosphoglycerate dehydrogenase >Feature sequence618 <2243 1261 gene locus_tag LOCUS_27280 <2243 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931611.1:amidase >Feature sequence619 904 512 gene locus_tag LOCUS_27290 904 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1397 1104 gene locus_tag LOCUS_27300 1397 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2135 1761 gene locus_tag LOCUS_27310 2135 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence620 1 1038 gene locus_tag LOCUS_27320 gene lpxB 1 1038 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N0 protein_id gnl|my_center|LOCUS_27320 1071 1595 gene locus_tag LOCUS_27330 gene rnhB 1071 1595 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JD8 protein_id gnl|my_center|LOCUS_27330 >Feature sequence621 938 153 gene locus_tag LOCUS_27340 gene lpxA 938 153 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY61 protein_id gnl|my_center|LOCUS_27340 1396 935 gene locus_tag LOCUS_27350 gene fabZ 1396 935 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH57 protein_id gnl|my_center|LOCUS_27350 2106 1594 gene locus_tag LOCUS_27360 2106 1594 CDS product outer membrane protein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199535.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence622 38 787 gene locus_tag LOCUS_27370 gene anr 38 787 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_27370 1678 989 gene locus_tag LOCUS_27380 1678 989 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_27380 2100 1684 gene locus_tag LOCUS_27390 2100 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence623 >Feature sequence624 1358 141 gene locus_tag LOCUS_27400 1358 141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 protein_id gnl|my_center|LOCUS_27400 1647 2006 gene locus_tag LOCUS_27410 1647 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence625 460 807 gene locus_tag LOCUS_27420 gene blh 460 807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence626 >Feature sequence627 386 1222 gene locus_tag LOCUS_27430 386 1222 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence628 >Feature sequence629 465 890 gene locus_tag LOCUS_27440 gene fliN 465 890 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W6 protein_id gnl|my_center|LOCUS_27440 891 1322 gene locus_tag LOCUS_27450 891 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1319 2053 gene locus_tag LOCUS_27460 gene fliP 1319 2053 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 protein_id gnl|my_center|LOCUS_27460 >Feature sequence630 767 246 gene locus_tag LOCUS_27470 gene dedE 767 246 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947074.1 protein_id gnl|my_center|LOCUS_27470 1386 784 gene locus_tag LOCUS_27480 1386 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2198 1371 gene locus_tag LOCUS_27490 2198 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence631 715 386 gene locus_tag LOCUS_27500 715 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1810 722 gene locus_tag LOCUS_27510 gene luxA2 1810 722 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090024.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence632 1420 665 gene locus_tag LOCUS_27520 1420 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1609 1746 gene locus_tag LOCUS_27530 1609 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence633 661 110 gene locus_tag LOCUS_27540 gene pgsA 661 110 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_27540 <2176 658 gene locus_tag LOCUS_27550 <2176 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0Q1:UvrABC system protein C >Feature sequence634 584 766 gene locus_tag LOCUS_27560 584 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 778 1083 gene locus_tag LOCUS_27570 778 1083 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence635 758 300 gene locus_tag LOCUS_27580 758 300 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_27580 958 2157 gene locus_tag LOCUS_27590 958 2157 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090876.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence636 1939 434 gene locus_tag LOCUS_27600 1939 434 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084703.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence637 <1 1186 gene locus_tag LOCUS_27610 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVV0:flagellin 1282 1671 gene locus_tag LOCUS_27620 1282 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence638 288 2027 gene locus_tag LOCUS_27630 288 2027 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence639 387 1385 gene locus_tag LOCUS_27640 gene egtD 387 1385 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK43 protein_id gnl|my_center|LOCUS_27640 1378 1998 gene locus_tag LOCUS_27650 1378 1998 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704411.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence640 1704 349 gene locus_tag LOCUS_27660 1704 349 CDS product benzoate dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601604.1 protein_id gnl|my_center|LOCUS_27660 2140 1760 gene locus_tag LOCUS_27670 2140 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence641 2119 1394 gene locus_tag LOCUS_27680 2119 1394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224104.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence642 544 296 gene locus_tag LOCUS_27690 544 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27690 2061 550 gene locus_tag LOCUS_27700 2061 550 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence643 1577 717 gene locus_tag LOCUS_27710 1577 717 CDS product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_27710 2125 1835 gene locus_tag LOCUS_27720 2125 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence644 229 465 gene locus_tag LOCUS_27730 229 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 497 1141 gene locus_tag LOCUS_27740 gene ribC 497 1141 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence645 1127 708 gene locus_tag LOCUS_27750 1127 708 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083110.1 protein_id gnl|my_center|LOCUS_27750 2020 1130 gene locus_tag LOCUS_27760 gene dhaA 2020 1130 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_27760 >Feature sequence646 <1 1462 gene locus_tag LOCUS_27770 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9K3:aconitate hydratase 1884 1594 gene locus_tag LOCUS_27780 1884 1594 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930852.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence647 109 609 gene locus_tag LOCUS_27790 109 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 708 1184 gene locus_tag LOCUS_27800 gene cheW 708 1184 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_27800 1194 1616 gene locus_tag LOCUS_27810 1194 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1689 1778 gene locus_tag LOCUS_t00260 1689 1778 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence648 1722 922 gene locus_tag LOCUS_27820 1722 922 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence649 376 155 gene locus_tag LOCUS_27830 376 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 641 363 gene locus_tag LOCUS_27840 641 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence650 493 59 gene locus_tag LOCUS_27850 493 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192175.1 protein_id gnl|my_center|LOCUS_27850 1134 490 gene locus_tag LOCUS_27860 1134 490 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence651 <2060 1418 gene locus_tag LOCUS_27870 <2060 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KLN9:aspartate-semialdehyde dehydrogenase >Feature sequence652 <1 1693 gene locus_tag LOCUS_27880 <1 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPA5:proline--tRNA ligase >Feature sequence653 51 344 gene locus_tag LOCUS_27890 51 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1032 373 gene locus_tag LOCUS_27900 1032 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1170 1673 gene locus_tag LOCUS_27910 1170 1673 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705180.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence654 <1 1320 gene locus_tag LOCUS_27920 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q57163:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase >Feature sequence655 756 466 gene locus_tag LOCUS_27930 756 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 866 1099 gene locus_tag LOCUS_27940 866 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence656 688 398 gene locus_tag LOCUS_27950 gene pqqD 688 398 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_27950 1436 681 gene locus_tag LOCUS_27960 gene pqqC 1436 681 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_27960 1699 1514 gene locus_tag LOCUS_27970 1699 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence657 <1 951 gene locus_tag LOCUS_27980 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTZ5:citrate synthase 1013 1993 gene locus_tag LOCUS_27990 gene mdh 1013 1993 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_27990 >Feature sequence658 255 1538 gene locus_tag LOCUS_28000 255 1538 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892094.1 protein_id gnl|my_center|LOCUS_28000 1594 1890 gene locus_tag LOCUS_28010 1594 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence659 <1 1039 gene locus_tag LOCUS_28020 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000211151.1:GTP-binding protein 1042 1479 gene locus_tag LOCUS_28030 gene dtd 1042 1479 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_28030 <2002 1487 gene locus_tag LOCUS_28040 <2002 1487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948029.1:twitching motility protein PilT >Feature sequence660 229 1149 gene locus_tag LOCUS_28050 229 1149 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_28050 <1994 1146 gene locus_tag LOCUS_28060 <1994 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62JB9:DNA ligase >Feature sequence661 <1 1388 gene locus_tag LOCUS_28070 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4W8:putative beta-barrel assembly-enhancing protease >Feature sequence662 <1984 335 gene locus_tag LOCUS_28080 <1984 335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929991.1:hydantoin utilization protein B >Feature sequence663 <1 1183 gene locus_tag LOCUS_28090 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064348.1:NAD-dependent formate dehydrogenase subunit beta >Feature sequence664 1592 381 gene locus_tag LOCUS_28100 1592 381 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence665 1756 350 gene locus_tag LOCUS_28110 gene udhA 1756 350 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224567.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence666 1062 379 gene locus_tag LOCUS_28120 1062 379 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 protein_id gnl|my_center|LOCUS_28120 1815 1171 gene locus_tag LOCUS_28130 1815 1171 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence667 95 1837 gene locus_tag LOCUS_28140 95 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence668 >Feature sequence669 <1 1273 gene locus_tag LOCUS_28150 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83IX8:ATP-dependent DNA helicase Rep <1955 1270 gene locus_tag LOCUS_28160 <1955 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085865.1:ABC transporter ATP-binding protein/permease >Feature sequence670 <1 867 gene locus_tag LOCUS_28170 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTK5:glycolate oxidase iron-sulfur subunit 1781 891 gene locus_tag LOCUS_28180 1781 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence671 331 822 gene locus_tag LOCUS_28190 331 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 819 1856 gene locus_tag LOCUS_28200 819 1856 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418263.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence672 941 549 gene locus_tag LOCUS_28210 941 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1317 949 gene locus_tag LOCUS_28220 1317 949 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_28220 1445 1930 gene locus_tag LOCUS_28230 1445 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence673 260 184 gene locus_tag LOCUS_t00270 260 184 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence674 911 135 gene locus_tag LOCUS_28240 911 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence675 >Feature sequence676 >Feature sequence677 940 218 gene locus_tag LOCUS_28250 gene ubiG 940 218 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_28250 1165 944 gene locus_tag LOCUS_28260 1165 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1899 1186 gene locus_tag LOCUS_28270 gene pppA 1899 1186 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence678 1312 476 gene locus_tag LOCUS_28280 1312 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1871 1434 gene locus_tag LOCUS_28290 1871 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence679 435 73 gene locus_tag LOCUS_28300 435 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 930 1817 gene locus_tag LOCUS_28310 930 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence680 1710 619 gene locus_tag LOCUS_28320 gene ychF 1710 619 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_28320 >Feature sequence681 <1 805 gene locus_tag LOCUS_28330 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87S34:protein translocase subunit SecD 824 1759 gene locus_tag LOCUS_28340 gene secF 824 1759 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_28340 >Feature sequence682 1336 476 gene locus_tag LOCUS_28350 gene tnp 1336 476 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974621.1 protein_id gnl|my_center|LOCUS_28350 1632 1333 gene locus_tag LOCUS_28360 1632 1333 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945908.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence683 >Feature sequence684 1520 1290 gene locus_tag LOCUS_28370 1520 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence685 356 1261 gene locus_tag LOCUS_28380 356 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_28380 <1880 1212 gene locus_tag LOCUS_28390 <1880 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005764786.1:cobalamin biosynthesis protein CobW >Feature sequence686 56 301 gene locus_tag LOCUS_28400 56 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 599 1030 gene locus_tag LOCUS_28410 599 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406596.1 protein_id gnl|my_center|LOCUS_28410 1694 1050 gene locus_tag LOCUS_28420 1694 1050 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929893.1 protein_id gnl|my_center|LOCUS_28420 >Feature sequence687 1588 533 gene locus_tag LOCUS_28430 1588 533 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence688 1137 1538 gene locus_tag LOCUS_28440 gene flgB 1137 1538 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 protein_id gnl|my_center|LOCUS_28440 >Feature sequence689 534 193 gene locus_tag LOCUS_28450 534 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1193 609 gene locus_tag LOCUS_28460 1193 609 CDS product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 protein_id gnl|my_center|LOCUS_28460 1873 1376 gene locus_tag LOCUS_28470 1873 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence690 1493 1017 gene locus_tag LOCUS_28480 gene aroK 1493 1017 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q56 protein_id gnl|my_center|LOCUS_28480 >Feature sequence691 <1 630 gene locus_tag LOCUS_28490 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAL1:heat-inducible transcription repressor HrcA 720 1259 gene locus_tag LOCUS_28500 gene grpE 720 1259 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 protein_id gnl|my_center|LOCUS_28500 >Feature sequence692 >Feature sequence693 1781 1512 gene locus_tag LOCUS_28510 1781 1512 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence694 1765 1061 gene locus_tag LOCUS_28520 1765 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence695 <1856 611 gene locus_tag LOCUS_28530 <1856 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720819.1:methylhydantoinase >Feature sequence696 <1 622 gene locus_tag LOCUS_28540 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090851.1:UDP-glucose 6-dehydrogenase 709 1815 gene locus_tag LOCUS_28550 gene wlbC 709 1815 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence697 129 1583 gene locus_tag LOCUS_28560 129 1583 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence698 122 700 gene locus_tag LOCUS_28570 122 700 CDS product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975282.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence699 165 944 gene locus_tag LOCUS_28580 165 944 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086215.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence700 1378 134 gene locus_tag LOCUS_28590 1378 134 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887960.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence701 <1840 1216 gene locus_tag LOCUS_28600 <1840 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393465.1:5-oxoprolinase >Feature sequence702 <1836 455 gene locus_tag LOCUS_28610 <1836 455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940864.1:ATP-dependent RNA helicase >Feature sequence703 >Feature sequence704 >Feature sequence705 <1813 441 gene locus_tag LOCUS_28620 <1813 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085722.1:cyclohexanone monooxygenase >Feature sequence706 1392 502 gene locus_tag LOCUS_28630 1392 502 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence707 >Feature sequence708 547 1179 gene locus_tag LOCUS_28640 547 1179 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence709 >Feature sequence710 <1 1161 gene locus_tag LOCUS_28650 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000944348.1:glutamate synthase >Feature sequence711 <1779 1165 gene locus_tag LOCUS_28660 <1779 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640174.1:class II aldolase >Feature sequence712 <1 708 gene locus_tag LOCUS_28670 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377457.1:membrane protein 883 716 gene locus_tag LOCUS_28680 gene rubA 883 716 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RH7 protein_id gnl|my_center|LOCUS_28680 939 1730 gene locus_tag LOCUS_28690 gene thiD 939 1730 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence713 450 82 gene locus_tag LOCUS_28700 450 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 <1776 447 gene locus_tag LOCUS_28710 <1776 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538146.1:5-oxoprolinase >Feature sequence714 189 1616 gene locus_tag LOCUS_28720 gene argH 189 1616 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_28720 >Feature sequence715 1644 286 gene locus_tag LOCUS_28730 1644 286 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence716 72 1391 gene locus_tag LOCUS_28740 72 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388514.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence717 >Feature sequence718 229 702 gene locus_tag LOCUS_28750 gene ribH 229 702 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ3 protein_id gnl|my_center|LOCUS_28750 702 1190 gene locus_tag LOCUS_28760 gene nusB 702 1190 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_28760 >Feature sequence719 <1 803 gene locus_tag LOCUS_28770 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZIX1:phosphatidylserine decarboxylase proenzyme <1750 825 gene locus_tag LOCUS_28780 <1750 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VZP2:NADH-quinone oxidoreductase subunit N >Feature sequence720 3 122 gene locus_tag LOCUS_28790 3 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 198 554 gene locus_tag LOCUS_28800 gene ihfB 198 554 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_28800 616 912 gene locus_tag LOCUS_28810 616 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence721 <1735 934 gene locus_tag LOCUS_28820 <1735 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390303.1:CoA transferase >Feature sequence722 >Feature sequence723 <1 645 gene locus_tag LOCUS_28830 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC17:pseudouridine synthase >Feature sequence724 <1723 932 gene locus_tag LOCUS_28840 <1723 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919912.1:acyl-CoA dehydrogenase >Feature sequence725 1719 526 gene locus_tag LOCUS_28850 1719 526 CDS product 1,4-butanediol diacrylate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence726 1287 469 gene locus_tag LOCUS_28860 1287 469 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence727 1049 1369 gene locus_tag LOCUS_28870 1049 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence728 262 1461 gene locus_tag LOCUS_28880 262 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence729 1510 437 gene locus_tag LOCUS_28890 gene leuB 1510 437 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_28890 >Feature sequence730 <1685 123 gene locus_tag LOCUS_28900 <1685 123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SKN9:long-chain-fatty-acid--CoA ligase >Feature sequence731 <1680 802 gene locus_tag LOCUS_28910 <1680 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084053.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence732 >Feature sequence733 >Feature sequence734 423 1298 gene locus_tag LOCUS_28920 423 1298 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence735 285 1328 gene locus_tag LOCUS_28930 gene obg 285 1328 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_28930 >Feature sequence736 <1644 899 gene locus_tag LOCUS_28940 <1644 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088361.1:flavin-dependent monooxygenase >Feature sequence737 1573 194 gene locus_tag LOCUS_28950 1573 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence738 <1 854 gene locus_tag LOCUS_28960 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63J47:chemotaxis response regulator protein-glutamate methylesterase 2 >Feature sequence739 >Feature sequence740 864 85 gene locus_tag LOCUS_28970 864 85 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_28970 1352 861 gene locus_tag LOCUS_28980 1352 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence741 >Feature sequence742 1288 137 gene locus_tag LOCUS_28990 1288 137 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_28990 1599 1414 gene locus_tag LOCUS_29000 1599 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence743 1361 210 gene locus_tag LOCUS_29010 1361 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence744 <1594 906 gene locus_tag LOCUS_29020 <1594 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256872.1:ATPase >Feature sequence745 <1 621 gene locus_tag LOCUS_29030 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064883.1:LysR family transcriptional regulator 785 1549 gene locus_tag LOCUS_29040 gene dhrS4 785 1549 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence746 >Feature sequence747 649 416 gene locus_tag LOCUS_29050 649 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 <1582 761 gene locus_tag LOCUS_29060 <1582 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NKP2:proline iminopeptidase >Feature sequence748 2 772 gene locus_tag LOCUS_29070 2 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1279 791 gene locus_tag LOCUS_29080 1279 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence749 >Feature sequence750 116 271 gene locus_tag LOCUS_29090 116 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1556 309 gene locus_tag LOCUS_29100 1556 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence751 1067 249 gene locus_tag LOCUS_29110 1067 249 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_29110 1069 1551 gene locus_tag LOCUS_29120 1069 1551 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUZ9 protein_id gnl|my_center|LOCUS_29120 >Feature sequence752 1425 1102 gene locus_tag LOCUS_29130 1425 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence753 >Feature sequence754 <1 1152 gene locus_tag LOCUS_29140 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204398.1:AMP-binding protein >Feature sequence755 208 1224 gene locus_tag LOCUS_29150 208 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence756 <1 609 gene locus_tag LOCUS_29160 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000510757.1:phosphohydrolase >Feature sequence757 >Feature sequence758 <1512 356 gene locus_tag LOCUS_29170 <1512 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87HX3:glucose-1-phosphate adenylyltransferase 2 >Feature sequence759 <1 620 gene locus_tag LOCUS_29180 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878527.1:4-hydroxyphenylacetate 3-hydroxylase >Feature sequence760 >Feature sequence761 >Feature sequence762 501 1358 gene locus_tag LOCUS_29190 501 1358 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence763 1336 431 gene locus_tag LOCUS_29200 1336 431 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728755.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence764 <1 1418 gene locus_tag LOCUS_29210 <1 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064005.1:malonyl-CoA synthetase