>Feature sequence001 904 1302 gene locus_tag LOCUS_00010 904 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1364 1624 gene locus_tag LOCUS_00020 1364 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1628 2290 gene locus_tag LOCUS_00030 1628 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3062 2283 gene locus_tag LOCUS_00040 3062 2283 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WK2 protein_id gnl|my_center|LOCUS_00040 5950 3143 gene locus_tag LOCUS_00050 gene valS 5950 3143 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_00050 6416 6141 gene locus_tag LOCUS_00060 6416 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6958 6521 gene locus_tag LOCUS_00070 gene holC 6958 6521 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_00070 8427 6961 gene locus_tag LOCUS_00080 gene pepA 8427 6961 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WC3 protein_id gnl|my_center|LOCUS_00080 8568 9662 gene locus_tag LOCUS_00090 8568 9662 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_00090 9659 10711 gene locus_tag LOCUS_00100 9659 10711 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948329.1 protein_id gnl|my_center|LOCUS_00100 10721 11212 gene locus_tag LOCUS_00110 gene dsbB 10721 11212 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 protein_id gnl|my_center|LOCUS_00110 12391 11207 gene locus_tag LOCUS_00120 12391 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12670 15018 gene locus_tag LOCUS_00130 gene rnr 12670 15018 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_00130 15018 15854 gene locus_tag LOCUS_00140 gene rlmB 15018 15854 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_00140 15992 16597 gene locus_tag LOCUS_00150 15992 16597 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_00150 16812 17240 gene locus_tag LOCUS_00160 gene rpsF 16812 17240 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2D9 protein_id gnl|my_center|LOCUS_00160 17259 17486 gene locus_tag LOCUS_00170 gene rpsR 17259 17486 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG68 protein_id gnl|my_center|LOCUS_00170 17558 18487 gene locus_tag LOCUS_00180 17558 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18507 18971 gene locus_tag LOCUS_00190 gene rplI 18507 18971 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_00190 19103 20524 gene locus_tag LOCUS_00200 gene dnaB 19103 20524 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXJ3 protein_id gnl|my_center|LOCUS_00200 20540 21628 gene locus_tag LOCUS_00210 gene alr1 20540 21628 CDS product alanine racemase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY6 protein_id gnl|my_center|LOCUS_00210 22581 21625 gene locus_tag LOCUS_00220 gene rsgA 22581 21625 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45339 protein_id gnl|my_center|LOCUS_00220 24145 22607 gene locus_tag LOCUS_00230 24145 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24363 24911 gene locus_tag LOCUS_00240 gene orn 24363 24911 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_00240 25429 24914 gene locus_tag LOCUS_00250 25429 24914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25834 25499 gene locus_tag LOCUS_00260 25834 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26604 25915 gene locus_tag LOCUS_00270 26604 25915 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX25 protein_id gnl|my_center|LOCUS_00270 26978 27397 gene locus_tag LOCUS_00280 gene flgB 26978 27397 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW71 protein_id gnl|my_center|LOCUS_00280 27400 27813 gene locus_tag LOCUS_00290 27400 27813 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YZ0 protein_id gnl|my_center|LOCUS_00290 27839 28519 gene locus_tag LOCUS_00300 gene flgD 27839 28519 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW69 protein_id gnl|my_center|LOCUS_00300 28531 29757 gene locus_tag LOCUS_00310 gene flgE 28531 29757 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B6 protein_id gnl|my_center|LOCUS_00310 29757 30497 gene locus_tag LOCUS_00320 29757 30497 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR4 protein_id gnl|my_center|LOCUS_00320 30527 31312 gene locus_tag LOCUS_00330 gene flgG 30527 31312 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B8 protein_id gnl|my_center|LOCUS_00330 31312 31977 gene locus_tag LOCUS_00340 gene flgH 31312 31977 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM39 protein_id gnl|my_center|LOCUS_00340 31999 33084 gene locus_tag LOCUS_00350 gene flgI 31999 33084 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_00350 33084 33938 gene locus_tag LOCUS_00360 gene flgJ 33084 33938 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ15 protein_id gnl|my_center|LOCUS_00360 34184 33963 gene locus_tag LOCUS_00370 34184 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34441 36348 gene locus_tag LOCUS_00380 gene flgK 34441 36348 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_00380 36379 37587 gene locus_tag LOCUS_00390 gene flgL 36379 37587 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 protein_id gnl|my_center|LOCUS_00390 37940 39463 gene locus_tag LOCUS_00400 gene fliC 37940 39463 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_00400 39531 39947 gene locus_tag LOCUS_00410 39531 39947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39947 41311 gene locus_tag LOCUS_00420 gene fliD 39947 41311 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_00420 41313 41702 gene locus_tag LOCUS_00430 gene fliS 41313 41702 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSR5 protein_id gnl|my_center|LOCUS_00430 >Feature sequence002 <1 662 gene locus_tag LOCUS_00440 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247147.1:DNA topoisomerase 659 2230 gene locus_tag LOCUS_00450 659 2230 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_00450 4021 2216 gene locus_tag LOCUS_00460 gene kefC 4021 2216 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 protein_id gnl|my_center|LOCUS_00460 2635 2554 gene locus_tag LOCUS_t00010 2635 2554 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4907 4014 gene locus_tag LOCUS_00470 4907 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_00470 5122 4943 gene locus_tag LOCUS_00480 5122 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5894 5199 gene locus_tag LOCUS_00490 5894 5199 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_00490 7556 5997 gene locus_tag LOCUS_00500 7556 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 7841 7566 gene locus_tag LOCUS_00510 7841 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 8233 8323 gene locus_tag LOCUS_t00020 8233 8323 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10031 8328 gene locus_tag LOCUS_00520 10031 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 10102 10749 gene locus_tag LOCUS_00530 10102 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 12094 10814 gene locus_tag LOCUS_00540 gene serS 12094 10814 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGC4 protein_id gnl|my_center|LOCUS_00540 13201 12233 gene locus_tag LOCUS_00550 gene cmoB 13201 12233 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G2T3 protein_id gnl|my_center|LOCUS_00550 13968 13201 gene locus_tag LOCUS_00560 gene cmoA 13968 13201 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G3 protein_id gnl|my_center|LOCUS_00560 14648 13968 gene locus_tag LOCUS_00570 14648 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 15947 14652 gene locus_tag LOCUS_00580 15947 14652 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405078.1 protein_id gnl|my_center|LOCUS_00580 16539 15925 gene locus_tag LOCUS_00590 gene lolA 16539 15925 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57068 protein_id gnl|my_center|LOCUS_00590 18972 16585 gene locus_tag LOCUS_00600 gene ftsK 18972 16585 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 protein_id gnl|my_center|LOCUS_00600 19295 20224 gene locus_tag LOCUS_00610 gene trxB 19295 20224 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887V5 protein_id gnl|my_center|LOCUS_00610 20416 21588 gene locus_tag LOCUS_00620 20416 21588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198598.1 protein_id gnl|my_center|LOCUS_00620 21578 22303 gene locus_tag LOCUS_00630 gene aat 21578 22303 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 protein_id gnl|my_center|LOCUS_00630 22503 22324 gene locus_tag LOCUS_00640 22503 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 23667 22528 gene locus_tag LOCUS_00650 gene thrC 23667 22528 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_00650 25010 23694 gene locus_tag LOCUS_00660 25010 23694 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY1 protein_id gnl|my_center|LOCUS_00660 26313 25093 gene locus_tag LOCUS_00670 26313 25093 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_00670 27531 26494 gene locus_tag LOCUS_00680 gene rpoS 27531 26494 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_00680 28278 27589 gene locus_tag LOCUS_00690 28278 27589 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 protein_id gnl|my_center|LOCUS_00690 28883 28299 gene locus_tag LOCUS_00700 28883 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_00700 29582 28893 gene locus_tag LOCUS_00710 gene pcm 29582 28893 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y6 protein_id gnl|my_center|LOCUS_00710 30363 29584 gene locus_tag LOCUS_00720 gene surE 30363 29584 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S4T3 protein_id gnl|my_center|LOCUS_00720 30460 30993 gene locus_tag LOCUS_00730 30460 30993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 31789 31031 gene locus_tag LOCUS_00740 gene rluB 31789 31031 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PST1 protein_id gnl|my_center|LOCUS_00740 31812 32294 gene locus_tag LOCUS_00750 31812 32294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 32302 32790 gene locus_tag LOCUS_00760 32302 32790 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_00760 33481 32819 gene locus_tag LOCUS_00770 33481 32819 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_00770 34014 33481 gene locus_tag LOCUS_00780 34014 33481 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 protein_id gnl|my_center|LOCUS_00780 35333 34011 gene locus_tag LOCUS_00790 gene pcnB 35333 34011 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T5 protein_id gnl|my_center|LOCUS_00790 37324 35330 gene locus_tag LOCUS_00800 37324 35330 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310356.1 protein_id gnl|my_center|LOCUS_00800 <38276 37331 gene locus_tag LOCUS_00810 <38276 37331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257389.1:cytochrome P450 >Feature sequence003 1635 1006 gene locus_tag LOCUS_00820 gene leuD 1635 1006 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_00820 3042 1648 gene locus_tag LOCUS_00830 gene leuC 3042 1648 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEZ0 protein_id gnl|my_center|LOCUS_00830 3140 4030 gene locus_tag LOCUS_00840 3140 4030 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_00840 4045 4911 gene locus_tag LOCUS_00850 4045 4911 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_00850 6122 4920 gene locus_tag LOCUS_00860 6122 4920 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_00860 7228 6140 gene locus_tag LOCUS_00870 gene aroC 7228 6140 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TK6 protein_id gnl|my_center|LOCUS_00870 7348 7878 gene locus_tag LOCUS_00880 7348 7878 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947723.1 protein_id gnl|my_center|LOCUS_00880 7941 9455 gene locus_tag LOCUS_00890 7941 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 9587 10555 gene locus_tag LOCUS_00900 9587 10555 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_00900 11049 11480 gene locus_tag LOCUS_00910 11049 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 11493 13016 gene locus_tag LOCUS_00920 gene crtI 11493 13016 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_00920 13017 14651 gene locus_tag LOCUS_00930 13017 14651 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_00930 14665 15519 gene locus_tag LOCUS_00940 14665 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 15516 16646 gene locus_tag LOCUS_00950 15516 16646 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123502.1 protein_id gnl|my_center|LOCUS_00950 17906 16677 gene locus_tag LOCUS_00960 17906 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 18112 18318 gene locus_tag LOCUS_00970 18112 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18824 18315 gene locus_tag LOCUS_00980 18824 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 19735 18821 gene locus_tag LOCUS_00990 19735 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 19806 20462 gene locus_tag LOCUS_01000 gene senC 19806 20462 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_01000 20455 20967 gene locus_tag LOCUS_01010 20455 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 21010 21861 gene locus_tag LOCUS_01020 gene psd 21010 21861 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV19 protein_id gnl|my_center|LOCUS_01020 22868 21858 gene locus_tag LOCUS_01030 22868 21858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 23702 22947 gene locus_tag LOCUS_01040 gene yeaZ 23702 22947 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_01040 25683 23695 gene locus_tag LOCUS_01050 25683 23695 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 protein_id gnl|my_center|LOCUS_01050 26306 25827 gene locus_tag LOCUS_01060 26306 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 28887 26485 gene locus_tag LOCUS_01070 gene mrcB 28887 26485 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_01070 29564 28998 gene locus_tag LOCUS_01080 29564 28998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 29728 31074 gene locus_tag LOCUS_01090 29728 31074 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_01090 31071 31802 gene locus_tag LOCUS_01100 gene ubiG 31071 31802 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8S3 protein_id gnl|my_center|LOCUS_01100 >Feature sequence004 829 572 gene locus_tag LOCUS_01110 829 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 798 983 gene locus_tag LOCUS_01120 798 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1456 1935 gene locus_tag LOCUS_01130 gene rimP 1456 1935 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_01130 2008 3507 gene locus_tag LOCUS_01140 gene nusA 2008 3507 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ4 protein_id gnl|my_center|LOCUS_01140 3577 6195 gene locus_tag LOCUS_01150 gene infB 3577 6195 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BS1 protein_id gnl|my_center|LOCUS_01150 6265 6636 gene locus_tag LOCUS_01160 gene rbfA 6265 6636 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_01160 6642 7586 gene locus_tag LOCUS_01170 gene truB 6642 7586 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBC4 protein_id gnl|my_center|LOCUS_01170 7787 8056 gene locus_tag LOCUS_01180 gene rpsO 7787 8056 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMU7 protein_id gnl|my_center|LOCUS_01180 8132 10234 gene locus_tag LOCUS_01190 gene pnp 8132 10234 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M06 protein_id gnl|my_center|LOCUS_01190 10480 11067 gene locus_tag LOCUS_01200 10480 11067 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_01200 11077 11784 gene locus_tag LOCUS_01210 11077 11784 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_01210 11865 12482 gene locus_tag LOCUS_01220 11865 12482 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LX2 protein_id gnl|my_center|LOCUS_01220 12526 13026 gene locus_tag LOCUS_01230 12526 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 13521 13066 gene locus_tag LOCUS_01240 13521 13066 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXZ3 protein_id gnl|my_center|LOCUS_01240 14171 13572 gene locus_tag LOCUS_01250 14171 13572 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_01250 15181 14291 gene locus_tag LOCUS_01260 gene tonB 15181 14291 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_01260 16353 15358 gene locus_tag LOCUS_01270 gene gshB 16353 15358 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_01270 17673 16354 gene locus_tag LOCUS_01280 17673 16354 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_01280 18032 18418 gene locus_tag LOCUS_01290 gene pilG 18032 18418 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_01290 18597 18953 gene locus_tag LOCUS_01300 gene pilH 18597 18953 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_01300 18989 19537 gene locus_tag LOCUS_01310 gene pilI 18989 19537 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_01310 19607 21709 gene locus_tag LOCUS_01320 gene pilJ 19607 21709 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_01320 21759 28613 gene locus_tag LOCUS_01330 21759 28613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence005 920 495 gene locus_tag LOCUS_01340 920 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 2363 930 gene locus_tag LOCUS_01350 2363 930 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_01350 2593 3189 gene locus_tag LOCUS_01360 2593 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_01360 3173 4081 gene locus_tag LOCUS_01370 3173 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_01370 4078 6153 gene locus_tag LOCUS_01380 4078 6153 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337565.1 protein_id gnl|my_center|LOCUS_01380 6170 6937 gene locus_tag LOCUS_01390 6170 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6942 7721 gene locus_tag LOCUS_01400 6942 7721 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_01400 7818 8453 gene locus_tag LOCUS_01410 gene parA 7818 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_01410 8408 8845 gene locus_tag LOCUS_01420 8408 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9768 8932 gene locus_tag LOCUS_01430 9768 8932 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_01430 11126 9768 gene locus_tag LOCUS_01440 11126 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_01440 12628 11123 gene locus_tag LOCUS_01450 12628 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 13427 12663 gene locus_tag LOCUS_01460 gene hemD 13427 12663 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 protein_id gnl|my_center|LOCUS_01460 14456 13545 gene locus_tag LOCUS_01470 gene hemC 14456 13545 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_01470 15209 14460 gene locus_tag LOCUS_01480 gene algR 15209 14460 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_01480 16335 15253 gene locus_tag LOCUS_01490 16335 15253 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_01490 16519 17937 gene locus_tag LOCUS_01500 gene argH 16519 17937 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 protein_id gnl|my_center|LOCUS_01500 18571 17900 gene locus_tag LOCUS_01510 18571 17900 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_01510 19282 18593 gene locus_tag LOCUS_01520 19282 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_01520 19406 19606 gene locus_tag LOCUS_01530 19406 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19610 20854 gene locus_tag LOCUS_01540 gene lysA 19610 20854 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_01540 20854 21696 gene locus_tag LOCUS_01550 gene dapF 20854 21696 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46357 protein_id gnl|my_center|LOCUS_01550 21693 22379 gene locus_tag LOCUS_01560 21693 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_01560 22472 23017 gene locus_tag LOCUS_01570 gene hslV 22472 23017 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_01570 23019 24344 gene locus_tag LOCUS_01580 gene hslU 23019 24344 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQI8 protein_id gnl|my_center|LOCUS_01580 26033 24807 gene locus_tag LOCUS_01590 26033 24807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence006 28 654 gene locus_tag LOCUS_01600 28 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 661 2340 gene locus_tag LOCUS_01610 gene ubiB 661 2340 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_01610 2883 2413 gene locus_tag LOCUS_01620 gene ybeY 2883 2413 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPY1 protein_id gnl|my_center|LOCUS_01620 3926 2883 gene locus_tag LOCUS_01630 3926 2883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_01630 5254 3926 gene locus_tag LOCUS_01640 gene miaB 5254 3926 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DX3 protein_id gnl|my_center|LOCUS_01640 5301 5483 gene locus_tag LOCUS_01650 5301 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 7408 5528 gene locus_tag LOCUS_01660 7408 5528 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_01660 8336 7659 gene locus_tag LOCUS_01670 8336 7659 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_01670 8875 8411 gene locus_tag LOCUS_01680 gene ssb 8875 8411 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_01680 10276 8897 gene locus_tag LOCUS_01690 10276 8897 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_01690 10467 13319 gene locus_tag LOCUS_01700 gene uvrA 10467 13319 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ38 protein_id gnl|my_center|LOCUS_01700 13323 13640 gene locus_tag LOCUS_01710 13323 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13679 14152 gene locus_tag LOCUS_01720 gene actI 13679 14152 CDS product 4-hydroxyphenylacetate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972383.1 protein_id gnl|my_center|LOCUS_01720 15487 14303 gene locus_tag LOCUS_01730 15487 14303 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_01730 16076 15693 gene locus_tag LOCUS_01740 gene rplQ 16076 15693 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AG47 protein_id gnl|my_center|LOCUS_01740 17144 16149 gene locus_tag LOCUS_01750 gene rpoA 17144 16149 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_01750 17857 17237 gene locus_tag LOCUS_01760 gene rpsD 17857 17237 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF44 protein_id gnl|my_center|LOCUS_01760 18282 17896 gene locus_tag LOCUS_01770 gene rpsK 18282 17896 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59375 protein_id gnl|my_center|LOCUS_01770 18658 18302 gene locus_tag LOCUS_01780 gene rpsM 18658 18302 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF42 protein_id gnl|my_center|LOCUS_01780 20199 18808 gene locus_tag LOCUS_01790 gene secY 20199 18808 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK50 protein_id gnl|my_center|LOCUS_01790 20635 20201 gene locus_tag LOCUS_01800 gene rplO 20635 20201 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYM4 protein_id gnl|my_center|LOCUS_01800 20817 20638 gene locus_tag LOCUS_01810 gene rpmD 20817 20638 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF3 protein_id gnl|my_center|LOCUS_01810 21332 20826 gene locus_tag LOCUS_01820 gene rpsE 21332 20826 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66587 protein_id gnl|my_center|LOCUS_01820 21701 21351 gene locus_tag LOCUS_01830 gene rplR 21701 21351 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK53 protein_id gnl|my_center|LOCUS_01830 22263 21736 gene locus_tag LOCUS_01840 gene rplF 22263 21736 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_01840 22692 22297 gene locus_tag LOCUS_01850 gene rpsH 22692 22297 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44377 protein_id gnl|my_center|LOCUS_01850 23023 22718 gene locus_tag LOCUS_01860 gene rpsN 23023 22718 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_01860 >Feature sequence007 1350 94 gene locus_tag LOCUS_01870 gene proA 1350 94 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62H23 protein_id gnl|my_center|LOCUS_01870 2409 1354 gene locus_tag LOCUS_01880 gene holA 2409 1354 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_01880 2473 3192 gene locus_tag LOCUS_01890 2473 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3260 4273 gene locus_tag LOCUS_01900 gene pyrD 3260 4273 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_01900 5942 4263 gene locus_tag LOCUS_01910 5942 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6543 6187 gene locus_tag LOCUS_01920 6543 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 7131 6616 gene locus_tag LOCUS_01930 7131 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9590 7128 gene locus_tag LOCUS_01940 gene leuS 9590 7128 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG64 protein_id gnl|my_center|LOCUS_01940 10449 9583 gene locus_tag LOCUS_01950 10449 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 12009 10489 gene locus_tag LOCUS_01960 gene lnt 12009 10489 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZI86 protein_id gnl|my_center|LOCUS_01960 12925 12035 gene locus_tag LOCUS_01970 gene corC 12925 12035 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 protein_id gnl|my_center|LOCUS_01970 13171 13980 gene locus_tag LOCUS_01980 13171 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 14088 16262 gene locus_tag LOCUS_01990 gene uvrD 14088 16262 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_01990 18496 16325 gene locus_tag LOCUS_02000 gene prc 18496 16325 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_02000 19417 18809 gene locus_tag LOCUS_02010 19417 18809 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_02010 19624 20814 gene locus_tag LOCUS_02020 19624 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 20952 22772 gene locus_tag LOCUS_02030 20952 22772 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence008 2986 2051 gene locus_tag LOCUS_02040 gene glyQ 2986 2051 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_02040 3261 4670 gene locus_tag LOCUS_02050 3261 4670 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_02050 4796 5479 gene locus_tag LOCUS_02060 4796 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5645 6745 gene locus_tag LOCUS_02070 gene ntrB 5645 6745 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_02070 6732 8153 gene locus_tag LOCUS_02080 gene ntrC 6732 8153 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_02080 8749 8147 gene locus_tag LOCUS_02090 8749 8147 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_02090 9421 8756 gene locus_tag LOCUS_02100 9421 8756 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_02100 10336 9701 gene locus_tag LOCUS_02110 10336 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 11039 10338 gene locus_tag LOCUS_02120 11039 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11106 12848 gene locus_tag LOCUS_02130 11106 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 13656 12880 gene locus_tag LOCUS_02140 13656 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14927 13647 gene locus_tag LOCUS_02150 14927 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 15787 14927 gene locus_tag LOCUS_02160 15787 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 16386 15796 gene locus_tag LOCUS_02170 16386 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18011 16386 gene locus_tag LOCUS_02180 18011 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 19224 18013 gene locus_tag LOCUS_02190 gene pilC 19224 18013 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_02190 20933 19224 gene locus_tag LOCUS_02200 20933 19224 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_02200 22170 20923 gene locus_tag LOCUS_02210 22170 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 <22934 22167 gene locus_tag LOCUS_02220 <22934 22167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387870.1:type II and III secretion system protein >Feature sequence009 1638 2546 gene locus_tag LOCUS_02230 gene lgt 1638 2546 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_02230 2571 3365 gene locus_tag LOCUS_02240 gene thyA 2571 3365 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_02240 3580 3822 gene locus_tag LOCUS_02250 3580 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 3960 5399 gene locus_tag LOCUS_02260 gene phr 3960 5399 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_02260 5407 5925 gene locus_tag LOCUS_02270 gene folA 5407 5925 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_02270 5962 7293 gene locus_tag LOCUS_02280 gene fadI 5962 7293 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRR3 protein_id gnl|my_center|LOCUS_02280 7303 9618 gene locus_tag LOCUS_02290 gene fadJ 7303 9618 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_02290 10321 9707 gene locus_tag LOCUS_02300 10321 9707 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227863.1 protein_id gnl|my_center|LOCUS_02300 11733 10363 gene locus_tag LOCUS_02310 gene cry1 11733 10363 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR33 protein_id gnl|my_center|LOCUS_02310 12164 11793 gene locus_tag LOCUS_02320 gene crcB 12164 11793 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG6 protein_id gnl|my_center|LOCUS_02320 12976 12158 gene locus_tag LOCUS_02330 gene apaH 12976 12158 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNQ1 protein_id gnl|my_center|LOCUS_02330 13372 12983 gene locus_tag LOCUS_02340 gene apaG 13372 12983 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 protein_id gnl|my_center|LOCUS_02340 14336 13530 gene locus_tag LOCUS_02350 gene rsmA 14336 13530 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE3 protein_id gnl|my_center|LOCUS_02350 15345 14338 gene locus_tag LOCUS_02360 gene pdxA1 15345 14338 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_02360 16694 15345 gene locus_tag LOCUS_02370 gene surA 16694 15345 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_02370 18996 16642 gene locus_tag LOCUS_02380 gene lptD 18996 16642 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_02380 19665 19456 gene locus_tag LOCUS_02390 19665 19456 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931694.1 protein_id gnl|my_center|LOCUS_02390 20093 21184 gene locus_tag LOCUS_02400 20093 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 21781 21407 gene locus_tag LOCUS_02410 21781 21407 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence010 1328 396 gene locus_tag LOCUS_02420 gene oppB 1328 396 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_02420 2941 1328 gene locus_tag LOCUS_02430 2941 1328 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_02430 3070 4098 gene locus_tag LOCUS_02440 gene yejB 3070 4098 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_02440 4115 5278 gene locus_tag LOCUS_02450 gene yejE 4115 5278 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 protein_id gnl|my_center|LOCUS_02450 5282 7159 gene locus_tag LOCUS_02460 5282 7159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_02460 7162 8199 gene locus_tag LOCUS_02470 7162 8199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_02470 8196 9194 gene locus_tag LOCUS_02480 8196 9194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_02480 9563 9411 gene locus_tag LOCUS_02490 9563 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 11275 9686 gene locus_tag LOCUS_02500 gene fadD 11275 9686 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZES9 protein_id gnl|my_center|LOCUS_02500 11614 12126 gene locus_tag LOCUS_02510 11614 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12200 12712 gene locus_tag LOCUS_02520 12200 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12803 13870 gene locus_tag LOCUS_02530 12803 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13908 14654 gene locus_tag LOCUS_02540 13908 14654 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_02540 14665 15960 gene locus_tag LOCUS_02550 14665 15960 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_02550 16159 17532 gene locus_tag LOCUS_02560 16159 17532 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948432.1 protein_id gnl|my_center|LOCUS_02560 17525 18481 gene locus_tag LOCUS_02570 17525 18481 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948430.1 protein_id gnl|my_center|LOCUS_02570 19673 18426 gene locus_tag LOCUS_02580 gene cqsA 19673 18426 CDS product CAI-1 autoinducer synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KM65 protein_id gnl|my_center|LOCUS_02580 20800 19937 gene locus_tag LOCUS_02590 20800 19937 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_02590 21076 20804 gene locus_tag LOCUS_02600 gene yrbA 21076 20804 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946582.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence011 2219 978 gene locus_tag LOCUS_02610 2219 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3030 2437 gene locus_tag LOCUS_02620 3030 2437 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZF0 protein_id gnl|my_center|LOCUS_02620 3450 3043 gene locus_tag LOCUS_02630 3450 3043 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_02630 4033 3512 gene locus_tag LOCUS_02640 gene exbB 4033 3512 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_02640 5413 4040 gene locus_tag LOCUS_02650 gene ttpC 5413 4040 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_02650 6225 5413 gene locus_tag LOCUS_02660 6225 5413 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_02660 7604 6486 gene locus_tag LOCUS_02670 7604 6486 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_02670 7929 7597 gene locus_tag LOCUS_02680 7929 7597 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063913.1 protein_id gnl|my_center|LOCUS_02680 9631 8021 gene locus_tag LOCUS_02690 9631 8021 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S41 protein_id gnl|my_center|LOCUS_02690 11592 9757 gene locus_tag LOCUS_02700 gene pckG 11592 9757 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNT2 protein_id gnl|my_center|LOCUS_02700 13038 11749 gene locus_tag LOCUS_02710 13038 11749 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 protein_id gnl|my_center|LOCUS_02710 13477 14451 gene locus_tag LOCUS_02720 gene pqqB 13477 14451 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEB9 protein_id gnl|my_center|LOCUS_02720 14461 15189 gene locus_tag LOCUS_02730 gene pqqC 14461 15189 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGE7 protein_id gnl|my_center|LOCUS_02730 15195 15470 gene locus_tag LOCUS_02740 15195 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 16598 15489 gene locus_tag LOCUS_02750 gene pqqE 16598 15489 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FG1 protein_id gnl|my_center|LOCUS_02750 18181 16688 gene locus_tag LOCUS_02760 gene lysS 18181 16688 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL6 protein_id gnl|my_center|LOCUS_02760 19163 18192 gene locus_tag LOCUS_02770 gene prfB 19163 18192 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A290 protein_id gnl|my_center|LOCUS_02770 <20918 19284 gene locus_tag LOCUS_02780 <20918 19284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103574.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence012 920 2146 gene locus_tag LOCUS_02790 gene argG 920 2146 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_02790 2691 2200 gene locus_tag LOCUS_02800 2691 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2792 3382 gene locus_tag LOCUS_02810 2792 3382 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_02810 4191 3379 gene locus_tag LOCUS_02820 4191 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5177 4191 gene locus_tag LOCUS_02830 5177 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5969 5193 gene locus_tag LOCUS_02840 5969 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6787 5969 gene locus_tag LOCUS_02850 6787 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_02850 7002 7160 gene locus_tag LOCUS_02860 7002 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7176 8579 gene locus_tag LOCUS_02870 7176 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 8743 10215 gene locus_tag LOCUS_02880 8743 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 11305 10319 gene locus_tag LOCUS_02890 11305 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12079 11384 gene locus_tag LOCUS_02900 12079 11384 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105836.1 protein_id gnl|my_center|LOCUS_02900 12129 12974 gene locus_tag LOCUS_02910 12129 12974 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089434.1 protein_id gnl|my_center|LOCUS_02910 12978 14159 gene locus_tag LOCUS_02920 12978 14159 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_02920 14159 14629 gene locus_tag LOCUS_02930 gene tadA 14159 14629 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 protein_id gnl|my_center|LOCUS_02930 14886 14626 gene locus_tag LOCUS_02940 14886 14626 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_02940 15136 14858 gene locus_tag LOCUS_02950 gene yefM 15136 14858 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83KJ8 protein_id gnl|my_center|LOCUS_02950 15365 15613 gene locus_tag LOCUS_02960 gene rpsP 15365 15613 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_02960 15650 16162 gene locus_tag LOCUS_02970 gene rimM 15650 16162 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_02970 16180 16905 gene locus_tag LOCUS_02980 gene trmD 16180 16905 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V0 protein_id gnl|my_center|LOCUS_02980 16959 17300 gene locus_tag LOCUS_02990 gene rplS 16959 17300 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_02990 17598 19496 gene locus_tag LOCUS_03000 gene htpG 17598 19496 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P880 protein_id gnl|my_center|LOCUS_03000 >Feature sequence013 186 776 gene locus_tag LOCUS_03010 gene hisB 186 776 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_03010 780 1400 gene locus_tag LOCUS_03020 gene hisH1 780 1400 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_03020 1487 2218 gene locus_tag LOCUS_03030 gene hisA 1487 2218 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE4 protein_id gnl|my_center|LOCUS_03030 2242 3027 gene locus_tag LOCUS_03040 gene hisF 2242 3027 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLQ2 protein_id gnl|my_center|LOCUS_03040 3134 3469 gene locus_tag LOCUS_03050 3134 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3472 3687 gene locus_tag LOCUS_03060 gene tatA 3472 3687 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57046 protein_id gnl|my_center|LOCUS_03060 3691 4080 gene locus_tag LOCUS_03070 gene tatB 3691 4080 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSY1 protein_id gnl|my_center|LOCUS_03070 4077 4862 gene locus_tag LOCUS_03080 gene tatC 4077 4862 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG1 protein_id gnl|my_center|LOCUS_03080 4947 5693 gene locus_tag LOCUS_03090 gene gpmA 4947 5693 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFC8 protein_id gnl|my_center|LOCUS_03090 5792 7018 gene locus_tag LOCUS_03100 5792 7018 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_03100 7043 7627 gene locus_tag LOCUS_03110 7043 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073415.1 protein_id gnl|my_center|LOCUS_03110 8254 7697 gene locus_tag LOCUS_03120 8254 7697 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_03120 8353 9261 gene locus_tag LOCUS_03130 8353 9261 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457564.1 protein_id gnl|my_center|LOCUS_03130 9373 9298 gene locus_tag LOCUS_t00030 9373 9298 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9714 9451 gene locus_tag LOCUS_03140 9714 9451 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D06 protein_id gnl|my_center|LOCUS_03140 10654 9707 gene locus_tag LOCUS_03150 gene mutY 10654 9707 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_03150 12887 10755 gene locus_tag LOCUS_03160 12887 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_03160 13018 14025 gene locus_tag LOCUS_03170 13018 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_03170 14648 14109 gene locus_tag LOCUS_03180 gene moaC 14648 14109 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_03180 14672 14911 gene locus_tag LOCUS_03190 gene moaD 14672 14911 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EF41 protein_id gnl|my_center|LOCUS_03190 14913 15380 gene locus_tag LOCUS_03200 14913 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 16757 15417 gene locus_tag LOCUS_03210 gene degP 16757 15417 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262646.1 protein_id gnl|my_center|LOCUS_03210 17333 16920 gene locus_tag LOCUS_03220 gene hspA 17333 16920 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_03220 17997 17416 gene locus_tag LOCUS_03230 17997 17416 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_03230 18748 17999 gene locus_tag LOCUS_03240 18748 17999 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_03240 19694 18822 gene locus_tag LOCUS_03250 19694 18822 CDS product UPF0701 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44726 protein_id gnl|my_center|LOCUS_03250 >Feature sequence014 476 685 gene locus_tag LOCUS_03260 476 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1203 625 gene locus_tag LOCUS_03270 1203 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_03270 2025 1228 gene locus_tag LOCUS_03280 gene proC 2025 1228 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_03280 2041 2223 gene locus_tag LOCUS_03290 2041 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3061 2264 gene locus_tag LOCUS_03300 3061 2264 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEE2 protein_id gnl|my_center|LOCUS_03300 3678 3058 gene locus_tag LOCUS_03310 gene eda 3678 3058 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_03310 4679 3675 gene locus_tag LOCUS_03320 gene glk 4679 3675 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58619 protein_id gnl|my_center|LOCUS_03320 6547 4676 gene locus_tag LOCUS_03330 gene edd 6547 4676 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_03330 7267 6572 gene locus_tag LOCUS_03340 gene pgl 7267 6572 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_03340 8739 7267 gene locus_tag LOCUS_03350 gene zwf 8739 7267 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE98 protein_id gnl|my_center|LOCUS_03350 9482 8799 gene locus_tag LOCUS_03360 gene yggS 9482 8799 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_03360 9463 9648 gene locus_tag LOCUS_03370 9463 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 9660 10694 gene locus_tag LOCUS_03380 gene pilT 9660 10694 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_03380 10777 11943 gene locus_tag LOCUS_03390 gene pilT-2 10777 11943 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_03390 11946 13112 gene locus_tag LOCUS_03400 gene uptC 11946 13112 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_03400 13607 13122 gene locus_tag LOCUS_03410 13607 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 13773 13570 gene locus_tag LOCUS_03420 13773 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14835 13873 gene locus_tag LOCUS_03430 gene thrB 14835 13873 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4W557 protein_id gnl|my_center|LOCUS_03430 14972 17764 gene locus_tag LOCUS_03440 gene polI 14972 17764 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZB2 protein_id gnl|my_center|LOCUS_03440 18799 18182 gene locus_tag LOCUS_03450 gene engB 18799 18182 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ86 protein_id gnl|my_center|LOCUS_03450 18926 19633 gene locus_tag LOCUS_03460 18926 19633 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence015 242 829 gene locus_tag LOCUS_03470 242 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 938 2815 gene locus_tag LOCUS_03480 938 2815 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_03480 2877 3668 gene locus_tag LOCUS_03490 2877 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4325 3732 gene locus_tag LOCUS_03500 4325 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 6064 4328 gene locus_tag LOCUS_03510 gene proS 6064 4328 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKX8 protein_id gnl|my_center|LOCUS_03510 6624 6178 gene locus_tag LOCUS_03520 6624 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_03520 6817 7956 gene locus_tag LOCUS_03530 6817 7956 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_03530 7949 8476 gene locus_tag LOCUS_03540 7949 8476 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_03540 8588 10123 gene locus_tag LOCUS_03550 8588 10123 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945845.1 protein_id gnl|my_center|LOCUS_03550 10123 11085 gene locus_tag LOCUS_03560 10123 11085 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244718.1 protein_id gnl|my_center|LOCUS_03560 11162 12613 gene locus_tag LOCUS_03570 11162 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14007 12619 gene locus_tag LOCUS_03580 14007 12619 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948529.1 protein_id gnl|my_center|LOCUS_03580 14596 14135 gene locus_tag LOCUS_03590 gene bcp 14596 14135 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_03590 14763 15638 gene locus_tag LOCUS_03600 gene dapA 14763 15638 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_03600 15650 15910 gene locus_tag LOCUS_03610 15650 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 15973 16407 gene locus_tag LOCUS_03620 15973 16407 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_03620 16518 17315 gene locus_tag LOCUS_03630 gene rimK 16518 17315 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_03630 18214 17396 gene locus_tag LOCUS_03640 gene folE2 18214 17396 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_03640 <19087 18434 gene locus_tag LOCUS_03650 <19087 18434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000568619.1:(2E,6E)-farnesyl diphosphate synthase >Feature sequence016 1427 477 gene locus_tag LOCUS_03660 gene fabD 1427 477 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAI9 protein_id gnl|my_center|LOCUS_03660 2236 1424 gene locus_tag LOCUS_03670 gene dapB 2236 1424 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH7 protein_id gnl|my_center|LOCUS_03670 3554 2424 gene locus_tag LOCUS_03680 gene dnaJ 3554 2424 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_03680 5559 3643 gene locus_tag LOCUS_03690 gene dnaK 5559 3643 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 protein_id gnl|my_center|LOCUS_03690 6247 5660 gene locus_tag LOCUS_03700 gene grpE 6247 5660 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3A5 protein_id gnl|my_center|LOCUS_03700 6860 6441 gene locus_tag LOCUS_03710 6860 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7180 6863 gene locus_tag LOCUS_03720 7180 6863 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971755.1 protein_id gnl|my_center|LOCUS_03720 8293 7235 gene locus_tag LOCUS_03730 gene hrcA 8293 7235 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_03730 10590 8353 gene locus_tag LOCUS_03740 10590 8353 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_03740 11491 10736 gene locus_tag LOCUS_03750 gene fliA 11491 10736 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29248 protein_id gnl|my_center|LOCUS_03750 12458 11544 gene locus_tag LOCUS_03760 gene fleN 12458 11544 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD64 protein_id gnl|my_center|LOCUS_03760 14078 12651 gene locus_tag LOCUS_03770 gene flhF 14078 12651 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_03770 16299 14119 gene locus_tag LOCUS_03780 gene flhA 16299 14119 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_03780 17477 16305 gene locus_tag LOCUS_03790 gene flhB 17477 16305 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457645.1 protein_id gnl|my_center|LOCUS_03790 18266 17481 gene locus_tag LOCUS_03800 gene fliR 18266 17481 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI15 protein_id gnl|my_center|LOCUS_03800 18528 18259 gene locus_tag LOCUS_03810 gene fliQ 18528 18259 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence017 2261 927 gene locus_tag LOCUS_03820 gene ahcY 2261 927 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_03820 3444 2266 gene locus_tag LOCUS_03830 gene metK 3444 2266 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_03830 5310 3553 gene locus_tag LOCUS_03840 gene dnaG 5310 3553 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGG5 protein_id gnl|my_center|LOCUS_03840 9866 5406 gene locus_tag LOCUS_03850 gene gltB 9866 5406 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105326.1 protein_id gnl|my_center|LOCUS_03850 11603 10263 gene locus_tag LOCUS_03860 11603 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12776 11610 gene locus_tag LOCUS_03870 12776 11610 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q58 protein_id gnl|my_center|LOCUS_03870 13858 12776 gene locus_tag LOCUS_03880 gene aroB 13858 12776 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_03880 14390 13845 gene locus_tag LOCUS_03890 gene aroK 14390 13845 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43880 protein_id gnl|my_center|LOCUS_03890 16640 14532 gene locus_tag LOCUS_03900 16640 14532 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 protein_id gnl|my_center|LOCUS_03900 17241 16720 gene locus_tag LOCUS_03910 gene pilP 17241 16720 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_03910 17855 17253 gene locus_tag LOCUS_03920 gene pilO 17855 17253 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946664.1 protein_id gnl|my_center|LOCUS_03920 18437 17865 gene locus_tag LOCUS_03930 18437 17865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence018 986 567 gene locus_tag LOCUS_03940 gene atpC 986 567 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_03940 2382 1009 gene locus_tag LOCUS_03950 gene atpD 2382 1009 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_03950 3272 2409 gene locus_tag LOCUS_03960 gene atpG 3272 2409 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX9 protein_id gnl|my_center|LOCUS_03960 4981 3443 gene locus_tag LOCUS_03970 gene atpA2 4981 3443 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_03970 5585 5055 gene locus_tag LOCUS_03980 gene atpH 5585 5055 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_03980 5963 5586 gene locus_tag LOCUS_03990 gene atpF 5963 5586 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ9 protein_id gnl|my_center|LOCUS_03990 6456 6175 gene locus_tag LOCUS_04000 gene atpE 6456 6175 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PH5 protein_id gnl|my_center|LOCUS_04000 7362 6511 gene locus_tag LOCUS_04010 gene atpB 7362 6511 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR95 protein_id gnl|my_center|LOCUS_04010 7830 7450 gene locus_tag LOCUS_04020 7830 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 7974 8579 gene locus_tag LOCUS_04030 7974 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 9472 8600 gene locus_tag LOCUS_04040 gene spoOJ 9472 8600 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_04040 10328 9483 gene locus_tag LOCUS_04050 10328 9483 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377884.1 protein_id gnl|my_center|LOCUS_04050 10974 10336 gene locus_tag LOCUS_04060 gene rsmG 10974 10336 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_04060 12877 10979 gene locus_tag LOCUS_04070 gene mnmG 12877 10979 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1M6 protein_id gnl|my_center|LOCUS_04070 13731 12955 gene locus_tag LOCUS_04080 gene murI 13731 12955 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW4 protein_id gnl|my_center|LOCUS_04080 15059 13731 gene locus_tag LOCUS_04090 15059 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_04090 16605 15235 gene locus_tag LOCUS_04100 gene mnmE 16605 15235 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94612 protein_id gnl|my_center|LOCUS_04100 18293 16632 gene locus_tag LOCUS_04110 gene yidC 18293 16632 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_04110 >Feature sequence019 1479 571 gene locus_tag LOCUS_04120 1479 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 1961 1476 gene locus_tag LOCUS_04130 1961 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2275 1961 gene locus_tag LOCUS_04140 2275 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3179 2310 gene locus_tag LOCUS_04150 3179 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4031 3183 gene locus_tag LOCUS_04160 4031 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5773 4034 gene locus_tag LOCUS_04170 5773 4034 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_04170 7065 5779 gene locus_tag LOCUS_04180 7065 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8026 7067 gene locus_tag LOCUS_04190 8026 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8237 8046 gene locus_tag LOCUS_04200 8237 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 8954 8238 gene locus_tag LOCUS_04210 8954 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 9808 8957 gene locus_tag LOCUS_04220 9808 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 11359 9812 gene locus_tag LOCUS_04230 11359 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 11767 11471 gene locus_tag LOCUS_04240 11767 11471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 protein_id gnl|my_center|LOCUS_04240 12105 13055 gene locus_tag LOCUS_04250 12105 13055 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090081.1 protein_id gnl|my_center|LOCUS_04250 14312 13107 gene locus_tag LOCUS_04260 14312 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence020 697 1182 gene locus_tag LOCUS_04270 697 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 protein_id gnl|my_center|LOCUS_04270 1212 2186 gene locus_tag LOCUS_04280 gene yeiR 1212 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_04280 2291 2593 gene locus_tag LOCUS_04290 2291 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3102 2641 gene locus_tag LOCUS_04300 3102 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3352 3987 gene locus_tag LOCUS_04310 3352 3987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_04310 3987 5198 gene locus_tag LOCUS_04320 3987 5198 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 protein_id gnl|my_center|LOCUS_04320 5961 5200 gene locus_tag LOCUS_04330 5961 5200 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_04330 6702 6106 gene locus_tag LOCUS_04340 6702 6106 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_04340 7248 6703 gene locus_tag LOCUS_04350 7248 6703 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 protein_id gnl|my_center|LOCUS_04350 8186 7245 gene locus_tag LOCUS_04360 8186 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8556 8209 gene locus_tag LOCUS_04370 8556 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 10261 8639 gene locus_tag LOCUS_04380 10261 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 10568 12652 gene locus_tag LOCUS_04390 10568 12652 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEE7 protein_id gnl|my_center|LOCUS_04390 12791 14935 gene locus_tag LOCUS_04400 12791 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 15793 15002 gene locus_tag LOCUS_04410 15793 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16411 15950 gene locus_tag LOCUS_04420 16411 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 <17731 16421 gene locus_tag LOCUS_04430 <17731 16421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931517.1:membrane protein >Feature sequence021 2275 1373 gene locus_tag LOCUS_04440 2275 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_04440 2394 2810 gene locus_tag LOCUS_04450 2394 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3853 2942 gene locus_tag LOCUS_04460 gene lpxC 3853 2942 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_04460 5486 4314 gene locus_tag LOCUS_04470 gene ftsZ 5486 4314 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ0 protein_id gnl|my_center|LOCUS_04470 6770 5538 gene locus_tag LOCUS_04480 gene ftsA 6770 5538 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_04480 7687 6770 gene locus_tag LOCUS_04490 7687 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 8627 7680 gene locus_tag LOCUS_04500 gene ddl 8627 7680 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 protein_id gnl|my_center|LOCUS_04500 9526 8624 gene locus_tag LOCUS_04510 gene murB 9526 8624 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F16 protein_id gnl|my_center|LOCUS_04510 10983 9523 gene locus_tag LOCUS_04520 gene murC 10983 9523 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_04520 12149 10983 gene locus_tag LOCUS_04530 gene murG 12149 10983 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ7 protein_id gnl|my_center|LOCUS_04530 13393 12146 gene locus_tag LOCUS_04540 gene ftsW 13393 12146 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_04540 14730 13390 gene locus_tag LOCUS_04550 gene murD 14730 13390 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY3 protein_id gnl|my_center|LOCUS_04550 15812 14727 gene locus_tag LOCUS_04560 gene mraY 15812 14727 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_04560 17206 15812 gene locus_tag LOCUS_04570 17206 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence022 2753 171 gene locus_tag LOCUS_04580 gene fadE 2753 171 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 protein_id gnl|my_center|LOCUS_04580 4715 3054 gene locus_tag LOCUS_04590 4715 3054 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_04590 6017 4890 gene locus_tag LOCUS_04600 gene dapE 6017 4890 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ52 protein_id gnl|my_center|LOCUS_04600 8677 6014 gene locus_tag LOCUS_04610 gene glnD 8677 6014 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_04610 9493 8699 gene locus_tag LOCUS_04620 gene map 9493 8699 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_04620 9854 10774 gene locus_tag LOCUS_04630 gene rpsB 9854 10774 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV2 protein_id gnl|my_center|LOCUS_04630 10836 11723 gene locus_tag LOCUS_04640 gene tsf 10836 11723 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_04640 11937 12674 gene locus_tag LOCUS_04650 gene pyrH 11937 12674 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_04650 12677 13234 gene locus_tag LOCUS_04660 gene frr 12677 13234 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPV5 protein_id gnl|my_center|LOCUS_04660 13236 14036 gene locus_tag LOCUS_04670 gene uppS 13236 14036 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P248 protein_id gnl|my_center|LOCUS_04670 14149 14937 gene locus_tag LOCUS_04680 gene cdsA 14149 14937 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_04680 14934 16178 gene locus_tag LOCUS_04690 gene dxr 14934 16178 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD2 protein_id gnl|my_center|LOCUS_04690 >Feature sequence023 432 1 gene locus_tag LOCUS_04700 gene dtd 432 1 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44814 protein_id gnl|my_center|LOCUS_04700 1048 1725 gene locus_tag LOCUS_04710 1048 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 3234 1777 gene locus_tag LOCUS_04720 gene trkH 3234 1777 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_04720 4640 3267 gene locus_tag LOCUS_04730 gene trkA 4640 3267 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_04730 5944 4652 gene locus_tag LOCUS_04740 gene rsmB 5944 4652 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU5 protein_id gnl|my_center|LOCUS_04740 6926 5937 gene locus_tag LOCUS_04750 gene fmt 6926 5937 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW9 protein_id gnl|my_center|LOCUS_04750 7457 6942 gene locus_tag LOCUS_04760 gene def 7457 6942 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRZ1 protein_id gnl|my_center|LOCUS_04760 7798 9009 gene locus_tag LOCUS_04770 7798 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_04770 9015 10127 gene locus_tag LOCUS_04780 gene smf 9015 10127 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_04780 10299 12620 gene locus_tag LOCUS_04790 gene topA 10299 12620 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA5 protein_id gnl|my_center|LOCUS_04790 12624 13136 gene locus_tag LOCUS_04800 12624 13136 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_04800 13129 14400 gene locus_tag LOCUS_04810 13129 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 14397 15326 gene locus_tag LOCUS_04820 gene hemF 14397 15326 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_04820 16189 15335 gene locus_tag LOCUS_04830 gene fdhD 16189 15335 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEF2 protein_id gnl|my_center|LOCUS_04830 >Feature sequence024 2480 1257 gene locus_tag LOCUS_04840 gene amiB 2480 1257 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_04840 3109 2672 gene locus_tag LOCUS_04850 3109 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4079 3123 gene locus_tag LOCUS_04860 4079 3123 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_04860 4771 4112 gene locus_tag LOCUS_04870 4771 4112 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_04870 5732 4779 gene locus_tag LOCUS_04880 gene rluC 5732 4779 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_04880 6346 9384 gene locus_tag LOCUS_04890 gene rne 6346 9384 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_04890 9900 9418 gene locus_tag LOCUS_04900 gene ptpA 9900 9418 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_04900 10044 11564 gene locus_tag LOCUS_04910 gene mltF 10044 11564 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN1 protein_id gnl|my_center|LOCUS_04910 11630 12448 gene locus_tag LOCUS_04920 gene dapD 11630 12448 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JB3 protein_id gnl|my_center|LOCUS_04920 12448 12819 gene locus_tag LOCUS_04930 gene yffB 12448 12819 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_04930 13405 12881 gene locus_tag LOCUS_04940 13405 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 14224 13424 gene locus_tag LOCUS_04950 14224 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_04950 15510 14254 gene locus_tag LOCUS_04960 15510 14254 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_04960 <16424 15535 gene locus_tag LOCUS_04970 <16424 15535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ED70:DNA ligase >Feature sequence025 747 1421 gene locus_tag LOCUS_04980 747 1421 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_04980 1422 1715 gene locus_tag LOCUS_04990 1422 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1700 2542 gene locus_tag LOCUS_05000 gene gloB 1700 2542 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3G3 protein_id gnl|my_center|LOCUS_05000 3141 2608 gene locus_tag LOCUS_05010 3141 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3329 5011 gene locus_tag LOCUS_05020 gene fhs1 3329 5011 CDS product formate--tetrahydrofolate ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99ZI9 protein_id gnl|my_center|LOCUS_05020 6178 5021 gene locus_tag LOCUS_05030 gene bioF 6178 5021 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_05030 7169 6180 gene locus_tag LOCUS_05040 gene bioB 7169 6180 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z893 protein_id gnl|my_center|LOCUS_05040 7491 8045 gene locus_tag LOCUS_05050 7491 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 8064 8471 gene locus_tag LOCUS_05060 8064 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 9545 8556 gene locus_tag LOCUS_05070 gene ubiA 9545 8556 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEP9 protein_id gnl|my_center|LOCUS_05070 9744 11111 gene locus_tag LOCUS_05080 9744 11111 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 protein_id gnl|my_center|LOCUS_05080 11108 11644 gene locus_tag LOCUS_05090 11108 11644 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_05090 11641 12219 gene locus_tag LOCUS_05100 11641 12219 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 protein_id gnl|my_center|LOCUS_05100 13078 12170 gene locus_tag LOCUS_05110 13078 12170 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_05110 13177 13950 gene locus_tag LOCUS_05120 13177 13950 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_05120 14783 13947 gene locus_tag LOCUS_05130 gene aroE 14783 13947 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S3 protein_id gnl|my_center|LOCUS_05130 15804 14776 gene locus_tag LOCUS_05140 gene hemB 15804 14776 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_05140 >Feature sequence026 618 1163 gene locus_tag LOCUS_05150 618 1163 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888271.1 protein_id gnl|my_center|LOCUS_05150 1160 3445 gene locus_tag LOCUS_05160 1160 3445 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339094.1 protein_id gnl|my_center|LOCUS_05160 3445 4041 gene locus_tag LOCUS_05170 3445 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_05170 4239 4919 gene locus_tag LOCUS_05180 4239 4919 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_05180 5059 4907 gene locus_tag LOCUS_05190 5059 4907 CDS product DUF2256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889657.1 protein_id gnl|my_center|LOCUS_05190 5153 5239 gene locus_tag LOCUS_t00040 5153 5239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5536 5276 gene locus_tag LOCUS_05200 5536 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5742 7328 gene locus_tag LOCUS_05210 5742 7328 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932241.1 protein_id gnl|my_center|LOCUS_05210 7325 8707 gene locus_tag LOCUS_05220 7325 8707 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_05220 8707 11805 gene locus_tag LOCUS_05230 8707 11805 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946457.1 protein_id gnl|my_center|LOCUS_05230 12282 11827 gene locus_tag LOCUS_05240 12282 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 13985 12786 gene locus_tag LOCUS_05250 13985 12786 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_05250 14467 13985 gene locus_tag LOCUS_05260 14467 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 15204 14920 gene locus_tag LOCUS_05270 15204 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 15473 15291 gene locus_tag LOCUS_05280 15473 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence027 206 1564 gene locus_tag LOCUS_05290 206 1564 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103262.1 protein_id gnl|my_center|LOCUS_05290 2032 1604 gene locus_tag LOCUS_05300 2032 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_05300 3326 2034 gene locus_tag LOCUS_05310 gene hemL 3326 2034 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VY5 protein_id gnl|my_center|LOCUS_05310 3362 5854 gene locus_tag LOCUS_05320 3362 5854 CDS product 9-hexadecenoic acid cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263450.1 protein_id gnl|my_center|LOCUS_05320 6486 5881 gene locus_tag LOCUS_05330 gene thiE 6486 5881 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF6 protein_id gnl|my_center|LOCUS_05330 7538 6474 gene locus_tag LOCUS_05340 gene thiED 7538 6474 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_05340 7685 7849 gene locus_tag LOCUS_05350 7685 7849 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA5 protein_id gnl|my_center|LOCUS_05350 7909 9204 gene locus_tag LOCUS_05360 7909 9204 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884263.1 protein_id gnl|my_center|LOCUS_05360 10125 9250 gene locus_tag LOCUS_05370 10125 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_05370 10355 11509 gene locus_tag LOCUS_05380 10355 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 11664 14180 gene locus_tag LOCUS_05390 11664 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 15249 14230 gene locus_tag LOCUS_05400 15249 14230 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_05400 <15930 15250 gene locus_tag LOCUS_05410 <15930 15250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091510.1:UDP-2,3-diacylglucosamine hydrolase >Feature sequence028 321 1010 gene locus_tag LOCUS_05420 321 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1007 1681 gene locus_tag LOCUS_05430 1007 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2037 1678 gene locus_tag LOCUS_05440 2037 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3082 2153 gene locus_tag LOCUS_05450 gene thiL 3082 2153 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_05450 3590 3099 gene locus_tag LOCUS_05460 gene nusB 3590 3099 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_05460 4091 3600 gene locus_tag LOCUS_05470 gene ribH 4091 3600 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3N1 protein_id gnl|my_center|LOCUS_05470 5208 4084 gene locus_tag LOCUS_05480 gene ribB 5208 4084 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG9 protein_id gnl|my_center|LOCUS_05480 5835 5239 gene locus_tag LOCUS_05490 gene ribC 5835 5239 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_05490 7043 5910 gene locus_tag LOCUS_05500 gene ribD 7043 5910 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q9 protein_id gnl|my_center|LOCUS_05500 7558 7052 gene locus_tag LOCUS_05510 gene nrdR 7558 7052 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_05510 8818 7565 gene locus_tag LOCUS_05520 gene glyA 8818 7565 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBN8 protein_id gnl|my_center|LOCUS_05520 9135 9617 gene locus_tag LOCUS_05530 9135 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 13739 9621 gene locus_tag LOCUS_05540 13739 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 13999 15666 gene locus_tag LOCUS_05550 13999 15666 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence029 76 1368 gene locus_tag LOCUS_05560 gene purA 76 1368 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_05560 1494 2210 gene locus_tag LOCUS_05570 1494 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2223 3431 gene locus_tag LOCUS_05580 gene glpD 2223 3431 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_05580 3431 3832 gene locus_tag LOCUS_05590 gene hisI 3431 3832 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_05590 4596 3853 gene locus_tag LOCUS_05600 4596 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811372.1 protein_id gnl|my_center|LOCUS_05600 6047 4596 gene locus_tag LOCUS_05610 gene cls 6047 4596 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_05610 9788 6048 gene locus_tag LOCUS_05620 9788 6048 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_05620 11521 9785 gene locus_tag LOCUS_05630 11521 9785 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104170.1 protein_id gnl|my_center|LOCUS_05630 12337 11540 gene locus_tag LOCUS_05640 12337 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 14045 12459 gene locus_tag LOCUS_05650 gene nadB 14045 12459 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 protein_id gnl|my_center|LOCUS_05650 14493 15080 gene locus_tag LOCUS_05660 14493 15080 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_05660 >Feature sequence030 <1 996 gene locus_tag LOCUS_05670 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87YQ1:glutamine--tRNA ligase 1053 1568 gene locus_tag LOCUS_05680 1053 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2464 1613 gene locus_tag LOCUS_05690 2464 1613 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_05690 2685 3029 gene locus_tag LOCUS_05700 2685 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3033 4460 gene locus_tag LOCUS_05710 3033 4460 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_05710 5257 4457 gene locus_tag LOCUS_05720 5257 4457 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_05720 5627 5235 gene locus_tag LOCUS_05730 5627 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932596.1 protein_id gnl|my_center|LOCUS_05730 5901 5611 gene locus_tag LOCUS_05740 5901 5611 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIY7 protein_id gnl|my_center|LOCUS_05740 6746 5895 gene locus_tag LOCUS_05750 6746 5895 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_05750 6942 8069 gene locus_tag LOCUS_05760 6942 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8788 8108 gene locus_tag LOCUS_05770 8788 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9246 8863 gene locus_tag LOCUS_05780 9246 8863 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_05780 9418 9909 gene locus_tag LOCUS_05790 gene dps 9418 9909 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCK6 protein_id gnl|my_center|LOCUS_05790 10098 11417 gene locus_tag LOCUS_05800 10098 11417 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_05800 11504 11947 gene locus_tag LOCUS_05810 11504 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence031 3181 2615 gene locus_tag LOCUS_05820 gene dcd 3181 2615 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W86 protein_id gnl|my_center|LOCUS_05820 4234 3200 gene locus_tag LOCUS_05830 4234 3200 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7A6 protein_id gnl|my_center|LOCUS_05830 4356 6686 gene locus_tag LOCUS_05840 4356 6686 CDS product transcription accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704308.1 protein_id gnl|my_center|LOCUS_05840 6690 8720 gene locus_tag LOCUS_05850 gene metG 6690 8720 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ9 protein_id gnl|my_center|LOCUS_05850 8832 9422 gene locus_tag LOCUS_05860 8832 9422 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT86 protein_id gnl|my_center|LOCUS_05860 9451 10128 gene locus_tag LOCUS_05870 gene rnfB 9451 10128 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ3 protein_id gnl|my_center|LOCUS_05870 10125 11840 gene locus_tag LOCUS_05880 10125 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 11842 12870 gene locus_tag LOCUS_05890 11842 12870 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_05890 12870 13616 gene locus_tag LOCUS_05900 12870 13616 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_05900 13613 14332 gene locus_tag LOCUS_05910 13613 14332 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_05910 14332 14982 gene locus_tag LOCUS_05920 gene nth 14332 14982 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3JHJ2 protein_id gnl|my_center|LOCUS_05920 >Feature sequence032 1938 859 gene locus_tag LOCUS_05930 1938 859 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_05930 2076 2654 gene locus_tag LOCUS_05940 2076 2654 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_05940 2916 2641 gene locus_tag LOCUS_05950 2916 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3049 5037 gene locus_tag LOCUS_05960 gene cheA 3049 5037 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_05960 5048 5506 gene locus_tag LOCUS_05970 gene cheW 5048 5506 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_05970 5531 7606 gene locus_tag LOCUS_05980 5531 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7612 8430 gene locus_tag LOCUS_05990 gene cheR 7612 8430 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J5 protein_id gnl|my_center|LOCUS_05990 8427 8996 gene locus_tag LOCUS_06000 8427 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 8993 10027 gene locus_tag LOCUS_06010 gene cheB2 8993 10027 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 2 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6V9 protein_id gnl|my_center|LOCUS_06010 10065 10424 gene locus_tag LOCUS_06020 10065 10424 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_06020 10436 10915 gene locus_tag LOCUS_06030 10436 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 10994 11914 gene locus_tag LOCUS_06040 10994 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142485.1 protein_id gnl|my_center|LOCUS_06040 12039 13934 gene locus_tag LOCUS_06050 gene thrS 12039 13934 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS05 protein_id gnl|my_center|LOCUS_06050 14052 14492 gene locus_tag LOCUS_06060 gene infC 14052 14492 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER8 protein_id gnl|my_center|LOCUS_06060 14646 14846 gene locus_tag LOCUS_06070 gene rpmI 14646 14846 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66283 protein_id gnl|my_center|LOCUS_06070 14859 15215 gene locus_tag LOCUS_06080 gene rplT 14859 15215 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9U1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence033 2384 789 gene locus_tag LOCUS_06090 2384 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3358 2459 gene locus_tag LOCUS_06100 3358 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4876 3365 gene locus_tag LOCUS_06110 4876 3365 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_06110 5701 5030 gene locus_tag LOCUS_06120 5701 5030 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_06120 8510 5688 gene locus_tag LOCUS_06130 8510 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176614.1 protein_id gnl|my_center|LOCUS_06130 10321 8627 gene locus_tag LOCUS_06140 10321 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 11658 10318 gene locus_tag LOCUS_06150 11658 10318 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_06150 13894 11651 gene locus_tag LOCUS_06160 13894 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 <14965 13956 gene locus_tag LOCUS_06170 <14965 13956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390850.1:sugar transferase >Feature sequence034 876 28 gene locus_tag LOCUS_06180 gene panC 876 28 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH0 protein_id gnl|my_center|LOCUS_06180 1701 880 gene locus_tag LOCUS_06190 gene panB 1701 880 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_06190 1823 2104 gene locus_tag LOCUS_06200 1823 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_06200 2599 2123 gene locus_tag LOCUS_06210 2599 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3434 2724 gene locus_tag LOCUS_06220 3434 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4014 3427 gene locus_tag LOCUS_06230 4014 3427 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002094113.1 protein_id gnl|my_center|LOCUS_06230 4602 4018 gene locus_tag LOCUS_06240 4602 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5952 4612 gene locus_tag LOCUS_06250 5952 4612 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_06250 6674 6108 gene locus_tag LOCUS_06260 6674 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 8221 6818 gene locus_tag LOCUS_06270 8221 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 9693 8527 gene locus_tag LOCUS_06280 9693 8527 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 protein_id gnl|my_center|LOCUS_06280 10562 9702 gene locus_tag LOCUS_06290 10562 9702 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463003.1 protein_id gnl|my_center|LOCUS_06290 10856 10765 gene locus_tag LOCUS_t00050 10856 10765 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11246 10914 gene locus_tag LOCUS_06300 11246 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_06300 11536 13338 gene locus_tag LOCUS_06310 11536 13338 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_06310 14740 13415 gene locus_tag LOCUS_06320 14740 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence035 665 2752 gene locus_tag LOCUS_06330 665 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_06330 2830 3225 gene locus_tag LOCUS_06340 2830 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3275 3538 gene locus_tag LOCUS_06350 3275 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3644 3802 gene locus_tag LOCUS_06360 3644 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4138 4662 gene locus_tag LOCUS_06370 4138 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531762.1 protein_id gnl|my_center|LOCUS_06370 4696 5766 gene locus_tag LOCUS_06380 4696 5766 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767796.1 protein_id gnl|my_center|LOCUS_06380 6186 5809 gene locus_tag LOCUS_06390 6186 5809 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_06390 6759 6286 gene locus_tag LOCUS_06400 gene fdsG 6759 6286 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709578.1 protein_id gnl|my_center|LOCUS_06400 6995 8458 gene locus_tag LOCUS_06410 gene guaB 6995 8458 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 protein_id gnl|my_center|LOCUS_06410 8611 10185 gene locus_tag LOCUS_06420 gene guaA 8611 10185 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX09 protein_id gnl|my_center|LOCUS_06420 10778 12850 gene locus_tag LOCUS_06430 10778 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13332 14321 gene locus_tag LOCUS_06440 13332 14321 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence036 1410 1111 gene locus_tag LOCUS_06450 1410 1111 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_06450 1504 2157 gene locus_tag LOCUS_06460 gene rlmE 1504 2157 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M3 protein_id gnl|my_center|LOCUS_06460 2229 4184 gene locus_tag LOCUS_06470 gene hflB 2229 4184 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF0 protein_id gnl|my_center|LOCUS_06470 4259 5071 gene locus_tag LOCUS_06480 gene folP 4259 5071 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AC15 protein_id gnl|my_center|LOCUS_06480 5256 6623 gene locus_tag LOCUS_06490 gene glmM 5256 6623 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_06490 6821 7594 gene locus_tag LOCUS_06500 gene tpiA 6821 7594 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN5 protein_id gnl|my_center|LOCUS_06500 7615 8088 gene locus_tag LOCUS_06510 7615 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8097 8181 gene locus_tag LOCUS_t00060 8097 8181 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8231 8752 gene locus_tag LOCUS_06520 8231 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 10487 8775 gene locus_tag LOCUS_06530 10487 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 10699 14028 gene locus_tag LOCUS_06540 10699 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence037 1490 483 gene locus_tag LOCUS_06550 gene aguA 1490 483 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_06550 2206 1574 gene locus_tag LOCUS_06560 2206 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2451 3698 gene locus_tag LOCUS_06570 gene lolC 2451 3698 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037277.1 protein_id gnl|my_center|LOCUS_06570 3691 4371 gene locus_tag LOCUS_06580 gene lolD 3691 4371 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV90 protein_id gnl|my_center|LOCUS_06580 4892 4386 gene locus_tag LOCUS_06590 4892 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_06590 5262 7562 gene locus_tag LOCUS_06600 gene comA 5262 7562 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_06600 7769 8422 gene locus_tag LOCUS_06610 7769 8422 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_06610 8427 8843 gene locus_tag LOCUS_06620 8427 8843 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_06620 8897 11794 gene locus_tag LOCUS_06630 8897 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11787 11969 gene locus_tag LOCUS_06640 11787 11969 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDM0 protein_id gnl|my_center|LOCUS_06640 11966 12721 gene locus_tag LOCUS_06650 gene kdsB 11966 12721 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLX9 protein_id gnl|my_center|LOCUS_06650 12792 13649 gene locus_tag LOCUS_06660 12792 13649 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_06660 13961 13671 gene locus_tag LOCUS_06670 13961 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence038 1912 725 gene locus_tag LOCUS_06680 gene frsA 1912 725 CDS product fermentation/respiration switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707188.1 protein_id gnl|my_center|LOCUS_06680 2687 1896 gene locus_tag LOCUS_06690 2687 1896 CDS product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267634.1 protein_id gnl|my_center|LOCUS_06690 2933 3766 gene locus_tag LOCUS_06700 2933 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3922 4515 gene locus_tag LOCUS_06710 3922 4515 CDS product NnrU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198721.1 protein_id gnl|my_center|LOCUS_06710 4538 4897 gene locus_tag LOCUS_06720 4538 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5943 4915 gene locus_tag LOCUS_06730 5943 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7184 5943 gene locus_tag LOCUS_06740 7184 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 8341 7265 gene locus_tag LOCUS_06750 8341 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9105 8341 gene locus_tag LOCUS_06760 9105 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9763 9161 gene locus_tag LOCUS_06770 gene purN 9763 9161 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI7 protein_id gnl|my_center|LOCUS_06770 10864 9818 gene locus_tag LOCUS_06780 gene purM 10864 9818 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPY6 protein_id gnl|my_center|LOCUS_06780 10996 12195 gene locus_tag LOCUS_06790 10996 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 12199 12936 gene locus_tag LOCUS_06800 12199 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86235 protein_id gnl|my_center|LOCUS_06800 13369 12953 gene locus_tag LOCUS_06810 13369 12953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 protein_id gnl|my_center|LOCUS_06810 13979 13389 gene locus_tag LOCUS_06820 13979 13389 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence039 408 1277 gene locus_tag LOCUS_06830 gene coaX 408 1277 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XZ2 protein_id gnl|my_center|LOCUS_06830 1287 1892 gene locus_tag LOCUS_06840 1287 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3048 1933 gene locus_tag LOCUS_06850 3048 1933 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_06850 3105 3180 gene locus_tag LOCUS_t00070 3105 3180 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3573 4877 gene locus_tag LOCUS_06860 3573 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4930 5394 gene locus_tag LOCUS_06870 4930 5394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_06870 5416 6270 gene locus_tag LOCUS_06880 gene qmcA 5416 6270 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_06880 6287 7168 gene locus_tag LOCUS_06890 gene sulA 6287 7168 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_06890 8729 7209 gene locus_tag LOCUS_06900 gene phrB 8729 7209 CDS product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 protein_id gnl|my_center|LOCUS_06900 9112 8726 gene locus_tag LOCUS_06910 9112 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 9250 9747 gene locus_tag LOCUS_06920 9250 9747 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_06920 >Feature sequence040 3161 2172 gene locus_tag LOCUS_06930 gene galE 3161 2172 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_06930 4636 3179 gene locus_tag LOCUS_06940 4636 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 5698 4640 gene locus_tag LOCUS_06950 gene gtrB 5698 4640 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037988.1 protein_id gnl|my_center|LOCUS_06950 6128 5757 gene locus_tag LOCUS_06960 6128 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6387 7745 gene locus_tag LOCUS_06970 6387 7745 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_06970 7956 8615 gene locus_tag LOCUS_06980 7956 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 8925 9251 gene locus_tag LOCUS_06990 gene trxA 8925 9251 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_06990 9612 10868 gene locus_tag LOCUS_07000 gene rho 9612 10868 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8U3 protein_id gnl|my_center|LOCUS_07000 12314 11037 gene locus_tag LOCUS_07010 gene purD 12314 11037 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJM2 protein_id gnl|my_center|LOCUS_07010 12412 12780 gene locus_tag LOCUS_07020 12412 12780 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence041 1940 111 gene locus_tag LOCUS_07030 gene hscA 1940 111 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44669 protein_id gnl|my_center|LOCUS_07030 2461 1940 gene locus_tag LOCUS_07040 gene hscB 2461 1940 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYX6 protein_id gnl|my_center|LOCUS_07040 2797 2474 gene locus_tag LOCUS_07050 gene iscA 2797 2474 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E782 protein_id gnl|my_center|LOCUS_07050 3192 2797 gene locus_tag LOCUS_07060 gene iscU 3192 2797 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEG3 protein_id gnl|my_center|LOCUS_07060 4444 3218 gene locus_tag LOCUS_07070 gene iscS 4444 3218 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_07070 5598 4465 gene locus_tag LOCUS_07080 5598 4465 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_07080 6056 5598 gene locus_tag LOCUS_07090 gene iscR 6056 5598 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_07090 7147 6227 gene locus_tag LOCUS_07100 gene trmJ 7147 6227 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887A4 protein_id gnl|my_center|LOCUS_07100 7207 7998 gene locus_tag LOCUS_07110 gene suhB 7207 7998 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_07110 8001 8774 gene locus_tag LOCUS_07120 8001 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_07120 9889 8816 gene locus_tag LOCUS_07130 gene rluD 9889 8816 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII1 protein_id gnl|my_center|LOCUS_07130 10030 10704 gene locus_tag LOCUS_07140 10030 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11841 10756 gene locus_tag LOCUS_07150 11841 10756 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_07150 <13771 12664 gene locus_tag LOCUS_07160 <13771 12664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926542.1:NAD+ synthase >Feature sequence042 358 1293 gene locus_tag LOCUS_07170 358 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2439 1294 gene locus_tag LOCUS_07180 gene zapE 2439 1294 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF3 protein_id gnl|my_center|LOCUS_07180 6149 2445 gene locus_tag LOCUS_07190 6149 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6483 9230 gene locus_tag LOCUS_07200 gene pepN 6483 9230 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 protein_id gnl|my_center|LOCUS_07200 9287 10528 gene locus_tag LOCUS_07210 gene metX 9287 10528 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 protein_id gnl|my_center|LOCUS_07210 10626 11072 gene locus_tag LOCUS_07220 10626 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 12222 11077 gene locus_tag LOCUS_07230 gene tqsA 12222 11077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_07230 12358 12945 gene locus_tag LOCUS_07240 12358 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_07240 13586 13020 gene locus_tag LOCUS_07250 13586 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence043 759 1 gene locus_tag LOCUS_07260 gene ccmC 759 1 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420296.1 protein_id gnl|my_center|LOCUS_07260 1432 773 gene locus_tag LOCUS_07270 gene ccmB 1432 773 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJZ3 protein_id gnl|my_center|LOCUS_07270 2067 1432 gene locus_tag LOCUS_07280 gene ccmA 2067 1432 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MK8 protein_id gnl|my_center|LOCUS_07280 2116 3198 gene locus_tag LOCUS_07290 2116 3198 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_07290 3294 4655 gene locus_tag LOCUS_07300 3294 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 5077 5571 gene locus_tag LOCUS_07310 5077 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5575 6615 gene locus_tag LOCUS_07320 5575 6615 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_07320 6623 7258 gene locus_tag LOCUS_07330 6623 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 7344 12278 gene locus_tag LOCUS_07340 7344 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence044 147 2897 gene locus_tag LOCUS_07350 147 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2937 4553 gene locus_tag LOCUS_07360 gene gspE 2937 4553 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262832.1 protein_id gnl|my_center|LOCUS_07360 4557 5780 gene locus_tag LOCUS_07370 gene xcpS 4557 5780 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_07370 6317 5742 gene locus_tag LOCUS_07380 6317 5742 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105745.1 protein_id gnl|my_center|LOCUS_07380 6400 6843 gene locus_tag LOCUS_07390 gene gspG 6400 6843 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_07390 6847 7362 gene locus_tag LOCUS_07400 6847 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7362 7859 gene locus_tag LOCUS_07410 7362 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7843 8478 gene locus_tag LOCUS_07420 gene epsJ 7843 8478 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45776 protein_id gnl|my_center|LOCUS_07420 8495 9577 gene locus_tag LOCUS_07430 8495 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 9589 10824 gene locus_tag LOCUS_07440 9589 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 10840 11328 gene locus_tag LOCUS_07450 10840 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 11337 12167 gene locus_tag LOCUS_07460 11337 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 12551 12174 gene locus_tag LOCUS_07470 12551 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 12701 13210 gene locus_tag LOCUS_07480 gene purE 12701 13210 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYZ3 protein_id gnl|my_center|LOCUS_07480 >Feature sequence045 492 148 gene locus_tag LOCUS_07490 gene gatC 492 148 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_07490 801 1847 gene locus_tag LOCUS_07500 gene mreB 801 1847 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_07500 1874 2827 gene locus_tag LOCUS_07510 gene mreC 1874 2827 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_07510 2824 3327 gene locus_tag LOCUS_07520 gene mreD 2824 3327 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BN4 protein_id gnl|my_center|LOCUS_07520 3327 4148 gene locus_tag LOCUS_07530 3327 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4145 4552 gene locus_tag LOCUS_07540 4145 4552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_07540 10167 4636 gene locus_tag LOCUS_07550 10167 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10951 10424 gene locus_tag LOCUS_07560 10951 10424 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EB5 protein_id gnl|my_center|LOCUS_07560 10997 11644 gene locus_tag LOCUS_07570 gene pdxH 10997 11644 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_07570 12048 12581 gene locus_tag LOCUS_07580 12048 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence046 198 2777 gene locus_tag LOCUS_07590 gene mutS 198 2777 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ2 protein_id gnl|my_center|LOCUS_07590 2780 3661 gene locus_tag LOCUS_07600 gene nadK 2780 3661 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_07600 3692 5359 gene locus_tag LOCUS_07610 gene recN 3692 5359 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WM11 protein_id gnl|my_center|LOCUS_07610 5800 5372 gene locus_tag LOCUS_07620 gene fur 5800 5372 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_07620 5930 6427 gene locus_tag LOCUS_07630 gene omlA 5930 6427 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79GM4 protein_id gnl|my_center|LOCUS_07630 6774 6472 gene locus_tag LOCUS_07640 6774 6472 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_07640 8207 6777 gene locus_tag LOCUS_07650 8207 6777 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 protein_id gnl|my_center|LOCUS_07650 8252 8728 gene locus_tag LOCUS_07660 gene smpB 8252 8728 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T34 protein_id gnl|my_center|LOCUS_07660 9462 8761 gene locus_tag LOCUS_07670 gene dnaQ 9462 8761 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1H0 protein_id gnl|my_center|LOCUS_07670 9966 9466 gene locus_tag LOCUS_07680 gene rnhA 9966 9466 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIS7 protein_id gnl|my_center|LOCUS_07680 10821 10015 gene locus_tag LOCUS_07690 10821 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 11053 11922 gene locus_tag LOCUS_07700 11053 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 11940 12902 gene locus_tag LOCUS_07710 11940 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence047 1157 2551 gene locus_tag LOCUS_07720 1157 2551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_07720 4436 2562 gene locus_tag LOCUS_07730 4436 2562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475345.1 protein_id gnl|my_center|LOCUS_07730 4513 5241 gene locus_tag LOCUS_07740 4513 5241 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_07740 5521 5261 gene locus_tag LOCUS_07750 5521 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 6108 5518 gene locus_tag LOCUS_07760 6108 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8881 6098 gene locus_tag LOCUS_07770 8881 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 10424 8886 gene locus_tag LOCUS_07780 10424 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 10876 12756 gene locus_tag LOCUS_07790 10876 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence048 285 875 gene locus_tag LOCUS_07800 285 875 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_07800 2443 872 gene locus_tag LOCUS_07810 gene phoA 2443 872 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_07810 3492 2443 gene locus_tag LOCUS_07820 3492 2443 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAV6 protein_id gnl|my_center|LOCUS_07820 4455 3508 gene locus_tag LOCUS_07830 gene lpxL 4455 3508 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW10 protein_id gnl|my_center|LOCUS_07830 5950 4526 gene locus_tag LOCUS_07840 5950 4526 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946436.1 protein_id gnl|my_center|LOCUS_07840 6337 6023 gene locus_tag LOCUS_07850 6337 6023 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_07850 6633 8540 gene locus_tag LOCUS_07860 gene thiC 6633 8540 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 protein_id gnl|my_center|LOCUS_07860 8703 9419 gene locus_tag LOCUS_07870 gene mtnC 8703 9419 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N5 protein_id gnl|my_center|LOCUS_07870 9416 9751 gene locus_tag LOCUS_07880 9416 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 9945 10115 gene locus_tag LOCUS_07890 9945 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 10108 11391 gene locus_tag LOCUS_07900 gene cisY 10108 11391 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ53 protein_id gnl|my_center|LOCUS_07900 12460 11477 gene locus_tag LOCUS_07910 12460 11477 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence049 2 1195 gene locus_tag LOCUS_07920 2 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1192 1881 gene locus_tag LOCUS_07930 gene cmk 1192 1881 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD6 protein_id gnl|my_center|LOCUS_07930 2061 3731 gene locus_tag LOCUS_07940 gene rpsA 2061 3731 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_07940 3973 4350 gene locus_tag LOCUS_07950 3973 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4548 4787 gene locus_tag LOCUS_07960 4548 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4851 6164 gene locus_tag LOCUS_07970 gene lapB 4851 6164 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN37 protein_id gnl|my_center|LOCUS_07970 6199 6924 gene locus_tag LOCUS_07980 gene pyrF 6199 6924 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9J2 protein_id gnl|my_center|LOCUS_07980 6955 7245 gene locus_tag LOCUS_07990 6955 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7255 8598 gene locus_tag LOCUS_08000 7255 8598 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W75 protein_id gnl|my_center|LOCUS_08000 8956 9327 gene locus_tag LOCUS_08010 8956 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 9346 9600 gene locus_tag LOCUS_08020 9346 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10123 10965 gene locus_tag LOCUS_08030 10123 10965 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_08030 11356 12273 gene locus_tag LOCUS_08040 gene dhmA 11356 12273 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_08040 >Feature sequence050 1028 351 gene locus_tag LOCUS_08050 1028 351 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_08050 2034 1015 gene locus_tag LOCUS_08060 gene fliG 2034 1015 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E0 protein_id gnl|my_center|LOCUS_08060 3701 2034 gene locus_tag LOCUS_08070 gene fliF 3701 2034 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUN3 protein_id gnl|my_center|LOCUS_08070 4125 3742 gene locus_tag LOCUS_08080 4125 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5196 4147 gene locus_tag LOCUS_08090 5196 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5417 6319 gene locus_tag LOCUS_08100 5417 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6707 6363 gene locus_tag LOCUS_08110 6707 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7289 6813 gene locus_tag LOCUS_08120 7289 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 8642 7374 gene locus_tag LOCUS_08130 8642 7374 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887610.1 protein_id gnl|my_center|LOCUS_08130 8732 10210 gene locus_tag LOCUS_08140 gene glpK 8732 10210 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_08140 11798 10221 gene locus_tag LOCUS_08150 gene fleQ 11798 10221 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence051 1324 311 gene locus_tag LOCUS_08160 1324 311 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_08160 3752 1341 gene locus_tag LOCUS_08170 3752 1341 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_08170 4557 3835 gene locus_tag LOCUS_08180 4557 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4901 5872 gene locus_tag LOCUS_08190 gene dusA 4901 5872 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7X0 protein_id gnl|my_center|LOCUS_08190 5865 6686 gene locus_tag LOCUS_08200 5865 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 7724 6696 gene locus_tag LOCUS_08210 7724 6696 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHQ3 protein_id gnl|my_center|LOCUS_08210 8602 7724 gene locus_tag LOCUS_08220 8602 7724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence052 1232 3376 gene locus_tag LOCUS_08230 1232 3376 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_08230 3539 9112 gene locus_tag LOCUS_08240 3539 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 9614 9201 gene locus_tag LOCUS_08250 9614 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 10479 9604 gene locus_tag LOCUS_08260 10479 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 10997 10476 gene locus_tag LOCUS_08270 10997 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11527 11012 gene locus_tag LOCUS_08280 11527 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 12012 11611 gene locus_tag LOCUS_08290 12012 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence053 272 1498 gene locus_tag LOCUS_08300 272 1498 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_08300 2172 1540 gene locus_tag LOCUS_08310 2172 1540 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_08310 2285 2773 gene locus_tag LOCUS_08320 gene coaD 2285 2773 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH3 protein_id gnl|my_center|LOCUS_08320 2775 3023 gene locus_tag LOCUS_08330 2775 3023 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_08330 3039 4745 gene locus_tag LOCUS_08340 gene ggt 3039 4745 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_08340 5560 4748 gene locus_tag LOCUS_08350 gene mutM 5560 4748 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_08350 6462 5560 gene locus_tag LOCUS_08360 6462 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6930 8123 gene locus_tag LOCUS_08370 6930 8123 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946303.1 protein_id gnl|my_center|LOCUS_08370 9525 8401 gene locus_tag LOCUS_08380 9525 8401 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_08380 9688 10881 gene locus_tag LOCUS_08390 gene ivdA 9688 10881 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_08390 10944 11777 gene locus_tag LOCUS_08400 10944 11777 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464912.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence054 3238 2381 gene locus_tag LOCUS_08410 3238 2381 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_08410 4269 3262 gene locus_tag LOCUS_08420 4269 3262 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_08420 5818 4472 gene locus_tag LOCUS_08430 5818 4472 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_08430 5796 6062 gene locus_tag LOCUS_08440 5796 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 7554 6277 gene locus_tag LOCUS_08450 7554 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 8603 7968 gene locus_tag LOCUS_08460 8603 7968 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_08460 9134 8622 gene locus_tag LOCUS_08470 9134 8622 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 protein_id gnl|my_center|LOCUS_08470 9328 10419 gene locus_tag LOCUS_08480 9328 10419 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence055 765 457 gene locus_tag LOCUS_08490 765 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1492 896 gene locus_tag LOCUS_08500 1492 896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873799.1 protein_id gnl|my_center|LOCUS_08500 4841 1521 gene locus_tag LOCUS_08510 4841 1521 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_08510 5154 6599 gene locus_tag LOCUS_08520 5154 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_08520 6628 7656 gene locus_tag LOCUS_08530 6628 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_08530 7740 8825 gene locus_tag LOCUS_08540 7740 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 protein_id gnl|my_center|LOCUS_08540 9575 8892 gene locus_tag LOCUS_08550 9575 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence056 476 946 gene locus_tag LOCUS_08560 476 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 969 1211 gene locus_tag LOCUS_08570 969 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1404 3191 gene locus_tag LOCUS_08580 gene lepA 1404 3191 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD2 protein_id gnl|my_center|LOCUS_08580 3264 4037 gene locus_tag LOCUS_08590 gene lepB-1 3264 4037 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_08590 4065 4460 gene locus_tag LOCUS_08600 4065 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4466 5161 gene locus_tag LOCUS_08610 gene rnc 4466 5161 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB2 protein_id gnl|my_center|LOCUS_08610 5244 6170 gene locus_tag LOCUS_08620 gene era 5244 6170 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL1 protein_id gnl|my_center|LOCUS_08620 6178 6903 gene locus_tag LOCUS_08630 gene recO 6178 6903 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44642 protein_id gnl|my_center|LOCUS_08630 6903 7667 gene locus_tag LOCUS_08640 6903 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202011.1 protein_id gnl|my_center|LOCUS_08640 8403 7675 gene locus_tag LOCUS_08650 gene lpxH 8403 7675 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58976 protein_id gnl|my_center|LOCUS_08650 8894 8403 gene locus_tag LOCUS_08660 gene ppiB 8894 8403 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SS5 protein_id gnl|my_center|LOCUS_08660 9547 8891 gene locus_tag LOCUS_08670 9547 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9671 11068 gene locus_tag LOCUS_08680 gene cysS 9671 11068 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D6 protein_id gnl|my_center|LOCUS_08680 <11840 11112 gene locus_tag LOCUS_08690 <11840 11112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113772.1:short-chain dehydrogenase/reductase >Feature sequence057 362 1435 gene locus_tag LOCUS_08700 362 1435 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_08700 1440 3050 gene locus_tag LOCUS_08710 1440 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119876.1 protein_id gnl|my_center|LOCUS_08710 3047 4573 gene locus_tag LOCUS_08720 3047 4573 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_08720 4583 5170 gene locus_tag LOCUS_08730 4583 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5295 6065 gene locus_tag LOCUS_08740 5295 6065 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_08740 6065 7015 gene locus_tag LOCUS_08750 gene motB 6065 7015 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460634.1 protein_id gnl|my_center|LOCUS_08750 7074 7676 gene locus_tag LOCUS_08760 7074 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 8463 7753 gene locus_tag LOCUS_08770 8463 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8774 9238 gene locus_tag LOCUS_08780 8774 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 9253 10218 gene locus_tag LOCUS_08790 gene fliM 9253 10218 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E6 protein_id gnl|my_center|LOCUS_08790 10248 10541 gene locus_tag LOCUS_08800 10248 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 10541 11017 gene locus_tag LOCUS_08810 10541 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence058 3417 1192 gene locus_tag LOCUS_08820 3417 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227803.1 protein_id gnl|my_center|LOCUS_08820 3516 4559 gene locus_tag LOCUS_08830 3516 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 5059 4541 gene locus_tag LOCUS_08840 gene greB 5059 4541 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P8 protein_id gnl|my_center|LOCUS_08840 5268 5113 gene locus_tag LOCUS_08850 gene rpmG 5268 5113 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NEU0 protein_id gnl|my_center|LOCUS_08850 5654 5280 gene locus_tag LOCUS_08860 5654 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5781 7049 gene locus_tag LOCUS_08870 5781 7049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_08870 8752 7040 gene locus_tag LOCUS_08880 8752 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 10692 8755 gene locus_tag LOCUS_08890 10692 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096405.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence059 4110 931 gene locus_tag LOCUS_08900 4110 931 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_08900 4332 4111 gene locus_tag LOCUS_08910 4332 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08910 5291 4329 gene locus_tag LOCUS_08920 gene cas1 5291 4329 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHN1 protein_id gnl|my_center|LOCUS_08920 5513 5698 gene locus_tag LOCUS_08930 5513 5698 CDS product antitoxin VapB32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_08930 5824 5961 gene locus_tag LOCUS_08940 5824 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7196 5973 gene locus_tag LOCUS_08950 7196 5973 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_08950 7650 7198 gene locus_tag LOCUS_08960 7650 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8886 8227 gene locus_tag LOCUS_08970 8886 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_08970 8966 9823 gene locus_tag LOCUS_08980 8966 9823 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_08980 10681 9929 gene locus_tag LOCUS_08990 10681 9929 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_08990 11496 10858 gene locus_tag LOCUS_09000 11496 10858 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975315.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence060 298 1701 gene locus_tag LOCUS_09010 gene hldE 298 1701 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ2 protein_id gnl|my_center|LOCUS_09010 1706 2287 gene locus_tag LOCUS_09020 gene gmhA 1706 2287 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93UJ2 protein_id gnl|my_center|LOCUS_09020 2303 2860 gene locus_tag LOCUS_09030 gene gmhB 2303 2860 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB1 protein_id gnl|my_center|LOCUS_09030 4216 2867 gene locus_tag LOCUS_09040 gene mgtE 4216 2867 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_09040 4721 4452 gene locus_tag LOCUS_09050 gene ptsH 4721 4452 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_09050 5171 4785 gene locus_tag LOCUS_09060 5171 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6042 5164 gene locus_tag LOCUS_09070 6042 5164 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_09070 7053 6109 gene locus_tag LOCUS_09080 gene hprK 7053 6109 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9S6 protein_id gnl|my_center|LOCUS_09080 7693 7205 gene locus_tag LOCUS_09090 7693 7205 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177163.1 protein_id gnl|my_center|LOCUS_09090 8030 7734 gene locus_tag LOCUS_09100 8030 7734 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_09100 9685 8192 gene locus_tag LOCUS_09110 gene rpoN 9685 8192 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_09110 10684 9947 gene locus_tag LOCUS_09120 gene lptB 10684 9947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_09120 11234 10686 gene locus_tag LOCUS_09130 gene lptA 11234 10686 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNU7 protein_id gnl|my_center|LOCUS_09130 >Feature sequence061 <1 526 gene locus_tag LOCUS_09140 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83AU7:pyruvate kinase 765 1814 gene locus_tag LOCUS_09150 765 1814 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_09150 3525 1858 gene locus_tag LOCUS_09160 3525 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4484 3525 gene locus_tag LOCUS_09170 4484 3525 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_09170 5104 4466 gene locus_tag LOCUS_09180 5104 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5981 5130 gene locus_tag LOCUS_09190 gene purC 5981 5130 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q8 protein_id gnl|my_center|LOCUS_09190 6437 8680 gene locus_tag LOCUS_09200 6437 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 8964 8695 gene locus_tag LOCUS_09210 8964 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 9582 9016 gene locus_tag LOCUS_09220 9582 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9732 10040 gene locus_tag LOCUS_09230 9732 10040 CDS product cytochrome c554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706159.1 protein_id gnl|my_center|LOCUS_09230 10141 10821 gene locus_tag LOCUS_09240 gene rpe 10141 10821 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK14 protein_id gnl|my_center|LOCUS_09240 >Feature sequence062 62 853 gene locus_tag LOCUS_09250 62 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973595.1 protein_id gnl|my_center|LOCUS_09250 857 2032 gene locus_tag LOCUS_09260 857 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460509.1 protein_id gnl|my_center|LOCUS_09260 2197 3243 gene locus_tag LOCUS_09270 gene gshB 2197 3243 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UR6 protein_id gnl|my_center|LOCUS_09270 4044 3328 gene locus_tag LOCUS_09280 4044 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5007 4270 gene locus_tag LOCUS_09290 5007 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 5981 5280 gene locus_tag LOCUS_09300 5981 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6946 6188 gene locus_tag LOCUS_09310 6946 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10412 6981 gene locus_tag LOCUS_09320 gene mfd 10412 6981 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_09320 >Feature sequence063 560 33 gene locus_tag LOCUS_09330 gene ppa 560 33 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ESN8 protein_id gnl|my_center|LOCUS_09330 742 1413 gene locus_tag LOCUS_09340 gene adk 742 1413 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_09340 1555 4548 gene locus_tag LOCUS_09350 gene sucA 1555 4548 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_09350 4667 5956 gene locus_tag LOCUS_09360 gene sucB 4667 5956 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 protein_id gnl|my_center|LOCUS_09360 6026 7477 gene locus_tag LOCUS_09370 gene lpdG 6026 7477 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_09370 7505 8668 gene locus_tag LOCUS_09380 gene sucC 7505 8668 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT18 protein_id gnl|my_center|LOCUS_09380 8671 9543 gene locus_tag LOCUS_09390 gene sucD 8671 9543 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY38 protein_id gnl|my_center|LOCUS_09390 9637 10962 gene locus_tag LOCUS_09400 9637 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence064 1772 618 gene locus_tag LOCUS_09410 gene carA 1772 618 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 protein_id gnl|my_center|LOCUS_09410 3228 1972 gene locus_tag LOCUS_09420 3228 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4542 3271 gene locus_tag LOCUS_09430 4542 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 5388 4546 gene locus_tag LOCUS_09440 gene rsmI 5388 4546 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK05 protein_id gnl|my_center|LOCUS_09440 5495 7360 gene locus_tag LOCUS_09450 5495 7360 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_09450 7360 7737 gene locus_tag LOCUS_09460 7360 7737 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY5 protein_id gnl|my_center|LOCUS_09460 7737 8315 gene locus_tag LOCUS_09470 7737 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8764 8354 gene locus_tag LOCUS_09480 gene sspB 8764 8354 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 protein_id gnl|my_center|LOCUS_09480 9452 8859 gene locus_tag LOCUS_09490 gene sspA 9452 8859 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948402.1 protein_id gnl|my_center|LOCUS_09490 10281 9493 gene locus_tag LOCUS_09500 10281 9493 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_09500 <10942 10345 gene locus_tag LOCUS_09510 <10942 10345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F599:cytochrome b >Feature sequence065 3382 587 gene locus_tag LOCUS_09520 gene ileS 3382 587 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_09520 4357 3410 gene locus_tag LOCUS_09530 gene ribF 4357 3410 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED4 protein_id gnl|my_center|LOCUS_09530 5871 4357 gene locus_tag LOCUS_09540 gene mviN 5871 4357 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED5 protein_id gnl|my_center|LOCUS_09540 6103 6399 gene locus_tag LOCUS_09550 gene rpsT 6103 6399 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_09550 7613 6501 gene locus_tag LOCUS_09560 gene proB 7613 6501 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_09560 8686 7613 gene locus_tag LOCUS_09570 gene obg 8686 7613 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_09570 9076 8792 gene locus_tag LOCUS_09580 gene rpmA 9076 8792 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E872 protein_id gnl|my_center|LOCUS_09580 9415 9104 gene locus_tag LOCUS_09590 gene rplU 9415 9104 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WBD7 protein_id gnl|my_center|LOCUS_09590 9555 10526 gene locus_tag LOCUS_09600 9555 10526 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence066 <1 873 gene locus_tag LOCUS_09610 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947351.1:alpha/beta hydrolase 1064 876 gene locus_tag LOCUS_09620 1064 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2865 1333 gene locus_tag LOCUS_09630 gene oprN 2865 1333 CDS product multidrug efflux outer membrane protein OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_09630 6074 2880 gene locus_tag LOCUS_09640 gene mexF2 6074 2880 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 protein_id gnl|my_center|LOCUS_09640 7387 6116 gene locus_tag LOCUS_09650 7387 6116 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947886.1 protein_id gnl|my_center|LOCUS_09650 7595 8650 gene locus_tag LOCUS_09660 7595 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09660 8604 8831 gene locus_tag LOCUS_09670 8604 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9748 8873 gene locus_tag LOCUS_09680 9748 8873 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_09680 10254 9787 gene locus_tag LOCUS_09690 10254 9787 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_09690 10682 10251 gene locus_tag LOCUS_09700 10682 10251 CDS product PaaI-family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265987.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence067 347 2692 gene locus_tag LOCUS_09710 gene bamA 347 2692 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPU7 protein_id gnl|my_center|LOCUS_09710 2707 3210 gene locus_tag LOCUS_09720 2707 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3217 4269 gene locus_tag LOCUS_09730 gene lpxD 3217 4269 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E9 protein_id gnl|my_center|LOCUS_09730 4388 4849 gene locus_tag LOCUS_09740 gene fabZ 4388 4849 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820W7 protein_id gnl|my_center|LOCUS_09740 4849 5628 gene locus_tag LOCUS_09750 gene lpxA 4849 5628 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW5 protein_id gnl|my_center|LOCUS_09750 5669 6475 gene locus_tag LOCUS_09760 5669 6475 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_09760 6478 7392 gene locus_tag LOCUS_09770 6478 7392 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_09770 7364 8224 gene locus_tag LOCUS_09780 7364 8224 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBU7 protein_id gnl|my_center|LOCUS_09780 8237 9448 gene locus_tag LOCUS_09790 8237 9448 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_09790 9751 9665 gene locus_tag LOCUS_t00080 9751 9665 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10132 9803 gene locus_tag LOCUS_09800 10132 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence068 810 2384 gene locus_tag LOCUS_09810 gene fha1 810 2384 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_09810 2390 2869 gene locus_tag LOCUS_09820 2390 2869 CDS product type VI secretion lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463795.1 protein_id gnl|my_center|LOCUS_09820 2895 4229 gene locus_tag LOCUS_09830 2895 4229 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 protein_id gnl|my_center|LOCUS_09830 4488 5195 gene locus_tag LOCUS_09840 4488 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5247 8717 gene locus_tag LOCUS_09850 gene icmF1 5247 8717 CDS product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_09850 8719 9462 gene locus_tag LOCUS_09860 8719 9462 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463803.1 protein_id gnl|my_center|LOCUS_09860 9467 10231 gene locus_tag LOCUS_09870 gene pppA 9467 10231 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence069 <1 1092 gene locus_tag LOCUS_09880 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZRK6:bifunctional protein GlmU 1105 2937 gene locus_tag LOCUS_09890 gene glmS 1105 2937 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT25 protein_id gnl|my_center|LOCUS_09890 3146 4282 gene locus_tag LOCUS_09900 3146 4282 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_09900 5738 4338 gene locus_tag LOCUS_09910 5738 4338 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTA4 protein_id gnl|my_center|LOCUS_09910 6517 5744 gene locus_tag LOCUS_09920 gene yibQ 6517 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_09920 7910 6594 gene locus_tag LOCUS_09930 7910 6594 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_09930 9013 7910 gene locus_tag LOCUS_09940 9013 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_09940 9141 9563 gene locus_tag LOCUS_09950 gene yibN 9141 9563 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_09950 9631 9846 gene locus_tag LOCUS_09960 gene grxC 9631 9846 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970079.1 protein_id gnl|my_center|LOCUS_09960 9875 10342 gene locus_tag LOCUS_09970 gene secB 9875 10342 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BI9 protein_id gnl|my_center|LOCUS_09970 >Feature sequence070 239 1270 gene locus_tag LOCUS_09980 gene purK 239 1270 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72158 protein_id gnl|my_center|LOCUS_09980 2081 1281 gene locus_tag LOCUS_09990 2081 1281 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_09990 3327 2119 gene locus_tag LOCUS_10000 3327 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016946.1 protein_id gnl|my_center|LOCUS_10000 4733 3807 gene locus_tag LOCUS_10010 4733 3807 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_10010 5484 4735 gene locus_tag LOCUS_10020 gene etfB 5484 4735 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_10020 6488 5733 gene locus_tag LOCUS_10030 6488 5733 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766802.1 protein_id gnl|my_center|LOCUS_10030 7474 6485 gene locus_tag LOCUS_10040 gene exoA 7474 6485 CDS product succinoglycan biosynthesis protein exoa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973529.1 protein_id gnl|my_center|LOCUS_10040 8511 7519 gene locus_tag LOCUS_10050 8511 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105247.1 protein_id gnl|my_center|LOCUS_10050 8595 9941 gene locus_tag LOCUS_10060 gene norM 8595 9941 CDS product multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4Y6 protein_id gnl|my_center|LOCUS_10060 >Feature sequence071 2723 513 gene locus_tag LOCUS_10070 2723 513 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_10070 3997 2723 gene locus_tag LOCUS_10080 3997 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5646 4132 gene locus_tag LOCUS_10090 5646 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5926 6975 gene locus_tag LOCUS_10100 gene idiA 5926 6975 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_10100 7089 8684 gene locus_tag LOCUS_10110 7089 8684 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_10110 8691 9716 gene locus_tag LOCUS_10120 8691 9716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_10120 10096 9779 gene locus_tag LOCUS_10130 10096 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence072 113 1255 gene locus_tag LOCUS_10140 113 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1482 2192 gene locus_tag LOCUS_10150 1482 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2837 2229 gene locus_tag LOCUS_10160 2837 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_10160 3270 2923 gene locus_tag LOCUS_10170 3270 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3618 4058 gene locus_tag LOCUS_10180 3618 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4076 4918 gene locus_tag LOCUS_10190 4076 4918 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604155.1 protein_id gnl|my_center|LOCUS_10190 5211 5831 gene locus_tag LOCUS_10200 gene sodC2 5211 5831 CDS product superoxide dismutase [Cu-Zn] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66602 protein_id gnl|my_center|LOCUS_10200 5831 7468 gene locus_tag LOCUS_10210 5831 7468 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_10210 7484 8857 gene locus_tag LOCUS_10220 7484 8857 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947312.1 protein_id gnl|my_center|LOCUS_10220 8857 9384 gene locus_tag LOCUS_10230 8857 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9388 9702 gene locus_tag LOCUS_10240 9388 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771691.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence073 1573 965 gene locus_tag LOCUS_10250 gene nqrE 1573 965 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_10250 2235 1573 gene locus_tag LOCUS_10260 gene nqrD 2235 1573 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_10260 3045 2242 gene locus_tag LOCUS_10270 gene nqrC 3045 2242 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_10270 4287 3064 gene locus_tag LOCUS_10280 gene nqrB 4287 3064 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_10280 5653 4292 gene locus_tag LOCUS_10290 gene nqrA 5653 4292 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP52 protein_id gnl|my_center|LOCUS_10290 5899 6894 gene locus_tag LOCUS_10300 gene acoA 5899 6894 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_10300 6891 7892 gene locus_tag LOCUS_10310 gene acoB2 6891 7892 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888040.1 protein_id gnl|my_center|LOCUS_10310 8003 8815 gene locus_tag LOCUS_10320 8003 8815 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_10320 8931 9128 gene locus_tag LOCUS_10330 8931 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9133 9711 gene locus_tag LOCUS_10340 9133 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence074 <1 1063 gene locus_tag LOCUS_10350 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261633.1:quinoprotein dehydrogenase 1096 3774 gene locus_tag LOCUS_10360 1096 3774 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_10360 3771 4220 gene locus_tag LOCUS_10370 3771 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4322 5125 gene locus_tag LOCUS_10380 4322 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5550 6779 gene locus_tag LOCUS_10390 5550 6779 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937781.1 protein_id gnl|my_center|LOCUS_10390 6832 8115 gene locus_tag LOCUS_10400 gene pfp 6832 8115 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_10400 8489 8136 gene locus_tag LOCUS_10410 8489 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 8694 9815 gene locus_tag LOCUS_10420 8694 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence075 6263 2403 gene locus_tag LOCUS_10430 gene purL 6263 2403 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V169 protein_id gnl|my_center|LOCUS_10430 6407 6765 gene locus_tag LOCUS_tm00010 6407 6765 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6982 7290 gene locus_tag LOCUS_10440 6982 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8412 7384 gene locus_tag LOCUS_10450 8412 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_10450 9030 8413 gene locus_tag LOCUS_10460 9030 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9342 9064 gene locus_tag LOCUS_10470 9342 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence076 602 835 gene locus_tag LOCUS_10480 602 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1067 1318 gene locus_tag LOCUS_10490 1067 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1914 1366 gene locus_tag LOCUS_10500 1914 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3360 2170 gene locus_tag LOCUS_10510 3360 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3631 3353 gene locus_tag LOCUS_10520 3631 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5061 3928 gene locus_tag LOCUS_10530 gene nah 5061 3928 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_10530 5430 5092 gene locus_tag LOCUS_10540 gene glnB 5430 5092 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 protein_id gnl|my_center|LOCUS_10540 5982 5575 gene locus_tag LOCUS_10550 5982 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 6395 5985 gene locus_tag LOCUS_10560 6395 5985 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_10560 7979 6531 gene locus_tag LOCUS_10570 gene gatB 7979 6531 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM8 protein_id gnl|my_center|LOCUS_10570 9456 7996 gene locus_tag LOCUS_10580 gene gatA 9456 7996 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_10580 9731 9549 gene locus_tag LOCUS_10590 9731 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence077 285 1544 gene locus_tag LOCUS_10600 gene murA 285 1544 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV2 protein_id gnl|my_center|LOCUS_10600 1554 2228 gene locus_tag LOCUS_10610 gene hisG 1554 2228 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_10610 2286 3353 gene locus_tag LOCUS_10620 gene aroG 2286 3353 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_10620 3358 4659 gene locus_tag LOCUS_10630 gene hisD 3358 4659 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSZ1 protein_id gnl|my_center|LOCUS_10630 4664 5728 gene locus_tag LOCUS_10640 gene hisC2 4664 5728 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q87 protein_id gnl|my_center|LOCUS_10640 5865 7655 gene locus_tag LOCUS_10650 5865 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8450 7719 gene locus_tag LOCUS_10660 8450 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 <9672 8692 gene locus_tag LOCUS_10670 <9672 8692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MP44:dihydrolipoyl dehydrogenase >Feature sequence078 <1 1363 gene locus_tag LOCUS_10680 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112740.1:PmbA protein 2325 1417 gene locus_tag LOCUS_10690 2325 1417 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_10690 2489 3337 gene locus_tag LOCUS_10700 2489 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 5113 3398 gene locus_tag LOCUS_10710 5113 3398 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_10710 5429 5106 gene locus_tag LOCUS_10720 5429 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6891 5422 gene locus_tag LOCUS_10730 6891 5422 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_10730 8471 6894 gene locus_tag LOCUS_10740 8471 6894 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_10740 8832 8458 gene locus_tag LOCUS_10750 8832 8458 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_10750 <9664 8832 gene locus_tag LOCUS_10760 <9664 8832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004599366.1:cation:proton antiporter >Feature sequence079 342 266 gene locus_tag LOCUS_t00090 342 266 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 534 459 gene locus_tag LOCUS_t00100 534 459 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 860 588 gene locus_tag LOCUS_10770 gene hupB 860 588 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_10770 3510 1075 gene locus_tag LOCUS_10780 gene lon 3510 1075 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_10780 4990 3710 gene locus_tag LOCUS_10790 gene clpX 4990 3710 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY5 protein_id gnl|my_center|LOCUS_10790 5949 5329 gene locus_tag LOCUS_10800 gene clpP 5949 5329 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FXB9 protein_id gnl|my_center|LOCUS_10800 7280 5961 gene locus_tag LOCUS_10810 gene tig 7280 5961 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU0 protein_id gnl|my_center|LOCUS_10810 7447 7363 gene locus_tag LOCUS_t00110 7447 7363 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7652 7577 gene locus_tag LOCUS_t00120 7652 7577 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7837 7761 gene locus_tag LOCUS_t00130 7837 7761 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8000 7924 gene locus_tag LOCUS_t00140 8000 7924 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8243 9079 gene locus_tag LOCUS_10820 gene folD 8243 9079 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence080 1723 740 gene locus_tag LOCUS_10830 1723 740 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_10830 1891 3375 gene locus_tag LOCUS_10840 gene sbcB 1891 3375 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_10840 4010 5932 gene locus_tag LOCUS_10850 4010 5932 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706273.1 protein_id gnl|my_center|LOCUS_10850 5942 7201 gene locus_tag LOCUS_10860 5942 7201 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL05 protein_id gnl|my_center|LOCUS_10860 7226 8737 gene locus_tag LOCUS_10870 7226 8737 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence081 860 129 gene locus_tag LOCUS_10880 860 129 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_10880 1462 860 gene locus_tag LOCUS_10890 1462 860 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_10890 2582 1518 gene locus_tag LOCUS_10900 gene nagZ 2582 1518 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKN0 protein_id gnl|my_center|LOCUS_10900 3063 2593 gene locus_tag LOCUS_10910 gene ispF 3063 2593 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_10910 3784 3068 gene locus_tag LOCUS_10920 gene ispD 3784 3068 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05029 protein_id gnl|my_center|LOCUS_10920 4101 3781 gene locus_tag LOCUS_10930 gene ftsB 4101 3781 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ3 protein_id gnl|my_center|LOCUS_10930 5501 4203 gene locus_tag LOCUS_10940 gene eno 5501 4203 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z3 protein_id gnl|my_center|LOCUS_10940 6388 5543 gene locus_tag LOCUS_10950 gene kdsA 6388 5543 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA3 protein_id gnl|my_center|LOCUS_10950 8025 6394 gene locus_tag LOCUS_10960 gene pyrG 8025 6394 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_10960 8444 8187 gene locus_tag LOCUS_10970 8444 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8707 8435 gene locus_tag LOCUS_10980 8707 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence082 3720 2557 gene locus_tag LOCUS_10990 3720 2557 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_10990 5282 3780 gene locus_tag LOCUS_11000 5282 3780 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706710.1 protein_id gnl|my_center|LOCUS_11000 5998 5306 gene locus_tag LOCUS_11010 5998 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6229 7056 gene locus_tag LOCUS_11020 6229 7056 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_11020 7165 9003 gene locus_tag LOCUS_11030 7165 9003 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence083 2621 1308 gene locus_tag LOCUS_11040 2621 1308 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040402.1 protein_id gnl|my_center|LOCUS_11040 4816 2618 gene locus_tag LOCUS_11050 4816 2618 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_11050 6714 4813 gene locus_tag LOCUS_11060 6714 4813 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_11060 7271 6711 gene locus_tag LOCUS_11070 7271 6711 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832895.1 protein_id gnl|my_center|LOCUS_11070 <9149 7426 gene locus_tag LOCUS_11080 <9149 7426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000951431.1:agglutination protein >Feature sequence084 2737 635 gene locus_tag LOCUS_11090 2737 635 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071387.1 protein_id gnl|my_center|LOCUS_11090 3137 5356 gene locus_tag LOCUS_11100 3137 5356 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883002.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 5353 5754 gene locus_tag LOCUS_11110 5353 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 5754 6107 gene locus_tag LOCUS_11120 5754 6107 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398830.1 protein_id gnl|my_center|LOCUS_11120 6104 7702 gene locus_tag LOCUS_11130 6104 7702 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_11130 7699 8172 gene locus_tag LOCUS_11140 7699 8172 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639705.1 protein_id gnl|my_center|LOCUS_11140 8165 8452 gene locus_tag LOCUS_11150 8165 8452 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883000.1 protein_id gnl|my_center|LOCUS_11150 8457 8768 gene locus_tag LOCUS_11160 8457 8768 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062160.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence085 53 1522 gene locus_tag LOCUS_11170 53 1522 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_11170 2732 1548 gene locus_tag LOCUS_11180 2732 1548 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986390.1 protein_id gnl|my_center|LOCUS_11180 3229 2810 gene locus_tag LOCUS_11190 3229 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4055 3435 gene locus_tag LOCUS_11200 gene sodB 4055 3435 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19685 protein_id gnl|my_center|LOCUS_11200 4952 4068 gene locus_tag LOCUS_11210 4952 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6731 5031 gene locus_tag LOCUS_11220 6731 5031 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 protein_id gnl|my_center|LOCUS_11220 7172 6831 gene locus_tag LOCUS_11230 7172 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8046 7261 gene locus_tag LOCUS_11240 8046 7261 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence086 1789 689 gene locus_tag LOCUS_11250 gene dnaN 1789 689 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_11250 3506 2028 gene locus_tag LOCUS_11260 gene dnaA 3506 2028 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TQ7 protein_id gnl|my_center|LOCUS_11260 3783 4349 gene locus_tag LOCUS_11270 3783 4349 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_11270 4349 5332 gene locus_tag LOCUS_11280 4349 5332 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_11280 5325 7676 gene locus_tag LOCUS_11290 5325 7676 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036291.1 protein_id gnl|my_center|LOCUS_11290 8032 8400 gene locus_tag LOCUS_11300 gene rnpA 8032 8400 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_11300 >Feature sequence087 71 739 gene locus_tag LOCUS_11310 71 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11310 956 1147 gene locus_tag LOCUS_11320 956 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1208 1759 gene locus_tag LOCUS_11330 1208 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073415.1 protein_id gnl|my_center|LOCUS_11330 1818 3392 gene locus_tag LOCUS_11340 1818 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3424 4500 gene locus_tag LOCUS_11350 3424 4500 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973328.1 protein_id gnl|my_center|LOCUS_11350 4512 7661 gene locus_tag LOCUS_11360 4512 7661 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_11360 7721 8371 gene locus_tag LOCUS_11370 7721 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence088 1012 74 gene locus_tag LOCUS_11380 1012 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2329 1334 gene locus_tag LOCUS_11390 2329 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4934 2397 gene locus_tag LOCUS_11400 4934 2397 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_11400 7942 5384 gene locus_tag LOCUS_11410 7942 5384 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_11410 <8840 8120 gene locus_tag LOCUS_11420 <8840 8120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266300.1:radical SAM protein >Feature sequence089 1029 2300 gene locus_tag LOCUS_11430 1029 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2699 2376 gene locus_tag LOCUS_11440 2699 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3348 2821 gene locus_tag LOCUS_11450 3348 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3618 4688 gene locus_tag LOCUS_11460 3618 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970517.1 protein_id gnl|my_center|LOCUS_11460 4740 5207 gene locus_tag LOCUS_11470 4740 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5876 5208 gene locus_tag LOCUS_11480 5876 5208 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_11480 8407 5879 gene locus_tag LOCUS_11490 8407 5879 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence090 953 1633 gene locus_tag LOCUS_11500 gene tmk 953 1633 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_11500 1633 2682 gene locus_tag LOCUS_11510 gene holB 1633 2682 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_11510 2756 3100 gene locus_tag LOCUS_11520 gene pilZ 2756 3100 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_11520 4131 3115 gene locus_tag LOCUS_11530 4131 3115 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJH8 protein_id gnl|my_center|LOCUS_11530 5294 4134 gene locus_tag LOCUS_11540 5294 4134 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VS5 protein_id gnl|my_center|LOCUS_11540 5880 5392 gene locus_tag LOCUS_11550 5880 5392 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883873.1 protein_id gnl|my_center|LOCUS_11550 7177 5882 gene locus_tag LOCUS_11560 7177 5882 CDS product molybdopterin biosynthesis protein MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455380.1 protein_id gnl|my_center|LOCUS_11560 7865 7320 gene locus_tag LOCUS_11570 7865 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence091 2460 46 gene locus_tag LOCUS_11580 2460 46 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267257.1 protein_id gnl|my_center|LOCUS_11580 3949 2453 gene locus_tag LOCUS_11590 3949 2453 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_11590 5271 3964 gene locus_tag LOCUS_11600 5271 3964 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208729.1 protein_id gnl|my_center|LOCUS_11600 6511 5282 gene locus_tag LOCUS_11610 6511 5282 CDS product aminotransferase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705409.1 protein_id gnl|my_center|LOCUS_11610 7331 6516 gene locus_tag LOCUS_11620 7331 6516 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGY7 protein_id gnl|my_center|LOCUS_11620 <8632 7328 gene locus_tag LOCUS_11630 <8632 7328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000090763.1:gamma-glutamyltranspeptidase >Feature sequence092 1250 651 gene locus_tag LOCUS_11640 gene petA 1250 651 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD50 protein_id gnl|my_center|LOCUS_11640 2224 1475 gene locus_tag LOCUS_11650 gene ybgI 2224 1475 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX0 protein_id gnl|my_center|LOCUS_11650 2281 3417 gene locus_tag LOCUS_11660 2281 3417 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_11660 4812 3724 gene locus_tag LOCUS_11670 4812 3724 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_11670 4916 5227 gene locus_tag LOCUS_11680 4916 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326309.1 protein_id gnl|my_center|LOCUS_11680 5417 5926 gene locus_tag LOCUS_11690 5417 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 5936 6883 gene locus_tag LOCUS_11700 5936 6883 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185296.1 protein_id gnl|my_center|LOCUS_11700 6943 7335 gene locus_tag LOCUS_11710 6943 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 <8584 7403 gene locus_tag LOCUS_11720 <8584 7403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257289.1:cell wall anchor >Feature sequence093 1360 1938 gene locus_tag LOCUS_11730 1360 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2922 2032 gene locus_tag LOCUS_11740 2922 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3425 3069 gene locus_tag LOCUS_11750 3425 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4108 3437 gene locus_tag LOCUS_11760 4108 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4547 4245 gene locus_tag LOCUS_11770 4547 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5367 4708 gene locus_tag LOCUS_11780 5367 4708 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 protein_id gnl|my_center|LOCUS_11780 6138 5395 gene locus_tag LOCUS_11790 6138 5395 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_11790 6486 6974 gene locus_tag LOCUS_11800 6486 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7544 7125 gene locus_tag LOCUS_11810 7544 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_11810 7649 8533 gene locus_tag LOCUS_11820 7649 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence094 793 719 gene locus_tag LOCUS_t00150 793 719 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1730 837 gene locus_tag LOCUS_11830 gene ispE 1730 837 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN01 protein_id gnl|my_center|LOCUS_11830 2317 1718 gene locus_tag LOCUS_11840 gene lolB 2317 1718 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI20 protein_id gnl|my_center|LOCUS_11840 4260 2314 gene locus_tag LOCUS_11850 4260 2314 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_11850 4541 5878 gene locus_tag LOCUS_11860 gene hemA 4541 5878 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMZ9 protein_id gnl|my_center|LOCUS_11860 5947 7038 gene locus_tag LOCUS_11870 gene prfA 5947 7038 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_11870 7080 7928 gene locus_tag LOCUS_11880 gene prmC 7080 7928 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 protein_id gnl|my_center|LOCUS_11880 >Feature sequence095 <1 4485 gene locus_tag LOCUS_11890 <1 4485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338726.1:hemolysin expression modulating protein 4565 4696 gene locus_tag LOCUS_11900 4565 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4765 5274 gene locus_tag LOCUS_11910 4765 5274 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_11910 5764 6483 gene locus_tag LOCUS_11920 5764 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6578 7465 gene locus_tag LOCUS_11930 6578 7465 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 protein_id gnl|my_center|LOCUS_11930 7559 7936 gene locus_tag LOCUS_11940 7559 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence096 328 253 gene locus_tag LOCUS_t00160 328 253 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1306 431 gene locus_tag LOCUS_11950 1306 431 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA14 protein_id gnl|my_center|LOCUS_11950 1505 1828 gene locus_tag LOCUS_11960 gene fdxA 1505 1828 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_11960 2028 4838 gene locus_tag LOCUS_11970 2028 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5261 4929 gene locus_tag LOCUS_11980 5261 4929 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405496.1 protein_id gnl|my_center|LOCUS_11980 5872 5258 gene locus_tag LOCUS_11990 gene recR 5872 5258 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW4 protein_id gnl|my_center|LOCUS_11990 6196 5873 gene locus_tag LOCUS_12000 6196 5873 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT50 protein_id gnl|my_center|LOCUS_12000 <8485 6224 gene locus_tag LOCUS_12010 <8485 6224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267265.1:DNA polymerase III subunit gamma/tau >Feature sequence097 346 1776 gene locus_tag LOCUS_12020 346 1776 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_12020 1941 2843 gene locus_tag LOCUS_12030 gene rpoH 1941 2843 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_12030 2949 5231 gene locus_tag LOCUS_12040 2949 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6454 5624 gene locus_tag LOCUS_12050 6454 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12050 8053 6458 gene locus_tag LOCUS_12060 8053 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence098 422 1189 gene locus_tag LOCUS_12070 422 1189 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_12070 1192 1896 gene locus_tag LOCUS_12080 1192 1896 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_12080 1936 2370 gene locus_tag LOCUS_12090 gene ygcM 1936 2370 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_12090 2947 2399 gene locus_tag LOCUS_12100 2947 2399 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_12100 4498 2948 gene locus_tag LOCUS_12110 gene purF 4498 2948 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_12110 5027 4503 gene locus_tag LOCUS_12120 gene dedE 5027 4503 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 protein_id gnl|my_center|LOCUS_12120 5748 5035 gene locus_tag LOCUS_12130 5748 5035 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198053.1 protein_id gnl|my_center|LOCUS_12130 7239 5866 gene locus_tag LOCUS_12140 gene folC 7239 5866 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_12140 8195 7263 gene locus_tag LOCUS_12150 gene accD 8195 7263 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_12150 >Feature sequence099 121 1302 gene locus_tag LOCUS_12160 121 1302 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_12160 1286 1945 gene locus_tag LOCUS_12170 1286 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_12170 1974 3869 gene locus_tag LOCUS_12180 1974 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5223 3877 gene locus_tag LOCUS_12190 5223 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5427 6272 gene locus_tag LOCUS_12200 5427 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7640 6267 gene locus_tag LOCUS_12210 7640 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence100 304 1905 gene locus_tag LOCUS_12220 gene pgi 304 1905 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_12220 2228 2767 gene locus_tag LOCUS_12230 2228 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2784 4832 gene locus_tag LOCUS_12240 2784 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4832 7903 gene locus_tag LOCUS_12250 4832 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence101 1765 551 gene locus_tag LOCUS_12260 gene ispG 1765 551 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK45 protein_id gnl|my_center|LOCUS_12260 2039 3982 gene locus_tag LOCUS_12270 gene dxs 2039 3982 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF9 protein_id gnl|my_center|LOCUS_12270 4127 4885 gene locus_tag LOCUS_12280 gene cysZ 4127 4885 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32DE0 protein_id gnl|my_center|LOCUS_12280 5085 5903 gene locus_tag LOCUS_12290 5085 5903 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040303.1 protein_id gnl|my_center|LOCUS_12290 6727 5900 gene locus_tag LOCUS_12300 6727 5900 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_12300 <8076 6751 gene locus_tag LOCUS_12310 <8076 6751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0M7:siroheme synthase >Feature sequence102 718 26 gene locus_tag LOCUS_12320 718 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1275 745 gene locus_tag LOCUS_12330 1275 745 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_12330 2249 1275 gene locus_tag LOCUS_12340 gene kdsD 2249 1275 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_12340 3234 2257 gene locus_tag LOCUS_12350 3234 2257 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_12350 4066 3335 gene locus_tag LOCUS_12360 4066 3335 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_12360 4372 5208 gene locus_tag LOCUS_12370 gene mlaF 4372 5208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_12370 5205 5990 gene locus_tag LOCUS_12380 5205 5990 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_12380 6009 6467 gene locus_tag LOCUS_12390 6009 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6596 7327 gene locus_tag LOCUS_12400 6596 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7332 7655 gene locus_tag LOCUS_12410 7332 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence103 875 114 gene locus_tag LOCUS_12420 gene ubiE 875 114 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A887 protein_id gnl|my_center|LOCUS_12420 3277 887 gene locus_tag LOCUS_12430 gene spoT 3277 887 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_12430 3715 3338 gene locus_tag LOCUS_12440 3715 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4414 3800 gene locus_tag LOCUS_12450 gene gmk 4414 3800 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTZ8 protein_id gnl|my_center|LOCUS_12450 4842 4546 gene locus_tag LOCUS_12460 4842 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5399 6859 gene locus_tag LOCUS_12470 5399 6859 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086509.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence104 <1 884 gene locus_tag LOCUS_12480 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389005.1:6-aminohexanoate-dimer hydrolase 988 1653 gene locus_tag LOCUS_12490 gene spoU 988 1653 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE14 protein_id gnl|my_center|LOCUS_12490 3102 1717 gene locus_tag LOCUS_12500 gene ffh 3102 1717 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVF4 protein_id gnl|my_center|LOCUS_12500 3335 4126 gene locus_tag LOCUS_12510 3335 4126 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266932.1 protein_id gnl|my_center|LOCUS_12510 4259 5446 gene locus_tag LOCUS_12520 4259 5446 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_12520 5602 6975 gene locus_tag LOCUS_12530 gene radA 5602 6975 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB3 protein_id gnl|my_center|LOCUS_12530 7009 7221 gene locus_tag LOCUS_12540 gene xseB 7009 7221 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence105 4450 2297 gene locus_tag LOCUS_12550 4450 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 7195 4796 gene locus_tag LOCUS_12560 7195 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence106 <1 541 gene locus_tag LOCUS_12570 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490371.1:ammonium transporter 1442 633 gene locus_tag LOCUS_12580 gene speE 1442 633 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_12580 1523 3388 gene locus_tag LOCUS_12590 gene speA 1523 3388 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN61 protein_id gnl|my_center|LOCUS_12590 3378 4538 gene locus_tag LOCUS_12600 gene pdxB 3378 4538 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL55 protein_id gnl|my_center|LOCUS_12600 4569 6380 gene locus_tag LOCUS_12610 gene typA 4569 6380 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_12610 6504 7607 gene locus_tag LOCUS_12620 6504 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence107 614 1855 gene locus_tag LOCUS_12630 614 1855 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104235.1 protein_id gnl|my_center|LOCUS_12630 1926 2507 gene locus_tag LOCUS_12640 1926 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2739 3893 gene locus_tag LOCUS_12650 2739 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 3934 4359 gene locus_tag LOCUS_12660 3934 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 5281 4373 gene locus_tag LOCUS_12670 5281 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_12670 5852 5289 gene locus_tag LOCUS_12680 5852 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence108 1265 3166 gene locus_tag LOCUS_12690 gene parE 1265 3166 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_12690 5858 3573 gene locus_tag LOCUS_12700 5858 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence109 <1 1007 gene locus_tag LOCUS_12710 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWU1:phosphate transport system permease protein PstA 1119 2006 gene locus_tag LOCUS_12720 gene pstB 1119 2006 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 protein_id gnl|my_center|LOCUS_12720 2078 2794 gene locus_tag LOCUS_12730 gene phoU 2078 2794 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_12730 2798 3178 gene locus_tag LOCUS_12740 2798 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3229 4524 gene locus_tag LOCUS_12750 3229 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943798.1 protein_id gnl|my_center|LOCUS_12750 5417 4515 gene locus_tag LOCUS_12760 gene argF 5417 4515 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ1 protein_id gnl|my_center|LOCUS_12760 6607 5426 gene locus_tag LOCUS_12770 gene argD 6607 5426 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_12770 6897 7268 gene locus_tag LOCUS_12780 6897 7268 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_12780 >Feature sequence110 1299 82 gene locus_tag LOCUS_12790 1299 82 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190444.1 protein_id gnl|my_center|LOCUS_12790 3080 1299 gene locus_tag LOCUS_12800 3080 1299 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_12800 4382 3084 gene locus_tag LOCUS_12810 4382 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5480 4392 gene locus_tag LOCUS_12820 5480 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 7181 5499 gene locus_tag LOCUS_12830 gene mshL 7181 5499 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence111 68 1984 gene locus_tag LOCUS_12840 gene atmA 68 1984 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_12840 2539 2006 gene locus_tag LOCUS_12850 2539 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2654 3679 gene locus_tag LOCUS_12860 gene moaA 2654 3679 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_12860 3894 4676 gene locus_tag LOCUS_12870 3894 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4771 5589 gene locus_tag LOCUS_12880 4771 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6844 5633 gene locus_tag LOCUS_12890 6844 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence112 652 1095 gene locus_tag LOCUS_12900 652 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096441.1 protein_id gnl|my_center|LOCUS_12900 1118 1807 gene locus_tag LOCUS_12910 1118 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2179 1931 gene locus_tag LOCUS_12920 2179 1931 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070492.1 protein_id gnl|my_center|LOCUS_12920 2372 2860 gene locus_tag LOCUS_12930 2372 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_12930 2882 3364 gene locus_tag LOCUS_12940 2882 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_12940 3421 5241 gene locus_tag LOCUS_12950 3421 5241 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268924.1 protein_id gnl|my_center|LOCUS_12950 5252 6190 gene locus_tag LOCUS_12960 5252 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103721.1 protein_id gnl|my_center|LOCUS_12960 6296 6694 gene locus_tag LOCUS_12970 6296 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6761 6967 gene locus_tag LOCUS_12980 6761 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence113 991 284 gene locus_tag LOCUS_12990 991 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_12990 1707 1000 gene locus_tag LOCUS_13000 1707 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_13000 3285 1798 gene locus_tag LOCUS_13010 3285 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 3984 3292 gene locus_tag LOCUS_13020 gene drrA 3984 3292 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_13020 4270 6762 gene locus_tag LOCUS_13030 4270 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence114 4192 3023 gene locus_tag LOCUS_13040 4192 3023 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_13040 5853 4411 gene locus_tag LOCUS_13050 5853 4411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087024.1 protein_id gnl|my_center|LOCUS_13050 6243 6167 gene locus_tag LOCUS_t00170 6243 6167 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 1323 2702 gene locus_tag LOCUS_13060 gene fumC 1323 2702 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_13060 2718 5435 gene locus_tag LOCUS_13070 gene rpfA 2718 5435 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 protein_id gnl|my_center|LOCUS_13070 >Feature sequence116 3000 1945 gene locus_tag LOCUS_13080 gene mtnA 3000 1945 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ92 protein_id gnl|my_center|LOCUS_13080 3182 3454 gene locus_tag LOCUS_13090 3182 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3458 3793 gene locus_tag LOCUS_13100 3458 3793 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_13100 5711 3906 gene locus_tag LOCUS_13110 5711 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 <6850 5880 gene locus_tag LOCUS_13120 <6850 5880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001075838.1:glucuronide transporter >Feature sequence117 35 373 gene locus_tag LOCUS_13130 gene fdx 35 373 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_13130 387 584 gene locus_tag LOCUS_13140 387 584 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_13140 679 1104 gene locus_tag LOCUS_13150 gene ndk 679 1104 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS2 protein_id gnl|my_center|LOCUS_13150 1205 2410 gene locus_tag LOCUS_13160 gene rlmN 1205 2410 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_13160 2566 3216 gene locus_tag LOCUS_13170 gene pilF 2566 3216 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_13170 3216 4349 gene locus_tag LOCUS_13180 gene rodZ 3216 4349 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII0 protein_id gnl|my_center|LOCUS_13180 4355 5680 gene locus_tag LOCUS_13190 gene hisS 4355 5680 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ45 protein_id gnl|my_center|LOCUS_13190 5765 6493 gene locus_tag LOCUS_13200 5765 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence118 786 1790 gene locus_tag LOCUS_13210 786 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1790 2878 gene locus_tag LOCUS_13220 1790 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2924 5095 gene locus_tag LOCUS_13230 2924 5095 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_13230 5092 6492 gene locus_tag LOCUS_13240 5092 6492 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W75 protein_id gnl|my_center|LOCUS_13240 >Feature sequence119 807 46 gene locus_tag LOCUS_13250 gene pssA 807 46 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_13250 1518 955 gene locus_tag LOCUS_13260 1518 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1482 1658 gene locus_tag LOCUS_13270 1482 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2667 1651 gene locus_tag LOCUS_13280 gene ilvC 2667 1651 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW9 protein_id gnl|my_center|LOCUS_13280 3263 2700 gene locus_tag LOCUS_13290 gene ilvH 3263 2700 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_13290 5019 3256 gene locus_tag LOCUS_13300 gene ilvI 5019 3256 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP8 protein_id gnl|my_center|LOCUS_13300 >Feature sequence120 371 1297 gene locus_tag LOCUS_13310 371 1297 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_13310 1297 2295 gene locus_tag LOCUS_13320 1297 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2304 2627 gene locus_tag LOCUS_13330 2304 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2642 3511 gene locus_tag LOCUS_13340 2642 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4902 3526 gene locus_tag LOCUS_13350 4902 3526 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_13350 5883 4909 gene locus_tag LOCUS_13360 5883 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 <6592 5893 gene locus_tag LOCUS_13370 <6592 5893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089093.1:alcohol dehydrogenase >Feature sequence121 1004 255 gene locus_tag LOCUS_13380 1004 255 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969545.1 protein_id gnl|my_center|LOCUS_13380 1097 1924 gene locus_tag LOCUS_13390 1097 1924 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 protein_id gnl|my_center|LOCUS_13390 3469 1949 gene locus_tag LOCUS_13400 gene rhlE 3469 1949 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 protein_id gnl|my_center|LOCUS_13400 >Feature sequence122 523 1746 gene locus_tag LOCUS_13410 gene lpxB 523 1746 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_13410 1749 3506 gene locus_tag LOCUS_13420 1749 3506 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_13420 3610 3867 gene locus_tag LOCUS_13430 3610 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3969 5951 gene locus_tag LOCUS_13440 3969 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <6487 5962 gene locus_tag LOCUS_13450 <6487 5962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q32D51:GTPase Der >Feature sequence123 919 86 gene locus_tag LOCUS_13460 919 86 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_13460 1616 936 gene locus_tag LOCUS_13470 gene rpiA 1616 936 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_13470 1676 3265 gene locus_tag LOCUS_13480 gene ilvA1 1676 3265 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_13480 3916 3410 gene locus_tag LOCUS_13490 3916 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4572 4120 gene locus_tag LOCUS_13500 4572 4120 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038366.1 protein_id gnl|my_center|LOCUS_13500 5144 4587 gene locus_tag LOCUS_13510 5144 4587 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44905 protein_id gnl|my_center|LOCUS_13510 5834 5520 gene locus_tag LOCUS_13520 5834 5520 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87US0 protein_id gnl|my_center|LOCUS_13520 6084 5866 gene locus_tag LOCUS_13530 6084 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence124 991 2181 gene locus_tag LOCUS_13540 gene aspC 991 2181 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_13540 2456 3487 gene locus_tag LOCUS_13550 2456 3487 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107777.1 protein_id gnl|my_center|LOCUS_13550 5095 3587 gene locus_tag LOCUS_13560 gene araA 5095 3587 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_13560 >Feature sequence125 <1 920 gene locus_tag LOCUS_13570 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E3D1:S-adenosylmethionine:tRNA ribosyltransferase-isomerase 923 2068 gene locus_tag LOCUS_13580 gene tgt 923 2068 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_13580 2194 2568 gene locus_tag LOCUS_13590 gene yajC 2194 2568 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 protein_id gnl|my_center|LOCUS_13590 2601 4451 gene locus_tag LOCUS_13600 gene secD 2601 4451 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_13600 4506 5432 gene locus_tag LOCUS_13610 gene secF 4506 5432 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_13610 5457 6296 gene locus_tag LOCUS_13620 gene yfiH 5457 6296 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K13 protein_id gnl|my_center|LOCUS_13620 >Feature sequence126 <1 700 gene locus_tag LOCUS_13630 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87Y31:aspartate--tRNA(Asp/Asn) ligase 1749 3089 gene locus_tag LOCUS_13640 1749 3089 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392712.1 protein_id gnl|my_center|LOCUS_13640 3235 4329 gene locus_tag LOCUS_13650 gene nadA 3235 4329 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR5 protein_id gnl|my_center|LOCUS_13650 4483 5235 gene locus_tag LOCUS_13660 4483 5235 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_13660 5254 5847 gene locus_tag LOCUS_13670 gene ruvC 5254 5847 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL3 protein_id gnl|my_center|LOCUS_13670 >Feature sequence127 679 1356 gene locus_tag LOCUS_13680 679 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1807 1376 gene locus_tag LOCUS_13690 1807 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4339 2423 gene locus_tag LOCUS_13700 4339 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_13700 5315 4488 gene locus_tag LOCUS_13710 gene znuB 5315 4488 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_13710 6170 5319 gene locus_tag LOCUS_13720 gene znuA 6170 5319 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence128 1488 2000 gene locus_tag LOCUS_13730 1488 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 4219 1997 gene locus_tag LOCUS_13740 gene ppk 4219 1997 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E4 protein_id gnl|my_center|LOCUS_13740 5049 4219 gene locus_tag LOCUS_13750 gene nadC 5049 4219 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_13750 5898 5101 gene locus_tag LOCUS_13760 5898 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence129 1782 2252 gene locus_tag LOCUS_13770 gene mraZ 1782 2252 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_13770 2300 3250 gene locus_tag LOCUS_13780 gene rsmH 2300 3250 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPF9 protein_id gnl|my_center|LOCUS_13780 3250 3588 gene locus_tag LOCUS_13790 3250 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3591 5351 gene locus_tag LOCUS_13800 gene pbpB 3591 5351 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence130 929 660 gene locus_tag LOCUS_13810 929 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086057.1 protein_id gnl|my_center|LOCUS_13810 1534 995 gene locus_tag LOCUS_13820 gene mip 1534 995 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P219 protein_id gnl|my_center|LOCUS_13820 4046 1932 gene locus_tag LOCUS_13830 4046 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5901 4624 gene locus_tag LOCUS_13840 gene dinB 5901 4624 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CQ6 protein_id gnl|my_center|LOCUS_13840 >Feature sequence131 125 964 gene locus_tag LOCUS_13850 gene ttcA 125 964 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_13850 936 1568 gene locus_tag LOCUS_13860 936 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1728 3422 gene locus_tag LOCUS_13870 1728 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <6178 3670 gene locus_tag LOCUS_13880 <6178 3670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071290.1:methionine synthase >Feature sequence132 500 1363 gene locus_tag LOCUS_13890 500 1363 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_13890 1360 2760 gene locus_tag LOCUS_13900 1360 2760 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_13900 2764 3300 gene locus_tag LOCUS_13910 2764 3300 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_13910 3317 3724 gene locus_tag LOCUS_13920 3317 3724 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_13920 3727 4404 gene locus_tag LOCUS_13930 gene tonB2 3727 4404 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_13930 4455 5732 gene locus_tag LOCUS_13940 4455 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence133 3382 182 gene locus_tag LOCUS_13950 3382 182 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_13950 4537 3383 gene locus_tag LOCUS_13960 4537 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6047 4530 gene locus_tag LOCUS_13970 6047 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence134 1076 483 gene locus_tag LOCUS_13980 gene azoR 1076 483 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG7 protein_id gnl|my_center|LOCUS_13980 2141 1164 gene locus_tag LOCUS_13990 gene dhmA1 2141 1164 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_13990 2391 2316 gene locus_tag LOCUS_t00180 2391 2316 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2534 2459 gene locus_tag LOCUS_t00190 2534 2459 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4020 2620 gene locus_tag LOCUS_14000 gene gltX1 4020 2620 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EV3 protein_id gnl|my_center|LOCUS_14000 4169 4909 gene locus_tag LOCUS_14010 gene pppA 4169 4909 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_14010 4906 5196 gene locus_tag LOCUS_14020 4906 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence135 1088 123 gene locus_tag LOCUS_14030 1088 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1618 1085 gene locus_tag LOCUS_14040 1618 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2155 1646 gene locus_tag LOCUS_14050 2155 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2808 2182 gene locus_tag LOCUS_14060 2808 2182 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_14060 3454 3146 gene locus_tag LOCUS_14070 3454 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 <6111 3456 gene locus_tag LOCUS_14080 <6111 3456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106407.1:serine/threonine protein kinase >Feature sequence136 312 803 gene locus_tag LOCUS_14090 312 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703241.1 protein_id gnl|my_center|LOCUS_14090 1105 2142 gene locus_tag LOCUS_14100 gene recA 1105 2142 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_14100 2151 2645 gene locus_tag LOCUS_14110 gene recX 2151 2645 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XY8 protein_id gnl|my_center|LOCUS_14110 2814 5432 gene locus_tag LOCUS_14120 gene alaS 2814 5432 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPG1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence137 3424 3047 gene locus_tag LOCUS_14130 gene rplL 3424 3047 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8S3 protein_id gnl|my_center|LOCUS_14130 3976 3458 gene locus_tag LOCUS_14140 gene rplJ 3976 3458 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID4 protein_id gnl|my_center|LOCUS_14140 4873 4184 gene locus_tag LOCUS_14150 gene rplA 4873 4184 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2A4 protein_id gnl|my_center|LOCUS_14150 5307 4873 gene locus_tag LOCUS_14160 gene rplK 5307 4873 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_14160 5933 5400 gene locus_tag LOCUS_14170 gene nusG 5933 5400 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_14170 >Feature sequence138 2907 2104 gene locus_tag LOCUS_14180 gene ephD 2907 2104 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_14180 3377 3057 gene locus_tag LOCUS_14190 3377 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329417.1 protein_id gnl|my_center|LOCUS_14190 3612 4508 gene locus_tag LOCUS_14200 gene ucpA 3612 4508 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206793.1 protein_id gnl|my_center|LOCUS_14200 5150 4551 gene locus_tag LOCUS_14210 gene cysC1 5150 4551 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK5 protein_id gnl|my_center|LOCUS_14210 5261 5677 gene locus_tag LOCUS_14220 5261 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence139 1440 1102 gene locus_tag LOCUS_14230 gene glnK 1440 1102 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_14230 2170 1499 gene locus_tag LOCUS_14240 2170 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2422 2694 gene locus_tag LOCUS_14250 2422 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369643.1 protein_id gnl|my_center|LOCUS_14250 2857 4380 gene locus_tag LOCUS_14260 gene comM 2857 4380 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_14260 4863 4381 gene locus_tag LOCUS_14270 4863 4381 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_14270 5113 5754 gene locus_tag LOCUS_14280 5113 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence140 3410 318 gene locus_tag LOCUS_14290 gene nrdA 3410 318 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_14290 4611 3943 gene locus_tag LOCUS_14300 4611 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence141 <1 731 gene locus_tag LOCUS_14310 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein 1638 739 gene locus_tag LOCUS_14320 gene lpxO1 1638 739 CDS product LPS biosynthetic protein LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 protein_id gnl|my_center|LOCUS_14320 1961 1653 gene locus_tag LOCUS_14330 1961 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2307 2062 gene locus_tag LOCUS_14340 2307 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369791.1 protein_id gnl|my_center|LOCUS_14340 3108 2323 gene locus_tag LOCUS_14350 gene sdhB 3108 2323 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ72 protein_id gnl|my_center|LOCUS_14350 4921 3134 gene locus_tag LOCUS_14360 gene sdhA 4921 3134 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V4 protein_id gnl|my_center|LOCUS_14360 5324 4944 gene locus_tag LOCUS_14370 5324 4944 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709623.1 protein_id gnl|my_center|LOCUS_14370 5662 5321 gene locus_tag LOCUS_14380 5662 5321 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence142 >Feature sequence143 <1 522 gene locus_tag LOCUS_14390 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918092.1:sterol desaturase 1061 519 gene locus_tag LOCUS_14400 1061 519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_14400 1240 2256 gene locus_tag LOCUS_14410 1240 2256 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GM3 protein_id gnl|my_center|LOCUS_14410 2256 3173 gene locus_tag LOCUS_14420 2256 3173 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705419.1 protein_id gnl|my_center|LOCUS_14420 4269 3289 gene locus_tag LOCUS_14430 4269 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5654 4407 gene locus_tag LOCUS_14440 5654 4407 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence144 1757 618 gene locus_tag LOCUS_14450 1757 618 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_14450 2933 1758 gene locus_tag LOCUS_14460 2933 1758 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_14460 4058 2973 gene locus_tag LOCUS_14470 gene serC 4058 2973 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_14470 <5674 4238 gene locus_tag LOCUS_14480 <5674 4238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEH1:DNA gyrase subunit A >Feature sequence145 843 163 gene locus_tag LOCUS_14490 gene trmB 843 163 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQC3 protein_id gnl|my_center|LOCUS_14490 1621 848 gene locus_tag LOCUS_14500 gene thiG 1621 848 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_14500 1870 1646 gene locus_tag LOCUS_14510 1870 1646 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_14510 1966 3075 gene locus_tag LOCUS_14520 gene aldA 1966 3075 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6H0 protein_id gnl|my_center|LOCUS_14520 4404 3070 gene locus_tag LOCUS_14530 gene cycH 4404 3070 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_14530 4850 4401 gene locus_tag LOCUS_14540 4850 4401 CDS product cytochrome c biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946599.1 protein_id gnl|my_center|LOCUS_14540 5358 4840 gene locus_tag LOCUS_14550 gene dsbE 5358 4840 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765251.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence146 948 2051 gene locus_tag LOCUS_14560 gene cca 948 2051 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW05 protein_id gnl|my_center|LOCUS_14560 2503 2087 gene locus_tag LOCUS_14570 2503 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3325 2504 gene locus_tag LOCUS_14580 gene uppP 3325 2504 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL0 protein_id gnl|my_center|LOCUS_14580 4207 3365 gene locus_tag LOCUS_14590 gene tatD 4207 3365 CDS product DNase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073889.1 protein_id gnl|my_center|LOCUS_14590 4639 4208 gene locus_tag LOCUS_14600 4639 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4928 4710 gene locus_tag LOCUS_14610 4928 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 protein_id gnl|my_center|LOCUS_14610 <5642 4938 gene locus_tag LOCUS_14620 <5642 4938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_231920.2:thiamin biosynthesis lipoprotein ApbE >Feature sequence147 1295 225 gene locus_tag LOCUS_14630 gene pslL 1295 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160261.1 protein_id gnl|my_center|LOCUS_14630 1449 2240 gene locus_tag LOCUS_14640 1449 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2977 2267 gene locus_tag LOCUS_14650 2977 2267 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267058.1 protein_id gnl|my_center|LOCUS_14650 3117 3041 gene locus_tag LOCUS_t00200 3117 3041 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3748 3227 gene locus_tag LOCUS_14660 3748 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187158.1 protein_id gnl|my_center|LOCUS_14660 3935 4441 gene locus_tag LOCUS_14670 3935 4441 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_14670 4658 5404 gene locus_tag LOCUS_14680 4658 5404 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence148 1093 3858 gene locus_tag LOCUS_14690 1093 3858 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSV9 protein_id gnl|my_center|LOCUS_14690 5216 3855 gene locus_tag LOCUS_14700 gene rimO 5216 3855 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQL6 protein_id gnl|my_center|LOCUS_14700 >Feature sequence149 175 1365 gene locus_tag LOCUS_14710 175 1365 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957351.1 protein_id gnl|my_center|LOCUS_14710 1629 1835 gene locus_tag LOCUS_14720 gene rpmE 1629 1835 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS9 protein_id gnl|my_center|LOCUS_14720 1956 3392 gene locus_tag LOCUS_14730 1956 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_14730 3432 4334 gene locus_tag LOCUS_14740 gene exo 3432 4334 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_14740 4334 4912 gene locus_tag LOCUS_14750 gene rluE 4334 4912 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1GRK1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 >Feature sequence150 1585 62 gene locus_tag LOCUS_14760 1585 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1719 3401 gene locus_tag LOCUS_14770 gene mprA 1719 3401 CDS product serine metalloprotease precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552132.1 protein_id gnl|my_center|LOCUS_14770 4300 3398 gene locus_tag LOCUS_14780 4300 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_14780 4842 4300 gene locus_tag LOCUS_14790 4842 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 <5535 4851 gene locus_tag LOCUS_14800 <5535 4851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83A98:arginine--tRNA ligase >Feature sequence151 1926 922 gene locus_tag LOCUS_14810 1926 922 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_14810 2544 1936 gene locus_tag LOCUS_14820 2544 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530955.1 protein_id gnl|my_center|LOCUS_14820 3288 2548 gene locus_tag LOCUS_14830 3288 2548 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_14830 3359 3592 gene locus_tag LOCUS_14840 3359 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4531 3674 gene locus_tag LOCUS_14850 gene cox3 4531 3674 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_14850 5097 4564 gene locus_tag LOCUS_14860 5097 4564 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence152 <1 1747 gene locus_tag LOCUS_14870 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2Q8:protein translocase subunit SecA 1765 2979 gene locus_tag LOCUS_14880 gene argJ 1765 2979 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ9 protein_id gnl|my_center|LOCUS_14880 3837 4859 gene locus_tag LOCUS_14890 3837 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence153 2472 400 gene locus_tag LOCUS_14900 gene fimX 2472 400 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_14900 3696 2692 gene locus_tag LOCUS_14910 3696 2692 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_14910 3813 4382 gene locus_tag LOCUS_14920 gene efp 3813 4382 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_14920 4508 5395 gene locus_tag LOCUS_14930 gene lysS 4508 5395 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB4 protein_id gnl|my_center|LOCUS_14930 >Feature sequence154 593 1204 gene locus_tag LOCUS_14940 gene azoR1 593 1204 CDS product FMN-dependent NADH-azoreductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F3 protein_id gnl|my_center|LOCUS_14940 2948 1293 gene locus_tag LOCUS_14950 2948 1293 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_14950 4729 3083 gene locus_tag LOCUS_14960 gene groL 4729 3083 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 protein_id gnl|my_center|LOCUS_14960 5059 4769 gene locus_tag LOCUS_14970 gene groS 5059 4769 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_14970 >Feature sequence155 3028 353 gene locus_tag LOCUS_14980 gene nasA 3028 353 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973413.1 protein_id gnl|my_center|LOCUS_14980 4332 3028 gene locus_tag LOCUS_14990 4332 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4789 4334 gene locus_tag LOCUS_15000 4789 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15000 <5400 4799 gene locus_tag LOCUS_15010 <5400 4799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197731.1:nitrite reductase large subunit >Feature sequence156 <1 2411 gene locus_tag LOCUS_15020 <1 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z9J4:RNA polymerase-associated protein RapA 2867 2412 gene locus_tag LOCUS_15030 2867 2412 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_15030 2964 3425 gene locus_tag LOCUS_15040 2964 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5018 3501 gene locus_tag LOCUS_15050 5018 3501 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_15050 >Feature sequence157 350 1333 gene locus_tag LOCUS_15060 gene mdh 350 1333 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_15060 1644 2387 gene locus_tag LOCUS_15070 1644 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2552 3457 gene locus_tag LOCUS_15080 gene mshI1 2552 3457 CDS product MSHA biogenesis protein MshI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073818.1 protein_id gnl|my_center|LOCUS_15080 3463 4101 gene locus_tag LOCUS_15090 3463 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4098 4817 gene locus_tag LOCUS_15100 4098 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4909 5157 gene locus_tag LOCUS_15110 4909 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence158 <1 1576 gene locus_tag LOCUS_15120 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072006.1:peptidoglycan-binding protein 1581 2573 gene locus_tag LOCUS_15130 1581 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2654 3172 gene locus_tag LOCUS_15140 gene blc 2654 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238386.1 protein_id gnl|my_center|LOCUS_15140 3266 3583 gene locus_tag LOCUS_15150 3266 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708710.1 protein_id gnl|my_center|LOCUS_15150 3588 4127 gene locus_tag LOCUS_15160 gene def 3588 4127 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_15160 >Feature sequence159 <1 2530 gene locus_tag LOCUS_15170 <1 2530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073797.1:DUF3971 domain-containing protein 2636 3490 gene locus_tag LOCUS_15180 2636 3490 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_15180 3510 4955 gene locus_tag LOCUS_15190 gene tldD 3510 4955 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704382.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence160 3 743 gene locus_tag LOCUS_15200 3 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2065 722 gene locus_tag LOCUS_15210 2065 722 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285020.1 protein_id gnl|my_center|LOCUS_15210 2092 2598 gene locus_tag LOCUS_15220 2092 2598 CDS product UPF0114 protein YqhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3Q8 protein_id gnl|my_center|LOCUS_15220 2925 2608 gene locus_tag LOCUS_15230 2925 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2974 4860 gene locus_tag LOCUS_15240 2974 4860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence161 <1 519 gene locus_tag LOCUS_15250 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462207.1:glycosyl transferase 562 1959 gene locus_tag LOCUS_15260 562 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1959 3164 gene locus_tag LOCUS_15270 1959 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3169 4665 gene locus_tag LOCUS_15280 3169 4665 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176627.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence162 811 1329 gene locus_tag LOCUS_15290 811 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1331 2107 gene locus_tag LOCUS_15300 gene mazG 1331 2107 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AEY3 protein_id gnl|my_center|LOCUS_15300 2097 2603 gene locus_tag LOCUS_15310 2097 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 <5134 2672 gene locus_tag LOCUS_15320 <5134 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921030.1:TonB-dependent receptor >Feature sequence163 206 967 gene locus_tag LOCUS_15330 206 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1665 1168 gene locus_tag LOCUS_15340 gene ybcL 1665 1168 CDS product phosphatidylethanolamine-binding protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070683.1 protein_id gnl|my_center|LOCUS_15340 2210 1788 gene locus_tag LOCUS_15350 2210 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2575 2234 gene locus_tag LOCUS_15360 2575 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2814 2617 gene locus_tag LOCUS_15370 2814 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2722 3234 gene locus_tag LOCUS_15380 2722 3234 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_15380 4557 3241 gene locus_tag LOCUS_15390 4557 3241 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence164 2211 1366 gene locus_tag LOCUS_15400 2211 1366 CDS product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_15400 3663 2212 gene locus_tag LOCUS_15410 3663 2212 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_15410 4185 3682 gene locus_tag LOCUS_15420 gene trmL 4185 3682 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8X2 protein_id gnl|my_center|LOCUS_15420 <5099 4204 gene locus_tag LOCUS_15430 <5099 4204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZJM6:glycerol-3-phosphate dehydrogenase [NAD(P)+] >Feature sequence165 633 202 gene locus_tag LOCUS_15440 633 202 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 protein_id gnl|my_center|LOCUS_15440 <5077 648 gene locus_tag LOCUS_15450 <5077 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545300.1:pilus assembly protein PilY >Feature sequence166 2008 134 gene locus_tag LOCUS_15460 gene asnB 2008 134 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_15460 2078 3091 gene locus_tag LOCUS_15470 gene rfaF 2078 3091 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_15470 3085 4188 gene locus_tag LOCUS_15480 3085 4188 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392878.1 protein_id gnl|my_center|LOCUS_15480 <5071 4229 gene locus_tag LOCUS_15490 <5071 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105256.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence167 297 1331 gene locus_tag LOCUS_15500 297 1331 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_15500 2661 1303 gene locus_tag LOCUS_15510 2661 1303 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083861.1 protein_id gnl|my_center|LOCUS_15510 2834 2685 gene locus_tag LOCUS_15520 2834 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2972 4267 gene locus_tag LOCUS_15530 gene yicE 2972 4267 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705187.1 protein_id gnl|my_center|LOCUS_15530 4341 5021 gene locus_tag LOCUS_15540 4341 5021 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266559.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence168 1235 2716 gene locus_tag LOCUS_15550 1235 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963892.1 protein_id gnl|my_center|LOCUS_15550 2829 3341 gene locus_tag LOCUS_15560 2829 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3341 4516 gene locus_tag LOCUS_15570 3341 4516 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence169 1116 223 gene locus_tag LOCUS_15580 1116 223 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_15580 2012 1326 gene locus_tag LOCUS_15590 2012 1326 CDS product 20-beta-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405006.1 protein_id gnl|my_center|LOCUS_15590 2916 2005 gene locus_tag LOCUS_15600 2916 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3046 4077 gene locus_tag LOCUS_15610 gene pyrC 3046 4077 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ8 protein_id gnl|my_center|LOCUS_15610 4179 4799 gene locus_tag LOCUS_15620 gene rnt 4179 4799 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_15620 >Feature sequence170 445 1299 gene locus_tag LOCUS_15630 445 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1299 1730 gene locus_tag LOCUS_15640 1299 1730 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44886 protein_id gnl|my_center|LOCUS_15640 1734 2276 gene locus_tag LOCUS_15650 1734 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2286 2888 gene locus_tag LOCUS_15660 2286 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2910 4283 gene locus_tag LOCUS_15670 2910 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261765.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence171 1170 88 gene locus_tag LOCUS_15680 gene dacC 1170 88 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_15680 2104 1253 gene locus_tag LOCUS_15690 gene rlpA 2104 1253 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF4 protein_id gnl|my_center|LOCUS_15690 3155 2112 gene locus_tag LOCUS_15700 gene sltB1 3155 2112 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_15700 4275 3169 gene locus_tag LOCUS_15710 gene mrdB 4275 3169 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_15710 <4859 4295 gene locus_tag LOCUS_15720 <4859 4295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093191.1:penicillin-binding protein 2 >Feature sequence172 486 172 gene locus_tag LOCUS_15730 486 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_15730 1563 490 gene locus_tag LOCUS_15740 1563 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 protein_id gnl|my_center|LOCUS_15740 3858 1588 gene locus_tag LOCUS_15750 gene rlmL 3858 1588 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_15750 >Feature sequence173 1242 76 gene locus_tag LOCUS_15760 gene hisZ 1242 76 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_15760 1445 1257 gene locus_tag LOCUS_15770 1445 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2420 1539 gene locus_tag LOCUS_15780 gene hflC 2420 1539 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ7 protein_id gnl|my_center|LOCUS_15780 3541 2417 gene locus_tag LOCUS_15790 3541 2417 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_15790 <4821 3646 gene locus_tag LOCUS_15800 <4821 3646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83CV3:GTPase HflX >Feature sequence174 540 67 gene locus_tag LOCUS_15810 540 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 791 543 gene locus_tag LOCUS_15820 791 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1145 1069 gene locus_tag LOCUS_t00210 1145 1069 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1568 1194 gene locus_tag LOCUS_15830 1568 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2659 1568 gene locus_tag LOCUS_15840 gene ychF 2659 1568 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS65 protein_id gnl|my_center|LOCUS_15840 3282 2701 gene locus_tag LOCUS_15850 gene pth 3282 2701 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K029 protein_id gnl|my_center|LOCUS_15850 3985 3323 gene locus_tag LOCUS_15860 gene rplY 3985 3323 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_15860 <4747 4241 gene locus_tag LOCUS_15870 <4747 4241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFG6:ribose-phosphate pyrophosphokinase >Feature sequence175 <1 868 gene locus_tag LOCUS_15880 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140483.1:fused response regulator/thioredoxin-disulfide reductase 1041 1445 gene locus_tag LOCUS_15890 gene ycgN 1041 1445 CDS product UPF0260 protein YcgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z682 protein_id gnl|my_center|LOCUS_15890 3170 1686 gene locus_tag LOCUS_15900 3170 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 <4743 3373 gene locus_tag LOCUS_15910 <4743 3373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038525.1:TonB-dependent receptor >Feature sequence176 63 1361 gene locus_tag LOCUS_15920 gene nrdB 63 1361 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL8 protein_id gnl|my_center|LOCUS_15920 1816 1424 gene locus_tag LOCUS_15930 1816 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2631 1828 gene locus_tag LOCUS_15940 2631 1828 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_15940 3540 2821 gene locus_tag LOCUS_15950 3540 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_15950 3714 4454 gene locus_tag LOCUS_15960 3714 4454 CDS product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence177 <1 884 gene locus_tag LOCUS_15970 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851168.1:ABC transporter substrate-binding protein 881 1459 gene locus_tag LOCUS_15980 881 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1904 2302 gene locus_tag LOCUS_15990 1904 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887731.1 protein_id gnl|my_center|LOCUS_15990 4602 2719 gene locus_tag LOCUS_16000 4602 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence178 689 162 gene locus_tag LOCUS_16010 689 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_16010 1657 686 gene locus_tag LOCUS_16020 1657 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_16020 2745 1702 gene locus_tag LOCUS_16030 2745 1702 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_16030 2931 3857 gene locus_tag LOCUS_16040 2931 3857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence179 <1 1025 gene locus_tag LOCUS_16050 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480330.1:type VI secretion protein 1054 1560 gene locus_tag LOCUS_16060 1054 1560 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 protein_id gnl|my_center|LOCUS_16060 1563 3053 gene locus_tag LOCUS_16070 1563 3053 CDS product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_16070 3091 4536 gene locus_tag LOCUS_16080 3091 4536 CDS product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206356.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence180 420 1430 gene locus_tag LOCUS_16090 420 1430 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942884.1 protein_id gnl|my_center|LOCUS_16090 1432 2559 gene locus_tag LOCUS_16100 1432 2559 CDS product WbnK-like family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942601.1 protein_id gnl|my_center|LOCUS_16100 2602 3495 gene locus_tag LOCUS_16110 2602 3495 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_16110 3498 4526 gene locus_tag LOCUS_16120 3498 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence181 2469 1012 gene locus_tag LOCUS_16130 gene phdB 2469 1012 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD06 protein_id gnl|my_center|LOCUS_16130 <4533 2475 gene locus_tag LOCUS_16140 <4533 2475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVD6:pyruvate dehydrogenase E1 component >Feature sequence182 1134 2156 gene locus_tag LOCUS_16150 1134 2156 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_16150 2274 2963 gene locus_tag LOCUS_16160 gene phoB 2274 2963 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_16160 3047 4360 gene locus_tag LOCUS_16170 gene phoR 3047 4360 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_16170 >Feature sequence183 226 23 gene locus_tag LOCUS_16180 226 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 706 287 gene locus_tag LOCUS_16190 706 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2028 712 gene locus_tag LOCUS_16200 gene amt 2028 712 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_16200 3502 2387 gene locus_tag LOCUS_16210 gene modC 3502 2387 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881C1 protein_id gnl|my_center|LOCUS_16210 4187 3492 gene locus_tag LOCUS_16220 gene modC 4187 3492 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence184 3540 820 gene locus_tag LOCUS_16230 gene glnE 3540 820 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZI61 protein_id gnl|my_center|LOCUS_16230 >Feature sequence185 1175 411 gene locus_tag LOCUS_16240 1175 411 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_16240 2313 1168 gene locus_tag LOCUS_16250 gene hemH1 2313 1168 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_16250 3006 2359 gene locus_tag LOCUS_16260 3006 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_16260 >Feature sequence186 <1 754 gene locus_tag LOCUS_16270 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525115.1:cardiolipin synthase B 1372 1662 gene locus_tag LOCUS_16280 1372 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1899 1735 gene locus_tag LOCUS_16290 1899 1735 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 protein_id gnl|my_center|LOCUS_16290 2090 3943 gene locus_tag LOCUS_16300 2090 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence187 524 87 gene locus_tag LOCUS_16310 gene rplM 524 87 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKU3 protein_id gnl|my_center|LOCUS_16310 717 1364 gene locus_tag LOCUS_16320 gene coq7 717 1364 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_16320 2188 1403 gene locus_tag LOCUS_16330 gene speD 2188 1403 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_16330 2634 2197 gene locus_tag LOCUS_16340 2634 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_16340 2742 3380 gene locus_tag LOCUS_16350 gene vfr 2742 3380 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_16350 4296 3493 gene locus_tag LOCUS_16360 gene trpC 4296 3493 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_16360 >Feature sequence188 165 971 gene locus_tag LOCUS_16370 165 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1214 1603 gene locus_tag LOCUS_16380 1214 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1627 2445 gene locus_tag LOCUS_16390 gene lptF 1627 2445 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 protein_id gnl|my_center|LOCUS_16390 2512 3645 gene locus_tag LOCUS_16400 2512 3645 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338163.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence189 9 773 gene locus_tag LOCUS_16410 9 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 793 2100 gene locus_tag LOCUS_16420 gene tolB 793 2100 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_16420 2126 2668 gene locus_tag LOCUS_16430 2126 2668 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_16430 2675 3634 gene locus_tag LOCUS_16440 2675 3634 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence190 508 1524 gene locus_tag LOCUS_16450 gene hexC 508 1524 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MH18 protein_id gnl|my_center|LOCUS_16450 1537 2745 gene locus_tag LOCUS_16460 gene pgk 1537 2745 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ74 protein_id gnl|my_center|LOCUS_16460 >Feature sequence191 1059 154 gene locus_tag LOCUS_16470 1059 154 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_16470 1274 1825 gene locus_tag LOCUS_16480 1274 1825 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797827.1 protein_id gnl|my_center|LOCUS_16480 1852 2436 gene locus_tag LOCUS_16490 1852 2436 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_16490 2578 3723 gene locus_tag LOCUS_16500 2578 3723 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence192 <1 1215 gene locus_tag LOCUS_16510 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUK1:DNA topoisomerase 4 subunit A 1224 2381 gene locus_tag LOCUS_16520 1224 2381 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_16520 2456 3340 gene locus_tag LOCUS_16530 gene htpX 2456 3340 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 protein_id gnl|my_center|LOCUS_16530 3767 3345 gene locus_tag LOCUS_16540 3767 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence193 411 1919 gene locus_tag LOCUS_16550 gene trpE 411 1919 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244435.1 protein_id gnl|my_center|LOCUS_16550 1912 2502 gene locus_tag LOCUS_16560 gene trpG 1912 2502 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_16560 2499 3512 gene locus_tag LOCUS_16570 gene trpD 2499 3512 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_16570 >Feature sequence194 531 914 gene locus_tag LOCUS_16580 531 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_16580 1055 2185 gene locus_tag LOCUS_16590 gene splB 1055 2185 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37956 protein_id gnl|my_center|LOCUS_16590 2439 4094 gene locus_tag LOCUS_16600 2439 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence195 1581 109 gene locus_tag LOCUS_16610 1581 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1981 2370 gene locus_tag LOCUS_16620 1981 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3490 2438 gene locus_tag LOCUS_16630 3490 2438 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402788.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence196 1002 532 gene locus_tag LOCUS_16640 1002 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454218.1 protein_id gnl|my_center|LOCUS_16640 1184 1330 gene locus_tag LOCUS_16650 1184 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1347 2294 gene locus_tag LOCUS_16660 gene gluQ 1347 2294 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_16660 >Feature sequence197 3346 725 gene locus_tag LOCUS_16670 gene acnB 3346 725 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V5 protein_id gnl|my_center|LOCUS_16670 4056 3592 gene locus_tag LOCUS_16680 4056 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence198 1490 624 gene locus_tag LOCUS_16690 1490 624 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_16690 2476 1517 gene locus_tag LOCUS_16700 2476 1517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267249.1 protein_id gnl|my_center|LOCUS_16700 3114 2656 gene locus_tag LOCUS_16710 3114 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_16710 4010 3147 gene locus_tag LOCUS_16720 4010 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310189.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence199 221 1177 gene locus_tag LOCUS_16730 gene msrP 221 1177 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBM7 protein_id gnl|my_center|LOCUS_16730 1352 1549 gene locus_tag LOCUS_16740 1352 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1606 2181 gene locus_tag LOCUS_16750 gene msrQ 1606 2181 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU7 protein_id gnl|my_center|LOCUS_16750 2182 2874 gene locus_tag LOCUS_16760 2182 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_16760 2876 3397 gene locus_tag LOCUS_16770 2876 3397 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266928.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence200 910 104 gene locus_tag LOCUS_16780 gene trpA 910 104 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_16780 2157 907 gene locus_tag LOCUS_16790 gene trpB 2157 907 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_16790 2799 2167 gene locus_tag LOCUS_16800 gene trpF 2799 2167 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 protein_id gnl|my_center|LOCUS_16800 3585 2806 gene locus_tag LOCUS_16810 gene truA 3585 2806 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN7 protein_id gnl|my_center|LOCUS_16810 >Feature sequence201 >Feature sequence202 1513 1100 gene locus_tag LOCUS_16820 1513 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112599.1 protein_id gnl|my_center|LOCUS_16820 <4016 1947 gene locus_tag LOCUS_16830 <4016 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7H2:elongation factor G 2 >Feature sequence203 817 431 gene locus_tag LOCUS_16840 gene gcvH 817 431 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_16840 2056 845 gene locus_tag LOCUS_16850 gene visC 2056 845 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209950.1 protein_id gnl|my_center|LOCUS_16850 3378 2053 gene locus_tag LOCUS_16860 gene pepP 3378 2053 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_16860 3942 3382 gene locus_tag LOCUS_16870 3942 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence204 2677 2204 gene locus_tag LOCUS_16880 gene rppH 2677 2204 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_16880 2835 3500 gene locus_tag LOCUS_16890 2835 3500 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence205 647 1504 gene locus_tag LOCUS_16900 647 1504 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704402.1 protein_id gnl|my_center|LOCUS_16900 3290 1494 gene locus_tag LOCUS_16910 gene aceK 3290 1494 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRX0 protein_id gnl|my_center|LOCUS_16910 <3996 3290 gene locus_tag LOCUS_16920 <3996 3290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195775.1:MBL fold metallo-hydrolase >Feature sequence206 2859 676 gene locus_tag LOCUS_16930 2859 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920273.1 protein_id gnl|my_center|LOCUS_16930 3094 3738 gene locus_tag LOCUS_16940 gene ycfQ 3094 3738 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179806.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence207 1603 1100 gene locus_tag LOCUS_16950 1603 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2248 1610 gene locus_tag LOCUS_16960 2248 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2898 2251 gene locus_tag LOCUS_16970 2898 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3211 2957 gene locus_tag LOCUS_16980 3211 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence208 127 468 gene locus_tag LOCUS_16990 gene rplV 127 468 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK63 protein_id gnl|my_center|LOCUS_16990 472 1155 gene locus_tag LOCUS_17000 gene rpsC 472 1155 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_17000 1223 1636 gene locus_tag LOCUS_17010 gene rplP 1223 1636 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN58 protein_id gnl|my_center|LOCUS_17010 1636 1848 gene locus_tag LOCUS_17020 gene rpmC 1636 1848 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER8 protein_id gnl|my_center|LOCUS_17020 1851 2138 gene locus_tag LOCUS_17030 gene rpsQ 1851 2138 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8A6 protein_id gnl|my_center|LOCUS_17030 2186 2554 gene locus_tag LOCUS_17040 gene rplN 2186 2554 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 protein_id gnl|my_center|LOCUS_17040 2593 2913 gene locus_tag LOCUS_17050 gene rplX 2593 2913 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60733 protein_id gnl|my_center|LOCUS_17050 2937 3479 gene locus_tag LOCUS_17060 gene rplE 2937 3479 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I4 protein_id gnl|my_center|LOCUS_17060 3484 3789 gene locus_tag LOCUS_17070 gene rpsN 3484 3789 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 protein_id gnl|my_center|LOCUS_17070 >Feature sequence209 1709 135 gene locus_tag LOCUS_17080 gene purH 1709 135 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFA6 protein_id gnl|my_center|LOCUS_17080 2073 1798 gene locus_tag LOCUS_17090 gene fis 2073 1798 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E260 protein_id gnl|my_center|LOCUS_17090 3170 2070 gene locus_tag LOCUS_17100 gene dusB 3170 2070 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYV0 protein_id gnl|my_center|LOCUS_17100 >Feature sequence210 398 183 gene locus_tag LOCUS_17110 398 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 916 398 gene locus_tag LOCUS_17120 916 398 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_17120 1366 2319 gene locus_tag LOCUS_17130 1366 2319 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_17130 2331 3323 gene locus_tag LOCUS_17140 2331 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence211 2286 190 gene locus_tag LOCUS_17150 gene fusA 2286 190 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_17150 2789 2316 gene locus_tag LOCUS_17160 gene rpsG 2789 2316 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ97 protein_id gnl|my_center|LOCUS_17160 3185 2811 gene locus_tag LOCUS_17170 gene rpsL 3185 2811 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYP8 protein_id gnl|my_center|LOCUS_17170 >Feature sequence212 3 830 gene locus_tag LOCUS_17180 3 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 830 2179 gene locus_tag LOCUS_17190 830 2179 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836472.1 protein_id gnl|my_center|LOCUS_17190 2182 3501 gene locus_tag LOCUS_17200 2182 3501 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence213 2 209 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtacaggcagcttagaaa 948 391 gene locus_tag LOCUS_17210 gene ampD 948 391 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_17210 1075 3111 gene locus_tag LOCUS_17220 gene rep 1075 3111 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ8 protein_id gnl|my_center|LOCUS_17220 >Feature sequence214 1940 654 gene locus_tag LOCUS_17230 1940 654 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_17230 2115 2660 gene locus_tag LOCUS_17240 gene lexA 2115 2660 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRT9 protein_id gnl|my_center|LOCUS_17240 >Feature sequence215 <1 2703 gene locus_tag LOCUS_17250 <1 2703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein 3623 2649 gene locus_tag LOCUS_17260 gene rnd 3623 2649 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_17260 >Feature sequence216 <1 1486 gene locus_tag LOCUS_17270 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094386.1:axial filament protein >Feature sequence217 2417 1173 gene locus_tag LOCUS_17280 gene fabF 2417 1173 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S87 protein_id gnl|my_center|LOCUS_17280 2811 2578 gene locus_tag LOCUS_17290 gene acpP 2811 2578 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E38 protein_id gnl|my_center|LOCUS_17290 >Feature sequence218 228 524 gene locus_tag LOCUS_17300 228 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 524 1162 gene locus_tag LOCUS_17310 524 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1195 2160 gene locus_tag LOCUS_17320 gene lipA 1195 2160 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_17320 2409 2176 gene locus_tag LOCUS_17330 2409 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3052 2399 gene locus_tag LOCUS_17340 3052 2399 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_17340 <3594 3052 gene locus_tag LOCUS_17350 <3594 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073438.1:cell wall phosphotransferase >Feature sequence219 1015 260 gene locus_tag LOCUS_17360 1015 260 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_17360 1124 1822 gene locus_tag LOCUS_17370 gene cobB 1124 1822 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PH8 protein_id gnl|my_center|LOCUS_17370 1868 2398 gene locus_tag LOCUS_17380 1868 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2395 2688 gene locus_tag LOCUS_17390 2395 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3014 2685 gene locus_tag LOCUS_17400 3014 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence220 616 2070 gene locus_tag LOCUS_17410 616 2070 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_17410 2148 2885 gene locus_tag LOCUS_17420 2148 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence221 1051 1623 gene locus_tag LOCUS_17430 gene rpoE 1051 1623 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_17430 1610 2020 gene locus_tag LOCUS_17440 1610 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2279 2680 gene locus_tag LOCUS_17450 2279 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2739 3188 gene locus_tag LOCUS_17460 2739 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence222 <1 714 gene locus_tag LOCUS_17470 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073924.1:bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase 711 1163 gene locus_tag LOCUS_17480 gene dut 711 1163 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64007 protein_id gnl|my_center|LOCUS_17480 1256 2641 gene locus_tag LOCUS_17490 gene algC 1256 2641 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26276 protein_id gnl|my_center|LOCUS_17490 2653 3516 gene locus_tag LOCUS_17500 gene argB 2653 3516 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_17500 >Feature sequence223 1775 873 gene locus_tag LOCUS_17510 gene cbbP 1775 873 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6I1 protein_id gnl|my_center|LOCUS_17510 <3491 1785 gene locus_tag LOCUS_17520 <3491 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038259.1:cation transporter >Feature sequence224 186 1220 gene locus_tag LOCUS_17530 gene pheS 186 1220 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_17530 >Feature sequence225 720 1946 gene locus_tag LOCUS_17540 gene sat 720 1946 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_17540 >Feature sequence226 1220 174 gene locus_tag LOCUS_17550 1220 174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 protein_id gnl|my_center|LOCUS_17550 1325 1594 gene locus_tag LOCUS_17560 1325 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231597.2 protein_id gnl|my_center|LOCUS_17560 1609 2091 gene locus_tag LOCUS_17570 1609 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2105 3010 gene locus_tag LOCUS_17580 2105 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3024 3296 gene locus_tag LOCUS_17590 gene yrbA 3024 3296 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946582.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence227 1437 313 gene locus_tag LOCUS_17600 1437 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2357 1434 gene locus_tag LOCUS_17610 2357 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3384 2350 gene locus_tag LOCUS_17620 3384 2350 CDS product purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918076.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence228 611 2914 gene locus_tag LOCUS_17630 gene maeB 611 2914 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence229 258 896 gene locus_tag LOCUS_17640 258 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 905 1351 gene locus_tag LOCUS_17650 905 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1837 1421 gene locus_tag LOCUS_17660 1837 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2563 1964 gene locus_tag LOCUS_17670 2563 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_17670 <3378 2563 gene locus_tag LOCUS_17680 <3378 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P57714:homoserine O-acetyltransferase >Feature sequence230 3137 1647 gene locus_tag LOCUS_17690 3137 1647 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529468.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence231 412 1209 gene locus_tag LOCUS_17700 412 1209 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040248.1 protein_id gnl|my_center|LOCUS_17700 1212 1700 gene locus_tag LOCUS_17710 gene rimI 1212 1700 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_17710 1847 2068 gene locus_tag LOCUS_17720 1847 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2243 2719 gene locus_tag LOCUS_17730 gene bfrB 2243 2719 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_17730 2729 3349 gene locus_tag LOCUS_17740 2729 3349 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence232 99 1493 gene locus_tag LOCUS_17750 99 1493 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 protein_id gnl|my_center|LOCUS_17750 >Feature sequence233 93 944 gene locus_tag LOCUS_17760 93 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 957 1487 gene locus_tag LOCUS_17770 957 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1484 1735 gene locus_tag LOCUS_17780 1484 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1739 3310 gene locus_tag LOCUS_17790 gene speE1 1739 3310 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence234 3198 835 gene locus_tag LOCUS_17800 3198 835 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence235 1828 482 gene locus_tag LOCUS_17810 gene accC 1828 482 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43873 protein_id gnl|my_center|LOCUS_17810 2290 1832 gene locus_tag LOCUS_17820 gene accB 2290 1832 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 protein_id gnl|my_center|LOCUS_17820 2798 2358 gene locus_tag LOCUS_17830 gene aroQ 2798 2358 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN43 protein_id gnl|my_center|LOCUS_17830 >Feature sequence236 >Feature sequence237 447 743 gene locus_tag LOCUS_17840 447 743 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_17840 963 1847 gene locus_tag LOCUS_17850 gene gspO 963 1847 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPV9 protein_id gnl|my_center|LOCUS_17850 1854 3281 gene locus_tag LOCUS_17860 1854 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence238 65 499 gene locus_tag LOCUS_17870 65 499 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019821.1 protein_id gnl|my_center|LOCUS_17870 664 2154 gene locus_tag LOCUS_17880 664 2154 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_17880 2189 3058 gene locus_tag LOCUS_17890 2189 3058 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence239 3044 2025 gene locus_tag LOCUS_17900 gene asd 3044 2025 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_17900 >Feature sequence240 <1 945 gene locus_tag LOCUS_17910 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222491.1:type I-F CRISPR-associated protein Csy1 938 1939 gene locus_tag LOCUS_17920 938 1939 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_17920 1959 2981 gene locus_tag LOCUS_17930 1959 2981 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence241 407 2446 gene locus_tag LOCUS_17940 gene nirB 407 2446 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118575.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence242 >Feature sequence243 <1 1751 gene locus_tag LOCUS_17950 <1 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin >Feature sequence244 137 550 gene locus_tag LOCUS_17960 gene msrB 137 550 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_17960 547 1173 gene locus_tag LOCUS_17970 547 1173 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195230.1 protein_id gnl|my_center|LOCUS_17970 2517 1204 gene locus_tag LOCUS_17980 gene argA 2517 1204 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_17980 <3151 2526 gene locus_tag LOCUS_17990 <3151 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK13:dihydroxy-acid dehydratase >Feature sequence245 1549 776 gene locus_tag LOCUS_18000 gene xth 1549 776 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_18000 1612 2247 gene locus_tag LOCUS_18010 gene pyrE 1612 2247 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L5 protein_id gnl|my_center|LOCUS_18010 2353 2967 gene locus_tag LOCUS_18020 2353 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence246 780 163 gene locus_tag LOCUS_18030 780 163 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705669.1 protein_id gnl|my_center|LOCUS_18030 1535 780 gene locus_tag LOCUS_18040 1535 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2128 1538 gene locus_tag LOCUS_18050 2128 1538 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705671.1 protein_id gnl|my_center|LOCUS_18050 2295 2960 gene locus_tag LOCUS_18060 2295 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence247 1634 249 gene locus_tag LOCUS_18070 1634 249 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_18070 2955 1909 gene locus_tag LOCUS_18080 2955 1909 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence248 2450 1035 gene locus_tag LOCUS_18090 2450 1035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_18090 <3113 2463 gene locus_tag LOCUS_18100 <3113 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919392.1:ABC transporter ATP-binding protein >Feature sequence249 3097 1565 gene locus_tag LOCUS_18110 3097 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence250 <1 1391 gene locus_tag LOCUS_18120 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KHL8:cell division protein ZipA >Feature sequence251 551 237 gene locus_tag LOCUS_18130 551 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1036 2676 gene locus_tag LOCUS_18140 1036 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence252 <3031 399 gene locus_tag LOCUS_18150 <3031 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528327.1:double-strand break repair helicase AddA >Feature sequence253 2526 229 gene locus_tag LOCUS_18160 gene metE 2526 229 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_18160 >Feature sequence254 >Feature sequence255 23 907 gene locus_tag LOCUS_18170 gene cysM 23 907 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y9 protein_id gnl|my_center|LOCUS_18170 916 2259 gene locus_tag LOCUS_18180 gene rlmD 916 2259 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX1 protein_id gnl|my_center|LOCUS_18180 2999 2265 gene locus_tag LOCUS_18190 2999 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence256 2961 466 gene locus_tag LOCUS_18200 2961 466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence257 1383 739 gene locus_tag LOCUS_18210 1383 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2440 1367 gene locus_tag LOCUS_18220 2440 1367 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946367.1 protein_id gnl|my_center|LOCUS_18220 2966 2442 gene locus_tag LOCUS_18230 2966 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence258 1486 431 gene locus_tag LOCUS_18240 gene hemE 1486 431 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_18240 2894 1488 gene locus_tag LOCUS_18250 gene gltD 2894 1488 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence259 1748 1305 gene locus_tag LOCUS_18260 1748 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 <2944 1745 gene locus_tag LOCUS_18270 <2944 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705275.1:flagellum-specific ATP synthase >Feature sequence260 230 901 gene locus_tag LOCUS_18280 230 901 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_18280 957 1568 gene locus_tag LOCUS_18290 957 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2077 1556 gene locus_tag LOCUS_18300 2077 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2319 2537 gene locus_tag LOCUS_18310 gene infA 2319 2537 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM3 protein_id gnl|my_center|LOCUS_18310 >Feature sequence261 2160 310 gene locus_tag LOCUS_18320 2160 310 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_18320 2605 2150 gene locus_tag LOCUS_18330 2605 2150 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463817.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence262 1202 408 gene locus_tag LOCUS_18340 1202 408 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 protein_id gnl|my_center|LOCUS_18340 2591 1209 gene locus_tag LOCUS_18350 gene bioA 2591 1209 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V66 protein_id gnl|my_center|LOCUS_18350 >Feature sequence263 >Feature sequence264 2731 161 gene locus_tag LOCUS_18360 2731 161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence265 >Feature sequence266 624 130 gene locus_tag LOCUS_18370 624 130 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_18370 1792 788 gene locus_tag LOCUS_18380 1792 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2396 1785 gene locus_tag LOCUS_18390 2396 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence267 433 1653 gene locus_tag LOCUS_18400 gene trpS 433 1653 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_18400 1704 2612 gene locus_tag LOCUS_18410 1704 2612 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_18410 >Feature sequence268 <2801 2250 gene locus_tag LOCUS_18420 <2801 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085921.1:formate dehydrogenase subunit beta >Feature sequence269 567 1379 gene locus_tag LOCUS_18430 gene lpqC 567 1379 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_18430 1636 2142 gene locus_tag LOCUS_18440 1636 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence270 733 440 gene locus_tag LOCUS_18450 gene rplW 733 440 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_18450 1335 730 gene locus_tag LOCUS_18460 gene rplD 1335 730 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF22 protein_id gnl|my_center|LOCUS_18460 2058 1411 gene locus_tag LOCUS_18470 gene rplC 2058 1411 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF21 protein_id gnl|my_center|LOCUS_18470 2614 2294 gene locus_tag LOCUS_18480 gene rpsJ 2614 2294 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 protein_id gnl|my_center|LOCUS_18480 >Feature sequence271 873 1577 gene locus_tag LOCUS_18490 873 1577 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_18490 <2775 1598 gene locus_tag LOCUS_18500 <2775 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55218:O-succinylhomoserine sulfhydrylase >Feature sequence272 1550 414 gene locus_tag LOCUS_18510 gene pucA 1550 414 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_18510 2735 1554 gene locus_tag LOCUS_18520 2735 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence273 1768 125 gene locus_tag LOCUS_18530 1768 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 <2710 1981 gene locus_tag LOCUS_18540 <2710 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198416.1:folate-binding protein YgfZ >Feature sequence274 1079 2104 gene locus_tag LOCUS_18550 gene uge 1079 2104 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence275 2157 49 gene locus_tag LOCUS_18560 gene recG 2157 49 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ6 protein_id gnl|my_center|LOCUS_18560 2641 2264 gene locus_tag LOCUS_18570 2641 2264 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence276 <1 1271 gene locus_tag LOCUS_18580 <1 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGG0:DNA-directed DNA polymerase 1327 1461 gene locus_tag LOCUS_18590 1327 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1721 2686 gene locus_tag LOCUS_18600 gene accA 1721 2686 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH9 protein_id gnl|my_center|LOCUS_18600 >Feature sequence277 1597 506 gene locus_tag LOCUS_18610 gene plsX 1597 506 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_18610 1876 1685 gene locus_tag LOCUS_18620 gene rpmF 1876 1685 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_18620 2483 1911 gene locus_tag LOCUS_18630 2483 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence278 2636 2118 gene locus_tag LOCUS_18640 2636 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence279 2189 849 gene locus_tag LOCUS_18650 2189 849 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence280 <1 910 gene locus_tag LOCUS_18660 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000133844.1:guanylate cyclase 1010 2215 gene locus_tag LOCUS_18670 1010 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence281 788 1882 gene locus_tag LOCUS_18680 gene oprP 788 1882 CDS product porin P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05695 protein_id gnl|my_center|LOCUS_18680 <2571 1997 gene locus_tag LOCUS_18690 <2571 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LF8:aspartate carbamoyltransferase >Feature sequence282 <1 761 gene locus_tag LOCUS_18700 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118576.1:NrfA- nitrite reduction protein 835 1449 gene locus_tag LOCUS_18710 835 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_18710 1452 1850 gene locus_tag LOCUS_18720 1452 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1852 2271 gene locus_tag LOCUS_18730 1852 2271 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence283 1029 289 gene locus_tag LOCUS_18740 1029 289 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_18740 1633 1073 gene locus_tag LOCUS_18750 1633 1073 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_18750 2279 1749 gene locus_tag LOCUS_18760 2279 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence284 194 754 gene locus_tag LOCUS_18770 194 754 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_18770 922 1422 gene locus_tag LOCUS_18780 922 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2383 1448 gene locus_tag LOCUS_18790 2383 1448 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence285 463 1110 gene locus_tag LOCUS_18800 463 1110 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence286 48 728 gene locus_tag LOCUS_18810 gene nadD 48 728 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN74 protein_id gnl|my_center|LOCUS_18810 739 1119 gene locus_tag LOCUS_18820 739 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1154 1633 gene locus_tag LOCUS_18830 gene rlmH 1154 1633 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP8 protein_id gnl|my_center|LOCUS_18830 1630 2292 gene locus_tag LOCUS_18840 1630 2292 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_18840 >Feature sequence287 792 2123 gene locus_tag LOCUS_18850 792 2123 CDS product K+ transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393256.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence288 722 477 gene locus_tag LOCUS_18860 722 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence289 1287 613 gene locus_tag LOCUS_18870 1287 613 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_18870 1392 2108 gene locus_tag LOCUS_18880 1392 2108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence290 <1 696 gene locus_tag LOCUS_18890 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388348.1:peptide ABC transporter permease 693 2303 gene locus_tag LOCUS_18900 693 2303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074814.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence291 1762 1064 gene locus_tag LOCUS_18910 gene araD 1762 1064 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705776.1 protein_id gnl|my_center|LOCUS_18910 <2360 1767 gene locus_tag LOCUS_18920 <2360 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JMC1:ribulokinase >Feature sequence292 352 1356 gene locus_tag LOCUS_18930 352 1356 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_18930 1346 1969 gene locus_tag LOCUS_18940 gene mobA 1346 1969 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 protein_id gnl|my_center|LOCUS_18940 >Feature sequence293 111 923 gene locus_tag LOCUS_18950 111 923 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_18950 1010 2140 gene locus_tag LOCUS_18960 1010 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence294 1053 892 gene locus_tag LOCUS_18970 1053 892 CDS product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 protein_id gnl|my_center|LOCUS_18970 1565 1182 gene locus_tag LOCUS_18980 1565 1182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_18980 1885 1598 gene locus_tag LOCUS_18990 1885 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2102 1878 gene locus_tag LOCUS_19000 2102 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence295 926 651 gene locus_tag LOCUS_19010 926 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1164 1487 gene locus_tag LOCUS_19020 1164 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1484 1852 gene locus_tag LOCUS_19030 1484 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 >Feature sequence296 1408 353 gene locus_tag LOCUS_19040 1408 353 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_19040 <2265 1438 gene locus_tag LOCUS_19050 <2265 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBG4:4-hydroxy-3-methylbut-2-enyl diphosphate reductase >Feature sequence297 396 692 gene locus_tag LOCUS_19060 396 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210643.1 protein_id gnl|my_center|LOCUS_19060 695 961 gene locus_tag LOCUS_19070 695 961 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_19070 993 2036 gene locus_tag LOCUS_19080 993 2036 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence298 363 1670 gene locus_tag LOCUS_19090 363 1670 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence299 112 1074 gene locus_tag LOCUS_19100 112 1074 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_19100 1081 1860 gene locus_tag LOCUS_19110 1081 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence300 <1 633 gene locus_tag LOCUS_19120 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZ68:histidinol-phosphate aminotransferase 2 630 1541 gene locus_tag LOCUS_19130 630 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence301 324 1157 gene locus_tag LOCUS_19140 gene bioC 324 1157 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QN4 protein_id gnl|my_center|LOCUS_19140 >Feature sequence302 >Feature sequence303 902 198 gene locus_tag LOCUS_19150 902 198 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_19150 1042 2016 gene locus_tag LOCUS_19160 gene cysB 1042 2016 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence304 786 1652 gene locus_tag LOCUS_19170 gene pabC 786 1652 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262287.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence305 >Feature sequence306 <1 1002 gene locus_tag LOCUS_19180 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYY2:DNA mismatch repair protein MutL 1024 1989 gene locus_tag LOCUS_19190 gene miaA 1024 1989 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS23 protein_id gnl|my_center|LOCUS_19190 >Feature sequence307 >Feature sequence308 1619 915 gene locus_tag LOCUS_19200 gene ftsE 1619 915 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence309 59 646 gene locus_tag LOCUS_19210 59 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 901 1764 gene locus_tag LOCUS_19220 gene purU 901 1764 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUA3 protein_id gnl|my_center|LOCUS_19220 >Feature sequence310 >Feature sequence311 <1 714 gene locus_tag LOCUS_19230 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEF3:Holliday junction ATP-dependent DNA helicase RuvB 793 1224 gene locus_tag LOCUS_19240 793 1224 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_19240 1214 1909 gene locus_tag LOCUS_19250 1214 1909 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence312 1188 421 gene locus_tag LOCUS_19260 1188 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1934 1212 gene locus_tag LOCUS_19270 1934 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence313 334 179 gene locus_tag LOCUS_19280 334 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19280 857 381 gene locus_tag LOCUS_19290 857 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 951 1520 gene locus_tag LOCUS_19300 951 1520 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089582.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence314 >Feature sequence315 155 1519 gene locus_tag LOCUS_19310 155 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence316 <1 813 gene locus_tag LOCUS_19320 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FPP0:peptidylprolyl isomerase 1692 892 gene locus_tag LOCUS_19330 1692 892 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_19330 >Feature sequence317 430 62 gene locus_tag LOCUS_19340 430 62 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHE6 protein_id gnl|my_center|LOCUS_19340 939 427 gene locus_tag LOCUS_19350 939 427 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223820.1 protein_id gnl|my_center|LOCUS_19350 1742 936 gene locus_tag LOCUS_19360 1742 936 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence318 >Feature sequence319 >Feature sequence320 671 1294 gene locus_tag LOCUS_19370 gene plsY 671 1294 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM5 protein_id gnl|my_center|LOCUS_19370 >Feature sequence321 >Feature sequence322 334 1368 gene locus_tag LOCUS_19380 334 1368 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266546.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence323 698 213 gene locus_tag LOCUS_19390 698 213 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN7 protein_id gnl|my_center|LOCUS_19390 <1617 711 gene locus_tag LOCUS_19400 <1617 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705057.1:MFS transporter >Feature sequence324 <1593 346 gene locus_tag LOCUS_19410 <1593 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3I6:chromosome partition protein Smc >Feature sequence325 >Feature sequence326 693 406 gene locus_tag LOCUS_19420 693 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768280.1 protein_id gnl|my_center|LOCUS_19420 1546 698 gene locus_tag LOCUS_19430 1546 698 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence327 <1 1573 gene locus_tag LOCUS_19440 <1 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266956.1:membrane protein >Feature sequence328 >Feature sequence329 <1 573 gene locus_tag LOCUS_19450 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CFS7:elongation factor P--(R)-beta-lysine ligase 1207 563 gene locus_tag LOCUS_19460 1207 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence330 465 1454 gene locus_tag LOCUS_19470 465 1454 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827078.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence331 >Feature sequence332 161 1495 gene locus_tag LOCUS_19480 161 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480