>Feature sequence001 11 1071 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccttgttctaatggatgatagtctttgac 1644 1162 gene locus_tag LOCUS_00010 1644 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2697 1678 gene locus_tag LOCUS_00020 2697 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3688 2684 gene locus_tag LOCUS_00030 3688 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5014 3743 gene locus_tag LOCUS_00040 5014 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6458 5049 gene locus_tag LOCUS_00050 6458 5049 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_00050 6818 6471 gene locus_tag LOCUS_00060 6818 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8169 6799 gene locus_tag LOCUS_00070 8169 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9306 8182 gene locus_tag LOCUS_00080 9306 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10933 9467 gene locus_tag LOCUS_00090 10933 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11936 10938 gene locus_tag LOCUS_00100 gene csm4 11936 10938 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_00100 12622 11936 gene locus_tag LOCUS_00110 12622 11936 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_00110 13048 12650 gene locus_tag LOCUS_00120 13048 12650 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_00120 15744 13060 gene locus_tag LOCUS_00130 gene csm1_2 15744 13060 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_00130 16423 15737 gene locus_tag LOCUS_00140 16423 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 >Feature sequence002 <1 549 gene locus_tag LOCUS_00150 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A3M1:methionine--tRNA ligase 581 1957 gene locus_tag LOCUS_00160 581 1957 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_00160 1990 2781 gene locus_tag LOCUS_00170 1990 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_00170 2778 3074 gene locus_tag LOCUS_00180 gene fjo15 2778 3074 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_00180 3108 4157 gene locus_tag LOCUS_00190 3108 4157 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_00190 4157 5203 gene locus_tag LOCUS_00200 gene selD 4157 5203 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQF1 protein_id gnl|my_center|LOCUS_00200 5229 5933 gene locus_tag LOCUS_00210 5229 5933 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930507.1 protein_id gnl|my_center|LOCUS_00210 6736 5978 gene locus_tag LOCUS_00220 gene scpA 6736 5978 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_00220 7779 6739 gene locus_tag LOCUS_00230 7779 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_00230 8731 7826 gene locus_tag LOCUS_00240 8731 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 9364 8978 gene locus_tag LOCUS_00250 9364 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 9838 9389 gene locus_tag LOCUS_00260 gene recX 9838 9389 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_00260 10419 10009 gene locus_tag LOCUS_00270 10419 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_00270 11705 10437 gene locus_tag LOCUS_00280 11705 10437 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_00280 13486 11813 gene locus_tag LOCUS_00290 13486 11813 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_00290 13753 14250 gene locus_tag LOCUS_00300 13753 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 <15670 14555 gene locus_tag LOCUS_00310 <15670 14555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984875.1:cell surface protein >Feature sequence003 36 491 gene locus_tag LOCUS_00320 36 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 644 1108 gene locus_tag LOCUS_00330 644 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 1222 2247 gene locus_tag LOCUS_00340 1222 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 2271 3302 gene locus_tag LOCUS_00350 2271 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 3352 3714 gene locus_tag LOCUS_00360 3352 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 3788 4546 gene locus_tag LOCUS_00370 3788 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4646 5632 gene locus_tag LOCUS_00380 4646 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 5658 6527 gene locus_tag LOCUS_00390 5658 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 6821 7384 gene locus_tag LOCUS_00400 6821 7384 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963812.1 protein_id gnl|my_center|LOCUS_00400 7422 8813 gene locus_tag LOCUS_00410 7422 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 8820 9068 gene locus_tag LOCUS_00420 8820 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 10274 9090 gene locus_tag LOCUS_00430 10274 9090 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_00430 10591 11004 gene locus_tag LOCUS_00440 10591 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 11017 11547 gene locus_tag LOCUS_00450 11017 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 11559 11930 gene locus_tag LOCUS_00460 11559 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 11977 12765 gene locus_tag LOCUS_00470 11977 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence004 2888 1569 gene locus_tag LOCUS_00480 2888 1569 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_00480 7831 2999 gene locus_tag LOCUS_00490 7831 2999 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_00490 8011 8556 gene locus_tag LOCUS_00500 8011 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 8864 8583 gene locus_tag LOCUS_00510 8864 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 10231 9308 gene locus_tag LOCUS_00520 10231 9308 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_00520 10410 10910 gene locus_tag LOCUS_00530 10410 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 10921 12348 gene locus_tag LOCUS_00540 10921 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 <13300 12362 gene locus_tag LOCUS_00550 <13300 12362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817457.1:DNA topoisomerase III >Feature sequence005 636 1211 gene locus_tag LOCUS_00560 636 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 1423 2097 gene locus_tag LOCUS_00570 1423 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2276 4552 gene locus_tag LOCUS_00580 2276 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4663 5442 gene locus_tag LOCUS_00590 gene crt 4663 5442 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_00590 5539 6579 gene locus_tag LOCUS_00600 5539 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8020 6764 gene locus_tag LOCUS_00610 8020 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 8945 8040 gene locus_tag LOCUS_00620 gene cysD 8945 8040 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_00620 9547 8942 gene locus_tag LOCUS_00630 gene cysC 9547 8942 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WL0 protein_id gnl|my_center|LOCUS_00630 12086 9867 gene locus_tag LOCUS_00640 gene pnp 12086 9867 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_00640 >Feature sequence006 3091 2348 gene locus_tag LOCUS_00650 gene kdsB 3091 2348 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_00650 5168 3096 gene locus_tag LOCUS_00660 gene dpp11 5168 3096 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_00660 5407 7419 gene locus_tag LOCUS_00670 5407 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 7585 8037 gene locus_tag LOCUS_00680 7585 8037 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_00680 8048 8968 gene locus_tag LOCUS_00690 gene natA 8048 8968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_00690 8991 10271 gene locus_tag LOCUS_00700 gene natB 8991 10271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence007 3193 2249 gene locus_tag LOCUS_00710 3193 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3569 4243 gene locus_tag LOCUS_00720 3569 4243 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_00720 4702 4343 gene locus_tag LOCUS_00730 4702 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5306 4806 gene locus_tag LOCUS_00740 5306 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 6585 5407 gene locus_tag LOCUS_00750 6585 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7006 6644 gene locus_tag LOCUS_00760 7006 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 8525 7113 gene locus_tag LOCUS_00770 8525 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence008 1613 900 gene locus_tag LOCUS_00780 1613 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 2461 2024 gene locus_tag LOCUS_00790 2461 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 3607 2906 gene locus_tag LOCUS_00800 3607 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4088 4669 gene locus_tag LOCUS_00810 4088 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 4680 6110 gene locus_tag LOCUS_00820 4680 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6216 8912 gene locus_tag LOCUS_00830 gene yeeA 6216 8912 CDS product putative DNA methyltransferase YeeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31504 protein_id gnl|my_center|LOCUS_00830 8893 9081 gene locus_tag LOCUS_00840 8893 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence009 240 479 gene locus_tag LOCUS_00850 240 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 2159 876 gene locus_tag LOCUS_00860 2159 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 2458 3432 gene locus_tag LOCUS_00870 2458 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3581 4075 gene locus_tag LOCUS_00880 3581 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4079 4921 gene locus_tag LOCUS_00890 4079 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4954 6222 gene locus_tag LOCUS_00900 4954 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970961.1 protein_id gnl|my_center|LOCUS_00900 6222 6560 gene locus_tag LOCUS_00910 6222 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 8071 6578 gene locus_tag LOCUS_00920 8071 6578 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023422.1 protein_id gnl|my_center|LOCUS_00920 9392 8229 gene locus_tag LOCUS_00930 9392 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 9361 9531 gene locus_tag LOCUS_00940 9361 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 <10193 9625 gene locus_tag LOCUS_00950 <10193 9625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QS98:elongation factor Tu >Feature sequence010 1337 186 gene locus_tag LOCUS_00960 1337 186 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_00960 2095 1496 gene locus_tag LOCUS_00970 2095 1496 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_00970 2614 2102 gene locus_tag LOCUS_00980 2614 2102 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202153.1 protein_id gnl|my_center|LOCUS_00980 3920 2763 gene locus_tag LOCUS_00990 3920 2763 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073061.1 protein_id gnl|my_center|LOCUS_00990 5247 3910 gene locus_tag LOCUS_01000 5247 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6428 5244 gene locus_tag LOCUS_01010 6428 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 7862 6765 gene locus_tag LOCUS_01020 7862 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9241 7859 gene locus_tag LOCUS_01030 9241 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 <9930 9282 gene locus_tag LOCUS_01040 <9930 9282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533311.1:lipopolysaccharide biosynthesis protein >Feature sequence011 1866 823 gene locus_tag LOCUS_01050 1866 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2671 2024 gene locus_tag LOCUS_01060 2671 2024 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_01060 2786 4453 gene locus_tag LOCUS_01070 2786 4453 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_01070 4553 6487 gene locus_tag LOCUS_01080 4553 6487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_01080 7761 6703 gene locus_tag LOCUS_01090 7761 6703 CDS product aminotransferase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_01090 8188 7775 gene locus_tag LOCUS_01100 8188 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 protein_id gnl|my_center|LOCUS_01100 8325 8735 gene locus_tag LOCUS_01110 8325 8735 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_01110 8825 9370 gene locus_tag LOCUS_01120 8825 9370 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence012 1852 797 gene locus_tag LOCUS_01130 gene phbC 1852 797 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_01130 2541 1903 gene locus_tag LOCUS_01140 2541 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3598 2552 gene locus_tag LOCUS_01150 gene speB 3598 2552 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_01150 3963 5834 gene locus_tag LOCUS_01160 gene mnmG 3963 5834 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_01160 7959 6088 gene locus_tag LOCUS_01170 7959 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 8032 8736 gene locus_tag LOCUS_01180 8032 8736 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence013 3795 1141 gene locus_tag LOCUS_01190 3795 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 4822 3824 gene locus_tag LOCUS_01200 4822 3824 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_01200 7541 4866 gene locus_tag LOCUS_01210 7541 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 8377 7622 gene locus_tag LOCUS_01220 8377 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence014 1803 1399 gene locus_tag LOCUS_01230 1803 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3377 1809 gene locus_tag LOCUS_01240 3377 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4782 3382 gene locus_tag LOCUS_01250 4782 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 5361 4786 gene locus_tag LOCUS_01260 5361 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6853 5342 gene locus_tag LOCUS_01270 6853 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 protein_id gnl|my_center|LOCUS_01270 7647 6856 gene locus_tag LOCUS_01280 7647 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence015 3579 3334 gene locus_tag LOCUS_01290 3579 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 3935 3543 gene locus_tag LOCUS_01300 3935 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4311 5531 gene locus_tag LOCUS_01310 4311 5531 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5A8 protein_id gnl|my_center|LOCUS_01310 5603 6379 gene locus_tag LOCUS_01320 5603 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_01320 6545 7945 gene locus_tag LOCUS_01330 gene aspA 6545 7945 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PC50 protein_id gnl|my_center|LOCUS_01330 8166 8546 gene locus_tag LOCUS_01340 8166 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence016 <1 927 gene locus_tag LOCUS_01350 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1V4:tryptophanase 1026 2282 gene locus_tag LOCUS_01360 1026 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2709 3857 gene locus_tag LOCUS_01370 2709 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4080 4586 gene locus_tag LOCUS_01380 4080 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5084 5593 gene locus_tag LOCUS_01390 5084 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 5679 6695 gene locus_tag LOCUS_01400 5679 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6665 7126 gene locus_tag LOCUS_01410 6665 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7229 7426 gene locus_tag LOCUS_01420 7229 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence017 100 720 gene locus_tag LOCUS_01430 100 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 717 2114 gene locus_tag LOCUS_01440 717 2114 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_01440 2340 3842 gene locus_tag LOCUS_01450 2340 3842 CDS product SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_01450 6094 4079 gene locus_tag LOCUS_01460 gene oprC 6094 4079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_01460 6892 6107 gene locus_tag LOCUS_01470 6892 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7508 7119 gene locus_tag LOCUS_01480 7508 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence018 710 408 gene locus_tag LOCUS_01490 710 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 895 1872 gene locus_tag LOCUS_01500 895 1872 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362004.1 protein_id gnl|my_center|LOCUS_01500 2018 2626 gene locus_tag LOCUS_01510 2018 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 2992 3603 gene locus_tag LOCUS_01520 2992 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4352 3873 gene locus_tag LOCUS_01530 4352 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403166.1 protein_id gnl|my_center|LOCUS_01530 6169 4349 gene locus_tag LOCUS_01540 6169 4349 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_01540 6325 6519 gene locus_tag LOCUS_01550 6325 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 6595 7140 gene locus_tag LOCUS_01560 6595 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01560 7186 7893 gene locus_tag LOCUS_01570 7186 7893 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 protein_id gnl|my_center|LOCUS_01570 7890 8351 gene locus_tag LOCUS_01580 7890 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038676.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence019 868 86 gene locus_tag LOCUS_01590 868 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063602.1 protein_id gnl|my_center|LOCUS_01590 2214 958 gene locus_tag LOCUS_01600 2214 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 3048 2281 gene locus_tag LOCUS_01610 gene tpiA 3048 2281 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_01610 4277 3087 gene locus_tag LOCUS_01620 4277 3087 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_01620 5309 4383 gene locus_tag LOCUS_01630 5309 4383 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_01630 5826 5341 gene locus_tag LOCUS_01640 5826 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 6817 5828 gene locus_tag LOCUS_01650 6817 5828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_01650 7186 6839 gene locus_tag LOCUS_01660 gene panD 7186 6839 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_01660 >Feature sequence020 1189 188 gene locus_tag LOCUS_01670 1189 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 2214 1219 gene locus_tag LOCUS_01680 2214 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3016 2204 gene locus_tag LOCUS_01690 3016 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3614 3027 gene locus_tag LOCUS_01700 3614 3027 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_01700 5419 3917 gene locus_tag LOCUS_01710 5419 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 7589 5421 gene locus_tag LOCUS_01720 7589 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7922 7602 gene locus_tag LOCUS_01730 7922 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence021 1639 245 gene locus_tag LOCUS_01740 1639 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122321.1 protein_id gnl|my_center|LOCUS_01740 2092 4050 gene locus_tag LOCUS_01750 2092 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4189 5820 gene locus_tag LOCUS_01760 4189 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6651 5839 gene locus_tag LOCUS_01770 6651 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7951 6926 gene locus_tag LOCUS_01780 gene thiL 7951 6926 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_01780 >Feature sequence022 1115 2662 gene locus_tag LOCUS_01790 1115 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3172 2663 gene locus_tag LOCUS_01800 gene yieF 3172 2663 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208164.1 protein_id gnl|my_center|LOCUS_01800 5031 3304 gene locus_tag LOCUS_01810 gene purF 5031 3304 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_01810 5241 5546 gene locus_tag LOCUS_01820 5241 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5602 6819 gene locus_tag LOCUS_01830 gene argD 5602 6819 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence023 472 2253 gene locus_tag LOCUS_01840 gene argS 472 2253 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_01840 2347 4029 gene locus_tag LOCUS_01850 2347 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4189 7005 gene locus_tag LOCUS_01860 4189 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence024 <1 1102 gene locus_tag LOCUS_01870 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962686.1:TonB-dependent receptor 1313 1705 gene locus_tag LOCUS_01880 1313 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 2186 2632 gene locus_tag LOCUS_01890 2186 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01890 2886 5681 gene locus_tag LOCUS_01900 2886 5681 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_01900 5698 6270 gene locus_tag LOCUS_01910 5698 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence025 1844 1095 gene locus_tag LOCUS_01920 1844 1095 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_01920 3736 1844 gene locus_tag LOCUS_01930 3736 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 >Feature sequence026 <1 551 gene locus_tag LOCUS_01940 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB4:lipoprotein-releasing system ATP-binding protein LolD 566 1486 gene locus_tag LOCUS_01950 566 1486 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_01950 1565 2254 gene locus_tag LOCUS_01960 1565 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2524 3867 gene locus_tag LOCUS_01970 gene pbpE 2524 3867 CDS product penicillin-binding protein 4* inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32959 protein_id gnl|my_center|LOCUS_01970 5075 3918 gene locus_tag LOCUS_01980 5075 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_01980 6517 5147 gene locus_tag LOCUS_01990 6517 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence027 <1 3575 gene locus_tag LOCUS_02000 <1 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405417.1:T9SS C-terminal target domain-containing protein 5300 3948 gene locus_tag LOCUS_02010 gene kmo 5300 3948 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_02010 6062 5340 gene locus_tag LOCUS_02020 6062 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 7024 6260 gene locus_tag LOCUS_02030 7024 6260 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence028 2025 940 gene locus_tag LOCUS_02040 2025 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence029 1844 1131 gene locus_tag LOCUS_02050 gene trmB 1844 1131 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_02050 3128 1866 gene locus_tag LOCUS_02060 gene yeiM 3128 1866 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_02060 6194 3759 gene locus_tag LOCUS_02070 gene ccoI 6194 3759 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_02070 6696 6172 gene locus_tag LOCUS_02080 6696 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence030 1 924 gene locus_tag LOCUS_02090 1 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 997 2451 gene locus_tag LOCUS_02100 997 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_02100 2486 3016 gene locus_tag LOCUS_02110 2486 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 3095 3661 gene locus_tag LOCUS_02120 gene gmk 3095 3661 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_02120 4478 3726 gene locus_tag LOCUS_02130 4478 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 5028 4501 gene locus_tag LOCUS_02140 5028 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 6851 5541 gene locus_tag LOCUS_02150 gene icd 6851 5541 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_02150 >Feature sequence031 885 223 gene locus_tag LOCUS_02160 885 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 1666 890 gene locus_tag LOCUS_02170 1666 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2781 1759 gene locus_tag LOCUS_02180 2781 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4004 2778 gene locus_tag LOCUS_02190 4004 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4443 3982 gene locus_tag LOCUS_02200 4443 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5713 4436 gene locus_tag LOCUS_02210 5713 4436 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082904.1 protein_id gnl|my_center|LOCUS_02210 <6925 5716 gene locus_tag LOCUS_02220 <6925 5716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938997.1:type I restriction-modification system subunit M >Feature sequence032 557 1585 gene locus_tag LOCUS_02230 557 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 1619 3109 gene locus_tag LOCUS_02240 1619 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3421 3173 gene locus_tag LOCUS_02250 3421 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_02250 3735 3424 gene locus_tag LOCUS_02260 3735 3424 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_02260 4471 3836 gene locus_tag LOCUS_02270 4471 3836 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_02270 5141 5359 gene locus_tag LOCUS_02280 5141 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776229.1 protein_id gnl|my_center|LOCUS_02280 5491 5982 gene locus_tag LOCUS_02290 5491 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 6077 6736 gene locus_tag LOCUS_02300 6077 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence033 1653 322 gene locus_tag LOCUS_02310 1653 322 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_02310 1822 3723 gene locus_tag LOCUS_02320 1822 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3984 4745 gene locus_tag LOCUS_02330 3984 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4907 5500 gene locus_tag LOCUS_02340 4907 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5542 5808 gene locus_tag LOCUS_02350 5542 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5861 6535 gene locus_tag LOCUS_02360 5861 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 >Feature sequence034 767 1057 gene locus_tag LOCUS_02370 767 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2008 1580 gene locus_tag LOCUS_02380 2008 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 2313 2131 gene locus_tag LOCUS_02390 2313 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3189 2659 gene locus_tag LOCUS_02400 3189 2659 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_02400 4152 3415 gene locus_tag LOCUS_02410 4152 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4922 4170 gene locus_tag LOCUS_02420 4922 4170 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_02420 5058 6443 gene locus_tag LOCUS_02430 5058 6443 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence035 780 100 gene locus_tag LOCUS_02440 780 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 1146 1301 gene locus_tag LOCUS_02450 gene rpmH 1146 1301 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_02450 1323 1730 gene locus_tag LOCUS_02460 1323 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2037 3452 gene locus_tag LOCUS_02470 2037 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence036 1201 275 gene locus_tag LOCUS_02480 1201 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2296 1205 gene locus_tag LOCUS_02490 2296 1205 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02490 2653 2435 gene locus_tag LOCUS_02500 2653 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02500 3053 2835 gene locus_tag LOCUS_02510 3053 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4076 3753 gene locus_tag LOCUS_02520 4076 3753 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_02520 4426 4076 gene locus_tag LOCUS_02530 4426 4076 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_02530 4807 5814 gene locus_tag LOCUS_02540 4807 5814 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 protein_id gnl|my_center|LOCUS_02540 6285 5986 gene locus_tag LOCUS_02550 gene parE1 6285 5986 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHG7 protein_id gnl|my_center|LOCUS_02550 6533 6282 gene locus_tag LOCUS_02560 gene parD-1 6533 6282 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence037 <1 1025 gene locus_tag LOCUS_02570 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y4I1:glyceraldehyde-3-phosphate dehydrogenase 1287 3539 gene locus_tag LOCUS_02580 1287 3539 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_02580 3594 4670 gene locus_tag LOCUS_02590 3594 4670 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_02590 4742 5083 gene locus_tag LOCUS_02600 4742 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5099 5425 gene locus_tag LOCUS_02610 5099 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 6082 5564 gene locus_tag LOCUS_02620 6082 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 6480 6316 gene locus_tag LOCUS_02630 6480 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence038 <1 1348 gene locus_tag LOCUS_02640 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter 1349 1798 gene locus_tag LOCUS_02650 1349 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_02650 2178 4007 gene locus_tag LOCUS_02660 2178 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4009 4320 gene locus_tag LOCUS_02670 4009 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 4550 5890 gene locus_tag LOCUS_02680 4550 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence039 1061 813 gene locus_tag LOCUS_02690 1061 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2374 1121 gene locus_tag LOCUS_02700 gene clpX 2374 1121 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW3 protein_id gnl|my_center|LOCUS_02700 2737 3177 gene locus_tag LOCUS_02710 2737 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3185 4627 gene locus_tag LOCUS_02720 3185 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4825 5334 gene locus_tag LOCUS_02730 4825 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence040 1199 2512 gene locus_tag LOCUS_02740 gene rimO 1199 2512 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_02740 2654 3115 gene locus_tag LOCUS_02750 2654 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 4361 3270 gene locus_tag LOCUS_02760 4361 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 4706 4461 gene locus_tag LOCUS_02770 4706 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6175 4796 gene locus_tag LOCUS_02780 gene nuoN-1 6175 4796 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_02780 >Feature sequence041 <1 2012 gene locus_tag LOCUS_02790 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962229.1:two-component sensor histidine kinase >Feature sequence042 63 1193 gene locus_tag LOCUS_02800 63 1193 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_02800 2409 1369 gene locus_tag LOCUS_02810 2409 1369 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_02810 2646 2434 gene locus_tag LOCUS_02820 2646 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2799 3671 gene locus_tag LOCUS_02830 gene folD 2799 3671 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_02830 3675 4292 gene locus_tag LOCUS_02840 gene queE 3675 4292 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_02840 4320 5162 gene locus_tag LOCUS_02850 gene uppP 4320 5162 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_02850 >Feature sequence043 6 1964 gene locus_tag LOCUS_02860 6 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3723 2032 gene locus_tag LOCUS_02870 3723 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4535 3735 gene locus_tag LOCUS_02880 4535 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5612 4599 gene locus_tag LOCUS_02890 5612 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence044 1241 3463 gene locus_tag LOCUS_02900 1241 3463 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_02900 4864 3542 gene locus_tag LOCUS_02910 4864 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5128 6138 gene locus_tag LOCUS_02920 gene gpsA 5128 6138 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_02920 >Feature sequence045 1514 258 gene locus_tag LOCUS_02930 gene rfbB 1514 258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_02930 2730 1681 gene locus_tag LOCUS_02940 2730 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3042 2791 gene locus_tag LOCUS_02950 3042 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4281 3382 gene locus_tag LOCUS_02960 4281 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4769 4344 gene locus_tag LOCUS_02970 4769 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 <6325 4895 gene locus_tag LOCUS_02980 <6325 4895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932396.1:sodium-independent anion transporter >Feature sequence046 79 300 gene locus_tag LOCUS_02990 79 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_02990 1433 342 gene locus_tag LOCUS_03000 1433 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2824 1883 gene locus_tag LOCUS_03010 2824 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3924 2851 gene locus_tag LOCUS_03020 gene prfA 3924 2851 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_03020 5255 4170 gene locus_tag LOCUS_03030 5255 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence047 444 1253 gene locus_tag LOCUS_03040 444 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 1241 1777 gene locus_tag LOCUS_03050 1241 1777 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_03050 1913 2824 gene locus_tag LOCUS_03060 1913 2824 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364557.1 protein_id gnl|my_center|LOCUS_03060 3135 3311 gene locus_tag LOCUS_03070 3135 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3351 5534 gene locus_tag LOCUS_03080 gene ccoN/ccoO 3351 5534 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence048 2309 417 gene locus_tag LOCUS_03090 gene parE 2309 417 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_03090 2495 4210 gene locus_tag LOCUS_03100 2495 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 <6297 4593 gene locus_tag LOCUS_03110 <6297 4593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934467.1:MSCRAMM family adhesin SdrD >Feature sequence049 1694 2251 gene locus_tag LOCUS_03120 1694 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 2483 3673 gene locus_tag LOCUS_03130 2483 3673 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_03130 4595 3876 gene locus_tag LOCUS_03140 4595 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5017 5541 gene locus_tag LOCUS_03150 5017 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence050 1101 1760 gene locus_tag LOCUS_03160 gene pdxH 1101 1760 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Y3 protein_id gnl|my_center|LOCUS_03160 1785 2312 gene locus_tag LOCUS_03170 gene pyrR1 1785 2312 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_03170 2351 3289 gene locus_tag LOCUS_03180 gene pyrB 2351 3289 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_03180 3299 4447 gene locus_tag LOCUS_03190 gene porR 3299 4447 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence051 916 566 gene locus_tag LOCUS_03200 916 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_03200 1885 923 gene locus_tag LOCUS_03210 1885 923 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_03210 1986 3509 gene locus_tag LOCUS_03220 1986 3509 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_03220 3525 4250 gene locus_tag LOCUS_03230 gene comB 3525 4250 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_03230 4275 5042 gene locus_tag LOCUS_03240 gene xth 4275 5042 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence052 430 116 gene locus_tag LOCUS_03250 430 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 1497 493 gene locus_tag LOCUS_03260 gene cas1 1497 493 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_03260 2016 1564 gene locus_tag LOCUS_03270 2016 1564 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_03270 4850 2097 gene locus_tag LOCUS_03280 4850 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5630 4854 gene locus_tag LOCUS_03290 5630 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence053 1417 764 gene locus_tag LOCUS_03300 1417 764 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_03300 1638 2585 gene locus_tag LOCUS_03310 1638 2585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_03310 2994 2773 gene locus_tag LOCUS_03320 2994 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 3538 2999 gene locus_tag LOCUS_03330 3538 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03330 4297 3557 gene locus_tag LOCUS_03340 4297 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03340 5522 4569 gene locus_tag LOCUS_03350 gene fjo11 5522 4569 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence054 1911 4556 gene locus_tag LOCUS_03360 1911 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4708 5217 gene locus_tag LOCUS_03370 4708 5217 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence055 2739 1369 gene locus_tag LOCUS_03380 2739 1369 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_03380 3447 2755 gene locus_tag LOCUS_03390 3447 2755 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_03390 3681 4556 gene locus_tag LOCUS_03400 3681 4556 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947995.1 protein_id gnl|my_center|LOCUS_03400 4732 5862 gene locus_tag LOCUS_03410 gene tgt 4732 5862 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_03410 >Feature sequence056 346 271 gene locus_tag LOCUS_t00010 346 271 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1941 436 gene locus_tag LOCUS_03420 gene mqo 1941 436 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_03420 4579 2135 gene locus_tag LOCUS_03430 4579 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 <5928 4667 gene locus_tag LOCUS_03440 <5928 4667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence057 551 1561 gene locus_tag LOCUS_03450 gene accA 551 1561 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_03450 1615 2490 gene locus_tag LOCUS_03460 gene dapA 1615 2490 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C0 protein_id gnl|my_center|LOCUS_03460 2839 3096 gene locus_tag LOCUS_03470 2839 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3116 3829 gene locus_tag LOCUS_03480 3116 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 5464 4493 gene locus_tag LOCUS_03490 gene queG 5464 4493 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_03490 >Feature sequence058 4427 2637 gene locus_tag LOCUS_03500 4427 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence059 1528 3318 gene locus_tag LOCUS_03510 1528 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3696 3340 gene locus_tag LOCUS_03520 3696 3340 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_03520 3972 3899 gene locus_tag LOCUS_t00020 3972 3899 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4295 4936 gene locus_tag LOCUS_03530 4295 4936 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_03530 4978 5517 gene locus_tag LOCUS_03540 4978 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence060 1137 745 gene locus_tag LOCUS_03550 1137 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2058 1138 gene locus_tag LOCUS_03560 gene rsmH 2058 1138 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_03560 2542 2072 gene locus_tag LOCUS_03570 gene mraZ 2542 2072 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_03570 3741 3136 gene locus_tag LOCUS_03580 gene sfp 3741 3136 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_03580 4170 3793 gene locus_tag LOCUS_03590 4170 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4589 4921 gene locus_tag LOCUS_03600 4589 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5629 5201 gene locus_tag LOCUS_03610 5629 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202907.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence061 708 2264 gene locus_tag LOCUS_03620 708 2264 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109061.1 protein_id gnl|my_center|LOCUS_03620 2261 3157 gene locus_tag LOCUS_03630 2261 3157 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_03630 3456 5480 gene locus_tag LOCUS_03640 3456 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence062 1594 2415 gene locus_tag LOCUS_03650 1594 2415 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_03650 2641 5127 gene locus_tag LOCUS_03660 2641 5127 CDS product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence063 2901 373 gene locus_tag LOCUS_03670 gene topA 2901 373 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_03670 4570 3110 gene locus_tag LOCUS_03680 4570 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 <5762 4704 gene locus_tag LOCUS_03690 <5762 4704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MH1:ribosome-binding ATPase YchF >Feature sequence064 1146 418 gene locus_tag LOCUS_03700 1146 418 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_03700 2625 1159 gene locus_tag LOCUS_03710 2625 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3015 2734 gene locus_tag LOCUS_03720 gene fjo13 3015 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_03720 3212 3535 gene locus_tag LOCUS_03730 3212 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_03730 3567 5099 gene locus_tag LOCUS_03740 gene guaA1 3567 5099 CDS product GMP synthase [glutamine-hydrolyzing] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZV6 protein_id gnl|my_center|LOCUS_03740 <5755 5205 gene locus_tag LOCUS_03750 <5755 5205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963911.1:8-amino-7-oxononanoate synthase >Feature sequence065 1258 593 gene locus_tag LOCUS_03760 1258 593 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_03760 2016 1285 gene locus_tag LOCUS_03770 2016 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_03770 2556 2098 gene locus_tag LOCUS_03780 2556 2098 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_03780 3376 2594 gene locus_tag LOCUS_03790 3376 2594 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_03790 4033 3401 gene locus_tag LOCUS_03800 4033 3401 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_03800 4124 4279 gene locus_tag LOCUS_03810 4124 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4296 5165 gene locus_tag LOCUS_03820 4296 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence066 445 849 gene locus_tag LOCUS_03830 445 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 1058 2038 gene locus_tag LOCUS_03840 gene lplA 1058 2038 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186L0 protein_id gnl|my_center|LOCUS_03840 3871 2333 gene locus_tag LOCUS_03850 3871 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 <5742 4693 gene locus_tag LOCUS_03860 <5742 4693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor >Feature sequence067 1004 264 gene locus_tag LOCUS_03870 1004 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 2754 1087 gene locus_tag LOCUS_03880 2754 1087 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258288.1 protein_id gnl|my_center|LOCUS_03880 3693 2773 gene locus_tag LOCUS_03890 3693 2773 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 protein_id gnl|my_center|LOCUS_03890 3901 3719 gene locus_tag LOCUS_03900 3901 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4907 4269 gene locus_tag LOCUS_03910 4907 4269 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403598.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence068 1009 1443 gene locus_tag LOCUS_03920 1009 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1473 1664 gene locus_tag LOCUS_03930 gene cspC 1473 1664 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_03930 2957 1746 gene locus_tag LOCUS_03940 2957 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_03940 4063 3074 gene locus_tag LOCUS_03950 4063 3074 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_03950 5268 4060 gene locus_tag LOCUS_03960 5268 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence069 3466 869 gene locus_tag LOCUS_03970 3466 869 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_03970 4478 3684 gene locus_tag LOCUS_03980 gene thyA 4478 3684 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRL3 protein_id gnl|my_center|LOCUS_03980 >Feature sequence070 1833 154 gene locus_tag LOCUS_03990 1833 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2757 1840 gene locus_tag LOCUS_04000 2757 1840 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966630.1 protein_id gnl|my_center|LOCUS_04000 3065 2754 gene locus_tag LOCUS_04010 3065 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 3382 4287 gene locus_tag LOCUS_04020 3382 4287 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_04020 4632 5480 gene locus_tag LOCUS_04030 4632 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence071 <1 1225 gene locus_tag LOCUS_04040 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531013.1:chloride channel protein 3343 1322 gene locus_tag LOCUS_04050 gene yuxL 3343 1322 CDS product putative peptidase YuxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39839 protein_id gnl|my_center|LOCUS_04050 3658 3571 gene locus_tag LOCUS_t00030 3658 3571 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3842 5197 gene locus_tag LOCUS_04060 gene tilS 3842 5197 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_04060 >Feature sequence072 <1 664 gene locus_tag LOCUS_04070 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962584.1:1-pyrroline-5-carboxylate dehydrogenase 759 1316 gene locus_tag LOCUS_04080 759 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1473 1787 gene locus_tag LOCUS_04090 1473 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3143 1938 gene locus_tag LOCUS_04100 3143 1938 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021090.1 protein_id gnl|my_center|LOCUS_04100 4086 3145 gene locus_tag LOCUS_04110 4086 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5401 4133 gene locus_tag LOCUS_04120 5401 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence073 1415 471 gene locus_tag LOCUS_04130 gene ribC 1415 471 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BI2 protein_id gnl|my_center|LOCUS_04130 3362 1422 gene locus_tag LOCUS_04140 gene kup 3362 1422 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_04140 3498 3830 gene locus_tag LOCUS_04150 3498 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3834 4550 gene locus_tag LOCUS_04160 3834 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5623 4547 gene locus_tag LOCUS_04170 gene prfB 5623 4547 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AS3 protein_id gnl|my_center|LOCUS_04170 >Feature sequence074 1226 2017 gene locus_tag LOCUS_04180 1226 2017 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_04180 2110 2541 gene locus_tag LOCUS_04190 gene osmC 2110 2541 CDS product redox protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_04190 2613 2999 gene locus_tag LOCUS_04200 2613 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_04200 3125 4546 gene locus_tag LOCUS_04210 3125 4546 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence075 855 538 gene locus_tag LOCUS_04220 855 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2319 1204 gene locus_tag LOCUS_04230 2319 1204 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 protein_id gnl|my_center|LOCUS_04230 3441 2563 gene locus_tag LOCUS_04240 3441 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4958 3681 gene locus_tag LOCUS_04250 4958 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence076 561 19 gene locus_tag LOCUS_04260 561 19 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_04260 1165 590 gene locus_tag LOCUS_04270 1165 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705248.1 protein_id gnl|my_center|LOCUS_04270 1930 1217 gene locus_tag LOCUS_04280 1930 1217 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_04280 2437 1934 gene locus_tag LOCUS_04290 2437 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2837 3058 gene locus_tag LOCUS_04300 2837 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3059 3349 gene locus_tag LOCUS_04310 3059 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3521 4258 gene locus_tag LOCUS_04320 3521 4258 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_04320 5226 4387 gene locus_tag LOCUS_04330 5226 4387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence077 <1 879 gene locus_tag LOCUS_04340 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070731.1:type III restriction-modification system restriction subunit Res 1114 1371 gene locus_tag LOCUS_04350 1114 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1362 1895 gene locus_tag LOCUS_04360 1362 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 1895 2317 gene locus_tag LOCUS_04370 1895 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2888 2493 gene locus_tag LOCUS_04380 2888 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3675 2857 gene locus_tag LOCUS_04390 3675 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5466 3985 gene locus_tag LOCUS_04400 gene accC 5466 3985 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence078 1213 455 gene locus_tag LOCUS_04410 1213 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 1956 1315 gene locus_tag LOCUS_04420 1956 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2118 2747 gene locus_tag LOCUS_04430 gene pyrE 2118 2747 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z17 protein_id gnl|my_center|LOCUS_04430 3040 4518 gene locus_tag LOCUS_04440 3040 4518 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_04440 5366 4665 gene locus_tag LOCUS_04450 5366 4665 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence079 1970 864 gene locus_tag LOCUS_04460 1970 864 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_04460 3104 2031 gene locus_tag LOCUS_04470 3104 2031 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107643.1 protein_id gnl|my_center|LOCUS_04470 5315 3210 gene locus_tag LOCUS_04480 5315 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence080 <5500 108 gene locus_tag LOCUS_04490 <5500 108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203358.1:DNA helicase >Feature sequence081 2839 1817 gene locus_tag LOCUS_04500 gene murB 2839 1817 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_04500 3865 2867 gene locus_tag LOCUS_04510 3865 2867 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_04510 3886 4377 gene locus_tag LOCUS_04520 3886 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence082 <1 877 gene locus_tag LOCUS_04530 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963567.1:phytoene dehydrogenase 889 1725 gene locus_tag LOCUS_04540 gene crtB 889 1725 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_04540 1725 2177 gene locus_tag LOCUS_04550 1725 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964348.1 protein_id gnl|my_center|LOCUS_04550 2184 2639 gene locus_tag LOCUS_04560 2184 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2650 3108 gene locus_tag LOCUS_04570 gene crtZ 2650 3108 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_04570 3105 3791 gene locus_tag LOCUS_04580 3105 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3794 4354 gene locus_tag LOCUS_04590 gene blc 3794 4354 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780585.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence083 734 2443 gene locus_tag LOCUS_04600 734 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3817 2597 gene locus_tag LOCUS_04610 gene coaBC 3817 2597 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_04610 4157 3822 gene locus_tag LOCUS_04620 4157 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_04620 4911 4144 gene locus_tag LOCUS_04630 4911 4144 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence084 1186 671 gene locus_tag LOCUS_04640 1186 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2217 1192 gene locus_tag LOCUS_04650 2217 1192 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_04650 3572 2256 gene locus_tag LOCUS_04660 3572 2256 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_04660 4490 3615 gene locus_tag LOCUS_04670 gene rmlA 4490 3615 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ53 protein_id gnl|my_center|LOCUS_04670 5069 4491 gene locus_tag LOCUS_04680 gene rmlC 5069 4491 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence085 148 2550 gene locus_tag LOCUS_04690 148 2550 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_04690 2977 4113 gene locus_tag LOCUS_04700 2977 4113 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_04700 4315 5046 gene locus_tag LOCUS_04710 gene ybhL 4315 5046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence086 <1 695 gene locus_tag LOCUS_04720 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016373.1:DNA methylase N-4 775 1527 gene locus_tag LOCUS_04730 775 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1965 2399 gene locus_tag LOCUS_04740 1965 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3084 2476 gene locus_tag LOCUS_04750 gene sodA 3084 2476 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_04750 4285 3308 gene locus_tag LOCUS_04760 4285 3308 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence087 244 1377 gene locus_tag LOCUS_04770 gene fjo29 244 1377 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_04770 2688 1483 gene locus_tag LOCUS_04780 2688 1483 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_04780 3347 2757 gene locus_tag LOCUS_04790 3347 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 <5324 3356 gene locus_tag LOCUS_04800 <5324 3356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme >Feature sequence088 645 2087 gene locus_tag LOCUS_04810 645 2087 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_04810 2218 2877 gene locus_tag LOCUS_04820 2218 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3015 3359 gene locus_tag LOCUS_04830 3015 3359 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852534.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence089 800 339 gene locus_tag LOCUS_04840 800 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1178 1774 gene locus_tag LOCUS_04850 1178 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1912 2100 gene locus_tag LOCUS_04860 1912 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3050 2133 gene locus_tag LOCUS_04870 3050 2133 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_04870 3175 3870 gene locus_tag LOCUS_04880 3175 3870 CDS product DUF4918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_04880 <5173 3943 gene locus_tag LOCUS_04890 <5173 3943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD >Feature sequence090 512 354 gene locus_tag LOCUS_04900 512 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 723 502 gene locus_tag LOCUS_04910 723 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1420 2136 gene locus_tag LOCUS_04920 1420 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_04920 2260 2739 gene locus_tag LOCUS_04930 2260 2739 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_04930 2821 4887 gene locus_tag LOCUS_04940 gene recG 2821 4887 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence091 1740 652 gene locus_tag LOCUS_04950 1740 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2325 1750 gene locus_tag LOCUS_04960 2325 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2583 4193 gene locus_tag LOCUS_04970 2583 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4204 4740 gene locus_tag LOCUS_04980 4204 4740 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence092 165 1328 gene locus_tag LOCUS_04990 165 1328 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_04990 1335 2678 gene locus_tag LOCUS_05000 1335 2678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_05000 2778 3479 gene locus_tag LOCUS_05010 gene truB 2778 3479 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_05010 4168 3536 gene locus_tag LOCUS_05020 4168 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 <5078 4448 gene locus_tag LOCUS_05030 <5078 4448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964301.1:ATPase >Feature sequence093 1582 782 gene locus_tag LOCUS_05040 1582 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 1839 2255 gene locus_tag LOCUS_05050 1839 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2277 3722 gene locus_tag LOCUS_05060 2277 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4244 3831 gene locus_tag LOCUS_05070 4244 3831 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538032.1 protein_id gnl|my_center|LOCUS_05070 4967 4278 gene locus_tag LOCUS_05080 4967 4278 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence094 277 1077 gene locus_tag LOCUS_05090 gene pyrF 277 1077 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_05090 1274 2131 gene locus_tag LOCUS_05100 1274 2131 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967094.1 protein_id gnl|my_center|LOCUS_05100 2228 3310 gene locus_tag LOCUS_05110 gene dinB2 2228 3310 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_05110 3752 4438 gene locus_tag LOCUS_05120 3752 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence095 42 2024 gene locus_tag LOCUS_05130 42 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_05130 2051 3115 gene locus_tag LOCUS_05140 2051 3115 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_05140 >Feature sequence096 22 336 gene locus_tag LOCUS_05150 22 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3041 582 gene locus_tag LOCUS_05160 3041 582 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_05160 3869 3159 gene locus_tag LOCUS_05170 3869 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4237 3881 gene locus_tag LOCUS_05180 4237 3881 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_05180 4785 4249 gene locus_tag LOCUS_05190 4785 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence097 2076 3071 gene locus_tag LOCUS_05200 2076 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_05200 4779 3130 gene locus_tag LOCUS_05210 4779 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence098 120 830 gene locus_tag LOCUS_05220 120 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1216 2574 gene locus_tag LOCUS_05230 1216 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2658 3158 gene locus_tag LOCUS_05240 2658 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3171 3626 gene locus_tag LOCUS_05250 3171 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_05250 3866 4303 gene locus_tag LOCUS_05260 3866 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 >Feature sequence099 <1 1124 gene locus_tag LOCUS_05270 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962921.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA 1754 1236 gene locus_tag LOCUS_05280 1754 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2894 1779 gene locus_tag LOCUS_05290 2894 1779 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_05290 3142 2969 gene locus_tag LOCUS_05300 3142 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3125 3346 gene locus_tag LOCUS_05310 3125 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_05310 3350 3769 gene locus_tag LOCUS_05320 3350 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4986 3904 gene locus_tag LOCUS_05330 4986 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence100 469 1395 gene locus_tag LOCUS_05340 469 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2335 2835 gene locus_tag LOCUS_05350 2335 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66688 protein_id gnl|my_center|LOCUS_05350 2976 3257 gene locus_tag LOCUS_05360 2976 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3898 3335 gene locus_tag LOCUS_05370 gene frr 3898 3335 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_05370 >Feature sequence101 1468 446 gene locus_tag LOCUS_05380 1468 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2453 1650 gene locus_tag LOCUS_05390 2453 1650 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_05390 3340 2597 gene locus_tag LOCUS_05400 3340 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4610 3348 gene locus_tag LOCUS_05410 gene fabF 4610 3348 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_05410 4891 4655 gene locus_tag LOCUS_05420 gene acpP 4891 4655 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_05420 >Feature sequence102 <1 863 gene locus_tag LOCUS_05430 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64SM4:phosphate transport system permease protein PstA 875 1621 gene locus_tag LOCUS_05440 gene pstB 875 1621 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A853 protein_id gnl|my_center|LOCUS_05440 1644 2312 gene locus_tag LOCUS_05450 1644 2312 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SM6 protein_id gnl|my_center|LOCUS_05450 2380 3069 gene locus_tag LOCUS_05460 2380 3069 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_05460 3066 4799 gene locus_tag LOCUS_05470 3066 4799 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762293.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence103 615 1322 gene locus_tag LOCUS_05480 615 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_05480 1647 2552 gene locus_tag LOCUS_05490 1647 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2956 3258 gene locus_tag LOCUS_05500 2956 3258 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_05500 3696 4415 gene locus_tag LOCUS_05510 3696 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence104 400 1011 gene locus_tag LOCUS_05520 400 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1086 1484 gene locus_tag LOCUS_05530 1086 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1505 2224 gene locus_tag LOCUS_05540 gene lipB 1505 2224 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_05540 2593 2261 gene locus_tag LOCUS_05550 2593 2261 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_05550 3439 2612 gene locus_tag LOCUS_05560 3439 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4569 3700 gene locus_tag LOCUS_05570 4569 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence105 <1 1868 gene locus_tag LOCUS_05580 <1 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202406.1:collagen-binding protein 1868 2308 gene locus_tag LOCUS_05590 1868 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2943 3368 gene locus_tag LOCUS_05600 2943 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3358 4419 gene locus_tag LOCUS_05610 3358 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4443 4793 gene locus_tag LOCUS_05620 4443 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence106 165 917 gene locus_tag LOCUS_05630 gene truA 165 917 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221853.1 protein_id gnl|my_center|LOCUS_05630 1666 1040 gene locus_tag LOCUS_05640 gene tpx 1666 1040 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SL6 protein_id gnl|my_center|LOCUS_05640 2376 1801 gene locus_tag LOCUS_05650 gene nusG 2376 1801 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_05650 2643 2410 gene locus_tag LOCUS_05660 2643 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2705 2634 gene locus_tag LOCUS_t00040 2705 2634 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3024 4280 gene locus_tag LOCUS_05670 gene sucB 3024 4280 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_05670 4571 4777 gene locus_tag LOCUS_05680 4571 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence107 <1 1090 gene locus_tag LOCUS_05690 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KBD4:magnesium transporter MgtE 4360 1142 gene locus_tag LOCUS_05700 4360 1142 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_05700 4937 4500 gene locus_tag LOCUS_05710 4937 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence108 1597 1028 gene locus_tag LOCUS_05720 1597 1028 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_05720 2043 1594 gene locus_tag LOCUS_05730 2043 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3616 2084 gene locus_tag LOCUS_05740 3616 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4166 3609 gene locus_tag LOCUS_05750 4166 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4925 4188 gene locus_tag LOCUS_05760 gene surE 4925 4188 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_05760 >Feature sequence109 929 669 gene locus_tag LOCUS_05770 929 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1790 1374 gene locus_tag LOCUS_05780 1790 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1968 1771 gene locus_tag LOCUS_05790 1968 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4111 3857 gene locus_tag LOCUS_05800 4111 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4322 4095 gene locus_tag LOCUS_05810 4322 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4644 4560 gene locus_tag LOCUS_t00050 4644 4560 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 804 391 gene locus_tag LOCUS_05820 gene yqiW 804 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_05820 1074 1000 gene locus_tag LOCUS_t00060 1074 1000 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1745 1182 gene locus_tag LOCUS_05830 1745 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2079 1759 gene locus_tag LOCUS_05840 2079 1759 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947576.1 protein_id gnl|my_center|LOCUS_05840 2749 2198 gene locus_tag LOCUS_05850 2749 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3580 2999 gene locus_tag LOCUS_05860 3580 2999 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_05860 4285 3797 gene locus_tag LOCUS_05870 4285 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05870 4701 4282 gene locus_tag LOCUS_05880 4701 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 4877 4680 gene locus_tag LOCUS_05890 4877 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence111 255 1730 gene locus_tag LOCUS_05900 255 1730 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_05900 3336 1906 gene locus_tag LOCUS_05910 gene sdaA 3336 1906 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_05910 4238 3456 gene locus_tag LOCUS_05920 4238 3456 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042983.1 protein_id gnl|my_center|LOCUS_05920 4676 4242 gene locus_tag LOCUS_05930 gene ydiI 4676 4242 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422946.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence112 1371 790 gene locus_tag LOCUS_05940 1371 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2495 1605 gene locus_tag LOCUS_05950 2495 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3579 3025 gene locus_tag LOCUS_05960 3579 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence113 258 647 gene locus_tag LOCUS_05970 258 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 972 2009 gene locus_tag LOCUS_05980 972 2009 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253581.1 protein_id gnl|my_center|LOCUS_05980 2150 2896 gene locus_tag LOCUS_05990 2150 2896 CDS product L-allo-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017148.1 protein_id gnl|my_center|LOCUS_05990 2915 3523 gene locus_tag LOCUS_06000 gene tag 2915 3523 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_06000 4294 3512 gene locus_tag LOCUS_06010 4294 3512 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_06010 4834 4298 gene locus_tag LOCUS_06020 4834 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence114 2084 2590 gene locus_tag LOCUS_06030 2084 2590 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_06030 2690 3940 gene locus_tag LOCUS_06040 gene pepT 2690 3940 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_06040 >Feature sequence115 777 187 gene locus_tag LOCUS_06050 777 187 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_06050 976 1437 gene locus_tag LOCUS_06060 976 1437 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_06060 1543 2304 gene locus_tag LOCUS_06070 gene pcbD 1543 2304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_06070 2315 2983 gene locus_tag LOCUS_06080 2315 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2994 3752 gene locus_tag LOCUS_06090 2994 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence116 1297 419 gene locus_tag LOCUS_06100 1297 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_06100 2109 1381 gene locus_tag LOCUS_06110 2109 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2982 2167 gene locus_tag LOCUS_06120 2982 2167 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_06120 3663 3061 gene locus_tag LOCUS_06130 gene miaE 3663 3061 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence117 1241 684 gene locus_tag LOCUS_06140 1241 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 2025 1375 gene locus_tag LOCUS_06150 gene clpP 2025 1375 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_06150 2749 2054 gene locus_tag LOCUS_06160 gene clpP 2749 2054 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_06160 3016 4512 gene locus_tag LOCUS_06170 3016 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence118 932 753 gene locus_tag LOCUS_06180 932 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1405 2313 gene locus_tag LOCUS_06190 1405 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2325 2705 gene locus_tag LOCUS_06200 2325 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 2722 3096 gene locus_tag LOCUS_06210 2722 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 <4738 3752 gene locus_tag LOCUS_06220 <4738 3752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXW3:aminomethyltransferase >Feature sequence119 1379 999 gene locus_tag LOCUS_06230 1379 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1430 1975 gene locus_tag LOCUS_06240 1430 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2033 2539 gene locus_tag LOCUS_06250 2033 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2723 2514 gene locus_tag LOCUS_06260 2723 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3304 2879 gene locus_tag LOCUS_06270 3304 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3531 3334 gene locus_tag LOCUS_06280 3531 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3863 3561 gene locus_tag LOCUS_06290 3863 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4225 3929 gene locus_tag LOCUS_06300 4225 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4608 4369 gene locus_tag LOCUS_06310 4608 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence120 <1 933 gene locus_tag LOCUS_06320 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000411031.1:RNA-directed DNA polymerase 940 2262 gene locus_tag LOCUS_06330 940 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2262 2924 gene locus_tag LOCUS_06340 2262 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2911 4521 gene locus_tag LOCUS_06350 2911 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence121 <1 2277 gene locus_tag LOCUS_06360 <1 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962188.1:helicase 2477 2737 gene locus_tag LOCUS_06370 2477 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2887 4101 gene locus_tag LOCUS_06380 2887 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4178 4432 gene locus_tag LOCUS_06390 gene rpsT 4178 4432 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM9 protein_id gnl|my_center|LOCUS_06390 >Feature sequence122 3182 1800 gene locus_tag LOCUS_06400 3182 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence123 1582 377 gene locus_tag LOCUS_06410 1582 377 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932205.1 protein_id gnl|my_center|LOCUS_06410 1978 2166 gene locus_tag LOCUS_06420 1978 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2150 2761 gene locus_tag LOCUS_06430 2150 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2745 3323 gene locus_tag LOCUS_06440 2745 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939308.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence124 2291 1368 gene locus_tag LOCUS_06450 2291 1368 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_06450 3289 2306 gene locus_tag LOCUS_06460 3289 2306 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_06460 <4559 3670 gene locus_tag LOCUS_06470 <4559 3670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259114.1:methionine gamma-lyase >Feature sequence125 957 64 gene locus_tag LOCUS_06480 957 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1456 3273 gene locus_tag LOCUS_06490 1456 3273 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence126 <1 1924 gene locus_tag LOCUS_06500 <1 1924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203587.1:membrane protein 2098 3306 gene locus_tag LOCUS_06510 2098 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence127 605 1444 gene locus_tag LOCUS_06520 605 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1531 2505 gene locus_tag LOCUS_06530 1531 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2860 4386 gene locus_tag LOCUS_06540 2860 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence128 110 1261 gene locus_tag LOCUS_06550 gene porY 110 1261 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_06550 1716 1474 gene locus_tag LOCUS_06560 1716 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2888 2190 gene locus_tag LOCUS_06570 2888 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3758 3531 gene locus_tag LOCUS_06580 3758 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4150 3938 gene locus_tag LOCUS_06590 4150 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence129 461 1579 gene locus_tag LOCUS_06600 gene lpxB 461 1579 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_06600 1581 2240 gene locus_tag LOCUS_06610 1581 2240 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_06610 2719 2192 gene locus_tag LOCUS_06620 gene folK 2719 2192 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_06620 3237 2719 gene locus_tag LOCUS_06630 3237 2719 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830405.1 protein_id gnl|my_center|LOCUS_06630 3749 3240 gene locus_tag LOCUS_06640 3749 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence130 2408 3814 gene locus_tag LOCUS_06650 gene speA 2408 3814 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_06650 >Feature sequence131 <1 1116 gene locus_tag LOCUS_06660 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6P8:60 kDa chaperonin 2420 1221 gene locus_tag LOCUS_06670 2420 1221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402920.1 protein_id gnl|my_center|LOCUS_06670 3592 2519 gene locus_tag LOCUS_06680 gene recF 3592 2519 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_06680 >Feature sequence132 722 1855 gene locus_tag LOCUS_06690 722 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1890 2846 gene locus_tag LOCUS_06700 1890 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence133 84 1157 gene locus_tag LOCUS_06710 84 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2526 1312 gene locus_tag LOCUS_06720 2526 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3489 2842 gene locus_tag LOCUS_06730 gene tal 3489 2842 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A767 protein_id gnl|my_center|LOCUS_06730 4163 3681 gene locus_tag LOCUS_06740 4163 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence134 <1 1352 gene locus_tag LOCUS_06750 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963250.1:cyanophycin synthetase 2290 1457 gene locus_tag LOCUS_06760 gene xapG 2290 1457 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_06760 3413 2277 gene locus_tag LOCUS_06770 gene rffA 3413 2277 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NF96 protein_id gnl|my_center|LOCUS_06770 >Feature sequence135 1049 171 gene locus_tag LOCUS_06780 gene mvaK 1049 171 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_06780 2306 1257 gene locus_tag LOCUS_06790 2306 1257 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 protein_id gnl|my_center|LOCUS_06790 2595 3392 gene locus_tag LOCUS_06800 2595 3392 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 protein_id gnl|my_center|LOCUS_06800 3435 4352 gene locus_tag LOCUS_06810 3435 4352 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence136 263 1006 gene locus_tag LOCUS_06820 263 1006 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_06820 1086 3206 gene locus_tag LOCUS_06830 gene feoB 1086 3206 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_06830 3215 3469 gene locus_tag LOCUS_06840 3215 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 <4421 3580 gene locus_tag LOCUS_06850 <4421 3580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence137 2423 960 gene locus_tag LOCUS_06860 2423 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3724 3284 gene locus_tag LOCUS_06870 3724 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence138 1971 1117 gene locus_tag LOCUS_06880 1971 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2993 1974 gene locus_tag LOCUS_06890 2993 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_06890 4198 3068 gene locus_tag LOCUS_06900 4198 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence139 379 95 gene locus_tag LOCUS_06910 gene clpS 379 95 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_06910 453 995 gene locus_tag LOCUS_06920 453 995 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_06920 1526 1047 gene locus_tag LOCUS_06930 1526 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2636 1590 gene locus_tag LOCUS_06940 2636 1590 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_06940 <4359 2633 gene locus_tag LOCUS_06950 <4359 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:ATP-dependent DNA helicase RecQ >Feature sequence140 1165 2910 gene locus_tag LOCUS_06960 1165 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4011 2920 gene locus_tag LOCUS_06970 gene menE 4011 2920 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_06970 4355 4074 gene locus_tag LOCUS_06980 4355 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence141 1537 722 gene locus_tag LOCUS_06990 gene dapD 1537 722 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_06990 1663 2430 gene locus_tag LOCUS_07000 1663 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2521 4245 gene locus_tag LOCUS_07010 gene gldG 2521 4245 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence142 228 512 gene locus_tag LOCUS_07020 228 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 509 778 gene locus_tag LOCUS_07030 509 778 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870615.1 protein_id gnl|my_center|LOCUS_07030 2368 1025 gene locus_tag LOCUS_07040 2368 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3213 2386 gene locus_tag LOCUS_07050 3213 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3095 3334 gene locus_tag LOCUS_07060 3095 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3452 3775 gene locus_tag LOCUS_07070 3452 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence143 1597 1445 gene locus_tag LOCUS_07080 1597 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2321 2016 gene locus_tag LOCUS_07090 2321 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3110 2373 gene locus_tag LOCUS_07100 3110 2373 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9H7 protein_id gnl|my_center|LOCUS_07100 4124 3117 gene locus_tag LOCUS_07110 gene tsaD 4124 3117 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_07110 >Feature sequence144 1873 575 gene locus_tag LOCUS_07120 gene wbpO 1873 575 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_07120 2896 1919 gene locus_tag LOCUS_07130 2896 1919 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_07130 3441 2908 gene locus_tag LOCUS_07140 3441 2908 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_07140 4061 3579 gene locus_tag LOCUS_07150 4061 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence145 <1 602 gene locus_tag LOCUS_07160 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYX7:glyceraldehyde-3-phosphate dehydrogenase 1068 1958 gene locus_tag LOCUS_07170 1068 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2027 2731 gene locus_tag LOCUS_07180 gene rprY 2027 2731 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_07180 3764 2886 gene locus_tag LOCUS_07190 3764 2886 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence146 2762 558 gene locus_tag LOCUS_07200 2762 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4134 2857 gene locus_tag LOCUS_07210 4134 2857 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence147 2 976 gene locus_tag LOCUS_07220 2 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1502 3547 gene locus_tag LOCUS_07230 gene dcp 1502 3547 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035485.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence148 1171 269 gene locus_tag LOCUS_07240 1171 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2245 1280 gene locus_tag LOCUS_07250 gene trxB1 2245 1280 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_07250 3354 2410 gene locus_tag LOCUS_07260 3354 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4135 3359 gene locus_tag LOCUS_07270 4135 3359 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence149 1106 54 gene locus_tag LOCUS_07280 gene ctaA 1106 54 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_07280 1289 2140 gene locus_tag LOCUS_07290 1289 2140 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_07290 2228 3502 gene locus_tag LOCUS_07300 2228 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence150 1404 619 gene locus_tag LOCUS_07310 1404 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07310 3038 1680 gene locus_tag LOCUS_07320 3038 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3389 3039 gene locus_tag LOCUS_07330 3389 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence151 8 2245 gene locus_tag LOCUS_07340 8 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence152 489 899 gene locus_tag LOCUS_07350 489 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2294 1017 gene locus_tag LOCUS_07360 2294 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2815 2324 gene locus_tag LOCUS_07370 2815 2324 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL1 protein_id gnl|my_center|LOCUS_07370 <4151 2914 gene locus_tag LOCUS_07380 <4151 2914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWA9:S-adenosylmethionine synthase >Feature sequence153 2 250 gene locus_tag LOCUS_07390 2 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 395 322 gene locus_tag LOCUS_t00070 395 322 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1708 503 gene locus_tag LOCUS_07400 1708 503 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_07400 2800 1928 gene locus_tag LOCUS_07410 2800 1928 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_07410 3066 4058 gene locus_tag LOCUS_07420 3066 4058 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_07420 >Feature sequence154 1231 521 gene locus_tag LOCUS_07430 1231 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence155 >Feature sequence156 705 256 gene locus_tag LOCUS_07440 705 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_07440 953 717 gene locus_tag LOCUS_07450 953 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1288 974 gene locus_tag LOCUS_07460 1288 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1471 1334 gene locus_tag LOCUS_07470 1471 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1674 1480 gene locus_tag LOCUS_07480 1674 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 <4113 1674 gene locus_tag LOCUS_07490 <4113 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter >Feature sequence157 2977 470 gene locus_tag LOCUS_07500 2977 470 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_07500 3476 3066 gene locus_tag LOCUS_07510 3476 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence158 1779 364 gene locus_tag LOCUS_07520 1779 364 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_07520 2205 1858 gene locus_tag LOCUS_07530 2205 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3502 2219 gene locus_tag LOCUS_07540 3502 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence159 741 1286 gene locus_tag LOCUS_07550 741 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1315 1521 gene locus_tag LOCUS_07560 gene rpmF 1315 1521 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_07560 1597 2577 gene locus_tag LOCUS_07570 gene plsX 1597 2577 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_07570 2971 3621 gene locus_tag LOCUS_07580 2971 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence160 3795 1900 gene locus_tag LOCUS_07590 3795 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence161 1243 608 gene locus_tag LOCUS_07600 gene folE2 1243 608 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_07600 1898 1251 gene locus_tag LOCUS_07610 1898 1251 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_07610 2883 2695 gene locus_tag LOCUS_07620 2883 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3597 3061 gene locus_tag LOCUS_07630 3597 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence162 276 650 gene locus_tag LOCUS_07640 276 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 749 1789 gene locus_tag LOCUS_07650 749 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1972 2418 gene locus_tag LOCUS_07660 1972 2418 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_07660 2415 3992 gene locus_tag LOCUS_07670 2415 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence163 1437 3458 gene locus_tag LOCUS_07680 1437 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence164 1149 172 gene locus_tag LOCUS_07690 gene etfA 1149 172 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_07690 1929 1186 gene locus_tag LOCUS_07700 gene etfB 1929 1186 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_07700 2340 3524 gene locus_tag LOCUS_07710 2340 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence165 <1 1073 gene locus_tag LOCUS_07720 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001020567.1:NAD(P) transhydrogenase subunit alpha 1121 1438 gene locus_tag LOCUS_07730 gene pntA 1121 1438 CDS product NADP transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_07730 1484 2887 gene locus_tag LOCUS_07740 gene pntB 1484 2887 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_07740 >Feature sequence166 138 1139 gene locus_tag LOCUS_07750 138 1139 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_07750 1165 2652 gene locus_tag LOCUS_07760 gene rpoN 1165 2652 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_07760 2969 3778 gene locus_tag LOCUS_07770 2969 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence167 3113 1365 gene locus_tag LOCUS_07780 3113 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence168 1317 709 gene locus_tag LOCUS_07790 1317 709 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_07790 1497 2138 gene locus_tag LOCUS_07800 gene cynT 1497 2138 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_07800 2477 2244 gene locus_tag LOCUS_07810 2477 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence169 529 1230 gene locus_tag LOCUS_07820 529 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1332 1973 gene locus_tag LOCUS_07830 1332 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3387 2080 gene locus_tag LOCUS_07840 gene murA 3387 2080 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_07840 >Feature sequence170 <1 1181 gene locus_tag LOCUS_07850 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108527.1:hybrid sensor histidine kinase/response regulator 1263 1715 gene locus_tag LOCUS_07860 1263 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07860 1836 2576 gene locus_tag LOCUS_07870 1836 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2970 2563 gene locus_tag LOCUS_07880 2970 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence171 <1 1006 gene locus_tag LOCUS_07890 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211395.1:4-hydroxybutyrate CoA-transferase 1454 3724 gene locus_tag LOCUS_07900 1454 3724 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence172 2040 1276 gene locus_tag LOCUS_07910 2040 1276 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_07910 2637 2059 gene locus_tag LOCUS_07920 gene def 2637 2059 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_07920 >Feature sequence173 1785 640 gene locus_tag LOCUS_07930 1785 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3202 1775 gene locus_tag LOCUS_07940 3202 1775 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence174 589 921 gene locus_tag LOCUS_07950 589 921 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_07950 1010 1252 gene locus_tag LOCUS_07960 1010 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1348 1560 gene locus_tag LOCUS_07970 1348 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1573 2160 gene locus_tag LOCUS_07980 1573 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2219 2404 gene locus_tag LOCUS_07990 2219 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2457 2750 gene locus_tag LOCUS_08000 2457 2750 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_08000 <3849 2898 gene locus_tag LOCUS_08010 <3849 2898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F3P1:vitamin B12-dependent ribonucleotide reductase >Feature sequence175 1681 2439 gene locus_tag LOCUS_08020 1681 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2454 3509 gene locus_tag LOCUS_08030 2454 3509 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence176 1923 334 gene locus_tag LOCUS_08040 1923 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_08040 2675 3463 gene locus_tag LOCUS_08050 2675 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence177 <1 548 gene locus_tag LOCUS_08060 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142655.1:transcriptional regulator 545 1390 gene locus_tag LOCUS_08070 545 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203382.1 protein_id gnl|my_center|LOCUS_08070 1788 2378 gene locus_tag LOCUS_08080 1788 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_08080 2525 2992 gene locus_tag LOCUS_08090 2525 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3004 3825 gene locus_tag LOCUS_08100 3004 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence178 120 3026 gene locus_tag LOCUS_08110 120 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08110 >Feature sequence179 1706 270 gene locus_tag LOCUS_08120 1706 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3775 1937 gene locus_tag LOCUS_08130 3775 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence180 677 749 gene locus_tag LOCUS_t00080 677 749 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 963 1970 gene locus_tag LOCUS_08140 963 1970 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_08140 1967 3721 gene locus_tag LOCUS_08150 1967 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence181 <1 2087 gene locus_tag LOCUS_08160 <1 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MG7:DNA mismatch repair protein MutS 2792 2334 gene locus_tag LOCUS_08170 2792 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3197 2814 gene locus_tag LOCUS_08180 3197 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3622 3179 gene locus_tag LOCUS_08190 3622 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence182 1264 308 gene locus_tag LOCUS_08200 1264 308 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_08200 2043 1372 gene locus_tag LOCUS_08210 2043 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_08210 2752 2036 gene locus_tag LOCUS_08220 2752 2036 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK1 protein_id gnl|my_center|LOCUS_08220 3330 2761 gene locus_tag LOCUS_08230 3330 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence183 1860 868 gene locus_tag LOCUS_08240 gene fabH 1860 868 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_08240 2658 1912 gene locus_tag LOCUS_08250 2658 1912 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_08250 3612 2863 gene locus_tag LOCUS_08260 3612 2863 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence184 903 2513 gene locus_tag LOCUS_08270 gene rny 903 2513 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_08270 2668 3228 gene locus_tag LOCUS_08280 gene purN 2668 3228 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_08280 <3776 3263 gene locus_tag LOCUS_08290 <3776 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141122.1:long-chain-fatty-acid--CoA ligase >Feature sequence185 1500 370 gene locus_tag LOCUS_08300 1500 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2116 1700 gene locus_tag LOCUS_08310 2116 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08310 2569 2300 gene locus_tag LOCUS_08320 2569 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08320 >Feature sequence186 <1 986 gene locus_tag LOCUS_08330 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962468.1:transporter 994 1953 gene locus_tag LOCUS_08340 994 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962467.1 protein_id gnl|my_center|LOCUS_08340 1957 3117 gene locus_tag LOCUS_08350 1957 3117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962466.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence187 1438 257 gene locus_tag LOCUS_08360 1438 257 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203212.1 protein_id gnl|my_center|LOCUS_08360 2255 1539 gene locus_tag LOCUS_08370 2255 1539 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_08370 2712 2260 gene locus_tag LOCUS_08380 2712 2260 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D50 protein_id gnl|my_center|LOCUS_08380 3524 2883 gene locus_tag LOCUS_08390 gene engB 3524 2883 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_08390 >Feature sequence188 2306 1392 gene locus_tag LOCUS_08400 2306 1392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021857.1 protein_id gnl|my_center|LOCUS_08400 3766 2342 gene locus_tag LOCUS_08410 3766 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence189 3 335 gene locus_tag LOCUS_08420 3 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 774 463 gene locus_tag LOCUS_08430 774 463 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_08430 1230 793 gene locus_tag LOCUS_08440 gene sufE 1230 793 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_08440 1305 2495 gene locus_tag LOCUS_08450 1305 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_08450 2707 3420 gene locus_tag LOCUS_08460 2707 3420 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence190 1729 890 gene locus_tag LOCUS_08470 1729 890 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125198.1 protein_id gnl|my_center|LOCUS_08470 2134 2853 gene locus_tag LOCUS_08480 2134 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence191 271 693 gene locus_tag LOCUS_08490 gene rplP 271 693 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH9 protein_id gnl|my_center|LOCUS_08490 749 967 gene locus_tag LOCUS_08500 gene rpmC 749 967 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL6 protein_id gnl|my_center|LOCUS_08500 993 1253 gene locus_tag LOCUS_08510 gene rpsQ1 993 1253 CDS product 30S ribosomal protein S17 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A485 protein_id gnl|my_center|LOCUS_08510 1333 1701 gene locus_tag LOCUS_08520 gene rplN 1333 1701 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0D0 protein_id gnl|my_center|LOCUS_08520 1760 2098 gene locus_tag LOCUS_08530 gene rplX 1760 2098 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRH1 protein_id gnl|my_center|LOCUS_08530 2098 2673 gene locus_tag LOCUS_08540 gene rplE 2098 2673 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_08540 2711 2980 gene locus_tag LOCUS_08550 gene rpsN 2711 2980 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_08550 3099 3497 gene locus_tag LOCUS_08560 gene rpsH 3099 3497 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_08560 >Feature sequence192 665 1000 gene locus_tag LOCUS_08570 665 1000 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_08570 1029 2873 gene locus_tag LOCUS_08580 1029 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence193 <1 786 gene locus_tag LOCUS_08590 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027231.1:glycosyl transferase 1169 2437 gene locus_tag LOCUS_08600 1169 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3516 2443 gene locus_tag LOCUS_08610 3516 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence194 298 20 gene locus_tag LOCUS_08620 gene rpsO 298 20 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHN4 protein_id gnl|my_center|LOCUS_08620 1858 650 gene locus_tag LOCUS_08630 1858 650 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_08630 2806 1967 gene locus_tag LOCUS_08640 gene nat 2806 1967 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5L9 protein_id gnl|my_center|LOCUS_08640 3513 2917 gene locus_tag LOCUS_08650 3513 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence195 <1 688 gene locus_tag LOCUS_08660 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963296.1:cytochrome c oxidase subunit III 926 2368 gene locus_tag LOCUS_08670 gene ccoG 926 2368 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_08670 2382 2855 gene locus_tag LOCUS_08680 gene ccoH 2382 2855 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_08680 2861 3580 gene locus_tag LOCUS_08690 2861 3580 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence196 120 728 gene locus_tag LOCUS_08700 120 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2710 842 gene locus_tag LOCUS_08710 gene mutL 2710 842 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_08710 3670 2816 gene locus_tag LOCUS_08720 3670 2816 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence197 1095 760 gene locus_tag LOCUS_08730 1095 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2550 1273 gene locus_tag LOCUS_08740 2550 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence198 2679 3635 gene locus_tag LOCUS_08750 2679 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence199 1906 3165 gene locus_tag LOCUS_08760 gene gldK 1906 3165 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence200 2140 809 gene locus_tag LOCUS_08770 2140 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3443 2355 gene locus_tag LOCUS_08780 3443 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence201 1100 276 gene locus_tag LOCUS_08790 1100 276 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_08790 1362 2225 gene locus_tag LOCUS_08800 gene panC 1362 2225 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_08800 2331 2885 gene locus_tag LOCUS_08810 2331 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence202 669 88 gene locus_tag LOCUS_08820 669 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 953 807 gene locus_tag LOCUS_08830 953 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2622 1219 gene locus_tag LOCUS_08840 2622 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3118 2813 gene locus_tag LOCUS_08850 3118 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence203 95 523 gene locus_tag LOCUS_08860 95 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 520 1242 gene locus_tag LOCUS_08870 520 1242 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_08870 1468 2181 gene locus_tag LOCUS_08880 1468 2181 CDS product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence204 187 561 gene locus_tag LOCUS_08890 187 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence205 2310 223 gene locus_tag LOCUS_08900 2310 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08900 3318 2386 gene locus_tag LOCUS_08910 3318 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08910 >Feature sequence206 992 33 gene locus_tag LOCUS_08920 992 33 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403316.1 protein_id gnl|my_center|LOCUS_08920 1520 1140 gene locus_tag LOCUS_08930 1520 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 2251 1547 gene locus_tag LOCUS_08940 2251 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08940 3632 2415 gene locus_tag LOCUS_08950 3632 2415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence207 741 415 gene locus_tag LOCUS_08960 gene ytxJ 741 415 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_08960 1437 865 gene locus_tag LOCUS_08970 1437 865 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 protein_id gnl|my_center|LOCUS_08970 1891 3132 gene locus_tag LOCUS_08980 1891 3132 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107629.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence208 <1 1453 gene locus_tag LOCUS_08990 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762337.1:membrane protein 1532 1981 gene locus_tag LOCUS_09000 1532 1981 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_09000 2036 2572 gene locus_tag LOCUS_09010 2036 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence209 1279 2223 gene locus_tag LOCUS_09020 gene nusB 1279 2223 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_09020 2260 2622 gene locus_tag LOCUS_09030 2260 2622 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_09030 2640 3239 gene locus_tag LOCUS_09040 gene coaE 2640 3239 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence210 <1 1028 gene locus_tag LOCUS_09050 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202155.1:3-oxoacyl-ACP synthase 1041 1955 gene locus_tag LOCUS_09060 1041 1955 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963746.1 protein_id gnl|my_center|LOCUS_09060 1949 2491 gene locus_tag LOCUS_09070 1949 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707834.1 protein_id gnl|my_center|LOCUS_09070 3362 2607 gene locus_tag LOCUS_09080 3362 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence211 941 156 gene locus_tag LOCUS_09090 gene dltE 941 156 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_09090 1537 941 gene locus_tag LOCUS_09100 1537 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202239.1 protein_id gnl|my_center|LOCUS_09100 1971 1534 gene locus_tag LOCUS_09110 1971 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 <3582 2049 gene locus_tag LOCUS_09120 <3582 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962810.1:DNA topoisomerase IV subunit A >Feature sequence212 1679 2842 gene locus_tag LOCUS_09130 1679 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence213 2387 1002 gene locus_tag LOCUS_09140 2387 1002 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947312.1 protein_id gnl|my_center|LOCUS_09140 2552 3442 gene locus_tag LOCUS_09150 gene accD 2552 3442 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_09150 >Feature sequence214 618 1652 gene locus_tag LOCUS_09160 618 1652 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972216.1 protein_id gnl|my_center|LOCUS_09160 2330 3343 gene locus_tag LOCUS_09170 2330 3343 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765036.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence215 25 1881 gene locus_tag LOCUS_09180 25 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3295 1892 gene locus_tag LOCUS_09190 3295 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence216 1501 608 gene locus_tag LOCUS_09200 1501 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2512 1514 gene locus_tag LOCUS_09210 gene fjo19 2512 1514 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence217 1555 437 gene locus_tag LOCUS_09220 gene prrC 1555 437 CDS product anticodon nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217540.1 protein_id gnl|my_center|LOCUS_09220 2714 1557 gene locus_tag LOCUS_09230 gene hsdS-2 2714 1557 CDS product type I restriction system specificity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933538.1 protein_id gnl|my_center|LOCUS_09230 3451 2711 gene locus_tag LOCUS_09240 3451 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09240 >Feature sequence218 458 9 gene locus_tag LOCUS_09250 gene rplO 458 9 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67561 protein_id gnl|my_center|LOCUS_09250 728 546 gene locus_tag LOCUS_09260 gene rpmD 728 546 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP02 protein_id gnl|my_center|LOCUS_09260 1298 783 gene locus_tag LOCUS_09270 gene rpsE 1298 783 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_09270 1720 1358 gene locus_tag LOCUS_09280 gene rplR 1720 1358 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_09280 2319 2606 gene locus_tag LOCUS_09290 2319 2606 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence219 1264 491 gene locus_tag LOCUS_09300 gene hisN 1264 491 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_09300 2700 1264 gene locus_tag LOCUS_09310 2700 1264 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence220 2270 147 gene locus_tag LOCUS_09320 2270 147 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_09320 3126 2371 gene locus_tag LOCUS_09330 3126 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_09330 3504 3130 gene locus_tag LOCUS_09340 3504 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence221 2187 259 gene locus_tag LOCUS_09350 2187 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3293 2220 gene locus_tag LOCUS_09360 3293 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence222 <3493 2505 gene locus_tag LOCUS_09370 <3493 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64X01:chaperone protein DnaK >Feature sequence223 <1 1204 gene locus_tag LOCUS_09380 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888361.1:HNH endonuclease 1578 2477 gene locus_tag LOCUS_09390 1578 2477 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_09390 2562 3215 gene locus_tag LOCUS_09400 2562 3215 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence224 2691 1189 gene locus_tag LOCUS_09410 2691 1189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence225 816 1952 gene locus_tag LOCUS_09420 816 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269295.1 protein_id gnl|my_center|LOCUS_09420 1952 2359 gene locus_tag LOCUS_09430 1952 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269296.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence226 402 1292 gene locus_tag LOCUS_09440 402 1292 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_09440 2851 1601 gene locus_tag LOCUS_09450 2851 1601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence227 1843 797 gene locus_tag LOCUS_09460 1843 797 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_09460 1933 2283 gene locus_tag LOCUS_09470 gene fdx1 1933 2283 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence228 2269 3399 gene locus_tag LOCUS_09480 2269 3399 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9M8 protein_id gnl|my_center|LOCUS_09480 >Feature sequence229 323 1021 gene locus_tag LOCUS_09490 323 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_09490 1379 2032 gene locus_tag LOCUS_09500 1379 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2029 2769 gene locus_tag LOCUS_09510 2029 2769 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922396.1 protein_id gnl|my_center|LOCUS_09510 <3466 2956 gene locus_tag LOCUS_09520 <3466 2956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105394.1:copper-binding protein >Feature sequence230 353 1648 gene locus_tag LOCUS_09530 353 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2882 2280 gene locus_tag LOCUS_09540 gene rplY 2882 2280 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_09540 >Feature sequence231 1 261 gene locus_tag LOCUS_09550 1 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1032 2267 gene locus_tag LOCUS_09560 1032 2267 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107244.1 protein_id gnl|my_center|LOCUS_09560 2446 2814 gene locus_tag LOCUS_09570 2446 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3393 2950 gene locus_tag LOCUS_09580 3393 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 >Feature sequence232 774 292 gene locus_tag LOCUS_09590 774 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1918 743 gene locus_tag LOCUS_09600 1918 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2476 2036 gene locus_tag LOCUS_09610 2476 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 <3450 2476 gene locus_tag LOCUS_09620 <3450 2476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:cell well associated RhsD protein >Feature sequence233 1274 768 gene locus_tag LOCUS_09630 1274 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1999 1523 gene locus_tag LOCUS_09640 1999 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2998 2147 gene locus_tag LOCUS_09650 gene prmC 2998 2147 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_09650 >Feature sequence234 94 834 gene locus_tag LOCUS_09660 94 834 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_09660 909 1217 gene locus_tag LOCUS_09670 909 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1396 1761 gene locus_tag LOCUS_09680 1396 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1944 2564 gene locus_tag LOCUS_09690 1944 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3061 2600 gene locus_tag LOCUS_09700 3061 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence235 238 1329 gene locus_tag LOCUS_09710 238 1329 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_09710 1365 2075 gene locus_tag LOCUS_09720 gene pyrH 1365 2075 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_09720 2133 2792 gene locus_tag LOCUS_09730 gene nth 2133 2792 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_09730 >Feature sequence236 2995 464 gene locus_tag LOCUS_09740 gene mur/alr 2995 464 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence237 1916 2947 gene locus_tag LOCUS_09750 gene fni 1916 2947 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD90 protein_id gnl|my_center|LOCUS_09750 >Feature sequence238 187 387 gene locus_tag LOCUS_09760 187 387 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_09760 1586 996 gene locus_tag LOCUS_09770 1586 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 1808 1677 gene locus_tag LOCUS_09780 1808 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2660 2355 gene locus_tag LOCUS_09790 2660 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence239 221 616 gene locus_tag LOCUS_09800 221 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_09800 1961 705 gene locus_tag LOCUS_09810 1961 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2069 2827 gene locus_tag LOCUS_09820 2069 2827 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence240 862 530 gene locus_tag LOCUS_09830 862 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2246 852 gene locus_tag LOCUS_09840 2246 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2565 2936 gene locus_tag LOCUS_09850 2565 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence241 <1 641 gene locus_tag LOCUS_09860 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458962.1:modification methylase 634 1926 gene locus_tag LOCUS_09870 634 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_09870 2184 2384 gene locus_tag LOCUS_09880 gene rpmI 2184 2384 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_09880 2447 2791 gene locus_tag LOCUS_09890 gene rplT 2447 2791 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_09890 2840 3196 gene locus_tag LOCUS_09900 gene rplS 2840 3196 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88WJ1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence242 1192 125 gene locus_tag LOCUS_09910 gene ribD 1192 125 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_09910 1574 1281 gene locus_tag LOCUS_09920 1574 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2496 1654 gene locus_tag LOCUS_09930 2496 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3006 2587 gene locus_tag LOCUS_09940 3006 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence243 923 477 gene locus_tag LOCUS_09950 923 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2502 1138 gene locus_tag LOCUS_09960 2502 1138 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_09960 <3373 2528 gene locus_tag LOCUS_09970 <3373 2528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A684:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence244 909 2183 gene locus_tag LOCUS_09980 909 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence245 162 2636 gene locus_tag LOCUS_09990 gene lon 162 2636 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_09990 3174 2764 gene locus_tag LOCUS_10000 3174 2764 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence246 920 1381 gene locus_tag LOCUS_10010 gene coaD 920 1381 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_10010 1442 3070 gene locus_tag LOCUS_10020 gene bshC 1442 3070 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_10020 3109 3184 gene locus_tag LOCUS_t00090 3109 3184 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence247 534 989 gene locus_tag LOCUS_10030 534 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1095 1364 gene locus_tag LOCUS_10040 1095 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1375 2523 gene locus_tag LOCUS_10050 1375 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence248 1400 834 gene locus_tag LOCUS_10060 1400 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2866 1442 gene locus_tag LOCUS_10070 2866 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence249 1828 1157 gene locus_tag LOCUS_10080 1828 1157 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence250 >Feature sequence251 2818 2144 gene locus_tag LOCUS_10090 gene pcm 2818 2144 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence252 342 1355 gene locus_tag LOCUS_10100 342 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence253 285 983 gene locus_tag LOCUS_10110 gene atoD 285 983 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_10110 1119 2213 gene locus_tag LOCUS_10120 gene purK 1119 2213 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_10120 2253 2756 gene locus_tag LOCUS_10130 gene purE 2253 2756 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_10130 >Feature sequence254 1922 1293 gene locus_tag LOCUS_10140 1922 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3297 2035 gene locus_tag LOCUS_10150 3297 2035 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence255 1020 262 gene locus_tag LOCUS_10160 1020 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3011 1020 gene locus_tag LOCUS_10170 3011 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence256 109 834 gene locus_tag LOCUS_10180 109 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 924 1757 gene locus_tag LOCUS_10190 924 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1831 2193 gene locus_tag LOCUS_10200 1831 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2982 2464 gene locus_tag LOCUS_10210 2982 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence257 228 605 gene locus_tag LOCUS_10220 gene gcvH 228 605 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_10220 620 1093 gene locus_tag LOCUS_10230 620 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1263 1913 gene locus_tag LOCUS_10240 1263 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254625.1 protein_id gnl|my_center|LOCUS_10240 2096 2320 gene locus_tag LOCUS_10250 2096 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2459 3010 gene locus_tag LOCUS_10260 2459 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence258 1016 1300 gene locus_tag LOCUS_10270 1016 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2760 1591 gene locus_tag LOCUS_10280 gene rlmL 2760 1591 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence259 796 197 gene locus_tag LOCUS_10290 796 197 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123453.1 protein_id gnl|my_center|LOCUS_10290 2661 799 gene locus_tag LOCUS_10300 2661 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence260 1923 904 gene locus_tag LOCUS_10310 1923 904 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_10310 <3280 2248 gene locus_tag LOCUS_10320 <3280 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047985.1:cytochrome d ubiquinol oxidase subunit I >Feature sequence261 381 1892 gene locus_tag LOCUS_10330 381 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence262 877 476 gene locus_tag LOCUS_10340 877 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_10340 2368 1052 gene locus_tag LOCUS_10350 2368 1052 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_10350 <3252 2399 gene locus_tag LOCUS_10360 <3252 2399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389068.1:aromatic hydrocarbon degradation protein >Feature sequence263 <1 1090 gene locus_tag LOCUS_10370 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786352.1:ribonuclease G 1193 2233 gene locus_tag LOCUS_10380 gene rlmN 1193 2233 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_10380 >Feature sequence264 <1 1085 gene locus_tag LOCUS_10390 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229069.1:2-hydroxymuconic semialdehyde dehydrogenase 1273 2049 gene locus_tag LOCUS_10400 1273 2049 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_10400 2918 2178 gene locus_tag LOCUS_10410 gene prsW 2918 2178 CDS product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50738 protein_id gnl|my_center|LOCUS_10410 >Feature sequence265 1256 414 gene locus_tag LOCUS_10420 1256 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2300 1317 gene locus_tag LOCUS_10430 gene pdhB 2300 1317 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_10430 3002 2352 gene locus_tag LOCUS_10440 3002 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence266 466 1218 gene locus_tag LOCUS_10450 gene sufC 466 1218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_10450 1269 2642 gene locus_tag LOCUS_10460 gene sufD 1269 2642 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence267 >Feature sequence268 <1 1672 gene locus_tag LOCUS_10470 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962750.1:glycosyl transferase family 2 1854 2669 gene locus_tag LOCUS_10480 1854 2669 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10480 >Feature sequence269 50 529 gene locus_tag LOCUS_10490 50 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 438 635 gene locus_tag LOCUS_10500 438 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1147 2529 gene locus_tag LOCUS_10510 1147 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence270 1624 116 gene locus_tag LOCUS_10520 gene purH 1624 116 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_10520 2571 1777 gene locus_tag LOCUS_10530 2571 1777 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002093008.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence271 2226 1153 gene locus_tag LOCUS_10540 2226 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence272 959 99 gene locus_tag LOCUS_10550 959 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2073 961 gene locus_tag LOCUS_10560 2073 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2691 2323 gene locus_tag LOCUS_10570 2691 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence273 1944 574 gene locus_tag LOCUS_10580 1944 574 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM2 protein_id gnl|my_center|LOCUS_10580 3055 1949 gene locus_tag LOCUS_10590 gene murG 3055 1949 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A258 protein_id gnl|my_center|LOCUS_10590 >Feature sequence274 640 359 gene locus_tag LOCUS_10600 640 359 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_10600 <3140 846 gene locus_tag LOCUS_10610 <3140 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815393.1:TonB-dependent receptor >Feature sequence275 508 975 gene locus_tag LOCUS_10620 508 975 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 protein_id gnl|my_center|LOCUS_10620 2238 1477 gene locus_tag LOCUS_10630 2238 1477 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence276 1821 388 gene locus_tag LOCUS_10640 1821 388 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_10640 2621 2430 gene locus_tag LOCUS_10650 2621 2430 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence277 1554 679 gene locus_tag LOCUS_10660 gene era 1554 679 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0U4 protein_id gnl|my_center|LOCUS_10660 2583 1666 gene locus_tag LOCUS_10670 2583 1666 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_10670 <3112 2589 gene locus_tag LOCUS_10680 <3112 2589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186079.1:SAM-dependent methyltransferase >Feature sequence278 1399 1554 gene locus_tag LOCUS_10690 1399 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence279 513 767 gene locus_tag LOCUS_10700 gene parD-1 513 767 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_10700 1191 1718 gene locus_tag LOCUS_10710 1191 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2122 2319 gene locus_tag LOCUS_10720 2122 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2410 2835 gene locus_tag LOCUS_10730 2410 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence280 177 959 gene locus_tag LOCUS_10740 177 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 965 2107 gene locus_tag LOCUS_10750 965 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 <3074 2423 gene locus_tag LOCUS_10760 <3074 2423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RC3:transcription termination factor Rho >Feature sequence281 539 303 gene locus_tag LOCUS_10770 539 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_10770 892 1890 gene locus_tag LOCUS_10780 892 1890 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_10780 1890 2117 gene locus_tag LOCUS_10790 1890 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence282 2354 672 gene locus_tag LOCUS_10800 2354 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence283 921 451 gene locus_tag LOCUS_10810 921 451 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771036.1 protein_id gnl|my_center|LOCUS_10810 2324 918 gene locus_tag LOCUS_10820 2324 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3060 2296 gene locus_tag LOCUS_10830 3060 2296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088660.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence284 <1 2075 gene locus_tag LOCUS_10840 <1 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776724.1:esterase 2086 2766 gene locus_tag LOCUS_10850 2086 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence285 392 646 gene locus_tag LOCUS_10860 392 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2038 845 gene locus_tag LOCUS_10870 gene aspC2 2038 845 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_10870 <3061 2146 gene locus_tag LOCUS_10880 <3061 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW82:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence286 1171 41 gene locus_tag LOCUS_10890 1171 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932663.1 protein_id gnl|my_center|LOCUS_10890 2380 1172 gene locus_tag LOCUS_10900 2380 1172 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence287 987 2495 gene locus_tag LOCUS_10910 987 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence288 754 332 gene locus_tag LOCUS_10920 754 332 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_10920 1484 792 gene locus_tag LOCUS_10930 1484 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2032 1517 gene locus_tag LOCUS_10940 2032 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence289 731 195 gene locus_tag LOCUS_10950 gene gmhB 731 195 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAI7 protein_id gnl|my_center|LOCUS_10950 1429 746 gene locus_tag LOCUS_10960 1429 746 CDS product D-mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107286.1 protein_id gnl|my_center|LOCUS_10960 2021 1449 gene locus_tag LOCUS_10970 gene gmhA 2021 1449 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ4 protein_id gnl|my_center|LOCUS_10970 2258 2860 gene locus_tag LOCUS_10980 2258 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence290 2 142 gene locus_tag LOCUS_10990 2 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1027 308 gene locus_tag LOCUS_11000 1027 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1615 1196 gene locus_tag LOCUS_11010 1615 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2383 1751 gene locus_tag LOCUS_11020 2383 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence291 <1 1308 gene locus_tag LOCUS_11030 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:peptidase S41 1399 2820 gene locus_tag LOCUS_11040 1399 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence292 2313 616 gene locus_tag LOCUS_11050 2313 616 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence293 >Feature sequence294 1539 2336 gene locus_tag LOCUS_11060 1539 2336 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence295 2750 255 gene locus_tag LOCUS_11070 2750 255 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence296 1631 171 gene locus_tag LOCUS_11080 1631 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2232 1852 gene locus_tag LOCUS_11090 2232 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence297 <1 591 gene locus_tag LOCUS_11100 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963542.1:prenyltransferase 654 1403 gene locus_tag LOCUS_11110 654 1403 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_11110 1407 2183 gene locus_tag LOCUS_11120 1407 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_11120 2180 2686 gene locus_tag LOCUS_11130 gene kdsC 2180 2686 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence298 1002 1991 gene locus_tag LOCUS_11140 1002 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence299 285 446 gene locus_tag LOCUS_11150 285 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1063 2202 gene locus_tag LOCUS_11160 1063 2202 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_11160 2431 2811 gene locus_tag LOCUS_11170 gene rpsL 2431 2811 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q06 protein_id gnl|my_center|LOCUS_11170 >Feature sequence300 234 602 gene locus_tag LOCUS_11180 234 602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_11180 1311 1640 gene locus_tag LOCUS_11190 1311 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1643 2638 gene locus_tag LOCUS_11200 1643 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence301 1433 1002 gene locus_tag LOCUS_11210 1433 1002 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_11210 <2987 1929 gene locus_tag LOCUS_11220 <2987 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070535.1:peptidase M6 >Feature sequence302 4 1308 gene locus_tag LOCUS_11230 4 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1313 2404 gene locus_tag LOCUS_11240 gene rfaG 1313 2404 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence303 2179 1526 gene locus_tag LOCUS_11250 2179 1526 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence304 2667 1915 gene locus_tag LOCUS_11260 gene uppS 2667 1915 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_11260 2815 2960 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcaaatgtcttaaataggg >Feature sequence305 <1 1915 gene locus_tag LOCUS_11270 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962208.1:type I endonuclease-methyltransferase fusion protein 1915 2586 gene locus_tag LOCUS_11280 1915 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence306 1777 248 gene locus_tag LOCUS_11290 gene gltX 1777 248 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_11290 >Feature sequence307 926 78 gene locus_tag LOCUS_11300 926 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1755 1114 gene locus_tag LOCUS_11310 1755 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2630 1809 gene locus_tag LOCUS_11320 2630 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence308 >Feature sequence309 <1 645 gene locus_tag LOCUS_11330 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963871.1:alkaline phosphatase family protein 668 1690 gene locus_tag LOCUS_11340 668 1690 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence310 658 1287 gene locus_tag LOCUS_11350 658 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1281 2153 gene locus_tag LOCUS_11360 1281 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence311 1057 1530 gene locus_tag LOCUS_11370 1057 1530 CDS product anti-oxidant AhpCTSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404264.1 protein_id gnl|my_center|LOCUS_11370 1919 2908 gene locus_tag LOCUS_11380 1919 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence312 1863 334 gene locus_tag LOCUS_11390 1863 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence313 1904 2755 gene locus_tag LOCUS_11400 1904 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence314 >Feature sequence315 203 1714 gene locus_tag LOCUS_11410 gene gldJ 203 1714 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_11410 1796 2221 gene locus_tag LOCUS_11420 1796 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2224 2619 gene locus_tag LOCUS_11430 2224 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence316 2162 942 gene locus_tag LOCUS_11440 gene aroA 2162 942 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KM2 protein_id gnl|my_center|LOCUS_11440 2514 2242 gene locus_tag LOCUS_11450 2514 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11450 >Feature sequence317 1001 1360 gene locus_tag LOCUS_11460 1001 1360 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_11460 1931 1443 gene locus_tag LOCUS_11470 1931 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2295 1975 gene locus_tag LOCUS_11480 2295 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence318 644 519 gene locus_tag LOCUS_11490 644 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 764 1546 gene locus_tag LOCUS_11500 764 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1922 1617 gene locus_tag LOCUS_11510 1922 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence319 444 121 gene locus_tag LOCUS_11520 444 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1048 548 gene locus_tag LOCUS_11530 1048 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 <2843 1177 gene locus_tag LOCUS_11540 <2843 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A378:ribonuclease R >Feature sequence320 >Feature sequence321 1231 311 gene locus_tag LOCUS_11550 1231 311 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_11550 <2841 1259 gene locus_tag LOCUS_11560 <2841 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI0:adenine deaminase >Feature sequence322 529 2013 gene locus_tag LOCUS_11570 529 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence323 1119 1475 gene locus_tag LOCUS_11580 1119 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11580 1527 1856 gene locus_tag LOCUS_11590 1527 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11590 1896 2384 gene locus_tag LOCUS_11600 1896 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11600 >Feature sequence324 2274 157 gene locus_tag LOCUS_11610 2274 157 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence325 203 2377 gene locus_tag LOCUS_11620 gene pepX1 203 2377 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence326 275 1132 gene locus_tag LOCUS_11630 275 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence327 1579 668 gene locus_tag LOCUS_11640 1579 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 <2791 1598 gene locus_tag LOCUS_11650 <2791 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964073.1:gliding motility protein GldM >Feature sequence328 <1 2382 gene locus_tag LOCUS_11660 <1 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203587.1:membrane protein >Feature sequence329 1677 430 gene locus_tag LOCUS_11670 1677 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279191.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence330 1086 178 gene locus_tag LOCUS_11680 1086 178 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11680 1297 2718 gene locus_tag LOCUS_11690 gene fumC 1297 2718 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_11690 >Feature sequence331 446 1051 gene locus_tag LOCUS_11700 446 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1081 1809 gene locus_tag LOCUS_11710 gene coaX 1081 1809 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XF4 protein_id gnl|my_center|LOCUS_11710 >Feature sequence332 1277 519 gene locus_tag LOCUS_11720 1277 519 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_11720 2041 1274 gene locus_tag LOCUS_11730 2041 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence333 729 1949 gene locus_tag LOCUS_11740 gene kdtA 729 1949 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_11740 <2755 1916 gene locus_tag LOCUS_11750 <2755 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020700.1:ABC transporter ATP-binding protein >Feature sequence334 2752 485 gene locus_tag LOCUS_11760 2752 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence335 1635 2180 gene locus_tag LOCUS_11770 1635 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence336 2168 651 gene locus_tag LOCUS_11780 gene lysS 2168 651 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_11780 <2746 2243 gene locus_tag LOCUS_11790 <2746 2243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788150.1:UDP-glucose 4-epimerase >Feature sequence337 148 717 gene locus_tag LOCUS_11800 148 717 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_11800 901 1677 gene locus_tag LOCUS_11810 901 1677 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_11810 <2743 1798 gene locus_tag LOCUS_11820 <2743 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183344.1:lipoprotein >Feature sequence338 215 802 gene locus_tag LOCUS_11830 215 802 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_11830 812 1111 gene locus_tag LOCUS_11840 812 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1122 1682 gene locus_tag LOCUS_11850 1122 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence339 <2735 862 gene locus_tag LOCUS_11860 <2735 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YB4:alanine--tRNA ligase >Feature sequence340 <1 2203 gene locus_tag LOCUS_11870 <1 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F937:glycine dehydrogenase (decarboxylating) >Feature sequence341 719 1351 gene locus_tag LOCUS_11880 719 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1401 2381 gene locus_tag LOCUS_11890 1401 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence342 <1 657 gene locus_tag LOCUS_11900 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1E4:glutamate racemase 798 1454 gene locus_tag LOCUS_11910 798 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1463 1798 gene locus_tag LOCUS_11920 1463 1798 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence343 1470 862 gene locus_tag LOCUS_11930 1470 862 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_11930 1488 1922 gene locus_tag LOCUS_11940 1488 1922 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015893.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence344 270 644 gene locus_tag LOCUS_11950 270 644 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNK3 protein_id gnl|my_center|LOCUS_11950 >Feature sequence345 <1 1031 gene locus_tag LOCUS_11960 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:glutamate:proton symporter 1073 1705 gene locus_tag LOCUS_11970 1073 1705 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_11970 <2710 1809 gene locus_tag LOCUS_11980 <2710 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943891.1:thioredoxin >Feature sequence346 357 223 gene locus_tag LOCUS_11990 357 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 859 365 gene locus_tag LOCUS_12000 859 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1062 856 gene locus_tag LOCUS_12010 1062 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2494 1394 gene locus_tag LOCUS_12020 2494 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence347 1828 917 gene locus_tag LOCUS_12030 1828 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_12030 <2702 1825 gene locus_tag LOCUS_12040 <2702 1825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H222:3-hydroxy-3-methylglutaryl coenzyme A reductase >Feature sequence348 <2698 243 gene locus_tag LOCUS_12050 <2698 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016374.1:type III restriction endonuclease subunit R >Feature sequence349 244 1971 gene locus_tag LOCUS_12060 244 1971 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_12060 2042 2587 gene locus_tag LOCUS_12070 2042 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence350 1089 745 gene locus_tag LOCUS_12080 1089 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1687 1109 gene locus_tag LOCUS_12090 1687 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence351 1395 829 gene locus_tag LOCUS_12100 gene ctaE 1395 829 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_12100 2350 1421 gene locus_tag LOCUS_12110 gene ctaB 2350 1421 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_12110 >Feature sequence352 3 299 gene locus_tag LOCUS_12120 3 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2262 382 gene locus_tag LOCUS_12130 gene rho 2262 382 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_12130 >Feature sequence353 613 1599 gene locus_tag LOCUS_12140 613 1599 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence354 276 878 gene locus_tag LOCUS_12150 276 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_12150 871 1155 gene locus_tag LOCUS_12160 871 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence355 330 1544 gene locus_tag LOCUS_12170 330 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1549 2373 gene locus_tag LOCUS_12180 gene pcaD 1549 2373 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594855.1 protein_id gnl|my_center|LOCUS_12180 2661 2401 gene locus_tag LOCUS_12190 2661 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence356 473 904 gene locus_tag LOCUS_12200 473 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence357 >Feature sequence358 1120 1737 gene locus_tag LOCUS_12210 1120 1737 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_12210 1968 1762 gene locus_tag LOCUS_12220 1968 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence359 <2647 106 gene locus_tag LOCUS_12230 <2647 106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence360 1307 402 gene locus_tag LOCUS_12240 1307 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2160 1321 gene locus_tag LOCUS_12250 2160 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2624 2487 gene locus_tag LOCUS_12260 2624 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence361 <1 728 gene locus_tag LOCUS_12270 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108949.1:outer membrane protein assembly factor 810 1346 gene locus_tag LOCUS_12280 810 1346 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_12280 1412 1924 gene locus_tag LOCUS_12290 1412 1924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence362 871 1149 gene locus_tag LOCUS_12300 871 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1350 1132 gene locus_tag LOCUS_12310 1350 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence363 <1 1529 gene locus_tag LOCUS_12320 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0U2:membrane protein insertase YidC 1531 1992 gene locus_tag LOCUS_12330 gene tadA 1531 1992 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence364 721 542 gene locus_tag LOCUS_12340 721 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1163 849 gene locus_tag LOCUS_12350 1163 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1970 1164 gene locus_tag LOCUS_12360 1970 1164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_12360 <2607 2011 gene locus_tag LOCUS_12370 <2607 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZE56:aspartate aminotransferase >Feature sequence365 <1 1020 gene locus_tag LOCUS_12380 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha >Feature sequence366 >Feature sequence367 <1 2537 gene locus_tag LOCUS_12390 <1 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962686.1:TonB-dependent receptor >Feature sequence368 <1 2019 gene locus_tag LOCUS_12400 <1 2019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877994.1:penicillin G acylase >Feature sequence369 991 1383 gene locus_tag LOCUS_12410 gene rpsF 991 1383 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 protein_id gnl|my_center|LOCUS_12410 1404 1670 gene locus_tag LOCUS_12420 gene rpsR 1404 1670 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_12420 1681 2127 gene locus_tag LOCUS_12430 gene rplI 1681 2127 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence370 <1 954 gene locus_tag LOCUS_12440 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962479.1:flavoprotein 1066 1575 gene locus_tag LOCUS_12450 1066 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2225 1596 gene locus_tag LOCUS_12460 2225 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence371 873 118 gene locus_tag LOCUS_12470 gene gldF 873 118 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_12470 1315 2121 gene locus_tag LOCUS_12480 gene rsmA 1315 2121 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_12480 >Feature sequence372 66 647 gene locus_tag LOCUS_12490 66 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 661 1479 gene locus_tag LOCUS_12500 gene deoD 661 1479 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM2 protein_id gnl|my_center|LOCUS_12500 >Feature sequence373 414 950 gene locus_tag LOCUS_12510 414 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1939 977 gene locus_tag LOCUS_12520 1939 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1978 2535 gene locus_tag LOCUS_12530 gene ruvC 1978 2535 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_12530 >Feature sequence374 578 1915 gene locus_tag LOCUS_12540 578 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence375 1109 1909 gene locus_tag LOCUS_12550 1109 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence376 301 77 gene locus_tag LOCUS_12560 301 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 988 1350 gene locus_tag LOCUS_12570 988 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2382 1507 gene locus_tag LOCUS_12580 2382 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence377 <2561 1592 gene locus_tag LOCUS_12590 <2561 1592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:alanine dehydrogenase >Feature sequence378 1971 523 gene locus_tag LOCUS_12600 1971 523 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence379 <1 1277 gene locus_tag LOCUS_12610 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2X1:L-aspartate oxidase >Feature sequence380 <1 1159 gene locus_tag LOCUS_12620 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964422.1:tail-specific protease 1240 1560 gene locus_tag LOCUS_12630 1240 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_12630 1595 2299 gene locus_tag LOCUS_12640 1595 2299 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence381 2034 1627 gene locus_tag LOCUS_12650 2034 1627 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_12650 2540 2154 gene locus_tag LOCUS_12660 2540 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence382 1000 458 gene locus_tag LOCUS_12670 1000 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2194 1013 gene locus_tag LOCUS_12680 2194 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence383 <1 644 gene locus_tag LOCUS_12690 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV6:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 771 1994 gene locus_tag LOCUS_12700 gene ribBA 771 1994 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_12700 >Feature sequence384 1423 1037 gene locus_tag LOCUS_12710 1423 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 <2537 1714 gene locus_tag LOCUS_12720 <2537 1714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965477.1:CDP-4-keto-6-deoxy-D-glucose-3-dehydrase >Feature sequence385 <1 1040 gene locus_tag LOCUS_12730 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964015.1:3-hydroxybutyryl-CoA dehydrogenase 1536 2252 gene locus_tag LOCUS_12740 1536 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence386 1255 101 gene locus_tag LOCUS_12750 1255 101 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_12750 2502 1348 gene locus_tag LOCUS_12760 gene serA 2502 1348 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence387 816 1172 gene locus_tag LOCUS_12770 816 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1203 2522 gene locus_tag LOCUS_12780 1203 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence388 <1 1160 gene locus_tag LOCUS_12790 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:magnesium chelatase 1185 1682 gene locus_tag LOCUS_12800 1185 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_12800 <2527 1698 gene locus_tag LOCUS_12810 <2527 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0G8:Na(+)/H(+) antiporter NhaA >Feature sequence389 1011 157 gene locus_tag LOCUS_12820 1011 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1239 1865 gene locus_tag LOCUS_12830 1239 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12830 1869 2315 gene locus_tag LOCUS_12840 1869 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12840 >Feature sequence390 514 936 gene locus_tag LOCUS_12850 514 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1069 2157 gene locus_tag LOCUS_12860 1069 2157 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence391 >Feature sequence392 1939 1112 gene locus_tag LOCUS_12870 gene ada 1939 1112 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_12870 <2515 1950 gene locus_tag LOCUS_12880 <2515 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962278.1:membrane protein >Feature sequence393 1133 198 gene locus_tag LOCUS_12890 1133 198 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_12890 2192 1170 gene locus_tag LOCUS_12900 gene mreB 2192 1170 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence394 1005 235 gene locus_tag LOCUS_12910 1005 235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_12910 1744 1220 gene locus_tag LOCUS_12920 1744 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2415 1759 gene locus_tag LOCUS_12930 2415 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence395 <1 1092 gene locus_tag LOCUS_12940 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073369.1:peptidase M28 1095 1652 gene locus_tag LOCUS_12950 1095 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12950 1689 2132 gene locus_tag LOCUS_12960 1689 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12960 >Feature sequence396 1433 885 gene locus_tag LOCUS_12970 1433 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2123 1437 gene locus_tag LOCUS_12980 2123 1437 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence397 741 82 gene locus_tag LOCUS_12990 741 82 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_12990 1063 1629 gene locus_tag LOCUS_13000 1063 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2231 2443 gene locus_tag LOCUS_13010 2231 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13010 >Feature sequence398 1701 211 gene locus_tag LOCUS_13020 1701 211 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_13020 1817 1891 gene locus_tag LOCUS_t00100 1817 1891 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence399 939 331 gene locus_tag LOCUS_13030 939 331 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_13030 <2470 1069 gene locus_tag LOCUS_13040 <2470 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87M84:RecBCD enzyme subunit RecB >Feature sequence400 1240 317 gene locus_tag LOCUS_13050 1240 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2193 1228 gene locus_tag LOCUS_13060 2193 1228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence401 181 633 gene locus_tag LOCUS_13070 181 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 646 1452 gene locus_tag LOCUS_13080 646 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1457 1759 gene locus_tag LOCUS_13090 1457 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1837 2424 gene locus_tag LOCUS_13100 1837 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence402 1019 156 gene locus_tag LOCUS_13110 1019 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1531 1034 gene locus_tag LOCUS_13120 1531 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1848 1567 gene locus_tag LOCUS_13130 1848 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 <2457 1852 gene locus_tag LOCUS_13140 <2457 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y7Q1:phenylalanine--tRNA ligase beta subunit >Feature sequence403 1321 26 gene locus_tag LOCUS_13150 1321 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence404 240 407 gene locus_tag LOCUS_13160 240 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 445 1422 gene locus_tag LOCUS_13170 gene hldD 445 1422 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_13170 1659 1958 gene locus_tag LOCUS_13180 1659 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence405 577 1329 gene locus_tag LOCUS_13190 577 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence406 >Feature sequence407 >Feature sequence408 1485 1081 gene locus_tag LOCUS_13200 1485 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence409 1744 233 gene locus_tag LOCUS_13210 gene yngK 1744 233 CDS product UPF0748 protein YngK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35015 protein_id gnl|my_center|LOCUS_13210 >Feature sequence410 1442 66 gene locus_tag LOCUS_13220 gene der 1442 66 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_13220 1611 2225 gene locus_tag LOCUS_13230 gene tpm 1611 2225 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence411 23 166 gene locus_tag LOCUS_13240 23 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 667 239 gene locus_tag LOCUS_13250 667 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1969 1811 gene locus_tag LOCUS_13260 1969 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence412 <2414 557 gene locus_tag LOCUS_13270 <2414 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWM2:Asp/Glu-specific dipeptidyl-peptidase >Feature sequence413 184 1935 gene locus_tag LOCUS_13280 184 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence414 <1 1763 gene locus_tag LOCUS_13290 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767911.1:DNA polymerase III subunit gamma/tau >Feature sequence415 606 1955 gene locus_tag LOCUS_13300 gene purB 606 1955 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_13300 >Feature sequence416 750 331 gene locus_tag LOCUS_13310 750 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2372 1011 gene locus_tag LOCUS_13320 2372 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence417 1748 516 gene locus_tag LOCUS_13330 gene hutI 1748 516 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_13330 <2361 1764 gene locus_tag LOCUS_13340 <2361 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962867.1:cysteine desulfurase >Feature sequence418 1677 604 gene locus_tag LOCUS_13350 1677 604 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDV4 protein_id gnl|my_center|LOCUS_13350 >Feature sequence419 1552 131 gene locus_tag LOCUS_13360 1552 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 <2357 1635 gene locus_tag LOCUS_13370 <2357 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108005.1:IS4 family transposase >Feature sequence420 <1 1102 gene locus_tag LOCUS_13380 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993033.1:aerotolerance-like protein 1113 1883 gene locus_tag LOCUS_13390 1113 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence421 906 268 gene locus_tag LOCUS_13400 906 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1312 917 gene locus_tag LOCUS_13410 1312 917 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence422 83 619 gene locus_tag LOCUS_13420 83 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 <2347 708 gene locus_tag LOCUS_13430 <2347 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106277.1:prolyl endopeptidase >Feature sequence423 2061 412 gene locus_tag LOCUS_13440 2061 412 CDS product ribonucleoside-diphosphate reductase, alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence424 <1 1091 gene locus_tag LOCUS_13450 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T41:replicative DNA helicase 1104 1556 gene locus_tag LOCUS_13460 gene dtd 1104 1556 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_13460 >Feature sequence425 <1 734 gene locus_tag LOCUS_13470 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036149.1:membrane protein 798 998 gene locus_tag LOCUS_13480 798 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 995 1615 gene locus_tag LOCUS_13490 995 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 >Feature sequence426 <1 535 gene locus_tag LOCUS_13500 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000925324.1:hydroxyacylglutathione hydrolase 639 959 gene locus_tag LOCUS_13510 639 959 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_13510 959 1585 gene locus_tag LOCUS_13520 959 1585 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_13520 1744 2307 gene locus_tag LOCUS_13530 1744 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence427 86 553 gene locus_tag LOCUS_13540 86 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 746 2152 gene locus_tag LOCUS_13550 746 2152 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence428 <1 1832 gene locus_tag LOCUS_13560 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962708.1:glutamine synthetase >Feature sequence429 476 177 gene locus_tag LOCUS_13570 476 177 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_13570 1430 537 gene locus_tag LOCUS_13580 gene xerC 1430 537 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_13580 1585 2016 gene locus_tag LOCUS_13590 gene mscL 1585 2016 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH4 protein_id gnl|my_center|LOCUS_13590 >Feature sequence430 <1 1519 gene locus_tag LOCUS_13600 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658876.1:peptidylprolyl isomerase <2321 1632 gene locus_tag LOCUS_13610 <2321 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089483.1:2-oxoglutarate ferredoxin oxidoreductase subunit beta >Feature sequence431 1252 1082 gene locus_tag LOCUS_13620 1252 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2017 1364 gene locus_tag LOCUS_13630 2017 1364 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence432 >Feature sequence433 766 101 gene locus_tag LOCUS_13640 766 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1775 900 gene locus_tag LOCUS_13650 1775 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence434 1254 286 gene locus_tag LOCUS_13660 1254 286 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_13660 2145 1366 gene locus_tag LOCUS_13670 2145 1366 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence435 602 517 gene locus_tag LOCUS_t00110 602 517 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 824 1369 gene locus_tag LOCUS_13680 gene msrA 824 1369 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_13680 1489 2088 gene locus_tag LOCUS_13690 1489 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence436 189 1874 gene locus_tag LOCUS_13700 gene msbA 189 1874 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence437 >Feature sequence438 >Feature sequence439 >Feature sequence440 >Feature sequence441 >Feature sequence442 >Feature sequence443 939 142 gene locus_tag LOCUS_13710 gene phuW 939 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_13710 1055 1705 gene locus_tag LOCUS_13720 gene aat 1055 1705 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_13720 >Feature sequence444 >Feature sequence445 1139 603 gene locus_tag LOCUS_13730 1139 603 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_13730 2192 1284 gene locus_tag LOCUS_13740 gene miaA1 2192 1284 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_13740 >Feature sequence446 >Feature sequence447 1443 796 gene locus_tag LOCUS_13750 1443 796 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_13750 1985 1446 gene locus_tag LOCUS_13760 1985 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence448 787 437 gene locus_tag LOCUS_13770 787 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence449 254 1420 gene locus_tag LOCUS_13780 254 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13780 >Feature sequence450 954 805 gene locus_tag LOCUS_13790 954 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1113 979 gene locus_tag LOCUS_13800 1113 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1422 1147 gene locus_tag LOCUS_13810 1422 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence451 >Feature sequence452 >Feature sequence453 <1 1853 gene locus_tag LOCUS_13820 <1 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107847.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence454 452 1102 gene locus_tag LOCUS_13830 452 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1769 1272 gene locus_tag LOCUS_13840 1769 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence455 217 1755 gene locus_tag LOCUS_13850 gene pccB 217 1755 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence456 <1 1767 gene locus_tag LOCUS_13860 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein >Feature sequence457 <1 1479 gene locus_tag LOCUS_13870 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765466.1:signal peptide peptidase SppA <2206 1583 gene locus_tag LOCUS_13880 <2206 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001186481.1:bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase >Feature sequence458 535 1983 gene locus_tag LOCUS_13890 gene fabZ 535 1983 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_13890 >Feature sequence459 <2191 794 gene locus_tag LOCUS_13900 <2191 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q180P3:DNA-directed DNA polymerase >Feature sequence460 >Feature sequence461 <1 1232 gene locus_tag LOCUS_13910 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202675.1:helicase >Feature sequence462 1093 302 gene locus_tag LOCUS_13920 gene folP 1093 302 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_13920 <2173 1166 gene locus_tag LOCUS_13930 <2173 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0P8:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence463 219 1817 gene locus_tag LOCUS_13940 219 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence464 <1 1044 gene locus_tag LOCUS_13950 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963211.1:two-component system response regulator 1056 1664 gene locus_tag LOCUS_13960 1056 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence465 2168 1206 gene locus_tag LOCUS_13970 2168 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence466 >Feature sequence467 >Feature sequence468 <2162 280 gene locus_tag LOCUS_13980 <2162 280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017156.1:DNA helicase >Feature sequence469 123 353 gene locus_tag LOCUS_13990 123 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 466 735 gene locus_tag LOCUS_14000 466 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 859 1164 gene locus_tag LOCUS_14010 859 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1265 1684 gene locus_tag LOCUS_14020 1265 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence470 124 294 gene locus_tag LOCUS_14030 124 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence471 396 70 gene locus_tag LOCUS_14040 396 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14040 634 1044 gene locus_tag LOCUS_14050 634 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2117 1161 gene locus_tag LOCUS_14060 gene oxyR 2117 1161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence472 622 1206 gene locus_tag LOCUS_14070 622 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1301 1375 gene locus_tag LOCUS_t00120 1301 1375 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1315 2013 gene locus_tag LOCUS_14080 1315 2013 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence473 161 721 gene locus_tag LOCUS_14090 gene ppa 161 721 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_14090 >Feature sequence474 163 1569 gene locus_tag LOCUS_14100 163 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence475 >Feature sequence476 >Feature sequence477 <1 1401 gene locus_tag LOCUS_14110 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence478 216 2102 gene locus_tag LOCUS_14120 gene recD 216 2102 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH01 protein_id gnl|my_center|LOCUS_14120 >Feature sequence479 1248 199 gene locus_tag LOCUS_14130 1248 199 CDS product putative adenine-specific methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50290 protein_id gnl|my_center|LOCUS_14130 2095 1259 gene locus_tag LOCUS_14140 2095 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence480 622 1080 gene locus_tag LOCUS_14150 622 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1105 1389 gene locus_tag LOCUS_14160 1105 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1422 1907 gene locus_tag LOCUS_14170 1422 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1940 2086 gene locus_tag LOCUS_14180 1940 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence481 <1 594 gene locus_tag LOCUS_14190 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962537.1:glycosyl transferase 635 1693 gene locus_tag LOCUS_14200 635 1693 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence482 308 646 gene locus_tag LOCUS_14210 308 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 <2125 953 gene locus_tag LOCUS_14220 <2125 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81F73:putative D-serine dehydratase >Feature sequence483 <1 617 gene locus_tag LOCUS_14230 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207550.1:membrane protein 1426 626 gene locus_tag LOCUS_14240 1426 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1507 1914 gene locus_tag LOCUS_14250 gene osmC 1507 1914 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence484 608 192 gene locus_tag LOCUS_14260 608 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14260 1214 723 gene locus_tag LOCUS_14270 1214 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14270 1801 1550 gene locus_tag LOCUS_14280 1801 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1806 2094 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcaattccaatatggtgcgattgagag >Feature sequence485 <1 1810 gene locus_tag LOCUS_14290 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202738.1:phage tail protein >Feature sequence486 <2110 56 gene locus_tag LOCUS_14300 <2110 56 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071882.1:membrane protein >Feature sequence487 475 1296 gene locus_tag LOCUS_14310 475 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence488 1761 172 gene locus_tag LOCUS_14320 gene prfC 1761 172 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_14320 >Feature sequence489 1185 373 gene locus_tag LOCUS_14330 1185 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence490 2028 925 gene locus_tag LOCUS_14340 2028 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence491 186 485 gene locus_tag LOCUS_14350 186 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 512 1327 gene locus_tag LOCUS_14360 512 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence492 1622 618 gene locus_tag LOCUS_14370 1622 618 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence493 1861 1187 gene locus_tag LOCUS_14380 1861 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence494 1001 441 gene locus_tag LOCUS_14390 gene gldD 1001 441 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_14390 1656 1063 gene locus_tag LOCUS_14400 1656 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence495 1 432 gene locus_tag LOCUS_14410 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 712 1638 gene locus_tag LOCUS_14420 712 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence496 753 1208 gene locus_tag LOCUS_14430 753 1208 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence497 784 710 gene locus_tag LOCUS_t00130 784 710 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 926 853 gene locus_tag LOCUS_t00140 926 853 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1072 989 gene locus_tag LOCUS_t00150 1072 989 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1219 1146 gene locus_tag LOCUS_t00160 1219 1146 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2003 1497 gene locus_tag LOCUS_14440 2003 1497 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837045.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence498 408 1199 gene locus_tag LOCUS_14450 408 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 <2060 1191 gene locus_tag LOCUS_14460 <2060 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G3:Holliday junction ATP-dependent DNA helicase RuvB >Feature sequence499 >Feature sequence500 1599 475 gene locus_tag LOCUS_14470 1599 475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence501 1490 1182 gene locus_tag LOCUS_14480 1490 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence502 2 955 gene locus_tag LOCUS_14490 2 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence503 1304 300 gene locus_tag LOCUS_14500 1304 300 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence504 1881 100 gene locus_tag LOCUS_14510 gene asnB-2 1881 100 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence505 1851 1561 gene locus_tag LOCUS_14520 1851 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence506 >Feature sequence507 846 1658 gene locus_tag LOCUS_14530 846 1658 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453500.1 protein_id gnl|my_center|LOCUS_14530 1666 1989 gene locus_tag LOCUS_14540 1666 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence508 952 392 gene locus_tag LOCUS_14550 gene atpH 952 392 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_14550 1492 998 gene locus_tag LOCUS_14560 gene atpF 1492 998 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_14560 1850 1605 gene locus_tag LOCUS_14570 1850 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence509 491 682 gene locus_tag LOCUS_14580 491 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence510 1652 108 gene locus_tag LOCUS_14590 1652 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence511 1181 594 gene locus_tag LOCUS_14600 1181 594 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_14600 1799 1311 gene locus_tag LOCUS_14610 1799 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence512 1201 614 gene locus_tag LOCUS_14620 1201 614 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_14620 1584 1213 gene locus_tag LOCUS_14630 1584 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence513 >Feature sequence514 >Feature sequence515 605 339 gene locus_tag LOCUS_14640 605 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1772 852 gene locus_tag LOCUS_14650 1772 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence516 1089 616 gene locus_tag LOCUS_14660 gene rlmH 1089 616 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_14660 1157 1231 gene locus_tag LOCUS_t00170 1157 1231 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence517 1280 618 gene locus_tag LOCUS_14670 1280 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence518 143 1171 gene locus_tag LOCUS_14680 gene pabC 143 1171 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence519 >Feature sequence520 412 1422 gene locus_tag LOCUS_14690 gene fbp 412 1422 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_14690 >Feature sequence521 1088 1957 gene locus_tag LOCUS_14700 1088 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence522 >Feature sequence523 22 1647 gene locus_tag LOCUS_14710 22 1647 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence524 575 81 gene locus_tag LOCUS_14720 575 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 903 682 gene locus_tag LOCUS_14730 903 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1133 909 gene locus_tag LOCUS_14740 1133 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence525 983 141 gene locus_tag LOCUS_14750 983 141 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_14750 <1946 1038 gene locus_tag LOCUS_14760 <1946 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0P5:primosomal protein N' >Feature sequence526 1334 564 gene locus_tag LOCUS_14770 gene rpoD 1334 564 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence527 1579 617 gene locus_tag LOCUS_14780 1579 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1798 1598 gene locus_tag LOCUS_14790 1798 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence528 <1 552 gene locus_tag LOCUS_14800 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785125.1:phosphohydrolase 1363 665 gene locus_tag LOCUS_14810 1363 665 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_14810 1496 1903 gene locus_tag LOCUS_14820 gene rsfS 1496 1903 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHF3 protein_id gnl|my_center|LOCUS_14820 >Feature sequence529 676 1335 gene locus_tag LOCUS_14830 676 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence530 1449 322 gene locus_tag LOCUS_14840 1449 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence531 1344 130 gene locus_tag LOCUS_14850 gene sucC 1344 130 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_14850 >Feature sequence532 >Feature sequence533 842 90 gene locus_tag LOCUS_14860 842 90 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence534 <1909 1185 gene locus_tag LOCUS_14870 <1909 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:alkaline phosphatase >Feature sequence535 <1 621 gene locus_tag LOCUS_14880 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884008.1:transposase 1039 1359 gene locus_tag LOCUS_14890 1039 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence536 568 56 gene locus_tag LOCUS_14900 568 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 <1905 646 gene locus_tag LOCUS_14910 <1905 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0U1:CTP synthase >Feature sequence537 >Feature sequence538 >Feature sequence539 1255 83 gene locus_tag LOCUS_14920 1255 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence540 >Feature sequence541 >Feature sequence542 >Feature sequence543 <1 850 gene locus_tag LOCUS_14930 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MR6:tyrosine recombinase XerC 1560 889 gene locus_tag LOCUS_14940 1560 889 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187213.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence544 773 1096 gene locus_tag LOCUS_14950 773 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence545 1394 972 gene locus_tag LOCUS_14960 1394 972 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_14960 >Feature sequence546 1050 340 gene locus_tag LOCUS_14970 1050 340 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_14970 1404 1477 gene locus_tag LOCUS_t00180 1404 1477 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence547 91 732 gene locus_tag LOCUS_14980 91 732 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence548 675 31 gene locus_tag LOCUS_14990 gene lspA 675 31 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_14990 >Feature sequence549 <1 1634 gene locus_tag LOCUS_15000 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:type II endonuclease-methyltransferasefusion protein >Feature sequence550 >Feature sequence551 587 871 gene locus_tag LOCUS_15010 587 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 920 1339 gene locus_tag LOCUS_15020 920 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence552 433 891 gene locus_tag LOCUS_15030 433 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence553 104 1330 gene locus_tag LOCUS_15040 104 1330 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766890.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence554 1004 468 gene locus_tag LOCUS_15050 1004 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence555 1169 660 gene locus_tag LOCUS_15060 1169 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1688 1614 gene locus_tag LOCUS_t00190 1688 1614 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence556 >Feature sequence557 1081 1329 gene locus_tag LOCUS_15070 1081 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1310 1633 gene locus_tag LOCUS_15080 1310 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence558 <1841 779 gene locus_tag LOCUS_15090 <1841 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963032.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence559 756 205 gene locus_tag LOCUS_15100 756 205 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_15100 1512 841 gene locus_tag LOCUS_15110 1512 841 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence560 <1 757 gene locus_tag LOCUS_15120 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766931.1:zinc protease 1266 910 gene locus_tag LOCUS_15130 1266 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence561 <1 1743 gene locus_tag LOCUS_15140 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476616.1:type II restriction endonuclease subunit M >Feature sequence562 1392 1033 gene locus_tag LOCUS_15150 gene rbfA 1392 1033 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_15150 >Feature sequence563 495 109 gene locus_tag LOCUS_15160 495 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 861 574 gene locus_tag LOCUS_15170 861 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence564 >Feature sequence565 1328 300 gene locus_tag LOCUS_15180 gene pheS 1328 300 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_15180 >Feature sequence566 217 873 gene locus_tag LOCUS_15190 217 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_15190 <1812 1062 gene locus_tag LOCUS_15200 <1812 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0Z4:30S ribosomal protein S2 >Feature sequence567 >Feature sequence568 375 632 gene locus_tag LOCUS_15210 375 632 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 protein_id gnl|my_center|LOCUS_15210 834 1385 gene locus_tag LOCUS_15220 834 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence569 <1 1351 gene locus_tag LOCUS_15230 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022291.1:asparagine synthetase B >Feature sequence570 <1 1181 gene locus_tag LOCUS_15240 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0U4:adenylosuccinate synthetase 1288 1728 gene locus_tag LOCUS_15250 1288 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence571 1308 88 gene locus_tag LOCUS_15260 1308 88 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence572 1795 983 gene locus_tag LOCUS_15270 1795 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence573 669 1118 gene locus_tag LOCUS_15280 669 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1271 1197 gene locus_tag LOCUS_t00200 1271 1197 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence574 <1793 1246 gene locus_tag LOCUS_15290 <1793 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962928.1:hydrolase Nlp/P60 >Feature sequence575 1737 1000 gene locus_tag LOCUS_15300 1737 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence576 >Feature sequence577 >Feature sequence578 <1 1455 gene locus_tag LOCUS_15310 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter >Feature sequence579 1082 246 gene locus_tag LOCUS_15320 1082 246 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_15320 <1763 1093 gene locus_tag LOCUS_15330 <1763 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963502.1:3-oxoacyl-ACP synthase >Feature sequence580 440 1069 gene locus_tag LOCUS_15340 440 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458823.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence581 1426 98 gene locus_tag LOCUS_15350 1426 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence582 1499 780 gene locus_tag LOCUS_15360 1499 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence583 108 578 gene locus_tag LOCUS_15370 108 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 235 537 gene locus_tag LOCUS_15380 235 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933034.1 protein_id gnl|my_center|LOCUS_15380 539 1303 gene locus_tag LOCUS_15390 gene phnP 539 1303 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence588 <1741 451 gene locus_tag LOCUS_15400 <1741 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963097.1:mechanosensitive ion channel protein MscS >Feature sequence589 >Feature sequence590 105 1037 gene locus_tag LOCUS_15410 gene htpX 105 1037 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64V41 protein_id gnl|my_center|LOCUS_15410 >Feature sequence591 >Feature sequence592 <1723 957 gene locus_tag LOCUS_15420 <1723 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004397257.1:metallopeptidase >Feature sequence593 413 1129 gene locus_tag LOCUS_15430 413 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence594 885 562 gene locus_tag LOCUS_15440 885 562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_15440 1228 872 gene locus_tag LOCUS_15450 1228 872 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence595 408 1511 gene locus_tag LOCUS_15460 408 1511 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence596 56 403 gene locus_tag LOCUS_15470 56 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 559 1344 gene locus_tag LOCUS_15480 559 1344 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence597 >Feature sequence598 >Feature sequence599 <1 708 gene locus_tag LOCUS_15490 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002888535.1:endonuclease >Feature sequence600 >Feature sequence601 1372 866 gene locus_tag LOCUS_15500 gene sixA 1372 866 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121948.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence602 1221 64 gene locus_tag LOCUS_15510 1221 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence603 <1702 852 gene locus_tag LOCUS_15520 <1702 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460406.1:ATPase >Feature sequence604 536 150 gene locus_tag LOCUS_15530 536 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 870 562 gene locus_tag LOCUS_15540 870 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1310 876 gene locus_tag LOCUS_15550 1310 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107464.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence605 55 1281 gene locus_tag LOCUS_15560 55 1281 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence606 294 731 gene locus_tag LOCUS_15570 294 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence607 362 790 gene locus_tag LOCUS_15580 362 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1437 865 gene locus_tag LOCUS_15590 1437 865 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence608 813 1310 gene locus_tag LOCUS_15600 813 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence609 3 689 gene locus_tag LOCUS_15610 gene blaA 3 689 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_15610 1022 816 gene locus_tag LOCUS_15620 1022 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence610 <1 509 gene locus_tag LOCUS_15630 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HFY5:beta-lactamase <1683 722 gene locus_tag LOCUS_15640 <1683 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962697.1:leucine dehydrogenase >Feature sequence611 800 420 gene locus_tag LOCUS_15650 gene rpsM 800 420 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_15650 1200 982 gene locus_tag LOCUS_15660 gene infA 1200 982 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_15660 >Feature sequence612 1 663 gene locus_tag LOCUS_15670 1 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence613 >Feature sequence614 694 17 gene locus_tag LOCUS_15680 694 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1364 732 gene locus_tag LOCUS_15690 gene plsY 1364 732 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG75 protein_id gnl|my_center|LOCUS_15690 >Feature sequence615 >Feature sequence616 >Feature sequence617 1229 501 gene locus_tag LOCUS_15700 1229 501 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence618 278 868 gene locus_tag LOCUS_15710 278 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence619 >Feature sequence620 <1646 268 gene locus_tag LOCUS_15720 <1646 268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962469.1:membrane protein >Feature sequence621 >Feature sequence622 374 1381 gene locus_tag LOCUS_15730 374 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence623 1009 569 gene locus_tag LOCUS_15740 1009 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence624 1418 1119 gene locus_tag LOCUS_15750 gene nuoK2 1418 1119 CDS product NADH-quinone oxidoreductase subunit K 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR4 protein_id gnl|my_center|LOCUS_15750 >Feature sequence625 1335 367 gene locus_tag LOCUS_15760 1335 367 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence626 1468 1076 gene locus_tag LOCUS_15770 1468 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence627 352 867 gene locus_tag LOCUS_15780 352 867 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_15780 1158 1562 gene locus_tag LOCUS_15790 1158 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704036.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence628 340 1113 gene locus_tag LOCUS_15800 340 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1143 1322 gene locus_tag LOCUS_15810 1143 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence629 435 1385 gene locus_tag LOCUS_15820 435 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence630 340 1284 gene locus_tag LOCUS_15830 340 1284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence631 <1 657 gene locus_tag LOCUS_15840 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963819.1:deoxyhypusine synthase >Feature sequence632 233 1420 gene locus_tag LOCUS_15850 233 1420 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence633 >Feature sequence634 >Feature sequence635 2 907 gene locus_tag LOCUS_15860 2 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 910 1221 gene locus_tag LOCUS_15870 910 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence636 238 1521 gene locus_tag LOCUS_15880 gene tyrS 238 1521 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_15880 >Feature sequence637 <1 1167 gene locus_tag LOCUS_15890 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0H8:dihydroorotase >Feature sequence638 >Feature sequence639 <1606 784 gene locus_tag LOCUS_15900 <1606 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT1:peptidylprolyl isomerase >Feature sequence640 >Feature sequence641 532 1287 gene locus_tag LOCUS_15910 532 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence642 <1602 953 gene locus_tag LOCUS_15920 <1602 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A277:DNA gyrase subunit B >Feature sequence643 385 1101 gene locus_tag LOCUS_15930 385 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence644 589 834 gene locus_tag LOCUS_15940 589 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_15940 834 1238 gene locus_tag LOCUS_15950 834 1238 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence645 >Feature sequence646 <1 610 gene locus_tag LOCUS_15960 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964426.1:MFS transporter 729 884 gene locus_tag LOCUS_15970 729 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 991 1500 gene locus_tag LOCUS_15980 991 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence647 <1 924 gene locus_tag LOCUS_15990 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704509.1:membrane protein 937 1257 gene locus_tag LOCUS_16000 937 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence648 1533 1351 gene locus_tag LOCUS_16010 1533 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence649 32 586 gene locus_tag LOCUS_16020 gene tag 32 586 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 protein_id gnl|my_center|LOCUS_16020 <1580 608 gene locus_tag LOCUS_16030 <1580 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence650 >Feature sequence651 234 1430 gene locus_tag LOCUS_16040 234 1430 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence652 70 1062 gene locus_tag LOCUS_16050 gene pmi 70 1062 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_16050 1498 1124 gene locus_tag LOCUS_16060 1498 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence653 <1 894 gene locus_tag LOCUS_16070 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962696.1:ABC transporter >Feature sequence654 223 837 gene locus_tag LOCUS_16080 223 837 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_16080 876 1526 gene locus_tag LOCUS_16090 gene deoC 876 1526 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFM7 protein_id gnl|my_center|LOCUS_16090 >Feature sequence655 >Feature sequence656 >Feature sequence657 <1 852 gene locus_tag LOCUS_16100 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203247.1:nucleotidyltransferase note possible pseudo, frameshifted >Feature sequence658 768 142 gene locus_tag LOCUS_16110 768 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence659 >Feature sequence660 <1 753 gene locus_tag LOCUS_16120 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2A9:glycine--tRNA ligase 756 1079 gene locus_tag LOCUS_16130 756 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence661 >Feature sequence662 907 518 gene locus_tag LOCUS_16140 907 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1318 917 gene locus_tag LOCUS_16150 1318 917 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence663 >Feature sequence664 >Feature sequence665 <1 595 gene locus_tag LOCUS_16160 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108719.1:prolyl tripeptidyl peptidase 1298 654 gene locus_tag LOCUS_16170 1298 654 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence666 >Feature sequence667 >Feature sequence668 1086 535 gene locus_tag LOCUS_16180 1086 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence669 >Feature sequence670 >Feature sequence671 >Feature sequence672 >Feature sequence673 >Feature sequence674 <1 540 gene locus_tag LOCUS_16190 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase >Feature sequence675 1245 316 gene locus_tag LOCUS_16200 1245 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence676 >Feature sequence677 >Feature sequence678 929 1000 gene locus_tag LOCUS_t00210 929 1000 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38