>Feature sequence001 <1 1179 gene locus_tag LOCUS_00010 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000457419.1:sodium-independent anion transporter 1252 2025 gene locus_tag LOCUS_00020 1252 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2165 3709 gene locus_tag LOCUS_00030 2165 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4440 3706 gene locus_tag LOCUS_00040 4440 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5300 4827 gene locus_tag LOCUS_00050 5300 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5501 6124 gene locus_tag LOCUS_00060 5501 6124 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_00060 6221 7477 gene locus_tag LOCUS_00070 gene metK 6221 7477 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_00070 9080 7674 gene locus_tag LOCUS_00080 9080 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10054 9260 gene locus_tag LOCUS_00090 gene fecB 10054 9260 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_00090 11778 10057 gene locus_tag LOCUS_00100 11778 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11895 12383 gene locus_tag LOCUS_00110 gene sixA 11895 12383 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_00110 12672 13232 gene locus_tag LOCUS_00120 12672 13232 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_00120 13253 13729 gene locus_tag LOCUS_00130 13253 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13865 14191 gene locus_tag LOCUS_00140 gene trx 13865 14191 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_00140 14288 14911 gene locus_tag LOCUS_00150 14288 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17631 15034 gene locus_tag LOCUS_00160 gene topA 17631 15034 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_00160 18352 18927 gene locus_tag LOCUS_00170 18352 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19051 20451 gene locus_tag LOCUS_00180 19051 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20531 21052 gene locus_tag LOCUS_00190 20531 21052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_00190 21262 22656 gene locus_tag LOCUS_00200 21262 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_00200 22930 24105 gene locus_tag LOCUS_00210 22930 24105 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 510 46 gene locus_tag LOCUS_00220 510 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 1618 2733 gene locus_tag LOCUS_00230 1618 2733 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_00230 2733 3428 gene locus_tag LOCUS_00240 2733 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 protein_id gnl|my_center|LOCUS_00240 3415 4116 gene locus_tag LOCUS_00250 3415 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_00250 4116 5057 gene locus_tag LOCUS_00260 4116 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096015.1 protein_id gnl|my_center|LOCUS_00260 5067 5738 gene locus_tag LOCUS_00270 5067 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 5826 6857 gene locus_tag LOCUS_00280 5826 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8078 6867 gene locus_tag LOCUS_00290 8078 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 8159 8968 gene locus_tag LOCUS_00300 gene xapG 8159 8968 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_00300 9075 10340 gene locus_tag LOCUS_00310 gene xapH 9075 10340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_00310 10343 11161 gene locus_tag LOCUS_00320 10343 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 11158 12735 gene locus_tag LOCUS_00330 11158 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 12740 14515 gene locus_tag LOCUS_00340 12740 14515 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_00340 14525 15463 gene locus_tag LOCUS_00350 14525 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 15460 16650 gene locus_tag LOCUS_00360 15460 16650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 16687 17217 gene locus_tag LOCUS_00370 16687 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 17214 18386 gene locus_tag LOCUS_00380 17214 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 18477 18986 gene locus_tag LOCUS_00390 18477 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 19031 19558 gene locus_tag LOCUS_00400 19031 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 20152 19628 gene locus_tag LOCUS_00410 20152 19628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 20968 20252 gene locus_tag LOCUS_00420 20968 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 21559 21041 gene locus_tag LOCUS_00430 21559 21041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 22304 21624 gene locus_tag LOCUS_00440 22304 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence003 2139 1780 gene locus_tag LOCUS_00450 2139 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2351 3118 gene locus_tag LOCUS_00460 2351 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 3163 4869 gene locus_tag LOCUS_00470 3163 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5332 5832 gene locus_tag LOCUS_00480 gene folA 5332 5832 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_00480 5858 6415 gene locus_tag LOCUS_00490 5858 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 6421 6792 gene locus_tag LOCUS_00500 6421 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 6792 7892 gene locus_tag LOCUS_00510 6792 7892 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_00510 8069 10105 gene locus_tag LOCUS_00520 8069 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 13934 10572 gene locus_tag LOCUS_00530 13934 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 14169 15053 gene locus_tag LOCUS_00540 14169 15053 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_00540 15146 17101 gene locus_tag LOCUS_00550 15146 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_00550 17500 21258 gene locus_tag LOCUS_00560 17500 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence004 108 821 gene locus_tag LOCUS_00570 108 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 1087 818 gene locus_tag LOCUS_00580 1087 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 992 1837 gene locus_tag LOCUS_00590 992 1837 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_00590 2019 3119 gene locus_tag LOCUS_00600 gene wbpG 2019 3119 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_00600 3116 3733 gene locus_tag LOCUS_00610 gene hisH2 3116 3733 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_00610 3790 4515 gene locus_tag LOCUS_00620 gene hisF2 3790 4515 CDS product putative imidazole glycerol phosphate synthase subunit hisF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72139 protein_id gnl|my_center|LOCUS_00620 5789 4512 gene locus_tag LOCUS_00630 5789 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 6019 8133 gene locus_tag LOCUS_00640 6019 8133 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_00640 8147 10054 gene locus_tag LOCUS_00650 8147 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 10051 11322 gene locus_tag LOCUS_00660 10051 11322 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_00660 11383 12006 gene locus_tag LOCUS_00670 11383 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 12009 12860 gene locus_tag LOCUS_00680 12009 12860 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403379.1 protein_id gnl|my_center|LOCUS_00680 12929 13567 gene locus_tag LOCUS_00690 12929 13567 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_00690 13717 15126 gene locus_tag LOCUS_00700 13717 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15556 16689 gene locus_tag LOCUS_00710 15556 16689 CDS product perosamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_00710 16699 17910 gene locus_tag LOCUS_00720 16699 17910 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_00720 17915 18592 gene locus_tag LOCUS_00730 17915 18592 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_00730 18602 19711 gene locus_tag LOCUS_00740 18602 19711 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence005 7301 3057 gene locus_tag LOCUS_00750 7301 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8669 7497 gene locus_tag LOCUS_00760 8669 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 11759 8904 gene locus_tag LOCUS_00770 11759 8904 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_00770 11961 13109 gene locus_tag LOCUS_00780 11961 13109 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759762.1 protein_id gnl|my_center|LOCUS_00780 17192 13449 gene locus_tag LOCUS_00790 17192 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 17531 19141 gene locus_tag LOCUS_00800 17531 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 >Feature sequence006 <1 876 gene locus_tag LOCUS_00810 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MJE1:GDP-mannose 4,6-dehydratase 863 1852 gene locus_tag LOCUS_00820 863 1852 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_00820 1933 3003 gene locus_tag LOCUS_00830 1933 3003 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039039.1 protein_id gnl|my_center|LOCUS_00830 3003 4265 gene locus_tag LOCUS_00840 3003 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4312 5526 gene locus_tag LOCUS_00850 4312 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 5581 6318 gene locus_tag LOCUS_00860 5581 6318 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_00860 7215 6307 gene locus_tag LOCUS_00870 7215 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8362 7220 gene locus_tag LOCUS_00880 8362 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 9296 8355 gene locus_tag LOCUS_00890 9296 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 10276 9362 gene locus_tag LOCUS_00900 10276 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 11593 10406 gene locus_tag LOCUS_00910 11593 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12576 11761 gene locus_tag LOCUS_00920 gene xapG 12576 11761 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_00920 17572 12614 gene locus_tag LOCUS_00930 17572 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17762 18670 gene locus_tag LOCUS_00940 17762 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence007 <1 5187 gene locus_tag LOCUS_00950 <1 5187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 5746 7791 gene locus_tag LOCUS_00960 gene yyaL 5746 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37512 protein_id gnl|my_center|LOCUS_00960 7847 8821 gene locus_tag LOCUS_00970 gene porP 7847 8821 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_00970 9050 10327 gene locus_tag LOCUS_00980 gene gldK 9050 10327 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_00980 10463 10681 gene locus_tag LOCUS_00990 10463 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 10708 11304 gene locus_tag LOCUS_01000 gene gldL 10708 11304 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_01000 11414 13009 gene locus_tag LOCUS_01010 gene gldM 11414 13009 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_01010 13093 13953 gene locus_tag LOCUS_01020 gene gldN 13093 13953 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence008 332 1603 gene locus_tag LOCUS_01030 332 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3407 2193 gene locus_tag LOCUS_01040 3407 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5802 3370 gene locus_tag LOCUS_01050 5802 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7145 5919 gene locus_tag LOCUS_01060 7145 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 8049 7819 gene locus_tag LOCUS_01070 8049 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 8659 10179 gene locus_tag LOCUS_01080 8659 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 10906 10244 gene locus_tag LOCUS_01090 10906 10244 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890391.1 protein_id gnl|my_center|LOCUS_01090 11590 12135 gene locus_tag LOCUS_01100 11590 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 12179 13108 gene locus_tag LOCUS_01110 12179 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 14118 13105 gene locus_tag LOCUS_01120 14118 13105 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_01120 14335 15261 gene locus_tag LOCUS_01130 14335 15261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_01130 15326 15781 gene locus_tag LOCUS_01140 15326 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 <18468 15945 gene locus_tag LOCUS_01150 <18468 15945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence009 1688 3199 gene locus_tag LOCUS_01160 1688 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4199 3777 gene locus_tag LOCUS_01170 4199 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_01170 4604 4254 gene locus_tag LOCUS_01180 gene ogt2 4604 4254 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_01180 4641 5285 gene locus_tag LOCUS_01190 4641 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5535 8924 gene locus_tag LOCUS_01200 5535 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 9529 8921 gene locus_tag LOCUS_01210 gene pnuT 9529 8921 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_01210 9677 10351 gene locus_tag LOCUS_01220 gene dpnC 9677 10351 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A460 protein_id gnl|my_center|LOCUS_01220 11071 10397 gene locus_tag LOCUS_01230 11071 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 11414 12364 gene locus_tag LOCUS_01240 11414 12364 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003568.1 protein_id gnl|my_center|LOCUS_01240 14699 12663 gene locus_tag LOCUS_01250 14699 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 15345 16631 gene locus_tag LOCUS_01260 15345 16631 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_01260 16716 17414 gene locus_tag LOCUS_01270 16716 17414 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_01270 17515 17832 gene locus_tag LOCUS_01280 17515 17832 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence010 <1 1126 gene locus_tag LOCUS_01290 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338686.1:dihydrolipoamide dehydrogenase 1185 2054 gene locus_tag LOCUS_01300 1185 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_01300 2054 3058 gene locus_tag LOCUS_01310 2054 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_01310 3060 4064 gene locus_tag LOCUS_01320 gene batA 3060 4064 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_01320 4243 6258 gene locus_tag LOCUS_01330 4243 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 6255 6896 gene locus_tag LOCUS_01340 6255 6896 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_01340 9082 6893 gene locus_tag LOCUS_01350 9082 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 9245 9868 gene locus_tag LOCUS_01360 9245 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 9923 11548 gene locus_tag LOCUS_01370 gene abfA2 9923 11548 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287297.1 protein_id gnl|my_center|LOCUS_01370 11592 12842 gene locus_tag LOCUS_01380 11592 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 13553 13041 gene locus_tag LOCUS_01390 13553 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 15165 13627 gene locus_tag LOCUS_01400 15165 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15729 15418 gene locus_tag LOCUS_01410 15729 15418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 16021 15788 gene locus_tag LOCUS_01420 16021 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 <18149 16078 gene locus_tag LOCUS_01430 <18149 16078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CJ99:DNA-directed DNA polymerase >Feature sequence011 1205 207 gene locus_tag LOCUS_01440 1205 207 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531457.1 protein_id gnl|my_center|LOCUS_01440 1235 2398 gene locus_tag LOCUS_01450 1235 2398 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_01450 3127 2399 gene locus_tag LOCUS_01460 gene recO 3127 2399 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A275 protein_id gnl|my_center|LOCUS_01460 3380 5800 gene locus_tag LOCUS_01470 3380 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5806 6147 gene locus_tag LOCUS_01480 5806 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 6375 8285 gene locus_tag LOCUS_01490 6375 8285 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_01490 8330 9076 gene locus_tag LOCUS_01500 8330 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 10267 9416 gene locus_tag LOCUS_01510 10267 9416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_01510 10396 11097 gene locus_tag LOCUS_01520 10396 11097 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_01520 11142 11516 gene locus_tag LOCUS_01530 11142 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11609 13111 gene locus_tag LOCUS_01540 11609 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_01540 13111 13932 gene locus_tag LOCUS_01550 13111 13932 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_01550 14633 16732 gene locus_tag LOCUS_01560 14633 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence012 1358 1083 gene locus_tag LOCUS_01570 gene rpsO 1358 1083 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_01570 1579 2124 gene locus_tag LOCUS_01580 gene rpoE 1579 2124 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224818.1 protein_id gnl|my_center|LOCUS_01580 2196 3065 gene locus_tag LOCUS_01590 2196 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4676 3270 gene locus_tag LOCUS_01600 4676 3270 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_01600 4951 6171 gene locus_tag LOCUS_01610 4951 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_01610 6397 6197 gene locus_tag LOCUS_01620 6397 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6706 7179 gene locus_tag LOCUS_01630 gene coaD 6706 7179 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_01630 7264 11751 gene locus_tag LOCUS_01640 7264 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 12188 11829 gene locus_tag LOCUS_01650 12188 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 13970 12477 gene locus_tag LOCUS_01660 13970 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_01660 14089 15120 gene locus_tag LOCUS_01670 14089 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 15734 15189 gene locus_tag LOCUS_01680 15734 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence013 502 996 gene locus_tag LOCUS_01690 502 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1526 993 gene locus_tag LOCUS_01700 1526 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 2016 2705 gene locus_tag LOCUS_01710 2016 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 3232 12723 gene locus_tag LOCUS_01720 3232 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13989 12793 gene locus_tag LOCUS_01730 13989 12793 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228406.1 protein_id gnl|my_center|LOCUS_01730 14299 15198 gene locus_tag LOCUS_01740 14299 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence014 3001 224 gene locus_tag LOCUS_01750 3001 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3697 3098 gene locus_tag LOCUS_01760 3697 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5395 3788 gene locus_tag LOCUS_01770 5395 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 5648 6199 gene locus_tag LOCUS_01780 5648 6199 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763953.1 protein_id gnl|my_center|LOCUS_01780 6381 7361 gene locus_tag LOCUS_01790 6381 7361 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790969.1 protein_id gnl|my_center|LOCUS_01790 7401 10043 gene locus_tag LOCUS_01800 7401 10043 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_01800 12173 10143 gene locus_tag LOCUS_01810 gene dnaG 12173 10143 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_01810 13444 12293 gene locus_tag LOCUS_01820 13444 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 14269 13445 gene locus_tag LOCUS_01830 14269 13445 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_01830 14510 15202 gene locus_tag LOCUS_01840 14510 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 15292 15915 gene locus_tag LOCUS_01850 15292 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence015 3940 1235 gene locus_tag LOCUS_01860 3940 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5392 4067 gene locus_tag LOCUS_01870 5392 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 5546 6031 gene locus_tag LOCUS_01880 5546 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6351 8498 gene locus_tag LOCUS_01890 6351 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8624 9238 gene locus_tag LOCUS_01900 8624 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9391 9771 gene locus_tag LOCUS_01910 9391 9771 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_01910 10865 9909 gene locus_tag LOCUS_01920 10865 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11049 12152 gene locus_tag LOCUS_01930 gene mnmA 11049 12152 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_01930 12193 12939 gene locus_tag LOCUS_01940 12193 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 12994 14157 gene locus_tag LOCUS_01950 12994 14157 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_01950 15569 14154 gene locus_tag LOCUS_01960 15569 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence016 274 1053 gene locus_tag LOCUS_01970 274 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1815 1237 gene locus_tag LOCUS_01980 gene tpm 1815 1237 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_01980 1969 2685 gene locus_tag LOCUS_01990 gene pdxJ 1969 2685 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_01990 3361 2807 gene locus_tag LOCUS_02000 3361 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926460.1 protein_id gnl|my_center|LOCUS_02000 4425 3358 gene locus_tag LOCUS_02010 4425 3358 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_02010 5914 4520 gene locus_tag LOCUS_02020 gene mnmE 5914 4520 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_02020 5913 7160 gene locus_tag LOCUS_02030 5913 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_02030 7327 7527 gene locus_tag LOCUS_02040 7327 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 9118 8087 gene locus_tag LOCUS_02050 gene pam 9118 8087 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_02050 9211 9786 gene locus_tag LOCUS_02060 9211 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_02060 10391 9783 gene locus_tag LOCUS_02070 gene ribE 10391 9783 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_02070 12006 10705 gene locus_tag LOCUS_02080 12006 10705 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence017 2674 1271 gene locus_tag LOCUS_02090 2674 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 3337 2927 gene locus_tag LOCUS_02100 gene csgF 3337 2927 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_02100 3786 3385 gene locus_tag LOCUS_02110 3786 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 4130 3762 gene locus_tag LOCUS_02120 4130 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4847 4278 gene locus_tag LOCUS_02130 4847 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 5860 5018 gene locus_tag LOCUS_02140 5860 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 6974 6228 gene locus_tag LOCUS_02150 6974 6228 CDS product putative two-component system response regulator, LuxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704442.1 protein_id gnl|my_center|LOCUS_02150 9472 6974 gene locus_tag LOCUS_02160 9472 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 10132 10893 gene locus_tag LOCUS_02170 10132 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 11003 11524 gene locus_tag LOCUS_02180 11003 11524 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_02180 12509 11733 gene locus_tag LOCUS_02190 12509 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 13188 13814 gene locus_tag LOCUS_02200 13188 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence018 4020 1552 gene locus_tag LOCUS_02210 4020 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5090 4122 gene locus_tag LOCUS_02220 5090 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7964 5685 gene locus_tag LOCUS_02230 7964 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 9130 8156 gene locus_tag LOCUS_02240 9130 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13307 9264 gene locus_tag LOCUS_02250 13307 9264 CDS product adenylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257283.1 protein_id gnl|my_center|LOCUS_02250 13358 13846 gene locus_tag LOCUS_02260 13358 13846 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMC6 protein_id gnl|my_center|LOCUS_02260 14874 14038 gene locus_tag LOCUS_02270 14874 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 >Feature sequence019 1425 2303 gene locus_tag LOCUS_02280 1425 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2372 2755 gene locus_tag LOCUS_02290 2372 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2773 3144 gene locus_tag LOCUS_02300 2773 3144 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_02300 3270 3197 gene locus_tag LOCUS_t00010 3270 3197 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3914 3432 gene locus_tag LOCUS_02310 gene cdd 3914 3432 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_02310 4068 5399 gene locus_tag LOCUS_02320 4068 5399 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_02320 6032 6733 gene locus_tag LOCUS_02330 6032 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6819 7901 gene locus_tag LOCUS_02340 gene aroC 6819 7901 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_02340 8220 8492 gene locus_tag LOCUS_02350 8220 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 9905 8769 gene locus_tag LOCUS_02360 gene hppD 9905 8769 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_02360 10443 9910 gene locus_tag LOCUS_02370 10443 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 11093 10440 gene locus_tag LOCUS_02380 gene atoA 11093 10440 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_02380 11852 11142 gene locus_tag LOCUS_02390 gene atoD 11852 11142 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_02390 12030 11956 gene locus_tag LOCUS_t00020 12030 11956 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12121 12047 gene locus_tag LOCUS_t00030 12121 12047 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13284 12229 gene locus_tag LOCUS_02400 gene gpsA 13284 12229 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y4 protein_id gnl|my_center|LOCUS_02400 13435 14442 gene locus_tag LOCUS_02410 13435 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113944.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence020 1281 157 gene locus_tag LOCUS_02420 1281 157 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203059.1 protein_id gnl|my_center|LOCUS_02420 2408 1278 gene locus_tag LOCUS_02430 2408 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3714 2398 gene locus_tag LOCUS_02440 3714 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4940 3702 gene locus_tag LOCUS_02450 4940 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5650 4937 gene locus_tag LOCUS_02460 5650 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_02460 6473 5655 gene locus_tag LOCUS_02470 6473 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7789 6470 gene locus_tag LOCUS_02480 7789 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9116 7815 gene locus_tag LOCUS_02490 gene wbtE 9116 7815 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_02490 10159 9125 gene locus_tag LOCUS_02500 10159 9125 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_02500 10751 10170 gene locus_tag LOCUS_02510 gene wlbB 10751 10170 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807114.1 protein_id gnl|my_center|LOCUS_02510 11887 10748 gene locus_tag LOCUS_02520 gene porR 11887 10748 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_02520 13013 11919 gene locus_tag LOCUS_02530 13013 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13561 13010 gene locus_tag LOCUS_02540 13561 13010 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_02540 <14645 13687 gene locus_tag LOCUS_02550 <14645 13687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965486.1:sialic acid synthase >Feature sequence021 2625 1849 gene locus_tag LOCUS_02560 gene pcbD 2625 1849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_02560 3958 2696 gene locus_tag LOCUS_02570 3958 2696 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_02570 6222 4345 gene locus_tag LOCUS_02580 gene htpG 6222 4345 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_02580 7993 6470 gene locus_tag LOCUS_02590 7993 6470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989605.1 protein_id gnl|my_center|LOCUS_02590 8630 7983 gene locus_tag LOCUS_02600 8630 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 9843 8614 gene locus_tag LOCUS_02610 9843 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 10097 10732 gene locus_tag LOCUS_02620 10097 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 11254 12801 gene locus_tag LOCUS_02630 gene dnaB 11254 12801 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_02630 12850 13935 gene locus_tag LOCUS_02640 12850 13935 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_02640 14188 14421 gene locus_tag LOCUS_02650 14188 14421 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I270 protein_id gnl|my_center|LOCUS_02650 >Feature sequence022 6940 3905 gene locus_tag LOCUS_02660 6940 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7147 8871 gene locus_tag LOCUS_02670 gene egl2 7147 8871 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_02670 9177 10934 gene locus_tag LOCUS_02680 gene atsA 9177 10934 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_02680 11135 12409 gene locus_tag LOCUS_02690 gene ugt 11135 12409 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038941.1 protein_id gnl|my_center|LOCUS_02690 12480 12665 gene locus_tag LOCUS_02700 12480 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14186 12729 gene locus_tag LOCUS_02710 14186 12729 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence023 275 2395 gene locus_tag LOCUS_02720 gene ppk 275 2395 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S51 protein_id gnl|my_center|LOCUS_02720 2507 3061 gene locus_tag LOCUS_02730 2507 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4865 3054 gene locus_tag LOCUS_02740 4865 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_02740 5246 4890 gene locus_tag LOCUS_02750 5246 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5605 6957 gene locus_tag LOCUS_02760 gene bfmBB 5605 6957 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_02760 7663 9840 gene locus_tag LOCUS_02770 7663 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 12209 10704 gene locus_tag LOCUS_02780 gene guaB 12209 10704 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_02780 12314 13621 gene locus_tag LOCUS_02790 12314 13621 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence024 871 161 gene locus_tag LOCUS_02800 871 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1066 2037 gene locus_tag LOCUS_02810 1066 2037 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_02810 2107 3249 gene locus_tag LOCUS_02820 2107 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_02820 4325 3246 gene locus_tag LOCUS_02830 4325 3246 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_02830 5584 4322 gene locus_tag LOCUS_02840 5584 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_02840 6378 5581 gene locus_tag LOCUS_02850 6378 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8321 6375 gene locus_tag LOCUS_02860 8321 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8523 9431 gene locus_tag LOCUS_02870 8523 9431 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_02870 9651 11198 gene locus_tag LOCUS_02880 9651 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_02880 11319 12794 gene locus_tag LOCUS_02890 11319 12794 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_02890 12794 13546 gene locus_tag LOCUS_02900 12794 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 13519 13743 gene locus_tag LOCUS_02910 13519 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence025 <1 4620 gene locus_tag LOCUS_02920 <1 4620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 4678 5619 gene locus_tag LOCUS_02930 gene porP 4678 5619 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_02930 5768 8146 gene locus_tag LOCUS_02940 5768 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8894 8250 gene locus_tag LOCUS_02950 8894 8250 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_02950 9252 9659 gene locus_tag LOCUS_02960 9252 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 10691 9720 gene locus_tag LOCUS_02970 10691 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence026 2165 2590 gene locus_tag LOCUS_02980 2165 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404126.1 protein_id gnl|my_center|LOCUS_02980 2989 3588 gene locus_tag LOCUS_02990 2989 3588 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_02990 3828 4412 gene locus_tag LOCUS_03000 3828 4412 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122143.1 protein_id gnl|my_center|LOCUS_03000 4904 4698 gene locus_tag LOCUS_03010 4904 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5311 5126 gene locus_tag LOCUS_03020 5311 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 5410 5772 gene locus_tag LOCUS_03030 5410 5772 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_03030 5772 7133 gene locus_tag LOCUS_03040 5772 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8333 7194 gene locus_tag LOCUS_03050 8333 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 9754 8495 gene locus_tag LOCUS_03060 9754 8495 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_03060 10168 9830 gene locus_tag LOCUS_03070 gene glnB 10168 9830 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_03070 10574 12112 gene locus_tag LOCUS_03080 10574 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 12452 12180 gene locus_tag LOCUS_03090 12452 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence027 2276 399 gene locus_tag LOCUS_03100 gene lnt 2276 399 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_03100 2436 2720 gene locus_tag LOCUS_03110 2436 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2824 3348 gene locus_tag LOCUS_03120 2824 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3407 4036 gene locus_tag LOCUS_03130 3407 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 7992 4558 gene locus_tag LOCUS_03140 7992 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 9405 8116 gene locus_tag LOCUS_03150 9405 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 11691 9427 gene locus_tag LOCUS_03160 11691 9427 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence028 1482 2204 gene locus_tag LOCUS_03170 1482 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2242 3267 gene locus_tag LOCUS_03180 2242 3267 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_03180 5747 3270 gene locus_tag LOCUS_03190 gene chb 5747 3270 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_03190 7729 6305 gene locus_tag LOCUS_03200 gene aslA 7729 6305 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_03200 9926 8157 gene locus_tag LOCUS_03210 9926 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 10451 9990 gene locus_tag LOCUS_03220 10451 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10861 11541 gene locus_tag LOCUS_03230 10861 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11918 12730 gene locus_tag LOCUS_03240 11918 12730 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence029 279 1544 gene locus_tag LOCUS_03250 279 1544 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_03250 1673 3853 gene locus_tag LOCUS_03260 1673 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5160 3868 gene locus_tag LOCUS_03270 gene folC 5160 3868 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_03270 10818 5224 gene locus_tag LOCUS_03280 10818 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_03280 12740 11187 gene locus_tag LOCUS_03290 12740 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence030 194 1000 gene locus_tag LOCUS_03300 194 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_03300 1157 1918 gene locus_tag LOCUS_03310 gene algR 1157 1918 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_03310 2207 2401 gene locus_tag LOCUS_03320 2207 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2578 4512 gene locus_tag LOCUS_03330 2578 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5668 4799 gene locus_tag LOCUS_03340 5668 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5942 6523 gene locus_tag LOCUS_03350 5942 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6829 7914 gene locus_tag LOCUS_03360 6829 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 8996 7935 gene locus_tag LOCUS_03370 8996 7935 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_03370 9105 10151 gene locus_tag LOCUS_03380 9105 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 <12414 10264 gene locus_tag LOCUS_03390 <12414 10264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P16397:bacillopeptidase F >Feature sequence031 758 1114 gene locus_tag LOCUS_03400 758 1114 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_03400 1277 2179 gene locus_tag LOCUS_03410 1277 2179 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_03410 2222 2788 gene locus_tag LOCUS_03420 2222 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2781 3974 gene locus_tag LOCUS_03430 2781 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4114 5469 gene locus_tag LOCUS_03440 4114 5469 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P22 protein_id gnl|my_center|LOCUS_03440 5561 5773 gene locus_tag LOCUS_03450 5561 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7426 6113 gene locus_tag LOCUS_03460 gene rimO 7426 6113 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_03460 9411 7489 gene locus_tag LOCUS_03470 gene yidC 9411 7489 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_03470 10593 9541 gene locus_tag LOCUS_03480 10593 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 11950 11183 gene locus_tag LOCUS_03490 11950 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence032 1602 301 gene locus_tag LOCUS_03500 1602 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2478 1672 gene locus_tag LOCUS_03510 2478 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 4596 2572 gene locus_tag LOCUS_03520 4596 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4794 5468 gene locus_tag LOCUS_03530 4794 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5806 5940 gene locus_tag LOCUS_03540 5806 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7664 6243 gene locus_tag LOCUS_03550 7664 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 10745 7752 gene locus_tag LOCUS_03560 10745 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125416.1 protein_id gnl|my_center|LOCUS_03560 10832 11293 gene locus_tag LOCUS_03570 10832 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence033 103 1620 gene locus_tag LOCUS_03580 103 1620 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_03580 3907 1670 gene locus_tag LOCUS_03590 gene rnr 3907 1670 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 protein_id gnl|my_center|LOCUS_03590 5343 4300 gene locus_tag LOCUS_03600 gene dinB2 5343 4300 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_03600 5933 5412 gene locus_tag LOCUS_03610 5933 5412 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence034 <1 5138 gene locus_tag LOCUS_03620 <1 5138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin 5209 6207 gene locus_tag LOCUS_03630 gene moaA 5209 6207 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EJ8 protein_id gnl|my_center|LOCUS_03630 6276 6842 gene locus_tag LOCUS_03640 6276 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_03640 6864 8138 gene locus_tag LOCUS_03650 6864 8138 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_03650 9735 8353 gene locus_tag LOCUS_03660 9735 8353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_03660 9811 10557 gene locus_tag LOCUS_03670 9811 10557 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Z3 protein_id gnl|my_center|LOCUS_03670 10623 11186 gene locus_tag LOCUS_03680 10623 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11186 11758 gene locus_tag LOCUS_03690 11186 11758 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence035 1238 615 gene locus_tag LOCUS_03700 gene gpm 1238 615 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_03700 2582 1389 gene locus_tag LOCUS_03710 gene mqnE 2582 1389 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_03710 2781 3647 gene locus_tag LOCUS_03720 2781 3647 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_03720 5782 4016 gene locus_tag LOCUS_03730 5782 4016 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_03730 5965 6696 gene locus_tag LOCUS_03740 5965 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6838 8295 gene locus_tag LOCUS_03750 6838 8295 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_03750 8325 8807 gene locus_tag LOCUS_03760 gene crtZ 8325 8807 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence036 >Feature sequence037 <1 794 gene locus_tag LOCUS_03770 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962627.1:ribonucleoside-diphosphate reductase 1002 3449 gene locus_tag LOCUS_03780 gene nrdA 1002 3449 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_03780 4599 3952 gene locus_tag LOCUS_03790 gene lolD 4599 3952 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_03790 5630 4641 gene locus_tag LOCUS_03800 5630 4641 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339022.1 protein_id gnl|my_center|LOCUS_03800 6904 5639 gene locus_tag LOCUS_03810 6904 5639 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_03810 7238 6951 gene locus_tag LOCUS_03820 7238 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence038 2907 1720 gene locus_tag LOCUS_03830 2907 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4255 3158 gene locus_tag LOCUS_03840 4255 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_03840 5196 4438 gene locus_tag LOCUS_03850 5196 4438 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_03850 5284 6003 gene locus_tag LOCUS_03860 5284 6003 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_03860 6280 6116 gene locus_tag LOCUS_03870 6280 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6350 6481 gene locus_tag LOCUS_03880 6350 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 9631 7004 gene locus_tag LOCUS_03890 9631 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10314 9745 gene locus_tag LOCUS_03900 10314 9745 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930643.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence039 3 662 gene locus_tag LOCUS_03910 3 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 713 2602 gene locus_tag LOCUS_03920 gene ctaD 713 2602 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_03920 2755 3594 gene locus_tag LOCUS_03930 gene ctaB 2755 3594 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_03930 3597 4187 gene locus_tag LOCUS_03940 gene coxO 3597 4187 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969992.1 protein_id gnl|my_center|LOCUS_03940 4284 5276 gene locus_tag LOCUS_03950 4284 5276 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_03950 5322 5744 gene locus_tag LOCUS_03960 5322 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5854 6495 gene locus_tag LOCUS_03970 5854 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6505 7065 gene locus_tag LOCUS_03980 gene yozB 6505 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_03980 7113 7415 gene locus_tag LOCUS_03990 7113 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8932 7601 gene locus_tag LOCUS_04000 8932 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10398 8968 gene locus_tag LOCUS_04010 10398 8968 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_04010 <11900 10557 gene locus_tag LOCUS_04020 <11900 10557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence040 865 155 gene locus_tag LOCUS_04030 865 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2820 979 gene locus_tag LOCUS_04040 gene glmS 2820 979 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_04040 4319 2961 gene locus_tag LOCUS_04050 4319 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5317 4478 gene locus_tag LOCUS_04060 5317 4478 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_04060 5830 7626 gene locus_tag LOCUS_04070 5830 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8841 8041 gene locus_tag LOCUS_04080 gene murI 8841 8041 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748S8 protein_id gnl|my_center|LOCUS_04080 9595 9089 gene locus_tag LOCUS_04090 9595 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 10255 9728 gene locus_tag LOCUS_04100 10255 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence041 483 1595 gene locus_tag LOCUS_04110 gene recF 483 1595 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_04110 2627 1962 gene locus_tag LOCUS_04120 2627 1962 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_04120 3698 2628 gene locus_tag LOCUS_04130 3698 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4521 3892 gene locus_tag LOCUS_04140 4521 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4914 4528 gene locus_tag LOCUS_04150 4914 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6968 5058 gene locus_tag LOCUS_04160 6968 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7225 8487 gene locus_tag LOCUS_04170 7225 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8710 9453 gene locus_tag LOCUS_04180 8710 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 9450 10346 gene locus_tag LOCUS_04190 9450 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence042 130 1377 gene locus_tag LOCUS_04200 130 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2668 1433 gene locus_tag LOCUS_04210 2668 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3532 6561 gene locus_tag LOCUS_04220 3532 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_04220 6690 7520 gene locus_tag LOCUS_04230 6690 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7598 8995 gene locus_tag LOCUS_04240 7598 8995 CDS product putative FAD-dependent pyridine nucleotide-disulphide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700707.1 protein_id gnl|my_center|LOCUS_04240 10579 9500 gene locus_tag LOCUS_04250 10579 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_04250 11261 10611 gene locus_tag LOCUS_04260 11261 10611 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence043 913 242 gene locus_tag LOCUS_04270 913 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1852 944 gene locus_tag LOCUS_04280 1852 944 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_04280 2123 3262 gene locus_tag LOCUS_04290 2123 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3360 5012 gene locus_tag LOCUS_04300 3360 5012 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_04300 5490 5119 gene locus_tag LOCUS_04310 5490 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5675 6163 gene locus_tag LOCUS_04320 5675 6163 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119906.1 protein_id gnl|my_center|LOCUS_04320 6243 7586 gene locus_tag LOCUS_04330 6243 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_04330 7600 8730 gene locus_tag LOCUS_04340 7600 8730 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_04340 9821 8883 gene locus_tag LOCUS_04350 9821 8883 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_04350 10355 11260 gene locus_tag LOCUS_04360 10355 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence044 2679 1627 gene locus_tag LOCUS_04370 2679 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3252 2746 gene locus_tag LOCUS_04380 3252 2746 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697198.1 protein_id gnl|my_center|LOCUS_04380 4026 3649 gene locus_tag LOCUS_04390 4026 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 6900 4150 gene locus_tag LOCUS_04400 6900 4150 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121470.1 protein_id gnl|my_center|LOCUS_04400 7064 9457 gene locus_tag LOCUS_04410 7064 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9852 10553 gene locus_tag LOCUS_04420 9852 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence045 1771 299 gene locus_tag LOCUS_04430 1771 299 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_04430 2860 1994 gene locus_tag LOCUS_04440 2860 1994 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_04440 3169 3096 gene locus_tag LOCUS_t00040 3169 3096 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3597 4079 gene locus_tag LOCUS_04450 3597 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 4289 4486 gene locus_tag LOCUS_04460 4289 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 4963 4379 gene locus_tag LOCUS_04470 4963 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 5818 5009 gene locus_tag LOCUS_04480 gene dapF 5818 5009 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_04480 6241 6020 gene locus_tag LOCUS_04490 6241 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 6373 7830 gene locus_tag LOCUS_04500 6373 7830 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_04500 8674 8213 gene locus_tag LOCUS_04510 8674 8213 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_04510 9711 8746 gene locus_tag LOCUS_04520 gene etfA 9711 8746 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_04520 10507 9767 gene locus_tag LOCUS_04530 gene etfB 10507 9767 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence046 3 962 gene locus_tag LOCUS_04540 3 962 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_04540 5531 1371 gene locus_tag LOCUS_04550 5531 1371 CDS product SWF/SNF family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_04550 5946 5764 gene locus_tag LOCUS_04560 5946 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7303 6023 gene locus_tag LOCUS_04570 gene rocD 7303 6023 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_04570 8391 7381 gene locus_tag LOCUS_04580 gene murB 8391 7381 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_04580 10773 8794 gene locus_tag LOCUS_04590 10773 8794 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence047 1540 980 gene locus_tag LOCUS_04600 1540 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1653 2516 gene locus_tag LOCUS_04610 1653 2516 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_04610 5312 2886 gene locus_tag LOCUS_04620 5312 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5420 6760 gene locus_tag LOCUS_04630 5420 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_04630 6927 7415 gene locus_tag LOCUS_04640 6927 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 7531 7331 gene locus_tag LOCUS_04650 7531 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8154 7705 gene locus_tag LOCUS_04660 8154 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 8348 9421 gene locus_tag LOCUS_04670 gene ilvK 8348 9421 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_04670 9452 9838 gene locus_tag LOCUS_04680 9452 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_04680 10601 9867 gene locus_tag LOCUS_04690 10601 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 <11107 10603 gene locus_tag LOCUS_04700 <11107 10603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943545.1:two-component sensor histidine kinase >Feature sequence048 <1 1399 gene locus_tag LOCUS_04710 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962640.1:GTP-binding protein 1483 3720 gene locus_tag LOCUS_04720 1483 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4694 3906 gene locus_tag LOCUS_04730 4694 3906 CDS product GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 protein_id gnl|my_center|LOCUS_04730 5250 4777 gene locus_tag LOCUS_04740 gene lrp 5250 4777 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45265 protein_id gnl|my_center|LOCUS_04740 5751 7496 gene locus_tag LOCUS_04750 5751 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 8032 7502 gene locus_tag LOCUS_04760 8032 7502 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_04760 8263 8805 gene locus_tag LOCUS_04770 8263 8805 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_04770 8807 9415 gene locus_tag LOCUS_04780 8807 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 9428 10339 gene locus_tag LOCUS_04790 9428 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence049 <1 512 gene locus_tag LOCUS_04800 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124996.1:6-phosphogluconolactonase 522 1160 gene locus_tag LOCUS_04810 522 1160 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_04810 1177 1722 gene locus_tag LOCUS_04820 1177 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1760 2356 gene locus_tag LOCUS_04830 gene cysC 1760 2356 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VR1 protein_id gnl|my_center|LOCUS_04830 2360 3265 gene locus_tag LOCUS_04840 gene cysD 2360 3265 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_04840 3285 3860 gene locus_tag LOCUS_04850 3285 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_04850 3866 5128 gene locus_tag LOCUS_04860 gene cysN 3866 5128 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_04860 5180 6070 gene locus_tag LOCUS_04870 gene fcl 5180 6070 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_04870 6317 7333 gene locus_tag LOCUS_04880 gene manC 6317 7333 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_04880 7598 8080 gene locus_tag LOCUS_04890 7598 8080 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_04890 8274 8086 gene locus_tag LOCUS_04900 8274 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8780 8442 gene locus_tag LOCUS_04910 gene yhjQ 8780 8442 CDS product putative cysteine-rich protein YhjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07571 protein_id gnl|my_center|LOCUS_04910 9455 8907 gene locus_tag LOCUS_04920 9455 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 <10989 9478 gene locus_tag LOCUS_04930 <10989 9478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:cation transporter >Feature sequence050 419 1813 gene locus_tag LOCUS_04940 gene ffh 419 1813 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_04940 1993 2205 gene locus_tag LOCUS_04950 1993 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2372 3238 gene locus_tag LOCUS_04960 2372 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3497 4486 gene locus_tag LOCUS_04970 3497 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4471 6822 gene locus_tag LOCUS_04980 4471 6822 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_04980 8409 7354 gene locus_tag LOCUS_04990 8409 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 8563 9363 gene locus_tag LOCUS_05000 8563 9363 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_05000 9360 9533 gene locus_tag LOCUS_05010 9360 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 <10789 9761 gene locus_tag LOCUS_05020 <10789 9761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8I4:dihydroorotase >Feature sequence051 <1 1792 gene locus_tag LOCUS_05030 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 1872 2771 gene locus_tag LOCUS_05040 1872 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2803 3084 gene locus_tag LOCUS_05050 2803 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3129 3950 gene locus_tag LOCUS_05060 gene pyrF 3129 3950 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_05060 4783 3989 gene locus_tag LOCUS_05070 4783 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5122 4901 gene locus_tag LOCUS_05080 5122 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_05080 6567 5449 gene locus_tag LOCUS_05090 6567 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7473 6676 gene locus_tag LOCUS_05100 7473 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7552 8541 gene locus_tag LOCUS_05110 gene rfaF 7552 8541 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_05110 8821 9816 gene locus_tag LOCUS_05120 8821 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence052 1711 875 gene locus_tag LOCUS_05130 1711 875 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_05130 2639 1704 gene locus_tag LOCUS_05140 2639 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2766 3536 gene locus_tag LOCUS_05150 2766 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4118 3615 gene locus_tag LOCUS_05160 4118 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4931 4170 gene locus_tag LOCUS_05170 4931 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_05170 5230 8913 gene locus_tag LOCUS_05180 5230 8913 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_05180 9028 9378 gene locus_tag LOCUS_05190 9028 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_05190 9579 10352 gene locus_tag LOCUS_05200 9579 10352 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence053 <1 681 gene locus_tag LOCUS_05210 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7S8:glutaminase 727 1473 gene locus_tag LOCUS_05220 727 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2451 1510 gene locus_tag LOCUS_05230 2451 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_05230 2644 4617 gene locus_tag LOCUS_05240 2644 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 4660 5439 gene locus_tag LOCUS_05250 4660 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946941.1 protein_id gnl|my_center|LOCUS_05250 5532 6473 gene locus_tag LOCUS_05260 5532 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6548 9046 gene locus_tag LOCUS_05270 6548 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9074 9604 gene locus_tag LOCUS_05280 gene aroK 9074 9604 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZU2 protein_id gnl|my_center|LOCUS_05280 10257 9607 gene locus_tag LOCUS_05290 10257 9607 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence054 635 1501 gene locus_tag LOCUS_05300 gene gluQ 635 1501 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BE3 protein_id gnl|my_center|LOCUS_05300 4588 1508 gene locus_tag LOCUS_05310 4588 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5608 4772 gene locus_tag LOCUS_05320 5608 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6395 5640 gene locus_tag LOCUS_05330 gene tpiA 6395 5640 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_05330 7867 6770 gene locus_tag LOCUS_05340 gene bioB 7867 6770 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_05340 8506 10356 gene locus_tag LOCUS_05350 8506 10356 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence055 1330 329 gene locus_tag LOCUS_05360 gene trpS 1330 329 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43835 protein_id gnl|my_center|LOCUS_05360 2235 1855 gene locus_tag LOCUS_05370 gene yjgF 2235 1855 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_05370 3099 2245 gene locus_tag LOCUS_05380 3099 2245 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_05380 3449 6616 gene locus_tag LOCUS_05390 3449 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6746 8497 gene locus_tag LOCUS_05400 6746 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8561 9694 gene locus_tag LOCUS_05410 8561 9694 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_05410 >Feature sequence056 2808 3530 gene locus_tag LOCUS_05420 2808 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3918 4943 gene locus_tag LOCUS_05430 gene splB 3918 4943 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435960.1 protein_id gnl|my_center|LOCUS_05430 6877 4940 gene locus_tag LOCUS_05440 6877 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_05440 7857 6958 gene locus_tag LOCUS_05450 gene mvaK 7857 6958 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_05450 7972 8847 gene locus_tag LOCUS_05460 7972 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9043 9702 gene locus_tag LOCUS_05470 9043 9702 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence057 <1 2940 gene locus_tag LOCUS_05480 <1 2940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 3052 4245 gene locus_tag LOCUS_05490 gene porV 3052 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_05490 4758 4444 gene locus_tag LOCUS_05500 gene arsR 4758 4444 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081429.1 protein_id gnl|my_center|LOCUS_05500 5515 5177 gene locus_tag LOCUS_05510 5515 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6396 5710 gene locus_tag LOCUS_05520 6396 5710 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_05520 6754 8256 gene locus_tag LOCUS_05530 gene crtI 6754 8256 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_05530 8240 9076 gene locus_tag LOCUS_05540 gene crtB 8240 9076 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_05540 9073 9744 gene locus_tag LOCUS_05550 9073 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence058 <1 5306 gene locus_tag LOCUS_05560 <1 5306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein 5694 6563 gene locus_tag LOCUS_05570 5694 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6740 7159 gene locus_tag LOCUS_05580 6740 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 7422 7228 gene locus_tag LOCUS_05590 7422 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7997 7464 gene locus_tag LOCUS_05600 7997 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8974 8210 gene locus_tag LOCUS_05610 gene lptB 8974 8210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence059 859 3390 gene locus_tag LOCUS_05620 859 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3733 3497 gene locus_tag LOCUS_05630 3733 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3868 5073 gene locus_tag LOCUS_05640 3868 5073 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_05640 7467 5197 gene locus_tag LOCUS_05650 7467 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 9517 7904 gene locus_tag LOCUS_05660 9517 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence060 3 356 gene locus_tag LOCUS_05670 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 933 4730 gene locus_tag LOCUS_05680 933 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5183 9004 gene locus_tag LOCUS_05690 5183 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence061 23 1363 gene locus_tag LOCUS_05700 23 1363 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S152 protein_id gnl|my_center|LOCUS_05700 1452 1814 gene locus_tag LOCUS_05710 1452 1814 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_05710 3454 1943 gene locus_tag LOCUS_05720 3454 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3866 4915 gene locus_tag LOCUS_05730 gene fjo29 3866 4915 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_05730 6223 4889 gene locus_tag LOCUS_05740 gene murF 6223 4889 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_05740 7821 6322 gene locus_tag LOCUS_05750 gene gldJ 7821 6322 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_05750 9023 7986 gene locus_tag LOCUS_05760 9023 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence062 2557 254 gene locus_tag LOCUS_05770 2557 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2922 2698 gene locus_tag LOCUS_05780 2922 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5581 3158 gene locus_tag LOCUS_05790 5581 3158 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_05790 5871 7046 gene locus_tag LOCUS_05800 5871 7046 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_05800 7504 9603 gene locus_tag LOCUS_05810 7504 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence063 1963 1409 gene locus_tag LOCUS_05820 1963 1409 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_05820 2505 1966 gene locus_tag LOCUS_05830 gene rimM 2505 1966 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A682 protein_id gnl|my_center|LOCUS_05830 2552 2752 gene locus_tag LOCUS_05840 2552 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4463 3177 gene locus_tag LOCUS_05850 4463 3177 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_05850 5936 4512 gene locus_tag LOCUS_05860 gene miaB 5936 4512 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_05860 7011 6256 gene locus_tag LOCUS_05870 7011 6256 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_05870 7334 8476 gene locus_tag LOCUS_05880 7334 8476 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_05880 8469 9557 gene locus_tag LOCUS_05890 8469 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence064 1333 260 gene locus_tag LOCUS_05900 1333 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_05900 2305 1427 gene locus_tag LOCUS_05910 gene folP 2305 1427 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_05910 4932 2407 gene locus_tag LOCUS_05920 4932 2407 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_05920 6040 5282 gene locus_tag LOCUS_05930 6040 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6546 6040 gene locus_tag LOCUS_05940 6546 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6704 7540 gene locus_tag LOCUS_05950 6704 7540 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_05950 7924 7550 gene locus_tag LOCUS_05960 gene gldC 7924 7550 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_05960 8630 7929 gene locus_tag LOCUS_05970 8630 7929 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_05970 <9734 8630 gene locus_tag LOCUS_05980 <9734 8630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PZ0:zinc metalloprotease >Feature sequence065 1324 8 gene locus_tag LOCUS_05990 1324 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2255 1308 gene locus_tag LOCUS_06000 2255 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_06000 2166 2393 gene locus_tag LOCUS_06010 2166 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3019 2642 gene locus_tag LOCUS_06020 gene crcB 3019 2642 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_06020 4082 3009 gene locus_tag LOCUS_06030 4082 3009 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_06030 4364 6808 gene locus_tag LOCUS_06040 gene pheT 4364 6808 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_06040 6844 7146 gene locus_tag LOCUS_06050 6844 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 7195 7491 gene locus_tag LOCUS_06060 7195 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7649 9328 gene locus_tag LOCUS_06070 gene rny 7649 9328 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_06070 >Feature sequence066 56 1702 gene locus_tag LOCUS_06080 gene pyrG 56 1702 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_06080 1887 2891 gene locus_tag LOCUS_06090 1887 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5959 2894 gene locus_tag LOCUS_06100 gene acrB5 5959 2894 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_06100 7060 5999 gene locus_tag LOCUS_06110 7060 5999 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_06110 8389 7067 gene locus_tag LOCUS_06120 8389 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 8576 9265 gene locus_tag LOCUS_06130 gene ung 8576 9265 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_06130 >Feature sequence067 1399 764 gene locus_tag LOCUS_06140 1399 764 CDS product nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 protein_id gnl|my_center|LOCUS_06140 2170 1628 gene locus_tag LOCUS_06150 2170 1628 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379366.1 protein_id gnl|my_center|LOCUS_06150 2816 2265 gene locus_tag LOCUS_06160 2816 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 4157 2895 gene locus_tag LOCUS_06170 gene pyrC 4157 2895 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_06170 4448 5515 gene locus_tag LOCUS_06180 4448 5515 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_06180 6518 5667 gene locus_tag LOCUS_06190 6518 5667 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875617.1 protein_id gnl|my_center|LOCUS_06190 7753 6581 gene locus_tag LOCUS_06200 7753 6581 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0T6 protein_id gnl|my_center|LOCUS_06200 8601 7750 gene locus_tag LOCUS_06210 8601 7750 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_06210 8966 8748 gene locus_tag LOCUS_06220 8966 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence068 2289 451 gene locus_tag LOCUS_06230 2289 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_06230 2380 3081 gene locus_tag LOCUS_06240 2380 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 3081 4637 gene locus_tag LOCUS_06250 3081 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06250 6021 4954 gene locus_tag LOCUS_06260 gene lpxK 6021 4954 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN6 protein_id gnl|my_center|LOCUS_06260 6912 6052 gene locus_tag LOCUS_06270 gene yqkF 6912 6052 CDS product putative oxidoreductase YqkF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54569 protein_id gnl|my_center|LOCUS_06270 7984 6959 gene locus_tag LOCUS_06280 gene hldD 7984 6959 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_06280 8009 9130 gene locus_tag LOCUS_06290 8009 9130 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence069 933 1790 gene locus_tag LOCUS_06300 933 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2648 1920 gene locus_tag LOCUS_06310 2648 1920 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74SR9 protein_id gnl|my_center|LOCUS_06310 3647 2688 gene locus_tag LOCUS_06320 3647 2688 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_06320 3789 5465 gene locus_tag LOCUS_06330 gene glpD 3789 5465 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18158 protein_id gnl|my_center|LOCUS_06330 5468 5911 gene locus_tag LOCUS_06340 5468 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7145 6180 gene locus_tag LOCUS_06350 7145 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7836 7264 gene locus_tag LOCUS_06360 7836 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7924 8757 gene locus_tag LOCUS_06370 7924 8757 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_06370 9579 8815 gene locus_tag LOCUS_06380 9579 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence070 445 2 gene locus_tag LOCUS_06390 445 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2242 494 gene locus_tag LOCUS_06400 2242 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2454 3530 gene locus_tag LOCUS_06410 2454 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_06410 4311 3802 gene locus_tag LOCUS_06420 4311 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5359 4373 gene locus_tag LOCUS_06430 5359 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_06430 5424 6749 gene locus_tag LOCUS_06440 5424 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7462 6764 gene locus_tag LOCUS_06450 7462 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8209 7487 gene locus_tag LOCUS_06460 8209 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_06460 <9660 8788 gene locus_tag LOCUS_06470 <9660 8788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886845.1:copper-translocating P-type ATPase >Feature sequence071 >Feature sequence072 >Feature sequence073 1699 758 gene locus_tag LOCUS_06480 1699 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2323 1901 gene locus_tag LOCUS_06490 2323 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 2449 3171 gene locus_tag LOCUS_06500 2449 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3198 4532 gene locus_tag LOCUS_06510 3198 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4714 5418 gene locus_tag LOCUS_06520 4714 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7378 5666 gene locus_tag LOCUS_06530 7378 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7922 7368 gene locus_tag LOCUS_06540 7922 7368 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence074 1010 219 gene locus_tag LOCUS_06550 1010 219 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06550 1923 1060 gene locus_tag LOCUS_06560 1923 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3894 1960 gene locus_tag LOCUS_06570 3894 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4771 4253 gene locus_tag LOCUS_06580 4771 4253 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_06580 5189 5695 gene locus_tag LOCUS_06590 5189 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6526 5744 gene locus_tag LOCUS_06600 6526 5744 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_06600 7277 6531 gene locus_tag LOCUS_06610 7277 6531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764108.1 protein_id gnl|my_center|LOCUS_06610 8453 7692 gene locus_tag LOCUS_06620 gene sdhB 8453 7692 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_06620 <9402 8526 gene locus_tag LOCUS_06630 <9402 8526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence075 276 1076 gene locus_tag LOCUS_06640 276 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1281 1829 gene locus_tag LOCUS_06650 1281 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3164 1893 gene locus_tag LOCUS_06660 3164 1893 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_06660 3325 4374 gene locus_tag LOCUS_06670 3325 4374 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_06670 4371 4784 gene locus_tag LOCUS_06680 gene osmC 4371 4784 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_06680 4781 6037 gene locus_tag LOCUS_06690 gene aroA 4781 6037 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_06690 6167 6838 gene locus_tag LOCUS_06700 6167 6838 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence076 4338 3490 gene locus_tag LOCUS_06710 4338 3490 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_06710 6492 4855 gene locus_tag LOCUS_06720 6492 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7102 6659 gene locus_tag LOCUS_06730 7102 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7728 7102 gene locus_tag LOCUS_06740 7728 7102 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_06740 8537 7887 gene locus_tag LOCUS_06750 8537 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8690 9232 gene locus_tag LOCUS_06760 8690 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence077 1582 521 gene locus_tag LOCUS_06770 1582 521 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_06770 1795 2529 gene locus_tag LOCUS_06780 1795 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2743 4398 gene locus_tag LOCUS_06790 2743 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4422 4895 gene locus_tag LOCUS_06800 gene rlmH 4422 4895 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_06800 4929 5570 gene locus_tag LOCUS_06810 4929 5570 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_06810 5574 6347 gene locus_tag LOCUS_06820 5574 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054413.1 protein_id gnl|my_center|LOCUS_06820 7735 6479 gene locus_tag LOCUS_06830 7735 6479 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_06830 8013 9077 gene locus_tag LOCUS_06840 8013 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9109 9285 gene locus_tag LOCUS_06850 9109 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence078 <1 1191 gene locus_tag LOCUS_06860 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA08:DNA helicase 1496 1421 gene locus_tag LOCUS_t00050 1496 1421 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1652 2185 gene locus_tag LOCUS_06870 1652 2185 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_06870 2392 3393 gene locus_tag LOCUS_06880 2392 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3402 5357 gene locus_tag LOCUS_06890 3402 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7111 5522 gene locus_tag LOCUS_06900 7111 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 7738 8475 gene locus_tag LOCUS_06910 7738 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 9165 8563 gene locus_tag LOCUS_06920 9165 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence079 170 2368 gene locus_tag LOCUS_06930 170 2368 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_06930 2507 4117 gene locus_tag LOCUS_06940 2507 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4812 4129 gene locus_tag LOCUS_06950 4812 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5884 4856 gene locus_tag LOCUS_06960 5884 4856 CDS product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_06960 7117 6464 gene locus_tag LOCUS_06970 gene upp 7117 6464 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_06970 7307 8830 gene locus_tag LOCUS_06980 gene cysS 7307 8830 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_06980 >Feature sequence080 778 128 gene locus_tag LOCUS_06990 778 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 869 1402 gene locus_tag LOCUS_07000 869 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2290 1607 gene locus_tag LOCUS_07010 2290 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence081 948 2066 gene locus_tag LOCUS_07020 948 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_07020 2253 3254 gene locus_tag LOCUS_07030 2253 3254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_07030 3374 5608 gene locus_tag LOCUS_07040 3374 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7035 6034 gene locus_tag LOCUS_07050 7035 6034 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_07050 7294 8574 gene locus_tag LOCUS_07060 7294 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8942 8571 gene locus_tag LOCUS_07070 8942 8571 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence082 <1 603 gene locus_tag LOCUS_07080 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878433.1:branched chain amino acid aminotransferase 1336 584 gene locus_tag LOCUS_07090 1336 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_07090 2673 1564 gene locus_tag LOCUS_07100 2673 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_07100 2923 4119 gene locus_tag LOCUS_07110 gene mauG 2923 4119 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_07110 4451 4861 gene locus_tag LOCUS_07120 4451 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_07120 7436 5307 gene locus_tag LOCUS_07130 gene feoB 7436 5307 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_07130 7734 7483 gene locus_tag LOCUS_07140 7734 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence083 1135 2148 gene locus_tag LOCUS_07150 gene gshB 1135 2148 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCV6 protein_id gnl|my_center|LOCUS_07150 2171 3142 gene locus_tag LOCUS_07160 2171 3142 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07160 3238 3645 gene locus_tag LOCUS_07170 3238 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3750 7298 gene locus_tag LOCUS_07180 3750 7298 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_07180 7363 8577 gene locus_tag LOCUS_07190 7363 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence084 82 5 gene locus_tag LOCUS_t00060 82 5 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 249 160 gene locus_tag LOCUS_t00070 249 160 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 482 1390 gene locus_tag LOCUS_07200 482 1390 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120888.1 protein_id gnl|my_center|LOCUS_07200 1692 5081 gene locus_tag LOCUS_07210 1692 5081 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202182.1 protein_id gnl|my_center|LOCUS_07210 5166 5639 gene locus_tag LOCUS_07220 5166 5639 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_07220 5794 6012 gene locus_tag LOCUS_07230 5794 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7478 6375 gene locus_tag LOCUS_07240 7478 6375 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_07240 8156 7530 gene locus_tag LOCUS_07250 gene pyrE 8156 7530 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_07250 8223 8846 gene locus_tag LOCUS_07260 8223 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence085 1988 3814 gene locus_tag LOCUS_07270 gene ogt 1988 3814 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_07270 6598 4187 gene locus_tag LOCUS_07280 6598 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7768 6665 gene locus_tag LOCUS_07290 7768 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8898 7843 gene locus_tag LOCUS_07300 8898 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence086 >Feature sequence087 2317 284 gene locus_tag LOCUS_07310 gene hutU 2317 284 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_07310 3120 2524 gene locus_tag LOCUS_07320 3120 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4482 3151 gene locus_tag LOCUS_07330 4482 3151 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_07330 7737 4501 gene locus_tag LOCUS_07340 7737 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence088 816 1448 gene locus_tag LOCUS_07350 816 1448 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_07350 1459 2784 gene locus_tag LOCUS_07360 1459 2784 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_07360 2933 4090 gene locus_tag LOCUS_07370 2933 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4142 7642 gene locus_tag LOCUS_07380 4142 7642 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_07380 7792 8124 gene locus_tag LOCUS_07390 7792 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538054.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence089 1919 4438 gene locus_tag LOCUS_07400 1919 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5777 4827 gene locus_tag LOCUS_07410 gene metF 5777 4827 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_07410 5874 6854 gene locus_tag LOCUS_07420 5874 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence090 809 3796 gene locus_tag LOCUS_07430 809 3796 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_07430 3884 5401 gene locus_tag LOCUS_07440 3884 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_07440 5639 7087 gene locus_tag LOCUS_07450 5639 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence091 1268 114 gene locus_tag LOCUS_07460 1268 114 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_07460 2305 1364 gene locus_tag LOCUS_07470 gene era 2305 1364 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_07470 3105 2350 gene locus_tag LOCUS_07480 3105 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_07480 3751 3218 gene locus_tag LOCUS_07490 3751 3218 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_07490 5474 4179 gene locus_tag LOCUS_07500 5474 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8405 5541 gene locus_tag LOCUS_07510 8405 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence092 4960 6249 gene locus_tag LOCUS_07520 4960 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6336 6944 gene locus_tag LOCUS_07530 6336 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 7127 8269 gene locus_tag LOCUS_07540 7127 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964256.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence093 1332 364 gene locus_tag LOCUS_07550 1332 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1465 2838 gene locus_tag LOCUS_07560 1465 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2936 3958 gene locus_tag LOCUS_07570 2936 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_07570 4010 4615 gene locus_tag LOCUS_07580 4010 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5476 4640 gene locus_tag LOCUS_07590 5476 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5497 7758 gene locus_tag LOCUS_07600 5497 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence094 6293 4362 gene locus_tag LOCUS_07610 6293 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 <8390 6619 gene locus_tag LOCUS_07620 <8390 6619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence095 53 1030 gene locus_tag LOCUS_07630 53 1030 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_07630 1125 1772 gene locus_tag LOCUS_07640 1125 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1813 2418 gene locus_tag LOCUS_07650 1813 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2502 3848 gene locus_tag LOCUS_07660 2502 3848 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_07660 6075 4015 gene locus_tag LOCUS_07670 6075 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6654 6136 gene locus_tag LOCUS_07680 6654 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7022 7369 gene locus_tag LOCUS_07690 7022 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence096 1338 382 gene locus_tag LOCUS_07700 1338 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1622 1410 gene locus_tag LOCUS_07710 1622 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1695 2798 gene locus_tag LOCUS_07720 1695 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3393 2875 gene locus_tag LOCUS_07730 3393 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3504 4103 gene locus_tag LOCUS_07740 3504 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4084 4767 gene locus_tag LOCUS_07750 4084 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4828 5757 gene locus_tag LOCUS_07760 4828 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5754 6344 gene locus_tag LOCUS_07770 5754 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6523 6341 gene locus_tag LOCUS_07780 6523 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence097 740 5815 gene locus_tag LOCUS_07790 740 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5873 6928 gene locus_tag LOCUS_07800 5873 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 <8309 7187 gene locus_tag LOCUS_07810 <8309 7187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545272.1:peptide ABC transporter permease >Feature sequence098 2946 706 gene locus_tag LOCUS_07820 2946 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4248 3106 gene locus_tag LOCUS_07830 4248 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4391 5608 gene locus_tag LOCUS_07840 4391 5608 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509587.1 protein_id gnl|my_center|LOCUS_07840 5744 6991 gene locus_tag LOCUS_07850 5744 6991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence099 1331 657 gene locus_tag LOCUS_07860 1331 657 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_07860 1610 2404 gene locus_tag LOCUS_07870 gene thyA 1610 2404 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE7 protein_id gnl|my_center|LOCUS_07870 2415 3113 gene locus_tag LOCUS_07880 gene npdA 2415 3113 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_07880 3110 4231 gene locus_tag LOCUS_07890 gene capI 3110 4231 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_07890 5001 4198 gene locus_tag LOCUS_07900 gene rmlD 5001 4198 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_07900 5759 5187 gene locus_tag LOCUS_07910 gene rmlC 5759 5187 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_07910 5885 6397 gene locus_tag LOCUS_07920 5885 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6492 7949 gene locus_tag LOCUS_07930 6492 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence100 1263 2807 gene locus_tag LOCUS_07940 1263 2807 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_07940 3071 5023 gene locus_tag LOCUS_07950 3071 5023 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_07950 6469 5240 gene locus_tag LOCUS_07960 6469 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence101 667 281 gene locus_tag LOCUS_07970 667 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1336 698 gene locus_tag LOCUS_07980 1336 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07980 1767 1333 gene locus_tag LOCUS_07990 gene aroQ 1767 1333 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_07990 3402 2323 gene locus_tag LOCUS_08000 gene pyrD 3402 2323 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_08000 3415 4149 gene locus_tag LOCUS_08010 gene rsmG 3415 4149 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_08010 4334 4537 gene locus_tag LOCUS_08020 4334 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4594 4737 gene locus_tag LOCUS_08030 4594 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4881 5351 gene locus_tag LOCUS_08040 4881 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5348 7120 gene locus_tag LOCUS_08050 5348 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence102 597 668 gene locus_tag LOCUS_t00080 597 668 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1055 2203 gene locus_tag LOCUS_08060 1055 2203 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_08060 3607 2321 gene locus_tag LOCUS_08070 gene hisD 3607 2321 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE7 protein_id gnl|my_center|LOCUS_08070 4897 4037 gene locus_tag LOCUS_08080 gene hisG 4897 4037 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_08080 5191 5118 gene locus_tag LOCUS_t00090 5191 5118 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6462 5290 gene locus_tag LOCUS_08090 6462 5290 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_08090 6611 7111 gene locus_tag LOCUS_08100 6611 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 <8193 7286 gene locus_tag LOCUS_08110 <8193 7286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202554.1:alkaline phosphatase >Feature sequence103 1784 195 gene locus_tag LOCUS_08120 1784 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1899 3764 gene locus_tag LOCUS_08130 1899 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3815 4363 gene locus_tag LOCUS_08140 3815 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4373 5035 gene locus_tag LOCUS_08150 4373 5035 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_08150 6890 5613 gene locus_tag LOCUS_08160 gene dctD 6890 5613 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence104 899 339 gene locus_tag LOCUS_08170 899 339 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_08170 933 1604 gene locus_tag LOCUS_08180 933 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2965 1601 gene locus_tag LOCUS_08190 2965 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3262 3924 gene locus_tag LOCUS_08200 3262 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4997 3939 gene locus_tag LOCUS_08210 gene porQ 4997 3939 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_08210 5674 5075 gene locus_tag LOCUS_08220 5674 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6801 5767 gene locus_tag LOCUS_08230 6801 5767 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_08230 7538 6870 gene locus_tag LOCUS_08240 gene rsmI 7538 6870 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_08240 <8177 7610 gene locus_tag LOCUS_08250 <8177 7610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963371.1:phosphatidylserine synthase >Feature sequence105 1960 1523 gene locus_tag LOCUS_08260 1960 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2783 2397 gene locus_tag LOCUS_08270 gene apaG 2783 2397 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5R0 protein_id gnl|my_center|LOCUS_08270 3399 2794 gene locus_tag LOCUS_08280 gene gmk 3399 2794 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 protein_id gnl|my_center|LOCUS_08280 4415 3471 gene locus_tag LOCUS_08290 4415 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_08290 4467 5798 gene locus_tag LOCUS_08300 gene rhlE 4467 5798 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_08300 6022 6918 gene locus_tag LOCUS_08310 6022 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6932 7531 gene locus_tag LOCUS_08320 6932 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939177.1 protein_id gnl|my_center|LOCUS_08320 8150 7713 gene locus_tag LOCUS_08330 8150 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence106 1 168 gene locus_tag LOCUS_08340 1 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6165 190 gene locus_tag LOCUS_08350 6165 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7295 6264 gene locus_tag LOCUS_08360 7295 6264 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence107 1804 1088 gene locus_tag LOCUS_08370 1804 1088 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140119.1 protein_id gnl|my_center|LOCUS_08370 1840 2343 gene locus_tag LOCUS_08380 1840 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3517 3050 gene locus_tag LOCUS_08390 3517 3050 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_08390 4132 3572 gene locus_tag LOCUS_08400 4132 3572 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_08400 4675 4193 gene locus_tag LOCUS_08410 4675 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5449 4685 gene locus_tag LOCUS_08420 5449 4685 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_08420 5908 5821 gene locus_tag LOCUS_t00100 5908 5821 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6919 6137 gene locus_tag LOCUS_08430 gene tatD 6919 6137 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence108 2633 1251 gene locus_tag LOCUS_08440 2633 1251 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_08440 4388 2643 gene locus_tag LOCUS_08450 4388 2643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_08450 4598 5278 gene locus_tag LOCUS_08460 4598 5278 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_08460 5815 5300 gene locus_tag LOCUS_08470 5815 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5882 6784 gene locus_tag LOCUS_08480 5882 6784 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_08480 7510 6785 gene locus_tag LOCUS_08490 7510 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence109 790 1092 gene locus_tag LOCUS_08500 790 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3561 1159 gene locus_tag LOCUS_08510 3561 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4609 3620 gene locus_tag LOCUS_08520 4609 3620 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_08520 5738 4635 gene locus_tag LOCUS_08530 5738 4635 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence110 1786 899 gene locus_tag LOCUS_08540 1786 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2903 2049 gene locus_tag LOCUS_08550 2903 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3017 3754 gene locus_tag LOCUS_08560 gene kdsB 3017 3754 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT5 protein_id gnl|my_center|LOCUS_08560 >Feature sequence111 391 212 gene locus_tag LOCUS_08570 391 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 527 1573 gene locus_tag LOCUS_08580 527 1573 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_08580 1730 2488 gene locus_tag LOCUS_08590 1730 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2543 3112 gene locus_tag LOCUS_08600 2543 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3190 3510 gene locus_tag LOCUS_08610 3190 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3600 4844 gene locus_tag LOCUS_08620 3600 4844 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_08620 5037 4825 gene locus_tag LOCUS_08630 5037 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5888 5034 gene locus_tag LOCUS_08640 5888 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6110 7171 gene locus_tag LOCUS_08650 6110 7171 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence112 <1 1381 gene locus_tag LOCUS_08660 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404983.1:Na-K-Cl cotransporter 1422 2153 gene locus_tag LOCUS_08670 1422 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3395 3634 gene locus_tag LOCUS_08680 3395 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5193 3784 gene locus_tag LOCUS_08690 5193 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6954 5368 gene locus_tag LOCUS_08700 6954 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7647 7051 gene locus_tag LOCUS_08710 7647 7051 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700856.1 protein_id gnl|my_center|LOCUS_08710 7967 7671 gene locus_tag LOCUS_08720 7967 7671 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence113 1865 441 gene locus_tag LOCUS_08730 gene putA 1865 441 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_08730 3198 2038 gene locus_tag LOCUS_08740 3198 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3691 3239 gene locus_tag LOCUS_08750 gene ybeY 3691 3239 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M2 protein_id gnl|my_center|LOCUS_08750 3865 5397 gene locus_tag LOCUS_08760 3865 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5394 7487 gene locus_tag LOCUS_08770 5394 7487 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence114 <1 813 gene locus_tag LOCUS_08780 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404286.1:glycerophosphoryl diester phosphodiesterase 810 1178 gene locus_tag LOCUS_08790 810 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963140.1 protein_id gnl|my_center|LOCUS_08790 1282 2214 gene locus_tag LOCUS_08800 1282 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2606 5113 gene locus_tag LOCUS_08810 2606 5113 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107414.1 protein_id gnl|my_center|LOCUS_08810 5253 6290 gene locus_tag LOCUS_08820 5253 6290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_08820 6316 7173 gene locus_tag LOCUS_08830 6316 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence115 692 1960 gene locus_tag LOCUS_08840 692 1960 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_08840 2261 2578 gene locus_tag LOCUS_08850 2261 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3606 2866 gene locus_tag LOCUS_08860 3606 2866 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_08860 3878 4609 gene locus_tag LOCUS_08870 3878 4609 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405430.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence116 7 1548 gene locus_tag LOCUS_08880 gene gltX 7 1548 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_08880 1662 3086 gene locus_tag LOCUS_08890 1662 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3535 4419 gene locus_tag LOCUS_08900 gene nadK 3535 4419 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_08900 4718 5275 gene locus_tag LOCUS_08910 4718 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6850 5291 gene locus_tag LOCUS_08920 6850 5291 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_08920 7055 7531 gene locus_tag LOCUS_08930 7055 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence117 1701 721 gene locus_tag LOCUS_08940 1701 721 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_08940 2326 1754 gene locus_tag LOCUS_08950 2326 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3559 2357 gene locus_tag LOCUS_08960 gene pgk 3559 2357 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_08960 4749 3748 gene locus_tag LOCUS_08970 4749 3748 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_08970 4962 5543 gene locus_tag LOCUS_08980 4962 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6385 5564 gene locus_tag LOCUS_08990 gene yhfR 6385 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4M8 protein_id gnl|my_center|LOCUS_08990 <7792 6544 gene locus_tag LOCUS_09000 <7792 6544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071048.1:gamma-glutamyltransferase >Feature sequence118 2688 1645 gene locus_tag LOCUS_09010 2688 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5326 2861 gene locus_tag LOCUS_09020 5326 2861 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_09020 6166 5489 gene locus_tag LOCUS_09030 6166 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7003 6215 gene locus_tag LOCUS_09040 7003 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7145 7639 gene locus_tag LOCUS_09050 7145 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence119 <1 1440 gene locus_tag LOCUS_09060 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141163.1:dehydrogenase 1449 2423 gene locus_tag LOCUS_09070 1449 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 protein_id gnl|my_center|LOCUS_09070 2908 3729 gene locus_tag LOCUS_09080 2908 3729 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_09080 4018 6693 gene locus_tag LOCUS_09090 4018 6693 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_09090 7002 7676 gene locus_tag LOCUS_09100 7002 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence120 265 606 gene locus_tag LOCUS_09110 265 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 632 877 gene locus_tag LOCUS_09120 632 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 878 1456 gene locus_tag LOCUS_09130 gene kdsC 878 1456 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_09130 1466 2407 gene locus_tag LOCUS_09140 1466 2407 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_09140 3720 2776 gene locus_tag LOCUS_09150 gene purC 3720 2776 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV7 protein_id gnl|my_center|LOCUS_09150 3796 4716 gene locus_tag LOCUS_09160 3796 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5273 4692 gene locus_tag LOCUS_09170 5273 4692 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_09170 5738 5307 gene locus_tag LOCUS_09180 5738 5307 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531881.1 protein_id gnl|my_center|LOCUS_09180 6461 5754 gene locus_tag LOCUS_09190 6461 5754 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_09190 7491 6439 gene locus_tag LOCUS_09200 7491 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence121 3662 18 gene locus_tag LOCUS_09210 3662 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3834 4664 gene locus_tag LOCUS_09220 3834 4664 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_09220 6262 4661 gene locus_tag LOCUS_09230 6262 4661 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 protein_id gnl|my_center|LOCUS_09230 6369 6578 gene locus_tag LOCUS_09240 gene ypzJ 6369 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H447 protein_id gnl|my_center|LOCUS_09240 <7611 6631 gene locus_tag LOCUS_09250 <7611 6631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404789.1:T9SS C-terminal target domain-containing protein >Feature sequence122 4429 1718 gene locus_tag LOCUS_09260 4429 1718 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403368.1 protein_id gnl|my_center|LOCUS_09260 5599 4547 gene locus_tag LOCUS_09270 gene rfbB 5599 4547 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFL8 protein_id gnl|my_center|LOCUS_09270 6889 5879 gene locus_tag LOCUS_09280 6889 5879 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence123 262 888 gene locus_tag LOCUS_09290 262 888 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_09290 977 2203 gene locus_tag LOCUS_09300 977 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2242 3267 gene locus_tag LOCUS_09310 2242 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3264 4442 gene locus_tag LOCUS_09320 3264 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5104 4460 gene locus_tag LOCUS_09330 5104 4460 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09330 5269 5559 gene locus_tag LOCUS_09340 gene gatC 5269 5559 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF4 protein_id gnl|my_center|LOCUS_09340 5616 6359 gene locus_tag LOCUS_09350 5616 6359 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_09350 6725 7276 gene locus_tag LOCUS_09360 6725 7276 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_09360 7539 7273 gene locus_tag LOCUS_09370 7539 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence124 5725 2126 gene locus_tag LOCUS_09380 5725 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence125 <1 1794 gene locus_tag LOCUS_09390 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2618 1800 gene locus_tag LOCUS_09400 2618 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3394 2630 gene locus_tag LOCUS_09410 gene lpxH 3394 2630 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_09410 3927 3412 gene locus_tag LOCUS_09420 gene nbaC 3927 3412 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_09420 4006 4791 gene locus_tag LOCUS_09430 4006 4791 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_09430 4855 7290 gene locus_tag LOCUS_09440 4855 7290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence126 2785 248 gene locus_tag LOCUS_09450 2785 248 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_09450 3874 2882 gene locus_tag LOCUS_09460 3874 2882 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_09460 4163 6100 gene locus_tag LOCUS_09470 4163 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence127 <1 1881 gene locus_tag LOCUS_09480 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931802.1:Fis family transcriptional regulator 2365 2171 gene locus_tag LOCUS_09490 2365 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2699 3667 gene locus_tag LOCUS_09500 2699 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3710 4024 gene locus_tag LOCUS_09510 3710 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4079 4471 gene locus_tag LOCUS_09520 4079 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4650 5042 gene locus_tag LOCUS_09530 4650 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 5054 5593 gene locus_tag LOCUS_09540 5054 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5613 6560 gene locus_tag LOCUS_09550 5613 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence128 882 235 gene locus_tag LOCUS_09560 882 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1293 2246 gene locus_tag LOCUS_09570 gene rsgA 1293 2246 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_09570 2689 2255 gene locus_tag LOCUS_09580 gene moaC 2689 2255 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_09580 4216 3005 gene locus_tag LOCUS_09590 gene moeA 4216 3005 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_09590 5265 4213 gene locus_tag LOCUS_09600 5265 4213 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_09600 5444 6166 gene locus_tag LOCUS_09610 5444 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence129 1862 1395 gene locus_tag LOCUS_09620 1862 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2419 1907 gene locus_tag LOCUS_09630 2419 1907 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202251.1 protein_id gnl|my_center|LOCUS_09630 2995 2492 gene locus_tag LOCUS_09640 2995 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3143 4528 gene locus_tag LOCUS_09650 3143 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4585 5661 gene locus_tag LOCUS_09660 4585 5661 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035292.1 protein_id gnl|my_center|LOCUS_09660 6266 5673 gene locus_tag LOCUS_09670 6266 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6930 6373 gene locus_tag LOCUS_09680 6930 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence130 492 1322 gene locus_tag LOCUS_09690 492 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1858 1337 gene locus_tag LOCUS_09700 1858 1337 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_09700 2669 1851 gene locus_tag LOCUS_09710 2669 1851 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_09710 3716 2685 gene locus_tag LOCUS_09720 gene mreB 3716 2685 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_09720 4318 3902 gene locus_tag LOCUS_09730 4318 3902 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_09730 5513 4512 gene locus_tag LOCUS_09740 5513 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 5683 7185 gene locus_tag LOCUS_09750 5683 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence131 1127 342 gene locus_tag LOCUS_09760 1127 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 1508 1206 gene locus_tag LOCUS_09770 1508 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 2459 2226 gene locus_tag LOCUS_09780 2459 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2367 6893 gene locus_tag LOCUS_09790 2367 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence132 1262 2191 gene locus_tag LOCUS_09800 gene pyrB 1262 2191 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_09800 2511 2188 gene locus_tag LOCUS_09810 2511 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_09810 3684 2563 gene locus_tag LOCUS_09820 3684 2563 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_09820 3833 3761 gene locus_tag LOCUS_t00110 3833 3761 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4006 5721 gene locus_tag LOCUS_09830 4006 5721 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_09830 5837 6403 gene locus_tag LOCUS_09840 5837 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence133 2742 247 gene locus_tag LOCUS_09850 2742 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5332 2939 gene locus_tag LOCUS_09860 5332 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence134 353 1138 gene locus_tag LOCUS_09870 353 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4237 1601 gene locus_tag LOCUS_09880 4237 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4522 5094 gene locus_tag LOCUS_09890 4522 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5091 5945 gene locus_tag LOCUS_09900 5091 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence135 514 858 gene locus_tag LOCUS_09910 514 858 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_09910 1890 1060 gene locus_tag LOCUS_09920 1890 1060 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968957.1 protein_id gnl|my_center|LOCUS_09920 2115 2582 gene locus_tag LOCUS_09930 2115 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2829 3266 gene locus_tag LOCUS_09940 2829 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3428 6145 gene locus_tag LOCUS_09950 3428 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 7110 6238 gene locus_tag LOCUS_09960 gene lipA 7110 6238 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_09960 >Feature sequence136 <1 1038 gene locus_tag LOCUS_09970 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A8:Lon protease 1808 1077 gene locus_tag LOCUS_09980 1808 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2779 2027 gene locus_tag LOCUS_09990 2779 2027 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_09990 4476 2869 gene locus_tag LOCUS_10000 4476 2869 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q3 protein_id gnl|my_center|LOCUS_10000 4625 4969 gene locus_tag LOCUS_10010 4625 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5169 5002 gene locus_tag LOCUS_10020 5169 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 6082 5210 gene locus_tag LOCUS_10030 6082 5210 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_10030 6108 6614 gene locus_tag LOCUS_10040 6108 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence137 <1 595 gene locus_tag LOCUS_10050 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A813:DNA repair protein RecN 677 1480 gene locus_tag LOCUS_10060 677 1480 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_10060 2751 1702 gene locus_tag LOCUS_10070 gene rlmN 2751 1702 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_10070 3032 3751 gene locus_tag LOCUS_10080 gene hisA 3032 3751 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_10080 3986 6880 gene locus_tag LOCUS_10090 3986 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence138 3287 1740 gene locus_tag LOCUS_10100 gene gpmI 3287 1740 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_10100 3510 4535 gene locus_tag LOCUS_10110 3510 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_10110 5646 4963 gene locus_tag LOCUS_10120 gene sigW 5646 4963 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFL5 protein_id gnl|my_center|LOCUS_10120 6925 5801 gene locus_tag LOCUS_10130 6925 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence139 <1 2976 gene locus_tag LOCUS_10140 <1 2976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein 2983 4506 gene locus_tag LOCUS_10150 2983 4506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_10150 5596 4607 gene locus_tag LOCUS_10160 5596 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence140 1549 1878 gene locus_tag LOCUS_10170 1549 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2075 3760 gene locus_tag LOCUS_10180 2075 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_10180 3867 4436 gene locus_tag LOCUS_10190 3867 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4501 6207 gene locus_tag LOCUS_10200 4501 6207 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_10200 <7188 6241 gene locus_tag LOCUS_10210 <7188 6241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108126.1:ketol-acid reductoisomerase >Feature sequence141 149 1060 gene locus_tag LOCUS_10220 149 1060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036079.1 protein_id gnl|my_center|LOCUS_10220 1497 1057 gene locus_tag LOCUS_10230 1497 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3734 2127 gene locus_tag LOCUS_10240 gene dagA 3734 2127 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_10240 3956 4312 gene locus_tag LOCUS_10250 gene rplS 3956 4312 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YW4 protein_id gnl|my_center|LOCUS_10250 >Feature sequence142 1509 3026 gene locus_tag LOCUS_10260 1509 3026 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_10260 3140 4384 gene locus_tag LOCUS_10270 3140 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4448 5356 gene locus_tag LOCUS_10280 4448 5356 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_10280 6660 5554 gene locus_tag LOCUS_10290 6660 5554 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence143 791 1489 gene locus_tag LOCUS_10300 791 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2447 3532 gene locus_tag LOCUS_10310 2447 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_10310 3529 4197 gene locus_tag LOCUS_10320 3529 4197 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_10320 5409 4777 gene locus_tag LOCUS_10330 5409 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6371 5799 gene locus_tag LOCUS_10340 6371 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence144 1869 541 gene locus_tag LOCUS_10350 gene nqrB 1869 541 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_10350 3555 1915 gene locus_tag LOCUS_10360 gene nqrA 3555 1915 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence145 890 1360 gene locus_tag LOCUS_10370 890 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1357 2295 gene locus_tag LOCUS_10380 gene rsmH 1357 2295 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_10380 2576 2857 gene locus_tag LOCUS_10390 2576 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2974 5145 gene locus_tag LOCUS_10400 gene ftsI 2974 5145 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_10400 5322 6776 gene locus_tag LOCUS_10410 gene murE 5322 6776 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A254 protein_id gnl|my_center|LOCUS_10410 >Feature sequence146 1330 488 gene locus_tag LOCUS_10420 1330 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1424 2644 gene locus_tag LOCUS_10430 1424 2644 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_10430 2787 4310 gene locus_tag LOCUS_10440 2787 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4726 6069 gene locus_tag LOCUS_10450 4726 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6601 6149 gene locus_tag LOCUS_10460 6601 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence147 2532 1330 gene locus_tag LOCUS_10470 2532 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3414 2593 gene locus_tag LOCUS_10480 3414 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4997 3504 gene locus_tag LOCUS_10490 4997 3504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_10490 <6942 5271 gene locus_tag LOCUS_10500 <6942 5271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence148 549 905 gene locus_tag LOCUS_10510 549 905 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460856.1 protein_id gnl|my_center|LOCUS_10510 1062 2531 gene locus_tag LOCUS_10520 1062 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2660 3235 gene locus_tag LOCUS_10530 2660 3235 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_10530 3314 4114 gene locus_tag LOCUS_10540 3314 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 4426 5265 gene locus_tag LOCUS_10550 4426 5265 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_10550 5724 5335 gene locus_tag LOCUS_10560 5724 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6659 5853 gene locus_tag LOCUS_10570 6659 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence149 1500 628 gene locus_tag LOCUS_10580 1500 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118539.1 protein_id gnl|my_center|LOCUS_10580 1530 1844 gene locus_tag LOCUS_10590 1530 1844 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389363.1 protein_id gnl|my_center|LOCUS_10590 1979 2143 gene locus_tag LOCUS_10600 1979 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2490 3986 gene locus_tag LOCUS_10610 2490 3986 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_10610 4014 4541 gene locus_tag LOCUS_10620 4014 4541 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence150 681 605 gene locus_tag LOCUS_t00120 681 605 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 854 3457 gene locus_tag LOCUS_10630 854 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3495 4205 gene locus_tag LOCUS_10640 3495 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4978 4226 gene locus_tag LOCUS_10650 gene rnc 4978 4226 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_10650 6429 5212 gene locus_tag LOCUS_10660 6429 5212 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 protein_id gnl|my_center|LOCUS_10660 6803 6561 gene locus_tag LOCUS_10670 gene acpP 6803 6561 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_10670 >Feature sequence151 565 2301 gene locus_tag LOCUS_10680 565 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2838 3467 gene locus_tag LOCUS_10690 2838 3467 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765040.1 protein_id gnl|my_center|LOCUS_10690 4791 3469 gene locus_tag LOCUS_10700 4791 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6268 5075 gene locus_tag LOCUS_10710 6268 5075 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25046 protein_id gnl|my_center|LOCUS_10710 6778 6296 gene locus_tag LOCUS_10720 6778 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence152 1486 3099 gene locus_tag LOCUS_10730 1486 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3151 5079 gene locus_tag LOCUS_10740 3151 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence153 667 350 gene locus_tag LOCUS_10750 667 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2027 927 gene locus_tag LOCUS_10760 2027 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2417 2058 gene locus_tag LOCUS_10770 2417 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5206 2483 gene locus_tag LOCUS_10780 gene valS 5206 2483 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZM4 protein_id gnl|my_center|LOCUS_10780 6679 5399 gene locus_tag LOCUS_10790 6679 5399 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence154 3842 2073 gene locus_tag LOCUS_10800 3842 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3969 6506 gene locus_tag LOCUS_10810 3969 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence155 <1 1295 gene locus_tag LOCUS_10820 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase 3285 1318 gene locus_tag LOCUS_10830 3285 1318 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L7 protein_id gnl|my_center|LOCUS_10830 6074 3657 gene locus_tag LOCUS_10840 gene mur/alr 6074 3657 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence156 <1 1832 gene locus_tag LOCUS_10850 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962750.1:glycosyl transferase family 2 1858 3045 gene locus_tag LOCUS_10860 1858 3045 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_10860 4501 3203 gene locus_tag LOCUS_10870 4501 3203 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_10870 4609 5511 gene locus_tag LOCUS_10880 gene rimK 4609 5511 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_10880 5528 6472 gene locus_tag LOCUS_10890 5528 6472 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence157 2338 299 gene locus_tag LOCUS_10900 2338 299 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_10900 2529 3482 gene locus_tag LOCUS_10910 2529 3482 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_10910 5129 4167 gene locus_tag LOCUS_10920 5129 4167 CDS product putative sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268788.1 protein_id gnl|my_center|LOCUS_10920 5098 5298 gene locus_tag LOCUS_10930 5098 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence158 471 623 gene locus_tag LOCUS_10940 471 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1322 843 gene locus_tag LOCUS_10950 1322 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_10950 1911 1426 gene locus_tag LOCUS_10960 1911 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2032 3246 gene locus_tag LOCUS_10970 2032 3246 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 protein_id gnl|my_center|LOCUS_10970 6560 3486 gene locus_tag LOCUS_10980 6560 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence159 1796 6 gene locus_tag LOCUS_10990 1796 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2131 5058 gene locus_tag LOCUS_11000 2131 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5086 5451 gene locus_tag LOCUS_11010 5086 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6509 5478 gene locus_tag LOCUS_11020 6509 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence160 <1 723 gene locus_tag LOCUS_11030 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7Z6:imidazole glycerol phosphate synthase subunit HisF 1040 4780 gene locus_tag LOCUS_11040 1040 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5884 4796 gene locus_tag LOCUS_11050 5884 4796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_11050 6663 5950 gene locus_tag LOCUS_11060 6663 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence161 1453 506 gene locus_tag LOCUS_11070 1453 506 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_11070 1565 2140 gene locus_tag LOCUS_11080 1565 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2227 3603 gene locus_tag LOCUS_11090 2227 3603 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_11090 3603 4574 gene locus_tag LOCUS_11100 3603 4574 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920217.1 protein_id gnl|my_center|LOCUS_11100 4576 5301 gene locus_tag LOCUS_11110 gene cutC 4576 5301 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF02 protein_id gnl|my_center|LOCUS_11110 6122 5727 gene locus_tag LOCUS_11120 6122 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence162 <1 910 gene locus_tag LOCUS_11130 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962387.1:glycosyl transferase 2460 1636 gene locus_tag LOCUS_11140 2460 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4401 2755 gene locus_tag LOCUS_11150 4401 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4679 5872 gene locus_tag LOCUS_11160 4679 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence163 2 421 gene locus_tag LOCUS_11170 2 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 589 1080 gene locus_tag LOCUS_11180 589 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1120 1614 gene locus_tag LOCUS_11190 1120 1614 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_11190 1640 2446 gene locus_tag LOCUS_11200 1640 2446 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_11200 2810 3760 gene locus_tag LOCUS_11210 2810 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4694 3819 gene locus_tag LOCUS_11220 4694 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5015 4725 gene locus_tag LOCUS_11230 5015 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5064 5360 gene locus_tag LOCUS_11240 5064 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11240 5436 5705 gene locus_tag LOCUS_11250 5436 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11250 >Feature sequence164 656 387 gene locus_tag LOCUS_11260 656 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1054 590 gene locus_tag LOCUS_11270 1054 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1197 1637 gene locus_tag LOCUS_11280 1197 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1796 4411 gene locus_tag LOCUS_11290 1796 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6309 4714 gene locus_tag LOCUS_11300 gene lig2 6309 4714 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence165 2615 369 gene locus_tag LOCUS_11310 gene relA 2615 369 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_11310 2681 3580 gene locus_tag LOCUS_11320 2681 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_11320 3704 3982 gene locus_tag LOCUS_11330 3704 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4014 4415 gene locus_tag LOCUS_11340 4014 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence166 653 1315 gene locus_tag LOCUS_11350 gene tal 653 1315 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R94 protein_id gnl|my_center|LOCUS_11350 1519 2100 gene locus_tag LOCUS_11360 1519 2100 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_11360 2160 3338 gene locus_tag LOCUS_11370 2160 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3374 3631 gene locus_tag LOCUS_11380 3374 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4152 3700 gene locus_tag LOCUS_11390 4152 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4226 4888 gene locus_tag LOCUS_11400 gene miaE 4226 4888 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_11400 6097 5453 gene locus_tag LOCUS_11410 6097 5453 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence167 1321 320 gene locus_tag LOCUS_11420 gene tsaD 1321 320 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_11420 1499 2080 gene locus_tag LOCUS_11430 1499 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2081 2914 gene locus_tag LOCUS_11440 2081 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2974 3555 gene locus_tag LOCUS_11450 2974 3555 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_11450 3803 5506 gene locus_tag LOCUS_11460 3803 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5659 6018 gene locus_tag LOCUS_11470 5659 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence168 2234 3586 gene locus_tag LOCUS_11480 2234 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3676 5538 gene locus_tag LOCUS_11490 3676 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence169 2214 550 gene locus_tag LOCUS_11500 gene glnS 2214 550 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_11500 3079 2324 gene locus_tag LOCUS_11510 3079 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 <6418 3646 gene locus_tag LOCUS_11520 <6418 3646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase >Feature sequence170 <1 1265 gene locus_tag LOCUS_11530 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525086.1:tyrosine kinase BceF 1296 2744 gene locus_tag LOCUS_11540 1296 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2838 4067 gene locus_tag LOCUS_11550 2838 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4477 5856 gene locus_tag LOCUS_11560 4477 5856 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence171 972 424 gene locus_tag LOCUS_11570 972 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1209 1481 gene locus_tag LOCUS_11580 1209 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1547 2239 gene locus_tag LOCUS_11590 1547 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3364 2345 gene locus_tag LOCUS_11600 3364 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4521 3475 gene locus_tag LOCUS_11610 gene fjo30 4521 3475 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_11610 5364 4690 gene locus_tag LOCUS_11620 5364 4690 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070499.1 protein_id gnl|my_center|LOCUS_11620 6347 5514 gene locus_tag LOCUS_11630 6347 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence172 <1 964 gene locus_tag LOCUS_11640 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108889.1:membrane protein 1633 2610 gene locus_tag LOCUS_11650 1633 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3907 2825 gene locus_tag LOCUS_11660 3907 2825 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_11660 4010 5080 gene locus_tag LOCUS_11670 gene fabH2 4010 5080 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_11670 <6401 5463 gene locus_tag LOCUS_11680 <6401 5463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482970.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence173 402 1280 gene locus_tag LOCUS_11690 402 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1300 2256 gene locus_tag LOCUS_11700 1300 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2519 6025 gene locus_tag LOCUS_11710 2519 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 6392 6033 gene locus_tag LOCUS_11720 6392 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence174 1539 226 gene locus_tag LOCUS_11730 gene hemL 1539 226 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VY5 protein_id gnl|my_center|LOCUS_11730 1701 3164 gene locus_tag LOCUS_11740 1701 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3706 3209 gene locus_tag LOCUS_11750 gene pyrR 3706 3209 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39765 protein_id gnl|my_center|LOCUS_11750 3898 3716 gene locus_tag LOCUS_11760 3898 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3889 5250 gene locus_tag LOCUS_11770 3889 5250 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_11770 5622 5879 gene locus_tag LOCUS_11780 5622 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5872 6261 gene locus_tag LOCUS_11790 5872 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence175 5812 5048 gene locus_tag LOCUS_11800 5812 5048 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY72 protein_id gnl|my_center|LOCUS_11800 >Feature sequence176 4109 4627 gene locus_tag LOCUS_11810 4109 4627 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108948.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence177 14 1297 gene locus_tag LOCUS_11820 gene eno2 14 1297 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_11820 1382 1696 gene locus_tag LOCUS_11830 1382 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_11830 1955 2827 gene locus_tag LOCUS_11840 gene sucD 1955 2827 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_11840 3266 3072 gene locus_tag LOCUS_11850 3266 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4802 3321 gene locus_tag LOCUS_11860 gene pykA 4802 3321 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_11860 5681 4959 gene locus_tag LOCUS_11870 5681 4959 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143374.1 protein_id gnl|my_center|LOCUS_11870 <6330 5706 gene locus_tag LOCUS_11880 <6330 5706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957323.1:peptidase S13 >Feature sequence178 3698 681 gene locus_tag LOCUS_11890 3698 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3959 5437 gene locus_tag LOCUS_11900 3959 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5486 6286 gene locus_tag LOCUS_11910 5486 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence179 198 1382 gene locus_tag LOCUS_11920 gene trpB 198 1382 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_11920 1383 3053 gene locus_tag LOCUS_11930 1383 3053 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_11930 3514 3101 gene locus_tag LOCUS_11940 3514 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3873 3586 gene locus_tag LOCUS_11950 3873 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence180 4201 5376 gene locus_tag LOCUS_11960 gene purK 4201 5376 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_11960 5373 5870 gene locus_tag LOCUS_11970 gene purE 5373 5870 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_11970 >Feature sequence181 3436 755 gene locus_tag LOCUS_11980 3436 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4041 3439 gene locus_tag LOCUS_11990 gene purN 4041 3439 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_11990 4575 5690 gene locus_tag LOCUS_12000 4575 5690 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence182 1218 115 gene locus_tag LOCUS_12010 1218 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1552 2073 gene locus_tag LOCUS_12020 1552 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2132 2914 gene locus_tag LOCUS_12030 2132 2914 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_12030 3023 3466 gene locus_tag LOCUS_12040 3023 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3636 4325 gene locus_tag LOCUS_12050 3636 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence183 883 3363 gene locus_tag LOCUS_12060 883 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4209 5921 gene locus_tag LOCUS_12070 4209 5921 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence184 232 699 gene locus_tag LOCUS_12080 232 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 846 1652 gene locus_tag LOCUS_12090 846 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1720 5541 gene locus_tag LOCUS_12100 1720 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence185 3546 2377 gene locus_tag LOCUS_12110 3546 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3721 3793 gene locus_tag LOCUS_t00130 3721 3793 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5095 3968 gene locus_tag LOCUS_12120 gene sbcD 5095 3968 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_12120 6000 5542 gene locus_tag LOCUS_12130 6000 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence186 644 2107 gene locus_tag LOCUS_12140 644 2107 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_12140 2177 3172 gene locus_tag LOCUS_12150 2177 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 <6138 3534 gene locus_tag LOCUS_12160 <6138 3534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence187 2135 687 gene locus_tag LOCUS_12170 2135 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2322 2939 gene locus_tag LOCUS_12180 2322 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3220 3762 gene locus_tag LOCUS_12190 3220 3762 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201269.1 protein_id gnl|my_center|LOCUS_12190 3836 4477 gene locus_tag LOCUS_12200 gene ppa 3836 4477 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404754.1 protein_id gnl|my_center|LOCUS_12200 5524 4478 gene locus_tag LOCUS_12210 5524 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence188 1253 618 gene locus_tag LOCUS_12220 1253 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4323 1363 gene locus_tag LOCUS_12230 4323 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4907 4455 gene locus_tag LOCUS_12240 4907 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 <6073 5546 gene locus_tag LOCUS_12250 <6073 5546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962802.1:acyl-CoA reductase >Feature sequence189 485 1651 gene locus_tag LOCUS_12260 gene galK 485 1651 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56838 protein_id gnl|my_center|LOCUS_12260 1789 3618 gene locus_tag LOCUS_12270 1789 3618 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_12270 3990 3694 gene locus_tag LOCUS_12280 3990 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4308 4033 gene locus_tag LOCUS_12290 4308 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4380 5246 gene locus_tag LOCUS_12300 4380 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 <6056 5383 gene locus_tag LOCUS_12310 <6056 5383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405547.1:glycosyl hydrolase >Feature sequence190 <1 1128 gene locus_tag LOCUS_12320 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWE2:aspartokinase 1859 1320 gene locus_tag LOCUS_12330 1859 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2211 3245 gene locus_tag LOCUS_12340 2211 3245 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D8 protein_id gnl|my_center|LOCUS_12340 3299 3979 gene locus_tag LOCUS_12350 3299 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4044 4541 gene locus_tag LOCUS_12360 4044 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4579 4941 gene locus_tag LOCUS_12370 4579 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963525.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence191 2305 1160 gene locus_tag LOCUS_12380 2305 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3266 2400 gene locus_tag LOCUS_12390 3266 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064924.1 protein_id gnl|my_center|LOCUS_12390 4204 3347 gene locus_tag LOCUS_12400 4204 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5140 4280 gene locus_tag LOCUS_12410 5140 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence192 1487 1561 gene locus_tag LOCUS_t00140 1487 1561 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1650 1898 gene locus_tag LOCUS_12420 gene rpmB 1650 1898 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EM4 protein_id gnl|my_center|LOCUS_12420 1943 2131 gene locus_tag LOCUS_12430 gene rpmG 1943 2131 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_12430 2179 2355 gene locus_tag LOCUS_12440 2179 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2560 3519 gene locus_tag LOCUS_12450 gene ftsY 2560 3519 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_12450 3547 4371 gene locus_tag LOCUS_12460 3547 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_12460 5136 4375 gene locus_tag LOCUS_12470 5136 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5931 5359 gene locus_tag LOCUS_12480 gene gmhA 5931 5359 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A605 protein_id gnl|my_center|LOCUS_12480 >Feature sequence193 987 172 gene locus_tag LOCUS_12490 987 172 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_12490 2068 1076 gene locus_tag LOCUS_12500 2068 1076 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368403.1 protein_id gnl|my_center|LOCUS_12500 2987 2790 gene locus_tag LOCUS_12510 2987 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3108 4115 gene locus_tag LOCUS_12520 3108 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_12520 4229 5680 gene locus_tag LOCUS_12530 4229 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence194 <1 731 gene locus_tag LOCUS_12540 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119918.1:mechanosensitive ion channel protein MscS 781 1095 gene locus_tag LOCUS_12550 781 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1146 1559 gene locus_tag LOCUS_12560 1146 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1729 2130 gene locus_tag LOCUS_12570 1729 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2137 2682 gene locus_tag LOCUS_12580 2137 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2697 3653 gene locus_tag LOCUS_12590 2697 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_12590 3720 4685 gene locus_tag LOCUS_12600 3720 4685 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_12600 4711 5823 gene locus_tag LOCUS_12610 4711 5823 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140330.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence195 593 907 gene locus_tag LOCUS_12620 593 907 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405177.1 protein_id gnl|my_center|LOCUS_12620 1942 1268 gene locus_tag LOCUS_12630 1942 1268 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249446.1 protein_id gnl|my_center|LOCUS_12630 2581 2153 gene locus_tag LOCUS_12640 2581 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_12640 2976 4190 gene locus_tag LOCUS_12650 2976 4190 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021090.1 protein_id gnl|my_center|LOCUS_12650 4187 5386 gene locus_tag LOCUS_12660 4187 5386 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_12660 5540 5971 gene locus_tag LOCUS_12670 5540 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence196 1 294 gene locus_tag LOCUS_12680 1 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 394 831 gene locus_tag LOCUS_12690 394 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1011 2291 gene locus_tag LOCUS_12700 1011 2291 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_12700 3029 2328 gene locus_tag LOCUS_12710 3029 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3236 4087 gene locus_tag LOCUS_12720 3236 4087 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_12720 4842 4282 gene locus_tag LOCUS_12730 4842 4282 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_12730 5253 5942 gene locus_tag LOCUS_12740 5253 5942 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence197 249 1004 gene locus_tag LOCUS_12750 gene hpcH 249 1004 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_12750 1190 4870 gene locus_tag LOCUS_12760 gene metH 1190 4870 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_12760 4916 5851 gene locus_tag LOCUS_12770 4916 5851 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence198 2620 1598 gene locus_tag LOCUS_12780 gene asd 2620 1598 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_12780 2840 5437 gene locus_tag LOCUS_12790 2840 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence199 1773 253 gene locus_tag LOCUS_12800 1773 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2536 1961 gene locus_tag LOCUS_12810 2536 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 <5959 3112 gene locus_tag LOCUS_12820 <5959 3112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MG4:leucine--tRNA ligase >Feature sequence200 867 115 gene locus_tag LOCUS_12830 867 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence201 194 910 gene locus_tag LOCUS_12840 gene trmB 194 910 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_12840 920 1501 gene locus_tag LOCUS_12850 920 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2271 1498 gene locus_tag LOCUS_12860 2271 1498 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_12860 3195 2314 gene locus_tag LOCUS_12870 3195 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3873 3229 gene locus_tag LOCUS_12880 3873 3229 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_12880 4231 5085 gene locus_tag LOCUS_12890 4231 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence202 1153 1527 gene locus_tag LOCUS_12900 1153 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1538 1750 gene locus_tag LOCUS_12910 1538 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1793 2281 gene locus_tag LOCUS_12920 1793 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2294 2533 gene locus_tag LOCUS_12930 2294 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3061 2642 gene locus_tag LOCUS_12940 3061 2642 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061352.1 protein_id gnl|my_center|LOCUS_12940 4647 3190 gene locus_tag LOCUS_12950 gene gabD 4647 3190 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_12950 4713 5270 gene locus_tag LOCUS_12960 4713 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence203 1013 2971 gene locus_tag LOCUS_12970 1013 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2978 4870 gene locus_tag LOCUS_12980 2978 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5668 5186 gene locus_tag LOCUS_12990 5668 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence204 547 191 gene locus_tag LOCUS_13000 547 191 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_13000 1283 831 gene locus_tag LOCUS_13010 gene dtd 1283 831 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_13010 1385 1537 gene locus_tag LOCUS_13020 1385 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1518 2111 gene locus_tag LOCUS_13030 1518 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2221 2793 gene locus_tag LOCUS_13040 2221 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4497 2899 gene locus_tag LOCUS_13050 4497 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <5864 4594 gene locus_tag LOCUS_13060 <5864 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122710.1:MFS transporter >Feature sequence205 1386 2963 gene locus_tag LOCUS_13070 1386 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 <5854 2972 gene locus_tag LOCUS_13080 <5854 2972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403313.1:peptidase >Feature sequence206 1389 523 gene locus_tag LOCUS_13090 1389 523 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_13090 1558 2238 gene locus_tag LOCUS_13100 1558 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2912 2235 gene locus_tag LOCUS_13110 2912 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3704 2973 gene locus_tag LOCUS_13120 3704 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4557 3796 gene locus_tag LOCUS_13130 4557 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5320 4535 gene locus_tag LOCUS_13140 5320 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence207 1036 356 gene locus_tag LOCUS_13150 gene nth 1036 356 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_13150 1206 4163 gene locus_tag LOCUS_13160 1206 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4352 5143 gene locus_tag LOCUS_13170 4352 5143 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_13170 5148 5405 gene locus_tag LOCUS_13180 gene moaD 5148 5405 CDS product molybdopterin converting factor small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_213755.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence208 392 883 gene locus_tag LOCUS_13190 392 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1060 2253 gene locus_tag LOCUS_13200 1060 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3141 2347 gene locus_tag LOCUS_13210 gene trpA 3141 2347 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_13210 3493 4704 gene locus_tag LOCUS_13220 3493 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 <5804 4650 gene locus_tag LOCUS_13230 <5804 4650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963797.1:PAS domain-containing sensor histidine kinase >Feature sequence209 833 66 gene locus_tag LOCUS_13240 833 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3019 830 gene locus_tag LOCUS_13250 3019 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3273 5348 gene locus_tag LOCUS_13260 3273 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence210 1374 22 gene locus_tag LOCUS_13270 1374 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2087 1605 gene locus_tag LOCUS_13280 2087 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2369 3538 gene locus_tag LOCUS_13290 2369 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143041.1 protein_id gnl|my_center|LOCUS_13290 3535 4269 gene locus_tag LOCUS_13300 3535 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_13300 4273 4863 gene locus_tag LOCUS_13310 4273 4863 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143043.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence211 295 2658 gene locus_tag LOCUS_13320 295 2658 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_13320 2702 3745 gene locus_tag LOCUS_13330 2702 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3817 4986 gene locus_tag LOCUS_13340 3817 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_13340 <5720 5009 gene locus_tag LOCUS_13350 <5720 5009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D599:L-arabinose isomerase >Feature sequence212 542 1087 gene locus_tag LOCUS_13360 542 1087 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13360 1077 2420 gene locus_tag LOCUS_13370 1077 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3244 2447 gene locus_tag LOCUS_13380 gene uppP 3244 2447 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_13380 3729 3409 gene locus_tag LOCUS_13390 3729 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4848 3973 gene locus_tag LOCUS_13400 4848 3973 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence213 412 870 gene locus_tag LOCUS_13410 412 870 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142677.1 protein_id gnl|my_center|LOCUS_13410 1065 1772 gene locus_tag LOCUS_13420 1065 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_13420 1789 2109 gene locus_tag LOCUS_13430 1789 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2184 4457 gene locus_tag LOCUS_13440 2184 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4465 4878 gene locus_tag LOCUS_13450 4465 4878 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532348.1 protein_id gnl|my_center|LOCUS_13450 4968 5498 gene locus_tag LOCUS_13460 4968 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence214 1973 636 gene locus_tag LOCUS_13470 1973 636 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_13470 2198 3808 gene locus_tag LOCUS_13480 gene malL 2198 3808 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_13480 3926 4462 gene locus_tag LOCUS_13490 gene dcd 3926 4462 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_13490 <5685 4944 gene locus_tag LOCUS_13500 <5685 4944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191664.1:inositol monophosphatase >Feature sequence215 324 794 gene locus_tag LOCUS_13510 324 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 807 1034 gene locus_tag LOCUS_13520 807 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1050 1619 gene locus_tag LOCUS_13530 1050 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1616 1996 gene locus_tag LOCUS_13540 1616 1996 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964435.1 protein_id gnl|my_center|LOCUS_13540 2068 4869 gene locus_tag LOCUS_13550 2068 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence216 689 165 gene locus_tag LOCUS_13560 689 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 807 1145 gene locus_tag LOCUS_13570 807 1145 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_13570 1222 1611 gene locus_tag LOCUS_13580 1222 1611 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 protein_id gnl|my_center|LOCUS_13580 1683 2117 gene locus_tag LOCUS_13590 1683 2117 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 protein_id gnl|my_center|LOCUS_13590 2184 2594 gene locus_tag LOCUS_13600 2184 2594 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_13600 3879 2551 gene locus_tag LOCUS_13610 3879 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence217 <1 1789 gene locus_tag LOCUS_13620 <1 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229136.1:beta-glucosidase 1868 4885 gene locus_tag LOCUS_13630 1868 4885 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence218 <1 567 gene locus_tag LOCUS_13640 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404259.1:DNA recombination protein RmuC 1479 574 gene locus_tag LOCUS_13650 1479 574 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_13650 2382 1798 gene locus_tag LOCUS_13660 2382 1798 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_13660 2855 2433 gene locus_tag LOCUS_13670 2855 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143007.1 protein_id gnl|my_center|LOCUS_13670 3569 2880 gene locus_tag LOCUS_13680 3569 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3943 4962 gene locus_tag LOCUS_13690 gene glnII 3943 4962 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_13690 >Feature sequence219 1160 429 gene locus_tag LOCUS_13700 gene rprY 1160 429 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_13700 2810 1311 gene locus_tag LOCUS_13710 gene rprX 2810 1311 CDS product sensor protein RprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08408 protein_id gnl|my_center|LOCUS_13710 3073 4257 gene locus_tag LOCUS_13720 3073 4257 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_13720 4783 4373 gene locus_tag LOCUS_13730 4783 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202918.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence220 1921 782 gene locus_tag LOCUS_13740 1921 782 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_13740 2494 2051 gene locus_tag LOCUS_13750 2494 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3259 2525 gene locus_tag LOCUS_13760 3259 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3534 3995 gene locus_tag LOCUS_13770 3534 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5086 4001 gene locus_tag LOCUS_13780 5086 4001 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence221 <1 1036 gene locus_tag LOCUS_13790 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941233.1:SAM-dependent methyltransferase 2126 1041 gene locus_tag LOCUS_13800 2126 1041 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_13800 2830 2186 gene locus_tag LOCUS_13810 2830 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3045 3770 gene locus_tag LOCUS_13820 3045 3770 CDS product rhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903069.1 protein_id gnl|my_center|LOCUS_13820 5143 3983 gene locus_tag LOCUS_13830 5143 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 5528 5169 gene locus_tag LOCUS_13840 5528 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence222 891 49 gene locus_tag LOCUS_13850 891 49 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_13850 1035 3368 gene locus_tag LOCUS_13860 1035 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence223 596 153 gene locus_tag LOCUS_13870 596 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1442 705 gene locus_tag LOCUS_13880 1442 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_13880 2024 1455 gene locus_tag LOCUS_13890 2024 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2190 3587 gene locus_tag LOCUS_13900 2190 3587 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_13900 3690 4838 gene locus_tag LOCUS_13910 3690 4838 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence224 3323 237 gene locus_tag LOCUS_13920 3323 237 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_13920 3689 5152 gene locus_tag LOCUS_13930 3689 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence225 909 1598 gene locus_tag LOCUS_13940 909 1598 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_13940 1934 2416 gene locus_tag LOCUS_13950 1934 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3539 2769 gene locus_tag LOCUS_13960 3539 2769 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_13960 3607 4500 gene locus_tag LOCUS_13970 3607 4500 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence226 279 869 gene locus_tag LOCUS_13980 279 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 942 1967 gene locus_tag LOCUS_13990 gene des 942 1967 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34653 protein_id gnl|my_center|LOCUS_13990 2099 3301 gene locus_tag LOCUS_14000 2099 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_14000 3650 4135 gene locus_tag LOCUS_14010 3650 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence227 <1 621 gene locus_tag LOCUS_14020 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY12:3-methyl-2-oxobutanoate hydroxymethyltransferase 672 1703 gene locus_tag LOCUS_14030 672 1703 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_14030 1843 2286 gene locus_tag LOCUS_14040 1843 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2977 2366 gene locus_tag LOCUS_14050 2977 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3701 4645 gene locus_tag LOCUS_14060 3701 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 <5455 4682 gene locus_tag LOCUS_14070 <5455 4682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963483.1:peptidoglycan synthetase >Feature sequence228 2336 1341 gene locus_tag LOCUS_14080 2336 1341 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_14080 2607 3245 gene locus_tag LOCUS_14090 2607 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4273 3521 gene locus_tag LOCUS_14100 4273 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 <5455 4352 gene locus_tag LOCUS_14110 <5455 4352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405547.1:glycosyl hydrolase >Feature sequence229 412 1809 gene locus_tag LOCUS_14120 412 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1869 3209 gene locus_tag LOCUS_14130 1869 3209 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_14130 3626 5086 gene locus_tag LOCUS_14140 3626 5086 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence230 1167 2372 gene locus_tag LOCUS_14150 1167 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2999 4360 gene locus_tag LOCUS_14160 2999 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence231 925 2022 gene locus_tag LOCUS_14170 925 2022 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_14170 2105 2557 gene locus_tag LOCUS_14180 2105 2557 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_14180 3424 2561 gene locus_tag LOCUS_14190 3424 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3588 4325 gene locus_tag LOCUS_14200 3588 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence232 3141 1144 gene locus_tag LOCUS_14210 3141 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence233 2687 4699 gene locus_tag LOCUS_14220 2687 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence234 428 2827 gene locus_tag LOCUS_14230 428 2827 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_14230 3949 3350 gene locus_tag LOCUS_14240 3949 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence235 1797 448 gene locus_tag LOCUS_14250 gene kmo 1797 448 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_14250 3577 2135 gene locus_tag LOCUS_14260 3577 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 protein_id gnl|my_center|LOCUS_14260 4521 3739 gene locus_tag LOCUS_14270 gene crt 4521 3739 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_14270 5337 4765 gene locus_tag LOCUS_14280 5337 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence236 <5327 2547 gene locus_tag LOCUS_14290 <5327 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence237 2574 637 gene locus_tag LOCUS_14300 2574 637 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_14300 2899 2714 gene locus_tag LOCUS_14310 2899 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3496 2948 gene locus_tag LOCUS_14320 gene pfpI 3496 2948 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_14320 3826 3584 gene locus_tag LOCUS_14330 3826 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4090 3881 gene locus_tag LOCUS_14340 4090 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5048 4173 gene locus_tag LOCUS_14350 5048 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence238 2012 1383 gene locus_tag LOCUS_14360 2012 1383 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_14360 3571 2111 gene locus_tag LOCUS_14370 3571 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 <5295 3578 gene locus_tag LOCUS_14380 <5295 3578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729174.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence239 464 592 gene locus_tag LOCUS_14390 464 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 608 2353 gene locus_tag LOCUS_14400 608 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2465 2845 gene locus_tag LOCUS_14410 2465 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3245 4735 gene locus_tag LOCUS_14420 3245 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence240 <1 2827 gene locus_tag LOCUS_14430 <1 2827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 2939 4000 gene locus_tag LOCUS_14440 2939 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence241 <1 1425 gene locus_tag LOCUS_14450 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31716:putative ABC transporter ATP-binding protein YkpA 2066 1794 gene locus_tag LOCUS_14460 2066 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14460 2923 2072 gene locus_tag LOCUS_14470 2923 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14470 <5271 3003 gene locus_tag LOCUS_14480 <5271 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase >Feature sequence242 3937 1103 gene locus_tag LOCUS_14490 3937 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 <5255 4390 gene locus_tag LOCUS_14500 <5255 4390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZR5:transcription termination/antitermination protein NusA >Feature sequence243 926 1096 gene locus_tag LOCUS_14510 926 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1089 1442 gene locus_tag LOCUS_14520 gene ytxJ 1089 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39914 protein_id gnl|my_center|LOCUS_14520 2875 1829 gene locus_tag LOCUS_14530 gene queA 2875 1829 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_14530 3109 4365 gene locus_tag LOCUS_14540 3109 4365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_14540 4420 4800 gene locus_tag LOCUS_14550 4420 4800 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence244 610 1239 gene locus_tag LOCUS_14560 610 1239 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_14560 1747 1244 gene locus_tag LOCUS_14570 gene recX 1747 1244 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_14570 2284 1817 gene locus_tag LOCUS_14580 2284 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2290 2502 gene locus_tag LOCUS_14590 2290 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3896 2601 gene locus_tag LOCUS_14600 gene nqrF 3896 2601 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_14600 4594 3989 gene locus_tag LOCUS_14610 gene nqrE 4594 3989 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4Q7 protein_id gnl|my_center|LOCUS_14610 5115 4642 gene locus_tag LOCUS_14620 5115 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence245 >Feature sequence246 1497 793 gene locus_tag LOCUS_14630 1497 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence247 916 149 gene locus_tag LOCUS_14640 916 149 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_14640 1217 2458 gene locus_tag LOCUS_14650 1217 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4553 2613 gene locus_tag LOCUS_14660 4553 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5225 4638 gene locus_tag LOCUS_14670 5225 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence248 1379 429 gene locus_tag LOCUS_14680 1379 429 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_14680 1502 1975 gene locus_tag LOCUS_14690 1502 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence249 1 915 gene locus_tag LOCUS_14700 1 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2171 1152 gene locus_tag LOCUS_14710 2171 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence250 800 369 gene locus_tag LOCUS_14720 gene osmC 800 369 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_14720 2168 870 gene locus_tag LOCUS_14730 gene amaA 2168 870 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_14730 <5179 2691 gene locus_tag LOCUS_14740 <5179 2691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DHH0:endoglucanase >Feature sequence251 198 2420 gene locus_tag LOCUS_14750 198 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4052 2559 gene locus_tag LOCUS_14760 4052 2559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729175.1 protein_id gnl|my_center|LOCUS_14760 <5177 4045 gene locus_tag LOCUS_14770 <5177 4045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729174.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence252 <1 789 gene locus_tag LOCUS_14780 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:ATP-dependent DNA helicase RecQ 1405 1971 gene locus_tag LOCUS_14790 1405 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3013 2216 gene locus_tag LOCUS_14800 3013 2216 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_14800 3057 3452 gene locus_tag LOCUS_14810 3057 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3551 3958 gene locus_tag LOCUS_14820 3551 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4905 3964 gene locus_tag LOCUS_14830 4905 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5140 5054 gene locus_tag LOCUS_t00150 5140 5054 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence253 244 933 gene locus_tag LOCUS_14840 244 933 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_14840 1093 2520 gene locus_tag LOCUS_14850 1093 2520 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_14850 2520 3380 gene locus_tag LOCUS_14860 2520 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3567 4124 gene locus_tag LOCUS_14870 3567 4124 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence254 693 1598 gene locus_tag LOCUS_14880 693 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1642 2520 gene locus_tag LOCUS_14890 1642 2520 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_14890 2577 3776 gene locus_tag LOCUS_14900 2577 3776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence255 908 4663 gene locus_tag LOCUS_14910 908 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence256 29 511 gene locus_tag LOCUS_14920 29 511 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_14920 645 1916 gene locus_tag LOCUS_14930 gene purA 645 1916 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_14930 4756 2120 gene locus_tag LOCUS_14940 4756 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence257 1544 2947 gene locus_tag LOCUS_14950 gene lpdA2 1544 2947 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_14950 4339 3179 gene locus_tag LOCUS_14960 4339 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence258 179 919 gene locus_tag LOCUS_14970 179 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2094 1168 gene locus_tag LOCUS_14980 gene cysK1 2094 1168 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HY98 protein_id gnl|my_center|LOCUS_14980 2800 2183 gene locus_tag LOCUS_14990 2800 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4552 3245 gene locus_tag LOCUS_15000 gene bioA 4552 3245 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence259 1699 530 gene locus_tag LOCUS_15010 1699 530 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_15010 2731 2114 gene locus_tag LOCUS_15020 2731 2114 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706626.1 protein_id gnl|my_center|LOCUS_15020 3641 2865 gene locus_tag LOCUS_15030 3641 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence260 3443 564 gene locus_tag LOCUS_15040 3443 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence261 398 958 gene locus_tag LOCUS_15050 gene pth 398 958 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_15050 1361 2287 gene locus_tag LOCUS_15060 1361 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2369 3418 gene locus_tag LOCUS_15070 2369 3418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_15070 3515 4213 gene locus_tag LOCUS_15080 3515 4213 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_15080 4210 4698 gene locus_tag LOCUS_15090 4210 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence262 3865 572 gene locus_tag LOCUS_15100 3865 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3962 4603 gene locus_tag LOCUS_15110 3962 4603 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence263 3013 1718 gene locus_tag LOCUS_15120 gene glyA 3013 1718 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_15120 >Feature sequence264 1739 1470 gene locus_tag LOCUS_15130 1739 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2962 1754 gene locus_tag LOCUS_15140 2962 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_15140 3743 3189 gene locus_tag LOCUS_15150 3743 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 <4985 4138 gene locus_tag LOCUS_15160 <4985 4138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808616.1:nicotinate phosphoribosyltransferase >Feature sequence265 <1 500 gene locus_tag LOCUS_15170 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962529.1:DNA-binding response regulator 500 1570 gene locus_tag LOCUS_15180 gene phoR 500 1570 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_15180 2966 1908 gene locus_tag LOCUS_15190 2966 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3637 2978 gene locus_tag LOCUS_15200 3637 2978 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_15200 4758 3676 gene locus_tag LOCUS_15210 4758 3676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence266 <1 1675 gene locus_tag LOCUS_15220 <1 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404446.1:acyl-CoA oxidase 2985 1939 gene locus_tag LOCUS_15230 2985 1939 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_15230 4980 4090 gene locus_tag LOCUS_15240 4980 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence267 31 105 gene locus_tag LOCUS_t00160 31 105 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 555 1358 gene locus_tag LOCUS_15250 555 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2584 1439 gene locus_tag LOCUS_15260 2584 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3885 2638 gene locus_tag LOCUS_15270 3885 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence268 32 1207 gene locus_tag LOCUS_15280 32 1207 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_15280 1563 1210 gene locus_tag LOCUS_15290 1563 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1809 2018 gene locus_tag LOCUS_15300 1809 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2596 4212 gene locus_tag LOCUS_15310 2596 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence269 1095 292 gene locus_tag LOCUS_15320 gene argB 1095 292 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_15320 2440 1481 gene locus_tag LOCUS_15330 gene argF' 2440 1481 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_15330 3588 2437 gene locus_tag LOCUS_15340 3588 2437 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_15340 4571 3600 gene locus_tag LOCUS_15350 gene argC 4571 3600 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_15350 4936 4568 gene locus_tag LOCUS_15360 4936 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence270 1397 645 gene locus_tag LOCUS_15370 gene truA 1397 645 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZY4 protein_id gnl|my_center|LOCUS_15370 1465 2130 gene locus_tag LOCUS_15380 gene psd 1465 2130 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP5 protein_id gnl|my_center|LOCUS_15380 2400 3449 gene locus_tag LOCUS_15390 2400 3449 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence271 616 1395 gene locus_tag LOCUS_15400 616 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1516 1590 gene locus_tag LOCUS_t00170 1516 1590 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1722 4862 gene locus_tag LOCUS_15410 1722 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence272 849 271 gene locus_tag LOCUS_15420 849 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1556 879 gene locus_tag LOCUS_15430 1556 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3024 1624 gene locus_tag LOCUS_15440 gene arsA 3024 1624 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_15440 <4901 3111 gene locus_tag LOCUS_15450 <4901 3111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000180590.1:alpha-amylase >Feature sequence273 <1 1809 gene locus_tag LOCUS_15460 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223239.1:oxidoreductase 4867 2084 gene locus_tag LOCUS_15470 4867 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence274 329 45 gene locus_tag LOCUS_15480 329 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 909 355 gene locus_tag LOCUS_15490 909 355 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_15490 1498 1169 gene locus_tag LOCUS_15500 gene sufA 1498 1169 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_15500 1930 1505 gene locus_tag LOCUS_15510 gene nifU 1930 1505 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY5 protein_id gnl|my_center|LOCUS_15510 3220 2000 gene locus_tag LOCUS_15520 gene iscS 3220 2000 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_15520 3445 4698 gene locus_tag LOCUS_15530 3445 4698 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence275 4319 3420 gene locus_tag LOCUS_15540 4319 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence276 3323 444 gene locus_tag LOCUS_15550 3323 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4072 3500 gene locus_tag LOCUS_15560 4072 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4676 4074 gene locus_tag LOCUS_15570 gene hisI 4676 4074 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_15570 >Feature sequence277 3540 2701 gene locus_tag LOCUS_15580 gene fdhD 3540 2701 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R194 protein_id gnl|my_center|LOCUS_15580 3615 3956 gene locus_tag LOCUS_15590 3615 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence278 <1 1433 gene locus_tag LOCUS_15600 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001201677.1:alpha-galactosidase 2967 1666 gene locus_tag LOCUS_15610 2967 1666 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_15610 4034 3102 gene locus_tag LOCUS_15620 4034 3102 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_15620 4835 4170 gene locus_tag LOCUS_15630 4835 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence279 3697 1307 gene locus_tag LOCUS_15640 3697 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence280 >Feature sequence281 422 1024 gene locus_tag LOCUS_15650 422 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2665 1070 gene locus_tag LOCUS_15660 2665 1070 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_15660 3500 3096 gene locus_tag LOCUS_15670 3500 3096 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_15670 4221 3625 gene locus_tag LOCUS_15680 4221 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence282 1090 821 gene locus_tag LOCUS_15690 1090 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2102 1125 gene locus_tag LOCUS_15700 2102 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963807.1 protein_id gnl|my_center|LOCUS_15700 2508 2095 gene locus_tag LOCUS_15710 2508 2095 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_15710 3308 2517 gene locus_tag LOCUS_15720 3308 2517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893826.1 protein_id gnl|my_center|LOCUS_15720 <4786 3746 gene locus_tag LOCUS_15730 <4786 3746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088987.1:ABC transporter permease >Feature sequence283 968 1882 gene locus_tag LOCUS_15740 gene natA 968 1882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_15740 1879 3219 gene locus_tag LOCUS_15750 gene natB 1879 3219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_15750 4564 3296 gene locus_tag LOCUS_15760 gene kynU 4564 3296 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_15760 >Feature sequence284 809 1216 gene locus_tag LOCUS_15770 809 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence285 <1 596 gene locus_tag LOCUS_15780 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339151.1:serine protease 2383 980 gene locus_tag LOCUS_15790 2383 980 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence286 <4733 913 gene locus_tag LOCUS_15800 <4733 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404789.1:T9SS C-terminal target domain-containing protein >Feature sequence287 1897 974 gene locus_tag LOCUS_15810 1897 974 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_15810 1992 3467 gene locus_tag LOCUS_15820 1992 3467 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence288 3 4109 gene locus_tag LOCUS_15830 3 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence289 668 3838 gene locus_tag LOCUS_15840 668 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence290 1042 551 gene locus_tag LOCUS_15850 1042 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1650 1108 gene locus_tag LOCUS_15860 1650 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2185 1670 gene locus_tag LOCUS_15870 2185 1670 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_15870 2953 2315 gene locus_tag LOCUS_15880 2953 2315 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813333.1 protein_id gnl|my_center|LOCUS_15880 4141 3062 gene locus_tag LOCUS_15890 gene metX 4141 3062 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_15890 >Feature sequence291 2021 4450 gene locus_tag LOCUS_15900 2021 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence292 <1 2068 gene locus_tag LOCUS_15910 <1 2068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor 2245 3090 gene locus_tag LOCUS_15920 2245 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3109 3915 gene locus_tag LOCUS_15930 3109 3915 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence293 850 557 gene locus_tag LOCUS_15940 850 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1513 1205 gene locus_tag LOCUS_15950 1513 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1623 2414 gene locus_tag LOCUS_15960 gene rsmA 1623 2414 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_15960 2411 2917 gene locus_tag LOCUS_15970 2411 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2976 3773 gene locus_tag LOCUS_15980 gene xth 2976 3773 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence294 842 363 gene locus_tag LOCUS_15990 842 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1621 941 gene locus_tag LOCUS_16000 1621 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2741 1782 gene locus_tag LOCUS_16010 2741 1782 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_16010 <4650 2825 gene locus_tag LOCUS_16020 <4650 2825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence295 519 325 gene locus_tag LOCUS_16030 gene rpmI 519 325 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_16030 664 1146 gene locus_tag LOCUS_16040 664 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1338 4196 gene locus_tag LOCUS_16050 1338 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence296 516 1478 gene locus_tag LOCUS_16060 516 1478 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_16060 1577 2275 gene locus_tag LOCUS_16070 1577 2275 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_16070 3174 2272 gene locus_tag LOCUS_16080 3174 2272 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence297 1828 233 gene locus_tag LOCUS_16090 1828 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2869 1874 gene locus_tag LOCUS_16100 gene hemB 2869 1874 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403773.1 protein_id gnl|my_center|LOCUS_16100 3536 3913 gene locus_tag LOCUS_16110 3536 3913 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_16110 4038 4367 gene locus_tag LOCUS_16120 4038 4367 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_16120 >Feature sequence298 445 1311 gene locus_tag LOCUS_16130 445 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1380 2285 gene locus_tag LOCUS_16140 gene dhaA 1380 2285 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T767 protein_id gnl|my_center|LOCUS_16140 3774 2323 gene locus_tag LOCUS_16150 3774 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence299 >Feature sequence300 3675 946 gene locus_tag LOCUS_16160 3675 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 <4575 3876 gene locus_tag LOCUS_16170 <4575 3876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268944.1:NAD(FAD)-utilizing dehydrogenase >Feature sequence301 3529 2429 gene locus_tag LOCUS_16180 gene smf 3529 2429 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_16180 3621 4145 gene locus_tag LOCUS_16190 3621 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence302 767 81 gene locus_tag LOCUS_16200 767 81 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_16200 870 1865 gene locus_tag LOCUS_16210 gene kdsD 870 1865 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_16210 1958 2728 gene locus_tag LOCUS_16220 1958 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence303 500 1405 gene locus_tag LOCUS_16230 gene ykfA 500 1405 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_16230 1457 1915 gene locus_tag LOCUS_16240 1457 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2936 2268 gene locus_tag LOCUS_16250 gene truB 2936 2268 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_16250 >Feature sequence304 457 1233 gene locus_tag LOCUS_16260 gene dltE 457 1233 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_16260 1454 2830 gene locus_tag LOCUS_16270 1454 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence305 129 722 gene locus_tag LOCUS_16280 gene hisH 129 722 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_16280 903 2078 gene locus_tag LOCUS_16290 903 2078 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_16290 2225 3052 gene locus_tag LOCUS_16300 2225 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence306 3363 550 gene locus_tag LOCUS_16310 3363 550 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_16310 <4527 3684 gene locus_tag LOCUS_16320 <4527 3684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence307 <1 852 gene locus_tag LOCUS_16330 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A137:3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 952 1512 gene locus_tag LOCUS_16340 gene efp 952 1512 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_16340 1686 2195 gene locus_tag LOCUS_16350 gene accB 1686 2195 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_16350 2269 3618 gene locus_tag LOCUS_16360 gene accC 2269 3618 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_16360 4236 4478 gene locus_tag LOCUS_16370 4236 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence308 453 1544 gene locus_tag LOCUS_16380 453 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1679 2155 gene locus_tag LOCUS_16390 gene greA 1679 2155 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_16390 2158 2550 gene locus_tag LOCUS_16400 2158 2550 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_16400 2655 3887 gene locus_tag LOCUS_16410 gene gcdH 2655 3887 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence309 <1 714 gene locus_tag LOCUS_16420 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764110.1:trigger factor 915 1625 gene locus_tag LOCUS_16430 gene clpP 915 1625 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_16430 1733 3037 gene locus_tag LOCUS_16440 gene clpX 1733 3037 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_16440 3919 3281 gene locus_tag LOCUS_16450 3919 3281 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence310 1493 348 gene locus_tag LOCUS_16460 1493 348 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405081.1 protein_id gnl|my_center|LOCUS_16460 2690 1740 gene locus_tag LOCUS_16470 gene tktC 2690 1740 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_16470 3635 2748 gene locus_tag LOCUS_16480 gene tktA 3635 2748 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_16480 4058 3786 gene locus_tag LOCUS_16490 gene hupA 4058 3786 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421291.1 protein_id gnl|my_center|LOCUS_16490 4281 4460 gene locus_tag LOCUS_16500 4281 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence311 1167 1823 gene locus_tag LOCUS_16510 1167 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_16510 3471 2167 gene locus_tag LOCUS_16520 3471 2167 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_16520 <4462 3475 gene locus_tag LOCUS_16530 <4462 3475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403312.1:nucleoside transporter NupC >Feature sequence312 799 455 gene locus_tag LOCUS_16540 799 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3596 2289 gene locus_tag LOCUS_16550 3596 2289 CDS product aminotransferase class III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_16550 4356 3598 gene locus_tag LOCUS_16560 4356 3598 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence313 778 251 gene locus_tag LOCUS_16570 778 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1922 1017 gene locus_tag LOCUS_16580 1922 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2163 4253 gene locus_tag LOCUS_16590 2163 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence314 988 1587 gene locus_tag LOCUS_16600 988 1587 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_16600 1798 2043 gene locus_tag LOCUS_16610 1798 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2613 2173 gene locus_tag LOCUS_16620 gene mscL 2613 2173 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNB2 protein_id gnl|my_center|LOCUS_16620 4173 2686 gene locus_tag LOCUS_16630 4173 2686 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence315 <1 1212 gene locus_tag LOCUS_16640 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551036.1:cytochrome c >Feature sequence316 <1 2473 gene locus_tag LOCUS_16650 <1 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:peptidase 4095 3025 gene locus_tag LOCUS_16660 4095 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence317 <1 1911 gene locus_tag LOCUS_16670 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:TonB-dependent receptor 1928 2146 gene locus_tag LOCUS_16680 1928 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2474 3913 gene locus_tag LOCUS_16690 2474 3913 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_16690 4113 4397 gene locus_tag LOCUS_16700 4113 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence318 891 514 gene locus_tag LOCUS_16710 891 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1115 888 gene locus_tag LOCUS_16720 1115 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1545 1078 gene locus_tag LOCUS_16730 1545 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2395 1697 gene locus_tag LOCUS_16740 gene aat 2395 1697 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 protein_id gnl|my_center|LOCUS_16740 2719 2399 gene locus_tag LOCUS_16750 gene clpS 2719 2399 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_16750 3303 2815 gene locus_tag LOCUS_16760 3303 2815 CDS product anti-oxidant AhpCTSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404264.1 protein_id gnl|my_center|LOCUS_16760 3385 4269 gene locus_tag LOCUS_16770 3385 4269 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence319 999 1769 gene locus_tag LOCUS_16780 gene fjo14 999 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_16780 1766 2059 gene locus_tag LOCUS_16790 1766 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence320 1425 481 gene locus_tag LOCUS_16800 1425 481 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_16800 2261 1455 gene locus_tag LOCUS_16810 gene parA 2261 1455 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_16810 3084 2401 gene locus_tag LOCUS_16820 3084 2401 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817E2 protein_id gnl|my_center|LOCUS_16820 3829 3347 gene locus_tag LOCUS_16830 3829 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence321 2231 1758 gene locus_tag LOCUS_16840 2231 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2305 2919 gene locus_tag LOCUS_16850 2305 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3836 3159 gene locus_tag LOCUS_16860 3836 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence322 <1 514 gene locus_tag LOCUS_16870 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404059.1:membrane protein 2254 515 gene locus_tag LOCUS_16880 2254 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence323 1803 709 gene locus_tag LOCUS_16890 1803 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1906 3720 gene locus_tag LOCUS_16900 1906 3720 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_16900 3898 4347 gene locus_tag LOCUS_16910 3898 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence324 <1 631 gene locus_tag LOCUS_16920 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000389833.1:mechanosensitive ion channel protein MscS 1181 660 gene locus_tag LOCUS_16930 1181 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4220 1296 gene locus_tag LOCUS_16940 4220 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence325 1013 549 gene locus_tag LOCUS_16950 1013 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1725 1294 gene locus_tag LOCUS_16960 1725 1294 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228810.1 protein_id gnl|my_center|LOCUS_16960 2221 1829 gene locus_tag LOCUS_16970 2221 1829 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_16970 2865 2371 gene locus_tag LOCUS_16980 2865 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_16980 4292 2880 gene locus_tag LOCUS_16990 4292 2880 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence326 1373 492 gene locus_tag LOCUS_17000 gene cysM 1373 492 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_17000 2427 1606 gene locus_tag LOCUS_17010 2427 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence327 267 1232 gene locus_tag LOCUS_17020 267 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2024 1431 gene locus_tag LOCUS_17030 2024 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_17030 2958 2167 gene locus_tag LOCUS_17040 2958 2167 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_17040 3066 3290 gene locus_tag LOCUS_17050 3066 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence328 199 867 gene locus_tag LOCUS_17060 199 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_17060 1123 2532 gene locus_tag LOCUS_17070 gene actA 1123 2532 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence329 1131 208 gene locus_tag LOCUS_17080 1131 208 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_17080 1228 2457 gene locus_tag LOCUS_17090 1228 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3147 2872 gene locus_tag LOCUS_17100 3147 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence330 82 465 gene locus_tag LOCUS_17110 82 465 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964435.1 protein_id gnl|my_center|LOCUS_17110 709 1419 gene locus_tag LOCUS_17120 709 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1531 3480 gene locus_tag LOCUS_17130 1531 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence331 1095 142 gene locus_tag LOCUS_17140 1095 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3203 1107 gene locus_tag LOCUS_17150 gene yyaL 3203 1107 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence332 <1 922 gene locus_tag LOCUS_17160 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802486.1:putative DNA modification/repair radical SAM protein 1199 2029 gene locus_tag LOCUS_17170 1199 2029 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_17170 2735 2037 gene locus_tag LOCUS_17180 2735 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2977 3939 gene locus_tag LOCUS_17190 2977 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053466.1 protein_id gnl|my_center|LOCUS_17190 4265 4032 gene locus_tag LOCUS_17200 4265 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence333 >Feature sequence334 2028 397 gene locus_tag LOCUS_17210 2028 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 <4318 3530 gene locus_tag LOCUS_17220 <4318 3530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405245.1:glycosyl hydrolase >Feature sequence335 912 688 gene locus_tag LOCUS_17230 912 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2211 1438 gene locus_tag LOCUS_17240 2211 1438 CDS product LPS biosynthesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 protein_id gnl|my_center|LOCUS_17240 3061 2204 gene locus_tag LOCUS_17250 3061 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <4318 3244 gene locus_tag LOCUS_17260 <4318 3244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVU9:DNA repair protein RadA >Feature sequence336 <1 603 gene locus_tag LOCUS_17270 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964500.1:membrane protein 685 1017 gene locus_tag LOCUS_17280 685 1017 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_17280 1985 1095 gene locus_tag LOCUS_17290 1985 1095 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence337 <1 969 gene locus_tag LOCUS_17300 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39581:D-alanine--poly(phosphoribitol) ligase subunit 1 1022 2242 gene locus_tag LOCUS_17310 gene argD 1022 2242 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_17310 2624 3091 gene locus_tag LOCUS_17320 2624 3091 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_17320 3148 3726 gene locus_tag LOCUS_17330 3148 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence338 <1 2498 gene locus_tag LOCUS_17340 <1 2498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:penicillin-binding protein 1A 2588 3331 gene locus_tag LOCUS_17350 2588 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <4282 3421 gene locus_tag LOCUS_17360 <4282 3421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108949.1:outer membrane protein assembly factor >Feature sequence339 2311 1259 gene locus_tag LOCUS_17370 gene lpxD 2311 1259 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A014 protein_id gnl|my_center|LOCUS_17370 2419 3513 gene locus_tag LOCUS_17380 2419 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4044 3802 gene locus_tag LOCUS_17390 4044 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence340 >Feature sequence341 >Feature sequence342 <1 554 gene locus_tag LOCUS_17400 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B616:putative K(+)-stimulated pyrophosphate-energized sodium pump 964 3075 gene locus_tag LOCUS_17410 964 3075 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence343 1492 278 gene locus_tag LOCUS_17420 1492 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3625 1682 gene locus_tag LOCUS_17430 3625 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence344 405 974 gene locus_tag LOCUS_17440 405 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_17440 1022 2083 gene locus_tag LOCUS_17450 1022 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2070 2906 gene locus_tag LOCUS_17460 2070 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_17460 4192 3482 gene locus_tag LOCUS_17470 gene murQ 4192 3482 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_17470 >Feature sequence345 1327 2319 gene locus_tag LOCUS_17480 1327 2319 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_17480 3257 2415 gene locus_tag LOCUS_17490 3257 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence346 901 176 gene locus_tag LOCUS_17500 gene rpsB 901 176 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_17500 1351 965 gene locus_tag LOCUS_17510 gene rpsI 1351 965 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z5 protein_id gnl|my_center|LOCUS_17510 1840 1391 gene locus_tag LOCUS_17520 gene rplM 1840 1391 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_17520 2229 3371 gene locus_tag LOCUS_17530 gene mqnC 2229 3371 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH46 protein_id gnl|my_center|LOCUS_17530 >Feature sequence347 2618 1512 gene locus_tag LOCUS_17540 gene paaE 2618 1512 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_17540 2750 3841 gene locus_tag LOCUS_17550 2750 3841 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence348 582 1718 gene locus_tag LOCUS_17560 582 1718 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_17560 2270 1989 gene locus_tag LOCUS_17570 2270 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2376 2804 gene locus_tag LOCUS_17580 2376 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933003.1 protein_id gnl|my_center|LOCUS_17580 3213 2809 gene locus_tag LOCUS_17590 3213 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3577 3299 gene locus_tag LOCUS_17600 3577 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence349 576 1424 gene locus_tag LOCUS_17610 576 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1693 2070 gene locus_tag LOCUS_17620 1693 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540506.1 protein_id gnl|my_center|LOCUS_17620 3092 2067 gene locus_tag LOCUS_17630 3092 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 3484 3125 gene locus_tag LOCUS_17640 3484 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence350 3907 848 gene locus_tag LOCUS_17650 3907 848 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence351 1316 960 gene locus_tag LOCUS_17660 1316 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2993 1443 gene locus_tag LOCUS_17670 2993 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3800 3225 gene locus_tag LOCUS_17680 3800 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence352 2968 620 gene locus_tag LOCUS_17690 2968 620 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence353 45 1469 gene locus_tag LOCUS_17700 45 1469 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_17700 3195 1522 gene locus_tag LOCUS_17710 3195 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 <4108 3333 gene locus_tag LOCUS_17720 <4108 3333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_639573.2:polysaccharide deacetylase >Feature sequence354 799 1968 gene locus_tag LOCUS_17730 799 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1984 2280 gene locus_tag LOCUS_17740 1984 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3486 2662 gene locus_tag LOCUS_17750 3486 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence355 2032 1193 gene locus_tag LOCUS_17760 2032 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3486 2230 gene locus_tag LOCUS_17770 3486 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence356 688 1242 gene locus_tag LOCUS_17780 688 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1269 1351 gene locus_tag LOCUS_t00180 1269 1351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1476 1558 gene locus_tag LOCUS_t00190 1476 1558 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1738 1580 gene locus_tag LOCUS_17790 1738 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2778 2083 gene locus_tag LOCUS_17800 gene trmD 2778 2083 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_17800 3021 3422 gene locus_tag LOCUS_17810 3021 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence357 708 4 gene locus_tag LOCUS_17820 708 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1738 1085 gene locus_tag LOCUS_17830 gene trmH 1738 1085 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729J5 protein_id gnl|my_center|LOCUS_17830 3342 1741 gene locus_tag LOCUS_17840 3342 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence358 <1 829 gene locus_tag LOCUS_17850 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108101.1:SusC/RagA family TonB-linked outer membrane protein 916 2334 gene locus_tag LOCUS_17860 916 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_17860 <4058 2922 gene locus_tag LOCUS_17870 <4058 2922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108738.1:glycan metabolism protein RagB >Feature sequence359 1268 99 gene locus_tag LOCUS_17880 1268 99 CDS product glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_17880 1776 1261 gene locus_tag LOCUS_17890 1776 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2184 3740 gene locus_tag LOCUS_17900 gene speE 2184 3740 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence360 522 25 gene locus_tag LOCUS_17910 522 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 764 2413 gene locus_tag LOCUS_17920 gene araB 764 2413 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIM8 protein_id gnl|my_center|LOCUS_17920 2422 3117 gene locus_tag LOCUS_17930 2422 3117 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence361 <1 542 gene locus_tag LOCUS_17940 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404801.1:outer membrane protein assembly factor BamD 499 849 gene locus_tag LOCUS_17950 499 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_17950 932 2152 gene locus_tag LOCUS_17960 932 2152 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_17960 2226 3122 gene locus_tag LOCUS_17970 2226 3122 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence362 418 861 gene locus_tag LOCUS_17980 418 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1415 969 gene locus_tag LOCUS_17990 1415 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_17990 3527 1587 gene locus_tag LOCUS_18000 3527 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence363 1604 1942 gene locus_tag LOCUS_18010 1604 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2729 2022 gene locus_tag LOCUS_18020 2729 2022 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_18020 <4005 2954 gene locus_tag LOCUS_18030 <4005 2954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861460.1:membrane protein >Feature sequence364 <1 1943 gene locus_tag LOCUS_18040 <1 1943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256980.1:hyalin 2085 2663 gene locus_tag LOCUS_18050 2085 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 <3992 2722 gene locus_tag LOCUS_18060 <3992 2722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963779.1:ribonuclease G >Feature sequence365 <1 1641 gene locus_tag LOCUS_18070 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 2953 2291 gene locus_tag LOCUS_18080 2953 2291 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_18080 3520 3017 gene locus_tag LOCUS_18090 3520 3017 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence366 1416 670 gene locus_tag LOCUS_18100 1416 670 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_18100 1935 2915 gene locus_tag LOCUS_18110 1935 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence367 1856 912 gene locus_tag LOCUS_18120 1856 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2873 1866 gene locus_tag LOCUS_18130 2873 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946008.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence368 1359 457 gene locus_tag LOCUS_18140 1359 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_18140 1907 1434 gene locus_tag LOCUS_18150 1907 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2609 2175 gene locus_tag LOCUS_18160 2609 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3361 2606 gene locus_tag LOCUS_18170 3361 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence369 >Feature sequence370 848 2440 gene locus_tag LOCUS_18180 848 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3040 2444 gene locus_tag LOCUS_18190 3040 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3591 3100 gene locus_tag LOCUS_18200 3591 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence371 >Feature sequence372 1294 356 gene locus_tag LOCUS_18210 1294 356 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_18210 1968 1375 gene locus_tag LOCUS_18220 1968 1375 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037707.1 protein_id gnl|my_center|LOCUS_18220 <3956 2142 gene locus_tag LOCUS_18230 <3956 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYR1:DNA mismatch repair protein MutL >Feature sequence373 435 713 gene locus_tag LOCUS_18240 435 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1296 1754 gene locus_tag LOCUS_18250 1296 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2634 1954 gene locus_tag LOCUS_18260 2634 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3863 2631 gene locus_tag LOCUS_18270 3863 2631 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence374 >Feature sequence375 813 538 gene locus_tag LOCUS_18280 813 538 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_18280 1493 1113 gene locus_tag LOCUS_18290 1493 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1963 1499 gene locus_tag LOCUS_18300 1963 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2580 2008 gene locus_tag LOCUS_18310 2580 2008 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence376 2259 469 gene locus_tag LOCUS_18320 2259 469 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_18320 2439 2909 gene locus_tag LOCUS_18330 2439 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2931 3308 gene locus_tag LOCUS_18340 2931 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence377 2229 3188 gene locus_tag LOCUS_18350 2229 3188 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence378 304 1245 gene locus_tag LOCUS_18360 304 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1403 3793 gene locus_tag LOCUS_18370 1403 3793 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence379 558 1544 gene locus_tag LOCUS_18380 gene pdhB 558 1544 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_18380 1781 1927 gene locus_tag LOCUS_18390 1781 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3414 2125 gene locus_tag LOCUS_18400 3414 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence380 920 1108 gene locus_tag LOCUS_18410 gene rpsU 920 1108 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_18410 1407 2309 gene locus_tag LOCUS_18420 gene xerC 1407 2309 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_18420 2368 2691 gene locus_tag LOCUS_18430 2368 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 <3864 2772 gene locus_tag LOCUS_18440 <3864 2772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence381 <1 927 gene locus_tag LOCUS_18450 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P41:exodeoxyribonuclease 7 large subunit 973 1176 gene locus_tag LOCUS_18460 973 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1319 2326 gene locus_tag LOCUS_18470 1319 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2376 3032 gene locus_tag LOCUS_18480 2376 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence382 >Feature sequence383 483 1298 gene locus_tag LOCUS_18490 483 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1360 2322 gene locus_tag LOCUS_18500 1360 2322 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767531.1 protein_id gnl|my_center|LOCUS_18500 <3830 2430 gene locus_tag LOCUS_18510 <3830 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase >Feature sequence384 483 3533 gene locus_tag LOCUS_18520 483 3533 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405100.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence385 <1 882 gene locus_tag LOCUS_18530 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKY8:polyphosphate kinase 963 1772 gene locus_tag LOCUS_18540 963 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2124 2894 gene locus_tag LOCUS_18550 2124 2894 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_18550 3493 2891 gene locus_tag LOCUS_18560 3493 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence386 2186 1572 gene locus_tag LOCUS_18570 gene bioD 2186 1572 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_18570 2579 3502 gene locus_tag LOCUS_18580 2579 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence387 1620 505 gene locus_tag LOCUS_18590 gene mvaD 1620 505 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_18590 1673 2647 gene locus_tag LOCUS_18600 1673 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 <3805 2725 gene locus_tag LOCUS_18610 <3805 2725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203603.1:Xaa-Pro aminopeptidase >Feature sequence388 215 730 gene locus_tag LOCUS_18620 gene infC 215 730 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_18620 884 1927 gene locus_tag LOCUS_18630 884 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2748 2140 gene locus_tag LOCUS_18640 2748 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 <3802 2779 gene locus_tag LOCUS_18650 <3802 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404533.1:methylmalonyl-CoA mutase >Feature sequence389 <1 952 gene locus_tag LOCUS_18660 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW32:adenosylhomocysteinase 1125 2318 gene locus_tag LOCUS_18670 gene aspC2 1125 2318 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_18670 3485 2673 gene locus_tag LOCUS_18680 3485 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence390 735 394 gene locus_tag LOCUS_18690 735 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1019 1663 gene locus_tag LOCUS_18700 1019 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2159 2677 gene locus_tag LOCUS_18710 2159 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2726 3601 gene locus_tag LOCUS_18720 2726 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence391 369 2681 gene locus_tag LOCUS_18730 gene pbpC 369 2681 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence392 <1 626 gene locus_tag LOCUS_18740 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964069.1:glycosyl transferase family 2 2409 916 gene locus_tag LOCUS_18750 2409 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2577 2969 gene locus_tag LOCUS_18760 2577 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3152 3481 gene locus_tag LOCUS_18770 3152 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence393 272 1465 gene locus_tag LOCUS_18780 gene sucC 272 1465 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_18780 1913 2308 gene locus_tag LOCUS_18790 1913 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2314 3072 gene locus_tag LOCUS_18800 2314 3072 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_18800 3129 3368 gene locus_tag LOCUS_18810 3129 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence394 834 163 gene locus_tag LOCUS_18820 834 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2792 834 gene locus_tag LOCUS_18830 2792 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence395 1432 1797 gene locus_tag LOCUS_18840 1432 1797 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence396 1459 737 gene locus_tag LOCUS_18850 1459 737 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_18850 1647 3668 gene locus_tag LOCUS_18860 1647 3668 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405148.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence397 338 1264 gene locus_tag LOCUS_18870 gene xerC 338 1264 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_18870 1933 1466 gene locus_tag LOCUS_18880 1933 1466 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_18880 2837 1959 gene locus_tag LOCUS_18890 2837 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence398 965 78 gene locus_tag LOCUS_18900 965 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1755 3635 gene locus_tag LOCUS_18910 1755 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence399 131 9 gene locus_tag LOCUS_18920 131 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1993 1796 gene locus_tag LOCUS_18930 1993 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2179 2937 gene locus_tag LOCUS_18940 2179 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence400 1082 537 gene locus_tag LOCUS_18950 1082 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_18950 1188 1640 gene locus_tag LOCUS_18960 1188 1640 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence401 576 2765 gene locus_tag LOCUS_18970 576 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2845 3180 gene locus_tag LOCUS_18980 2845 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence402 703 1491 gene locus_tag LOCUS_18990 703 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1815 2633 gene locus_tag LOCUS_19000 gene prmA 1815 2633 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence403 970 1530 gene locus_tag LOCUS_19010 970 1530 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_19010 1961 3433 gene locus_tag LOCUS_19020 1961 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence404 <1 561 gene locus_tag LOCUS_19030 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIS3:porphobilinogen deaminase 1176 763 gene locus_tag LOCUS_19040 1176 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1283 1870 gene locus_tag LOCUS_19050 1283 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_19050 2540 1872 gene locus_tag LOCUS_19060 2540 1872 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence405 593 438 gene locus_tag LOCUS_19070 gene rpmH 593 438 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F6 protein_id gnl|my_center|LOCUS_19070 718 1821 gene locus_tag LOCUS_19080 718 1821 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227759.1 protein_id gnl|my_center|LOCUS_19080 2944 1943 gene locus_tag LOCUS_19090 2944 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence406 974 234 gene locus_tag LOCUS_19100 974 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1516 971 gene locus_tag LOCUS_19110 1516 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence407 672 1445 gene locus_tag LOCUS_19120 672 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2071 1514 gene locus_tag LOCUS_19130 2071 1514 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403872.1 protein_id gnl|my_center|LOCUS_19130 2276 2782 gene locus_tag LOCUS_19140 2276 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2839 3204 gene locus_tag LOCUS_19150 2839 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence408 611 150 gene locus_tag LOCUS_19160 611 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19160 2482 611 gene locus_tag LOCUS_19170 2482 611 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence409 367 3012 gene locus_tag LOCUS_19180 gene mutS 367 3012 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A334 protein_id gnl|my_center|LOCUS_19180 >Feature sequence410 438 740 gene locus_tag LOCUS_19190 438 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2285 1146 gene locus_tag LOCUS_19200 2285 1146 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence411 620 1312 gene locus_tag LOCUS_19210 620 1312 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_19210 1786 2640 gene locus_tag LOCUS_19220 1786 2640 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence412 2 406 gene locus_tag LOCUS_19230 2 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 597 821 gene locus_tag LOCUS_19240 597 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1364 861 gene locus_tag LOCUS_19250 1364 861 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_19250 1819 2790 gene locus_tag LOCUS_19260 1819 2790 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence413 491 1564 gene locus_tag LOCUS_19270 491 1564 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_19270 2047 3102 gene locus_tag LOCUS_19280 2047 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence414 2158 2595 gene locus_tag LOCUS_19290 gene yuxK 2158 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_19290 2701 2791 gene locus_tag LOCUS_t00200 2701 2791 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence415 1344 466 gene locus_tag LOCUS_19300 1344 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence416 1770 1117 gene locus_tag LOCUS_19310 1770 1117 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_19310 <3568 1849 gene locus_tag LOCUS_19320 <3568 1849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203525.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence417 102 761 gene locus_tag LOCUS_19330 102 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 805 1557 gene locus_tag LOCUS_19340 805 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1986 3089 gene locus_tag LOCUS_19350 1986 3089 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence418 3365 2367 gene locus_tag LOCUS_19360 3365 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence419 <1 1222 gene locus_tag LOCUS_19370 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H194:UDP-N-acetylmuramate--L-alanine ligase 1498 2307 gene locus_tag LOCUS_19380 1498 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence420 2203 509 gene locus_tag LOCUS_19390 gene gldG 2203 509 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_19390 2982 2251 gene locus_tag LOCUS_19400 gene gldF 2982 2251 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence421 91 411 gene locus_tag LOCUS_19410 91 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1757 738 gene locus_tag LOCUS_19420 gene gnl 1757 738 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_19420 2796 1768 gene locus_tag LOCUS_19430 2796 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_19430 <3554 2886 gene locus_tag LOCUS_19440 <3554 2886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962613.1:MFS transporter >Feature sequence422 329 1402 gene locus_tag LOCUS_19450 329 1402 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence423 1998 3086 gene locus_tag LOCUS_19460 1998 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence424 101 1162 gene locus_tag LOCUS_19470 gene trpD 101 1162 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD5 protein_id gnl|my_center|LOCUS_19470 1211 2029 gene locus_tag LOCUS_19480 gene trpC 1211 2029 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_19480 2026 2664 gene locus_tag LOCUS_19490 gene trpF 2026 2664 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX4 protein_id gnl|my_center|LOCUS_19490 3452 2682 gene locus_tag LOCUS_19500 3452 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence425 <1 1495 gene locus_tag LOCUS_19510 <1 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962810.1:DNA topoisomerase IV subunit A 1615 2304 gene locus_tag LOCUS_19520 1615 2304 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_19520 2347 3072 gene locus_tag LOCUS_19530 2347 3072 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence426 <1 702 gene locus_tag LOCUS_19540 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1P9:50S ribosomal protein L21 883 1602 gene locus_tag LOCUS_19550 883 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 protein_id gnl|my_center|LOCUS_19550 1662 2648 gene locus_tag LOCUS_19560 1662 2648 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028250.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence427 1991 711 gene locus_tag LOCUS_19570 1991 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence428 639 103 gene locus_tag LOCUS_19580 639 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 754 3162 gene locus_tag LOCUS_19590 754 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence429 1986 1393 gene locus_tag LOCUS_19600 1986 1393 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence430 398 1144 gene locus_tag LOCUS_19610 398 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1141 1521 gene locus_tag LOCUS_19620 1141 1521 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_19620 2188 1706 gene locus_tag LOCUS_19630 2188 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2476 3498 gene locus_tag LOCUS_19640 2476 3498 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_19640 >Feature sequence431 1231 230 gene locus_tag LOCUS_19650 1231 230 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_19650 1422 2828 gene locus_tag LOCUS_19660 1422 2828 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_19660 2828 3196 gene locus_tag LOCUS_19670 2828 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence432 559 2481 gene locus_tag LOCUS_19680 559 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence433 <1 1559 gene locus_tag LOCUS_19690 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:penicillin-binding protein 1A 2096 1686 gene locus_tag LOCUS_19700 2096 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2660 2124 gene locus_tag LOCUS_19710 2660 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2837 2661 gene locus_tag LOCUS_19720 2837 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3049 3291 gene locus_tag LOCUS_19730 3049 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence434 1 1665 gene locus_tag LOCUS_19740 1 1665 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_19740 2583 2077 gene locus_tag LOCUS_19750 2583 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3179 2580 gene locus_tag LOCUS_19760 3179 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence435 1674 331 gene locus_tag LOCUS_19770 1674 331 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_19770 2451 1996 gene locus_tag LOCUS_19780 2451 1996 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 protein_id gnl|my_center|LOCUS_19780 2650 3144 gene locus_tag LOCUS_19790 2650 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3199 3468 gene locus_tag LOCUS_19800 gene rpsR 3199 3468 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_19800 >Feature sequence436 >Feature sequence437 157 1092 gene locus_tag LOCUS_19810 157 1092 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_19810 2828 1731 gene locus_tag LOCUS_19820 2828 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence438 331 969 gene locus_tag LOCUS_19830 331 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence439 1130 378 gene locus_tag LOCUS_19840 gene lipB 1130 378 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_19840 1289 1741 gene locus_tag LOCUS_19850 1289 1741 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_19850 2721 1996 gene locus_tag LOCUS_19860 gene ppa 2721 1996 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B8Z8 protein_id gnl|my_center|LOCUS_19860 >Feature sequence440 <1 1326 gene locus_tag LOCUS_19870 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203417.1:rRNA cytosine-C5-methyltransferase 2229 1465 gene locus_tag LOCUS_19880 2229 1465 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence441 778 1425 gene locus_tag LOCUS_19890 gene tdk 778 1425 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_19890 1459 2340 gene locus_tag LOCUS_19900 gene udp 1459 2340 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_19900 2350 3216 gene locus_tag LOCUS_19910 2350 3216 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence442 1199 267 gene locus_tag LOCUS_19920 gene nusB 1199 267 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_19920 1332 2054 gene locus_tag LOCUS_19930 1332 2054 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_19930 2051 2707 gene locus_tag LOCUS_19940 2051 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_19940 3409 3179 gene locus_tag LOCUS_19950 3409 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence443 111 1337 gene locus_tag LOCUS_19960 111 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence444 133 660 gene locus_tag LOCUS_19970 133 660 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_19970 758 3229 gene locus_tag LOCUS_19980 758 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence445 67 1506 gene locus_tag LOCUS_19990 67 1506 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3P5 protein_id gnl|my_center|LOCUS_19990 2099 1509 gene locus_tag LOCUS_20000 2099 1509 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683453.1 protein_id gnl|my_center|LOCUS_20000 <3386 2187 gene locus_tag LOCUS_20010 <3386 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268774.1:methyltransferase >Feature sequence446 <1 526 gene locus_tag LOCUS_20020 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759752.1:glycosyl transferase 523 1260 gene locus_tag LOCUS_20030 523 1260 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_20030 1516 2529 gene locus_tag LOCUS_20040 1516 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2539 2763 gene locus_tag LOCUS_20050 2539 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3304 3044 gene locus_tag LOCUS_20060 3304 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence447 1893 352 gene locus_tag LOCUS_20070 gene guaA 1893 352 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_20070 3156 2236 gene locus_tag LOCUS_20080 3156 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence448 355 897 gene locus_tag LOCUS_20090 355 897 CDS product DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031635.1 protein_id gnl|my_center|LOCUS_20090 1239 1913 gene locus_tag LOCUS_20100 1239 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence449 1554 127 gene locus_tag LOCUS_20110 1554 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250828.1 protein_id gnl|my_center|LOCUS_20110 2668 1646 gene locus_tag LOCUS_20120 gene adhP 2668 1646 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence450 802 1485 gene locus_tag LOCUS_20130 802 1485 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_20130 1518 1937 gene locus_tag LOCUS_20140 1518 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20140 1956 2618 gene locus_tag LOCUS_20150 1956 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20150 >Feature sequence451 218 2737 gene locus_tag LOCUS_20160 218 2737 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence452 363 1118 gene locus_tag LOCUS_20170 363 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142745.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence453 933 1298 gene locus_tag LOCUS_20180 933 1298 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_20180 1562 2416 gene locus_tag LOCUS_20190 1562 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2500 3000 gene locus_tag LOCUS_20200 2500 3000 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence454 1530 454 gene locus_tag LOCUS_20210 1530 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2605 1541 gene locus_tag LOCUS_20220 2605 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3330 2722 gene locus_tag LOCUS_20230 3330 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence455 53 1051 gene locus_tag LOCUS_20240 53 1051 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence456 2936 2487 gene locus_tag LOCUS_20250 2936 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence457 2663 774 gene locus_tag LOCUS_20260 2663 774 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence458 >Feature sequence459 <1 1481 gene locus_tag LOCUS_20270 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2B0:peptidylprolyl isomerase 1803 3227 gene locus_tag LOCUS_20280 1803 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence460 357 1454 gene locus_tag LOCUS_20290 357 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1587 2672 gene locus_tag LOCUS_20300 1587 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence461 >Feature sequence462 1212 868 gene locus_tag LOCUS_20310 1212 868 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_20310 1315 2919 gene locus_tag LOCUS_20320 gene treA 1315 2919 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MI6 protein_id gnl|my_center|LOCUS_20320 >Feature sequence463 3084 1750 gene locus_tag LOCUS_20330 3084 1750 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence464 322 1368 gene locus_tag LOCUS_20340 gene hisC 322 1368 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_20340 1377 2156 gene locus_tag LOCUS_20350 gene cysQ 1377 2156 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence465 109 861 gene locus_tag LOCUS_20360 109 861 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096539.1 protein_id gnl|my_center|LOCUS_20360 907 1653 gene locus_tag LOCUS_20370 907 1653 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931156.1 protein_id gnl|my_center|LOCUS_20370 2217 2777 gene locus_tag LOCUS_20380 2217 2777 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence466 <1 2317 gene locus_tag LOCUS_20390 <1 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:cell envelope biogenesis protein OmpA >Feature sequence467 >Feature sequence468 731 985 gene locus_tag LOCUS_20400 731 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1708 2622 gene locus_tag LOCUS_20410 1708 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence469 <1 684 gene locus_tag LOCUS_20420 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FZ8:1,4-dihydroxy-6-naphtoate synthase 840 1364 gene locus_tag LOCUS_20430 840 1364 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_20430 3263 2244 gene locus_tag LOCUS_20440 gene pepT 3263 2244 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_20440 >Feature sequence470 2074 2244 gene locus_tag LOCUS_20450 2074 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence471 1872 778 gene locus_tag LOCUS_20460 1872 778 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_20460 <3231 2031 gene locus_tag LOCUS_20470 <3231 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965973.1:maltose phosphorylase >Feature sequence472 1 375 gene locus_tag LOCUS_20480 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence473 1060 68 gene locus_tag LOCUS_20490 1060 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1122 1604 gene locus_tag LOCUS_20500 1122 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_20500 3077 1551 gene locus_tag LOCUS_20510 3077 1551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538283.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence474 <1 506 gene locus_tag LOCUS_20520 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765755.1:prevent-host-death protein 2434 635 gene locus_tag LOCUS_20530 2434 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence475 111 1253 gene locus_tag LOCUS_20540 111 1253 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_20540 1295 2143 gene locus_tag LOCUS_20550 1295 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2734 2225 gene locus_tag LOCUS_20560 2734 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence476 1923 559 gene locus_tag LOCUS_20570 1923 559 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 protein_id gnl|my_center|LOCUS_20570 2826 1969 gene locus_tag LOCUS_20580 2826 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence477 2421 955 gene locus_tag LOCUS_20590 gene glgA 2421 955 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWX0 protein_id gnl|my_center|LOCUS_20590 2815 2477 gene locus_tag LOCUS_20600 2815 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence478 382 852 gene locus_tag LOCUS_20610 382 852 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887233.1 protein_id gnl|my_center|LOCUS_20610 1888 1028 gene locus_tag LOCUS_20620 1888 1028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_20620 1983 2915 gene locus_tag LOCUS_20630 1983 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence479 1961 675 gene locus_tag LOCUS_20640 1961 675 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_20640 <3163 2163 gene locus_tag LOCUS_20650 <3163 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764095.1:membrane protein >Feature sequence480 1603 2646 gene locus_tag LOCUS_20660 1603 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence481 2607 1780 gene locus_tag LOCUS_20670 2607 1780 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence482 183 569 gene locus_tag LOCUS_20680 183 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 599 880 gene locus_tag LOCUS_20690 599 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 900 1433 gene locus_tag LOCUS_20700 gene guaA 900 1433 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_20700 2283 1702 gene locus_tag LOCUS_20710 2283 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2501 2764 gene locus_tag LOCUS_20720 2501 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902953.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence483 1225 1803 gene locus_tag LOCUS_20730 1225 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1871 2065 gene locus_tag LOCUS_20740 1871 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence484 68 1537 gene locus_tag LOCUS_20750 68 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1700 1563 gene locus_tag LOCUS_20760 1700 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence485 857 213 gene locus_tag LOCUS_20770 857 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1901 879 gene locus_tag LOCUS_20780 1901 879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_20780 <3118 2474 gene locus_tag LOCUS_20790 <3118 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191889.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence486 113 1030 gene locus_tag LOCUS_20800 113 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1082 1969 gene locus_tag LOCUS_20810 gene folD 1082 1969 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_20810 2383 1976 gene locus_tag LOCUS_20820 2383 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence487 >Feature sequence488 2831 603 gene locus_tag LOCUS_20830 2831 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence489 1333 395 gene locus_tag LOCUS_20840 1333 395 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_20840 1536 1907 gene locus_tag LOCUS_20850 1536 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2083 2910 gene locus_tag LOCUS_20860 2083 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence490 561 1103 gene locus_tag LOCUS_20870 gene pyrR1 561 1103 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_20870 2382 1105 gene locus_tag LOCUS_20880 2382 1105 CDS product tripeptidyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108298.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence491 <3090 161 gene locus_tag LOCUS_20890 <3090 161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020394.1:cell surface protein >Feature sequence492 1297 2700 gene locus_tag LOCUS_20900 gene lpdA1 1297 2700 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_20900 >Feature sequence493 601 2232 gene locus_tag LOCUS_20910 601 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence494 2556 580 gene locus_tag LOCUS_20920 2556 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence495 <1 682 gene locus_tag LOCUS_20930 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123110.1:multidrug resistance protein 727 1257 gene locus_tag LOCUS_20940 727 1257 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_20940 1260 1682 gene locus_tag LOCUS_20950 1260 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1694 3022 gene locus_tag LOCUS_20960 1694 3022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence496 399 1127 gene locus_tag LOCUS_20970 gene yoxD 399 1127 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_20970 1146 2666 gene locus_tag LOCUS_20980 1146 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence497 223 786 gene locus_tag LOCUS_20990 223 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073723.1 protein_id gnl|my_center|LOCUS_20990 924 1814 gene locus_tag LOCUS_21000 924 1814 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815895.1 protein_id gnl|my_center|LOCUS_21000 2321 1848 gene locus_tag LOCUS_21010 2321 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2731 2405 gene locus_tag LOCUS_21020 2731 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence498 1070 2290 gene locus_tag LOCUS_21030 gene ribBA 1070 2290 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_21030 2327 2989 gene locus_tag LOCUS_21040 2327 2989 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence499 417 1703 gene locus_tag LOCUS_21050 417 1703 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_21050 1817 2158 gene locus_tag LOCUS_21060 1817 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2349 2191 gene locus_tag LOCUS_21070 2349 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence500 1595 420 gene locus_tag LOCUS_21080 1595 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence501 2185 1556 gene locus_tag LOCUS_21090 2185 1556 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HD0 protein_id gnl|my_center|LOCUS_21090 2861 2178 gene locus_tag LOCUS_21100 gene lspA 2861 2178 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_21100 >Feature sequence502 1717 812 gene locus_tag LOCUS_21110 1717 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence503 138 1259 gene locus_tag LOCUS_21120 138 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_21120 1886 1347 gene locus_tag LOCUS_21130 1886 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2780 1962 gene locus_tag LOCUS_21140 2780 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence504 2749 1124 gene locus_tag LOCUS_21150 2749 1124 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258651.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence505 948 1604 gene locus_tag LOCUS_21160 gene rnhB 948 1604 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_21160 >Feature sequence506 <1 658 gene locus_tag LOCUS_21170 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202475.1:hemolysin 1941 664 gene locus_tag LOCUS_21180 1941 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_21180 2137 2787 gene locus_tag LOCUS_21190 2137 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence507 981 25 gene locus_tag LOCUS_21200 981 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1113 2036 gene locus_tag LOCUS_21210 1113 2036 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861471.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence508 786 1265 gene locus_tag LOCUS_21220 786 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2107 1460 gene locus_tag LOCUS_21230 2107 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence509 1202 1065 gene locus_tag LOCUS_21240 1202 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 <2941 1272 gene locus_tag LOCUS_21250 <2941 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258322.1:O-antigen polymerase >Feature sequence510 2794 1301 gene locus_tag LOCUS_21260 2794 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence511 335 1216 gene locus_tag LOCUS_21270 335 1216 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_21270 1503 2630 gene locus_tag LOCUS_21280 1503 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence512 <1 775 gene locus_tag LOCUS_21290 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790944.1:alkaline serine protease 990 862 gene locus_tag LOCUS_21300 990 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1132 2049 gene locus_tag LOCUS_21310 1132 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2870 2106 gene locus_tag LOCUS_21320 2870 2106 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence513 1665 502 gene locus_tag LOCUS_21330 1665 502 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_21330 <2918 1829 gene locus_tag LOCUS_21340 <2918 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UVH1:1,4-alpha-glucan branching enzyme GlgB >Feature sequence514 1748 687 gene locus_tag LOCUS_21350 1748 687 CDS product dimethylaniline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_21350 2353 1802 gene locus_tag LOCUS_21360 2353 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence515 1789 1157 gene locus_tag LOCUS_21370 1789 1157 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence516 <1 582 gene locus_tag LOCUS_21380 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038965.1:epimerase 1527 553 gene locus_tag LOCUS_21390 1527 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence517 >Feature sequence518 513 1034 gene locus_tag LOCUS_21400 513 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1274 2008 gene locus_tag LOCUS_21410 1274 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence519 1179 1673 gene locus_tag LOCUS_21420 1179 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2585 1686 gene locus_tag LOCUS_21430 2585 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence520 388 173 gene locus_tag LOCUS_21440 388 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 628 1125 gene locus_tag LOCUS_21450 628 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1924 1481 gene locus_tag LOCUS_21460 1924 1481 CDS product OsmC-related redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265892.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence521 >Feature sequence522 >Feature sequence523 2861 1842 gene locus_tag LOCUS_21470 2861 1842 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence524 <1 1544 gene locus_tag LOCUS_21480 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393310.1:glycoside hydrolase 2719 1892 gene locus_tag LOCUS_21490 2719 1892 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence525 <2855 2091 gene locus_tag LOCUS_21500 <2855 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107708.1:histidine kinase >Feature sequence526 <1 584 gene locus_tag LOCUS_21510 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963740.1:2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase 971 2209 gene locus_tag LOCUS_21520 971 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2852 2349 gene locus_tag LOCUS_21530 2852 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence527 2 1438 gene locus_tag LOCUS_21540 2 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence528 1632 517 gene locus_tag LOCUS_21550 1632 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_21550 2714 1680 gene locus_tag LOCUS_21560 gene ruvB 2714 1680 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M0 protein_id gnl|my_center|LOCUS_21560 >Feature sequence529 <1 2477 gene locus_tag LOCUS_21570 <1 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256767.1:peptidase M23 >Feature sequence530 2052 328 gene locus_tag LOCUS_21580 2052 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2839 2138 gene locus_tag LOCUS_21590 2839 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence531 <2839 1860 gene locus_tag LOCUS_21600 <2839 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973184.1:zinc protease >Feature sequence532 <1 860 gene locus_tag LOCUS_21610 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase 1515 2324 gene locus_tag LOCUS_21620 1515 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence533 <1 2397 gene locus_tag LOCUS_21630 <1 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118053.1:beta-lactam sensor/signal transducer >Feature sequence534 76 1521 gene locus_tag LOCUS_21640 76 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1538 2545 gene locus_tag LOCUS_21650 1538 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence535 <2828 426 gene locus_tag LOCUS_21660 <2828 426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122060.1:cytochrome c >Feature sequence536 >Feature sequence537 1265 945 gene locus_tag LOCUS_21670 1265 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1531 1262 gene locus_tag LOCUS_21680 1531 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2082 1528 gene locus_tag LOCUS_21690 2082 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence538 <1 744 gene locus_tag LOCUS_21700 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107393.1:carboxynorspermidine decarboxylase 744 1604 gene locus_tag LOCUS_21710 744 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 <2812 1750 gene locus_tag LOCUS_21720 <2812 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence539 <1 510 gene locus_tag LOCUS_21730 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67681:formyltetrahydrofolate deformylase 1303 1106 gene locus_tag LOCUS_21740 1303 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2045 1557 gene locus_tag LOCUS_21750 2045 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence540 <2807 791 gene locus_tag LOCUS_21760 <2807 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence541 2232 316 gene locus_tag LOCUS_21770 gene gpi2 2232 316 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_21770 <2805 2296 gene locus_tag LOCUS_21780 <2805 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125417.1:VTC domain-containing protein >Feature sequence542 >Feature sequence543 <2792 713 gene locus_tag LOCUS_21790 <2792 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TL9:DNA gyrase subunit A >Feature sequence544 1324 1593 gene locus_tag LOCUS_21800 1324 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 <2790 1842 gene locus_tag LOCUS_21810 <2790 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704328.1:oligopeptidase B >Feature sequence545 644 1132 gene locus_tag LOCUS_21820 gene paaD 644 1132 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_21820 1298 2125 gene locus_tag LOCUS_21830 1298 2125 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_21830 >Feature sequence546 1188 124 gene locus_tag LOCUS_21840 1188 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1756 1253 gene locus_tag LOCUS_21850 1756 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2788 2366 gene locus_tag LOCUS_21860 2788 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence547 1969 1496 gene locus_tag LOCUS_21870 1969 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2446 2147 gene locus_tag LOCUS_21880 2446 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence548 1873 494 gene locus_tag LOCUS_21890 1873 494 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973088.1 protein_id gnl|my_center|LOCUS_21890 2522 2112 gene locus_tag LOCUS_21900 2522 2112 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence549 1628 603 gene locus_tag LOCUS_21910 gene dfrA 1628 603 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_21910 2624 2217 gene locus_tag LOCUS_21920 2624 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence550 1778 327 gene locus_tag LOCUS_21930 1778 327 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence551 588 791 gene locus_tag LOCUS_21940 588 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 844 2631 gene locus_tag LOCUS_21950 844 2631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence552 1346 759 gene locus_tag LOCUS_21960 1346 759 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_21960 2737 1361 gene locus_tag LOCUS_21970 gene leuC 2737 1361 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence553 863 60 gene locus_tag LOCUS_21980 863 60 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_21980 1947 1207 gene locus_tag LOCUS_21990 1947 1207 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence554 1124 1966 gene locus_tag LOCUS_22000 1124 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence555 <1 1230 gene locus_tag LOCUS_22010 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase 1227 2444 gene locus_tag LOCUS_22020 1227 2444 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence556 1525 2643 gene locus_tag LOCUS_22030 gene dnaN 1525 2643 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_22030 >Feature sequence557 >Feature sequence558 1399 704 gene locus_tag LOCUS_22040 1399 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_22040 2643 1723 gene locus_tag LOCUS_22050 2643 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence559 221 1270 gene locus_tag LOCUS_22060 gene pdxA 221 1270 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_22060 2214 1498 gene locus_tag LOCUS_22070 2214 1498 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence560 1756 2361 gene locus_tag LOCUS_22080 1756 2361 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence561 2010 1597 gene locus_tag LOCUS_22090 2010 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2499 2074 gene locus_tag LOCUS_22100 2499 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence562 207 923 gene locus_tag LOCUS_22110 207 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_22110 1933 1112 gene locus_tag LOCUS_22120 1933 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence563 844 647 gene locus_tag LOCUS_22130 844 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1529 987 gene locus_tag LOCUS_22140 1529 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1893 1561 gene locus_tag LOCUS_22150 1893 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence564 1 669 gene locus_tag LOCUS_22160 1 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence565 76 474 gene locus_tag LOCUS_22170 76 474 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_22170 826 1299 gene locus_tag LOCUS_22180 gene rpiB 826 1299 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence566 <1 1561 gene locus_tag LOCUS_22190 <1 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63X50:glycerol kinase 1786 2529 gene locus_tag LOCUS_22200 gene glpF 1786 2529 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence567 265 906 gene locus_tag LOCUS_22210 265 906 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence568 316 771 gene locus_tag LOCUS_22220 316 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 819 2546 gene locus_tag LOCUS_22230 819 2546 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence569 <1 1191 gene locus_tag LOCUS_22240 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962479.1:flavoprotein 1524 1195 gene locus_tag LOCUS_22250 1524 1195 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326562.1 protein_id gnl|my_center|LOCUS_22250 2530 1712 gene locus_tag LOCUS_22260 2530 1712 CDS product stomatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675424.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence570 1 1131 gene locus_tag LOCUS_22270 1 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1213 1413 gene locus_tag LOCUS_22280 1213 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence571 1308 547 gene locus_tag LOCUS_22290 gene paaC 1308 547 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976334.1 protein_id gnl|my_center|LOCUS_22290 1598 1308 gene locus_tag LOCUS_22300 gene paaB 1598 1308 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_22300 2573 1608 gene locus_tag LOCUS_22310 gene paaA 2573 1608 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence572 625 5 gene locus_tag LOCUS_22320 625 5 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_22320 760 1857 gene locus_tag LOCUS_22330 gene ychF 760 1857 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_22330 >Feature sequence573 23 667 gene locus_tag LOCUS_22340 23 667 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_22340 691 1059 gene locus_tag LOCUS_22350 691 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence574 1475 822 gene locus_tag LOCUS_22360 1475 822 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence575 <1 889 gene locus_tag LOCUS_22370 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:formate dehydrogenase 1767 949 gene locus_tag LOCUS_22380 1767 949 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 protein_id gnl|my_center|LOCUS_22380 2093 1812 gene locus_tag LOCUS_22390 2093 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence576 774 1253 gene locus_tag LOCUS_22400 774 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1365 2249 gene locus_tag LOCUS_22410 1365 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402862.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence577 115 1368 gene locus_tag LOCUS_22420 115 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1420 2163 gene locus_tag LOCUS_22430 1420 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence578 1296 613 gene locus_tag LOCUS_22440 1296 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2089 1424 gene locus_tag LOCUS_22450 2089 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22450 >Feature sequence579 557 1303 gene locus_tag LOCUS_22460 557 1303 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_22460 1462 2136 gene locus_tag LOCUS_22470 1462 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2603 2133 gene locus_tag LOCUS_22480 2603 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence580 >Feature sequence581 <2600 2052 gene locus_tag LOCUS_22490 <2600 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC8:DNA topoisomerase (ATP-hydrolyzing) >Feature sequence582 >Feature sequence583 <1 679 gene locus_tag LOCUS_22500 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962326.1:ribose-phosphate pyrophosphokinase 2136 883 gene locus_tag LOCUS_22510 2136 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081499.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence584 >Feature sequence585 <1 858 gene locus_tag LOCUS_22520 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66610:glutamyl-tRNA(Gln) amidotransferase subunit A 978 2366 gene locus_tag LOCUS_22530 978 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence586 1600 887 gene locus_tag LOCUS_22540 gene pyrH 1600 887 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_22540 <2570 1776 gene locus_tag LOCUS_22550 <2570 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU1:elongation factor Ts >Feature sequence587 808 1281 gene locus_tag LOCUS_22560 808 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence588 610 1431 gene locus_tag LOCUS_22570 610 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904083.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence589 1010 2113 gene locus_tag LOCUS_22580 1010 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence590 1 465 gene locus_tag LOCUS_22590 1 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1018 641 gene locus_tag LOCUS_22600 1018 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1651 2526 gene locus_tag LOCUS_22610 1651 2526 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence591 1396 746 gene locus_tag LOCUS_22620 1396 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1508 2512 gene locus_tag LOCUS_22630 1508 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence592 208 657 gene locus_tag LOCUS_22640 208 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1372 644 gene locus_tag LOCUS_22650 1372 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2373 1384 gene locus_tag LOCUS_22660 2373 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence593 732 46 gene locus_tag LOCUS_22670 732 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 856 1254 gene locus_tag LOCUS_22680 856 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1318 2154 gene locus_tag LOCUS_22690 gene tatC 1318 2154 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_22690 >Feature sequence594 443 742 gene locus_tag LOCUS_22700 443 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_108210.2 protein_id gnl|my_center|LOCUS_22700 834 1820 gene locus_tag LOCUS_22710 834 1820 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence595 342 1031 gene locus_tag LOCUS_22720 342 1031 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence596 677 1378 gene locus_tag LOCUS_22730 677 1378 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706227.1 protein_id gnl|my_center|LOCUS_22730 2120 1584 gene locus_tag LOCUS_22740 gene rplQ 2120 1584 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_22740 >Feature sequence597 1026 1850 gene locus_tag LOCUS_22750 1026 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1879 2127 gene locus_tag LOCUS_22760 1879 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22760 >Feature sequence598 2327 1140 gene locus_tag LOCUS_22770 gene mauG 2327 1140 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence599 50 125 gene locus_tag LOCUS_t00210 50 125 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 188 811 gene locus_tag LOCUS_22780 188 811 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence600 1140 394 gene locus_tag LOCUS_22790 1140 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2478 1174 gene locus_tag LOCUS_22800 2478 1174 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence601 1522 452 gene locus_tag LOCUS_22810 gene prfA 1522 452 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727E1 protein_id gnl|my_center|LOCUS_22810 2301 1633 gene locus_tag LOCUS_22820 2301 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence602 2340 841 gene locus_tag LOCUS_22830 2340 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence603 >Feature sequence604 820 1245 gene locus_tag LOCUS_22840 820 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203198.1 protein_id gnl|my_center|LOCUS_22840 2101 1673 gene locus_tag LOCUS_22850 2101 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence605 1218 271 gene locus_tag LOCUS_22860 1218 271 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546428.1 protein_id gnl|my_center|LOCUS_22860 1354 2088 gene locus_tag LOCUS_22870 1354 2088 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence606 1280 87 gene locus_tag LOCUS_22880 1280 87 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_22880 1357 2073 gene locus_tag LOCUS_22890 1357 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence607 1354 50 gene locus_tag LOCUS_22900 1354 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence608 1128 685 gene locus_tag LOCUS_22910 1128 685 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_22910 <2461 1160 gene locus_tag LOCUS_22920 <2461 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787747.1:membrane protein >Feature sequence609 214 915 gene locus_tag LOCUS_22930 214 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1790 912 gene locus_tag LOCUS_22940 1790 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence610 1457 309 gene locus_tag LOCUS_22950 1457 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 <2445 1497 gene locus_tag LOCUS_22960 <2445 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108616.1:thiol reductase thioredoxin >Feature sequence611 <1 1006 gene locus_tag LOCUS_22970 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768487.1:glycosyl transferase 1172 2389 gene locus_tag LOCUS_22980 1172 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence612 2 334 gene locus_tag LOCUS_22990 2 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2424 595 gene locus_tag LOCUS_23000 gene rssA 2424 595 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826015.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence613 757 1962 gene locus_tag LOCUS_23010 gene aspC1 757 1962 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_23010 >Feature sequence614 1114 491 gene locus_tag LOCUS_23020 1114 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1216 2058 gene locus_tag LOCUS_23030 1216 2058 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence615 1181 768 gene locus_tag LOCUS_23040 1181 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203198.1 protein_id gnl|my_center|LOCUS_23040 <2428 1277 gene locus_tag LOCUS_23050 <2428 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267573.1:glucoamylase >Feature sequence616 123 779 gene locus_tag LOCUS_23060 gene scpB 123 779 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_23060 843 1364 gene locus_tag LOCUS_23070 843 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence617 >Feature sequence618 1675 1124 gene locus_tag LOCUS_23080 1675 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence619 <1 1168 gene locus_tag LOCUS_23090 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase 1712 1356 gene locus_tag LOCUS_23100 1712 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence620 219 1685 gene locus_tag LOCUS_23110 219 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence621 1490 63 gene locus_tag LOCUS_23120 1490 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_23120 <2412 1766 gene locus_tag LOCUS_23130 <2412 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203657.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence622 >Feature sequence623 932 1798 gene locus_tag LOCUS_23140 gene yedI 932 1798 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263160.1 protein_id gnl|my_center|LOCUS_23140 1878 2369 gene locus_tag LOCUS_23150 gene msrA 1878 2369 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6A2 protein_id gnl|my_center|LOCUS_23150 >Feature sequence624 >Feature sequence625 1275 514 gene locus_tag LOCUS_23160 1275 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence626 2092 611 gene locus_tag LOCUS_23170 2092 611 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence627 1027 113 gene locus_tag LOCUS_23180 1027 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1918 1178 gene locus_tag LOCUS_23190 1918 1178 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence628 1642 1965 gene locus_tag LOCUS_23200 1642 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence629 1321 746 gene locus_tag LOCUS_23210 1321 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence630 1457 330 gene locus_tag LOCUS_23220 gene hisB 1457 330 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_23220 <2382 1744 gene locus_tag LOCUS_23230 <2382 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PM9:lysine--tRNA ligase >Feature sequence631 >Feature sequence632 <1 789 gene locus_tag LOCUS_23240 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212588.1:transporter 800 1234 gene locus_tag LOCUS_23250 800 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1238 1720 gene locus_tag LOCUS_23260 1238 1720 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence633 979 431 gene locus_tag LOCUS_23270 979 431 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence634 2 373 gene locus_tag LOCUS_23280 2 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence635 744 1712 gene locus_tag LOCUS_23290 744 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1754 2179 gene locus_tag LOCUS_23300 1754 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence636 <1 740 gene locus_tag LOCUS_23310 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963997.1:exopolyphosphatase 830 1726 gene locus_tag LOCUS_23320 830 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence637 <1 565 gene locus_tag LOCUS_23330 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H213:5'-nucleotidase SurE 558 857 gene locus_tag LOCUS_23340 558 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1158 2273 gene locus_tag LOCUS_23350 gene lpxB 1158 2273 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence638 <1 575 gene locus_tag LOCUS_23360 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYK9:UPF0721 transmembrane protein 1244 732 gene locus_tag LOCUS_23370 1244 732 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence639 1682 261 gene locus_tag LOCUS_23380 1682 261 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence640 >Feature sequence641 1167 2093 gene locus_tag LOCUS_23390 gene queG 1167 2093 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_23390 >Feature sequence642 687 1295 gene locus_tag LOCUS_23400 687 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence643 <1 542 gene locus_tag LOCUS_23410 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DUG0:7,8-dihydroneopterin aldolase 1556 675 gene locus_tag LOCUS_23420 1556 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence644 782 1657 gene locus_tag LOCUS_23430 782 1657 CDS product LACX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_23430 2210 1725 gene locus_tag LOCUS_23440 2210 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence645 1635 1414 gene locus_tag LOCUS_23450 1635 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence646 909 355 gene locus_tag LOCUS_23460 909 355 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_23460 1296 931 gene locus_tag LOCUS_23470 1296 931 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_23470 1656 2252 gene locus_tag LOCUS_23480 1656 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence647 710 1258 gene locus_tag LOCUS_23490 710 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence648 985 188 gene locus_tag LOCUS_23500 985 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 <2283 1527 gene locus_tag LOCUS_23510 <2283 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122864.1:transcriptional regulator >Feature sequence649 >Feature sequence650 1335 412 gene locus_tag LOCUS_23520 1335 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence651 141 986 gene locus_tag LOCUS_23530 141 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289351.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence652 1299 2045 gene locus_tag LOCUS_23540 1299 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence653 484 2 gene locus_tag LOCUS_23550 484 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1624 764 gene locus_tag LOCUS_23560 1624 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence654 1055 492 gene locus_tag LOCUS_23570 1055 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence655 >Feature sequence656 419 1600 gene locus_tag LOCUS_23580 419 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence657 2038 434 gene locus_tag LOCUS_23590 2038 434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089705.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence658 121 879 gene locus_tag LOCUS_23600 121 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence659 366 1277 gene locus_tag LOCUS_23610 366 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence660 1441 1821 gene locus_tag LOCUS_23620 1441 1821 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence661 1124 231 gene locus_tag LOCUS_23630 1124 231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_23630 1446 2120 gene locus_tag LOCUS_23640 1446 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence662 800 1258 gene locus_tag LOCUS_23650 800 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence663 <2210 1343 gene locus_tag LOCUS_23660 <2210 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650A0:mannonate dehydratase >Feature sequence664 543 1121 gene locus_tag LOCUS_23670 gene adk 543 1121 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_23670 >Feature sequence665 <2205 444 gene locus_tag LOCUS_23680 <2205 444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence666 162 749 gene locus_tag LOCUS_23690 162 749 CDS product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_23690 742 975 gene locus_tag LOCUS_23700 742 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 989 1903 gene locus_tag LOCUS_23710 989 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence667 581 2119 gene locus_tag LOCUS_23720 gene pccB 581 2119 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence668 851 1594 gene locus_tag LOCUS_23730 gene uppS 851 1594 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 protein_id gnl|my_center|LOCUS_23730 >Feature sequence669 >Feature sequence670 1811 1167 gene locus_tag LOCUS_23740 1811 1167 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence671 >Feature sequence672 282 722 gene locus_tag LOCUS_23750 282 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 <2176 704 gene locus_tag LOCUS_23760 <2176 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963589.1:histidine kinase >Feature sequence673 517 1146 gene locus_tag LOCUS_23770 gene udk 517 1146 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_23770 >Feature sequence674 282 1715 gene locus_tag LOCUS_23780 gene gatB 282 1715 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_23780 >Feature sequence675 <1 1347 gene locus_tag LOCUS_23790 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein <2160 1363 gene locus_tag LOCUS_23800 <2160 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404651.1:DNA-binding protein >Feature sequence676 >Feature sequence677 978 1526 gene locus_tag LOCUS_23810 978 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence678 <2154 4 gene locus_tag LOCUS_23820 <2154 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA >Feature sequence679 1780 398 gene locus_tag LOCUS_23830 1780 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence680 >Feature sequence681 <1 576 gene locus_tag LOCUS_23840 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P08200:isocitrate dehydrogenase [NADP] <2130 948 gene locus_tag LOCUS_23850 <2130 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964301.1:ATPase >Feature sequence682 1300 32 gene locus_tag LOCUS_23860 1300 32 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_23860 2125 1568 gene locus_tag LOCUS_23870 2125 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence683 753 1136 gene locus_tag LOCUS_23880 753 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1988 1218 gene locus_tag LOCUS_23890 1988 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence684 >Feature sequence685 <2115 928 gene locus_tag LOCUS_23900 <2115 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence686 >Feature sequence687 >Feature sequence688 1518 271 gene locus_tag LOCUS_23910 1518 271 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_23910 >Feature sequence689 1129 62 gene locus_tag LOCUS_23920 1129 62 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_23920 1255 1665 gene locus_tag LOCUS_23930 1255 1665 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_23930 >Feature sequence690 <1 625 gene locus_tag LOCUS_23940 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722722.1:hemolysin D >Feature sequence691 <1 1304 gene locus_tag LOCUS_23950 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein >Feature sequence692 >Feature sequence693 <1 1740 gene locus_tag LOCUS_23960 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405417.1:T9SS C-terminal target domain-containing protein >Feature sequence694 1466 9 gene locus_tag LOCUS_23970 gene phrB 1466 9 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403933.1 protein_id gnl|my_center|LOCUS_23970 1935 1642 gene locus_tag LOCUS_23980 1935 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence695 >Feature sequence696 >Feature sequence697 <1 986 gene locus_tag LOCUS_23990 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020392.1:MATE family efflux transporter >Feature sequence698 2 985 gene locus_tag LOCUS_24000 2 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence699 1387 68 gene locus_tag LOCUS_24010 gene argH 1387 68 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_24010 <2076 1397 gene locus_tag LOCUS_24020 <2076 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201961.1:acetylornithine deacetylase >Feature sequence700 144 69 gene locus_tag LOCUS_t00220 144 69 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1170 244 gene locus_tag LOCUS_24030 gene hemF 1170 244 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK3 protein_id gnl|my_center|LOCUS_24030 <2075 1223 gene locus_tag LOCUS_24040 <2075 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence701 598 1167 gene locus_tag LOCUS_24050 598 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 <2075 1528 gene locus_tag LOCUS_24060 <2075 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403516.1:histidine kinase >Feature sequence702 <1 1204 gene locus_tag LOCUS_24070 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766931.1:zinc protease 1204 1842 gene locus_tag LOCUS_24080 1204 1842 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence703 >Feature sequence704 3 1154 gene locus_tag LOCUS_24090 3 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence705 >Feature sequence706 >Feature sequence707 684 238 gene locus_tag LOCUS_24100 684 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 774 1778 gene locus_tag LOCUS_24110 774 1778 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence708 1816 791 gene locus_tag LOCUS_24120 1816 791 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence709 256 1008 gene locus_tag LOCUS_24130 256 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24130 1076 1633 gene locus_tag LOCUS_24140 gene def 1076 1633 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_24140 >Feature sequence710 <1997 1047 gene locus_tag LOCUS_24150 <1997 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963173.1:dehydrogenase >Feature sequence711 >Feature sequence712 >Feature sequence713 >Feature sequence714 >Feature sequence715 824 9 gene locus_tag LOCUS_24160 824 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1015 1959 gene locus_tag LOCUS_24170 gene trxB1 1015 1959 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence716 >Feature sequence717 1361 876 gene locus_tag LOCUS_24180 1361 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence718 >Feature sequence719 >Feature sequence720 >Feature sequence721 1416 1916 gene locus_tag LOCUS_24190 1416 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence722 389 1054 gene locus_tag LOCUS_24200 389 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 <1944 1076 gene locus_tag LOCUS_24210 <1944 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYM2:UvrABC system protein A >Feature sequence723 1941 1558 gene locus_tag LOCUS_24220 gene rsfS 1941 1558 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRB4 protein_id gnl|my_center|LOCUS_24220 >Feature sequence724 <1 1052 gene locus_tag LOCUS_24230 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257690.1:lycopene cyclase >Feature sequence725 560 1297 gene locus_tag LOCUS_24240 560 1297 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence726 >Feature sequence727 1086 361 gene locus_tag LOCUS_24250 gene coaX 1086 361 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence728 1100 297 gene locus_tag LOCUS_24260 gene proC 1100 297 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_24260 <1929 1248 gene locus_tag LOCUS_24270 <1929 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE5:pyruvate dehydrogenase E1 component subunit alpha >Feature sequence729 34 807 gene locus_tag LOCUS_24280 34 807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence730 670 482 gene locus_tag LOCUS_24290 670 482 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_24290 821 1522 gene locus_tag LOCUS_24300 821 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence731 1537 956 gene locus_tag LOCUS_24310 1537 956 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence732 <1916 44 gene locus_tag LOCUS_24320 <1916 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813448.1:TonB-dependent receptor >Feature sequence733 1831 644 gene locus_tag LOCUS_24330 1831 644 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence734 589 1233 gene locus_tag LOCUS_24340 gene pcm 589 1233 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_24340 1661 1230 gene locus_tag LOCUS_24350 1661 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence735 139 489 gene locus_tag LOCUS_24360 139 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence736 >Feature sequence737 1178 135 gene locus_tag LOCUS_24370 1178 135 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence738 133 1437 gene locus_tag LOCUS_24380 gene der 133 1437 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_24380 >Feature sequence739 712 1608 gene locus_tag LOCUS_24390 712 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence740 665 1390 gene locus_tag LOCUS_24400 665 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence741 712 20 gene locus_tag LOCUS_24410 712 20 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence742 1052 1867 gene locus_tag LOCUS_24420 1052 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence743 >Feature sequence744 185 1426 gene locus_tag LOCUS_24430 185 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence745 <1 944 gene locus_tag LOCUS_24440 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein >Feature sequence746 >Feature sequence747 >Feature sequence748 <1 1417 gene locus_tag LOCUS_24450 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962677.1:anthranilate synthase component I >Feature sequence749 292 1026 gene locus_tag LOCUS_24460 292 1026 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence750 491 1351 gene locus_tag LOCUS_24470 491 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1684 1439 gene locus_tag LOCUS_24480 1684 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence751 >Feature sequence752 1 585 gene locus_tag LOCUS_24490 1 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1794 586 gene locus_tag LOCUS_24500 1794 586 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence753 >Feature sequence754 >Feature sequence755 >Feature sequence756 677 1192 gene locus_tag LOCUS_24510 677 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence757 6 263 gene locus_tag LOCUS_24520 6 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 <1829 765 gene locus_tag LOCUS_24530 <1829 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403490.1:oxidoreductase >Feature sequence758 >Feature sequence759 <1825 308 gene locus_tag LOCUS_24540 <1825 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404636.1:DUF547 domain-containing protein >Feature sequence760 <1823 1018 gene locus_tag LOCUS_24550 <1823 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730949.1:polyprenyl glycosylphosphotransferase >Feature sequence761 920 285 gene locus_tag LOCUS_24560 920 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1736 1008 gene locus_tag LOCUS_24570 1736 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence762 >Feature sequence763 >Feature sequence764 702 1121 gene locus_tag LOCUS_24580 702 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence765 1805 531 gene locus_tag LOCUS_24590 1805 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence766 <1 160 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaggtaatttgatctgaaagcaattcacaa 435 1556 gene locus_tag LOCUS_24600 435 1556 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389257.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence767 <1 1095 gene locus_tag LOCUS_24610 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038080.1:lipase >Feature sequence768 >Feature sequence769 >Feature sequence770 998 1291 gene locus_tag LOCUS_24620 998 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence771 <1 681 gene locus_tag LOCUS_24630 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963482.1:DNA repair protein RadC 711 1763 gene locus_tag LOCUS_24640 gene corA 711 1763 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence772 >Feature sequence773 697 215 gene locus_tag LOCUS_24650 697 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence774 >Feature sequence775 >Feature sequence776 <1 980 gene locus_tag LOCUS_24660 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121485.1:4Fe-4S ferredoxin >Feature sequence777 <1752 433 gene locus_tag LOCUS_24670 <1752 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405197.1:carboxypeptidase M32 >Feature sequence778 485 1471 gene locus_tag LOCUS_24680 485 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence779 >Feature sequence780 >Feature sequence781 221 817 gene locus_tag LOCUS_24690 221 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1722 868 gene locus_tag LOCUS_24700 1722 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence782 <1742 868 gene locus_tag LOCUS_24710 <1742 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962301.1:acyltransferase >Feature sequence783 45 536 gene locus_tag LOCUS_24720 45 536 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_24720 1732 629 gene locus_tag LOCUS_24730 1732 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence784 838 1515 gene locus_tag LOCUS_24740 838 1515 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence785 123 1205 gene locus_tag LOCUS_24750 123 1205 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930153.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence786 443 1000 gene locus_tag LOCUS_24760 443 1000 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence787 >Feature sequence788 <1 1030 gene locus_tag LOCUS_24770 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143421.1:sensor histidine kinase >Feature sequence789 <1685 1171 gene locus_tag LOCUS_24780 <1685 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000058536.1:histidine kinase >Feature sequence790 <1683 582 gene locus_tag LOCUS_24790 <1683 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109189.1:hemolysin D >Feature sequence791 >Feature sequence792 <1 812 gene locus_tag LOCUS_24800 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143083.1:delta(24)-sterol C-methyltransferase >Feature sequence793 <1 886 gene locus_tag LOCUS_24810 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A2:arginine decarboxylase >Feature sequence794 1304 570 gene locus_tag LOCUS_24820 1304 570 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256999.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence795 >Feature sequence796 <1 735 gene locus_tag LOCUS_24830 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918189.1:Xaa-Pro dipeptidase 739 1371 gene locus_tag LOCUS_24840 739 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence797 >Feature sequence798 >Feature sequence799 539 1345 gene locus_tag LOCUS_24850 539 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence800 >Feature sequence801 933 133 gene locus_tag LOCUS_24860 933 133 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence802 <1618 153 gene locus_tag LOCUS_24870 <1618 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence803 >Feature sequence804 >Feature sequence805 41 1180 gene locus_tag LOCUS_24880 41 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence806 <1 1490 gene locus_tag LOCUS_24890 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964073.1:gliding motility protein GldM >Feature sequence807 <1602 526 gene locus_tag LOCUS_24900 <1602 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088479.1:transcriptional regulator >Feature sequence808 >Feature sequence809 772 275 gene locus_tag LOCUS_24910 772 275 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_24910 <1596 929 gene locus_tag LOCUS_24920 <1596 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108811.1:ribonuclease H >Feature sequence810 >Feature sequence811 1044 1 gene locus_tag LOCUS_24930 1044 1 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence812 <1 1230 gene locus_tag LOCUS_24940 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117742.1:cysteine proteinase >Feature sequence813 726 292 gene locus_tag LOCUS_24950 726 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence814 726 1541 gene locus_tag LOCUS_24960 726 1541 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence815 <1 601 gene locus_tag LOCUS_24970 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963090.1:acetyl-coenzyme A synthetase 773 1432 gene locus_tag LOCUS_24980 773 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24980 >Feature sequence816 549 926 gene locus_tag LOCUS_24990 549 926 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence817 512 928 gene locus_tag LOCUS_25000 512 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 946 1494 gene locus_tag LOCUS_25010 946 1494 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence818 >Feature sequence819 >Feature sequence820 >Feature sequence821 <1523 231 gene locus_tag LOCUS_25020 <1523 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226929.1:SGNH hydrolase >Feature sequence822 >Feature sequence823 >Feature sequence824 250 1242 gene locus_tag LOCUS_25030 250 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence825 >Feature sequence826 790 473 gene locus_tag LOCUS_25040 790 473 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_25040 1498 803 gene locus_tag LOCUS_25050 1498 803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence827