COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..465458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..1110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1135..1884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1951..2817) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531569.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3006..3488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3500..6487) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6565..7398 product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9P7 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene fdhD CDS complement(7582..8454) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8473..10032) product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene fadD3 CDS complement(10049..10819) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10951..11403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 11587..12480 product putative 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701337.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12480..13367 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13370..14167 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14164..15030 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene paaG CDS 15027..16145 product putative 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 16171..16941 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene paaG CDS 16938..18101 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18235..19293 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 19305..20453 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene atoB CDS 20500..21375 product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 21381..23735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 23793..24389 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197883.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 24492..24749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 24825..25631 product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 25752..26495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 26492..27427 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(27457..28989) product alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene phoD CDS 29227..29835 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene tetR CDS 29917..30540 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene pncA CDS complement(30950..31420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(31490..31927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(32229..32951) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(32948..33592) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(33589..34359) product acetylglucosaminylphosphatidylinositol deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(34347..35411) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(35437..37599) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN3 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene katE CDS 37890..38192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38187..42728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 42871..43695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(43743..46043) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 46303..47106 product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(47173..47547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 47486..48937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(48963..49367) product hypothetical HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 49575..50723 product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene yjcL CDS complement(50727..52214) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C940 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene zwf CDS complement(52359..53612) product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT99 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene clsB CDS complement(53609..54373) product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 54510..55463 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(55476..56126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 56091..56318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(56284..56925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(57010..57762) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(57759..58610) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(58661..59329) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 59493..60542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(60589..60927) product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene pilZ CDS complement(60940..61902) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(61899..62522) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene tmk CDS complement(62519..63523) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(63525..64343) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene pabC CDS complement(64336..65712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene trpE CDS complement(65774..67006) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX5 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(67038..67283) product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene acpP1 CDS complement(67468..68217) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene fabG CDS complement(68218..69150) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH6 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(69147..69761) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 69906..70403 product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene xcpT CDS 70527..71249 product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene gspH CDS 71375..71812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 71809..72489 product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene xcsJ CDS 72498..73454 product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT3 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene gspK CDS 73458..74660 product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene xcpY CDS 74657..75163 product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25061 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene xcpZ CDS 75160..75915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 75912..76382 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(76402..77691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 78083..79162 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MH98 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene trmU CDS complement(79610..81082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(81177..82325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(82361..84847) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(84984..85187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(85217..86029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(86026..86661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 86850..89507 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene rpfA CDS 89567..90394 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 90502..91269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(91390..91983) product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 92243..93163 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 93175..94374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(94421..94921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(94924..99990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(99954..101123) product glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JST6 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene bcsZ CDS complement(101157..105614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(105640..106389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(106448..107341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(107354..107836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(108065..108463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(108460..108996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 109279..109899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 109896..110408 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene sixA CDS complement(110654..112150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(112207..115257) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene fecA CDS 115298..115516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(115780..116361) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 116430..117026 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(117013..117873) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(117887..118735) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(118746..120227) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(120359..121078) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(121075..123012) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene yoaA CDS complement(123063..123647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(123644..125962) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene mrcB CDS 126108..126818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(126792..128045) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(128171..129445) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene serS CDS complement(129513..129908) product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW19 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene crcB CDS complement(129905..131251) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(131315..131935) product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW06 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene lolA CDS complement(132020..132508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(132538..134889) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene ftsK CDS 135058..135393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 135409..136581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 136578..137333 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene aat CDS 137330..138037 product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene ate CDS 138107..138301 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM3 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene infA CDS complement(138596..140869) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene clpA CDS complement(140869..141186) product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJD6 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene clpS CDS complement(141370..143580) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene gidA CDS 143817..144629 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene gspC CDS 144631..146679 product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene xcpQ CDS 146688..148184 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37093 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene epsE CDS 148242..149462 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene xcpS CDS 149462..150322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(150313..151428) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL98 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene alr-2 CDS complement(151440..152858) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW7 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(152927..153379) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC0 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rplI CDS complement(153392..153619) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7U1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rpsR CDS complement(153622..154062) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM9 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rpsF CDS complement(154215..155177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(155174..155908) product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM8 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rlmB CDS complement(156051..156764) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(156761..159085) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rnr note possible pseudo, frameshifted tRNA 159134..159218 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(160066..160986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(161554..161778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 161668..162897 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FM1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 162899..163363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(163376..164242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(164433..165464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(166335..167330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(167334..168755) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(169346..170443) product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MU27 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene dcm CDS complement(170664..171911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(171946..172389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 172558..172866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 173002..173448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 173448..173855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 173858..175495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 175816..179592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(179922..181283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(181280..183625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 tRNA complement(183972..184047) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(184122..184802) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK2 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene queC CDS complement(184799..185488) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene queE CDS complement(185490..186275) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(186332..186850) product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene ompP6 CDS complement(186896..188188) product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene tolB CDS complement(188188..189213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(189236..189682) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene tolR CDS complement(189679..190365) product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(190362..190772) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(190913..191947) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene ruvB CDS complement(191944..192531) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QU8 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene ruvA CDS complement(192528..193046) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA7 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene ruvC CDS complement(193059..193811) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW02 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(194021..194557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(194641..196077) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene lpdG CDS complement(196222..197463) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene sucB CDS complement(197513..200377) product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636859.2 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene sucA CDS complement(200420..201325) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G7 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene galU CDS complement(201388..202266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(202305..203582) product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene cycH CDS complement(203579..204022) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036834.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene cycL CDS complement(204019..204534) product cytochrome C-type biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene ccmG CDS complement(204541..206514) product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene ccmF CDS complement(206511..206999) product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene ccmE CDS complement(206996..207160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(207153..207911) product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene ccmC CDS complement(207908..208573) product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE4 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(208574..209170) product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene ccmA tRNA complement(209262..209348) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(209465..209538) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(209607..209682) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(209799..210359) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene pgsA CDS complement(210459..212276) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X7 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene uvrC CDS complement(212347..213063) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene uvrY CDS 213325..214689 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene phoA CDS complement(214753..216072) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene aceA CDS complement(216598..217083) product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J86 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(217080..217592) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene dsbB CDS 217734..219293 product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 219405..219566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(219632..221152) product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAC6 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 221415..223706 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 223752..224606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(224619..226004) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene fumC CDS 226189..227556 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUG3 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 227556..228032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(228045..228419) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(228479..228853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 229198..229788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(229959..230501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(230498..231604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(231772..232983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(233066..234112) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62K45 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene pyrD CDS complement(234109..234795) product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7I9 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene ribA CDS complement(234792..236210) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene fabG CDS 236558..237442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 237592..239166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 239268..240710 product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene gtfA CDS complement(240717..241595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 241763..242491 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene ompR CDS 242488..243723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 243932..245086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 245125..246360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(246378..248783) product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I596 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(248872..249960) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 250086..250676 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391448.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 250676..251878 product amino acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 251901..253229 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 253238..254428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(254529..254990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 255849..257777 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 257788..259257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 259257..260531 product oxidoreductase FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 260596..261609 product cytochrome c554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 261618..263828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 263825..264640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 264643..266895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 267004..268008 product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene dusA CDS 268060..268596 product peptidyl-prolyl cis-trans isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_011090.2 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene ppiB-2 CDS 268610..269356 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene lpxH CDS 269456..271354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(271355..272128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(272125..273309) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene metZ CDS complement(273472..274992) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene purF CDS complement(274996..275514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(275669..276388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(276381..277613) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene folC CDS complement(277731..278648) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MP2 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene accD1 CDS complement(278662..279471) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene trpA CDS complement(279545..280135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(280135..280614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(280611..281933) product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(281930..282577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(282574..283197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(283246..284013) product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(284024..284449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(284485..284835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(284876..286042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(286039..288606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(288647..290773) product EscV/YscV/HrcV family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene bcrD CDS complement(291030..291479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 291586..292716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 292713..293324 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 293321..294424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 294411..295076 product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene sctR CDS 295083..295349 product EscS/YscS/HrcS family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene yscS CDS 295354..296145 product type III secretion system protein SsaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene ssaT CDS complement(296189..297247) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene yscU CDS 297388..297753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 297753..298463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(298496..299098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(299109..300386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 300753..301736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 301925..302605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 302715..303452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 303490..304053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(304063..305280) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene trpB CDS complement(305264..305905) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene trpF CDS complement(305920..306684) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN7 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene truA CDS complement(306702..307349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(307436..310555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(310723..311748) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT63 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene asd CDS complement(311804..312880) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene leuB CDS complement(312891..313652) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(313655..314293) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene leuD CDS complement(314290..315726) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0Y9 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene leuC CDS 315861..316727 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 316894..317739 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(317841..319715) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene uup CDS complement(319761..320942) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(320978..322678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(323118..323678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(323695..324438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(324435..324851) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(324844..328170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(328550..330340) product acyl-CoA dehydrogenase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(330541..331644) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12008 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene aroC CDS complement(331672..332580) product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM8 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene prmB CDS 332697..333311 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 333319..334206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 334290..335753 product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(335784..336770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(336911..338080) product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene lapB CDS complement(338135..338452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(338449..338751) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ihfB CDS complement(338874..340553) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene rpsA CDS complement(340649..341335) product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene cmk CDS complement(341328..342662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 note possible pseudo, internal stop codon, frameshifted CDS complement(342659..343537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(343534..344676) product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene hisC2 CDS complement(344794..345891) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(346001..347083) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGB4 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene serC CDS 347234..348142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(348219..348587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 348981..351617 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 351718..352476 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 352512..352784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 352840..354492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 354527..354970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(354973..355566) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(355672..358407) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene gyrA CDS 358718..359398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(359377..360717) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene tilS CDS complement(360714..361673) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene accA CDS complement(361696..365247) product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW8 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene dnaE1 CDS complement(365252..365842) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYB6 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rnhB CDS complement(365839..366972) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene lpxB CDS complement(367118..367891) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95379 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene lpxA CDS complement(367888..368352) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N2 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene fabZ CDS complement(368345..369406) product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene lpxD CDS complement(369426..369902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(369982..372231) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene bamA CDS complement(372309..373670) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG8 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene rseP CDS complement(373663..374862) product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JD0 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene dxr CDS complement(374862..375683) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV8 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene cdsA CDS complement(375683..376402) product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY2 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene uppS CDS complement(376425..376982) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene frr CDS complement(377002..377721) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene pyrH CDS complement(377984..378862) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene tsf CDS complement(378859..379638) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MED2 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene rpsB CDS 380019..380783 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAU5 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene map CDS 380919..383615 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene glnD CDS 383724..384542 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG0 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene dapD CDS complement(384590..386305) product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(386390..386839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 386946..388091 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHR5 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene dapE CDS 388088..389071 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(389042..390847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(391085..392104) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 tRNA 392255..392342 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(392533..393396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 tRNA complement(393690..393765) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 393832..394410 product pre-pilin like leader sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene fimT CDS 394407..394973 product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene pilV CDS 395015..396016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 396019..396666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 396724..402132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 402135..402602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 402623..403114 product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene pilE CDS 403140..403643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(403697..404647) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene ispH CDS complement(404648..405148) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJE2 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene lspA CDS complement(405148..405543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(405543..408362) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene ileS CDS complement(408426..409355) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene ribF CDS complement(409422..409982) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene orn CDS 410190..411371 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 411566..412414 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 412616..412954 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 413007..414266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 414263..415498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 415513..416145 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXY9 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene upp CDS 416305..416535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55533 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 416525..416809 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(416903..417508) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL54 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene recR CDS complement(417525..417848) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44711 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(417901..419592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(419891..421015) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene ald CDS complement(421207..423435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 tRNA complement(423665..423739) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(423776..423852) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 424063..424139 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 424316..425440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 425437..426618 product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 426669..427457 product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(427485..428471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(428536..430398) product glycine/betaine transmethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene gbt CDS 430776..430994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(430916..432802) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 433015..433755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(433759..434958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(435013..435918) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(435915..436790) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene nodI CDS complement(436794..437180) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(437194..437943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(438053..439660) product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(439657..440169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(440174..440797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(440797..442335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(442332..442985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(442982..444778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene atuA CDS complement(444780..445562) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 445728..446276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 446291..447298 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene paaG CDS 447411..448625 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene acdA CDS 448622..449485 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 449598..450872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 451114..451545 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(451555..451941) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE72 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene acpS CDS complement(451938..452699) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCP4 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene pdxJ CDS complement(452707..453426) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB50 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene recO CDS complement(453478..454356) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene era CDS complement(454519..455187) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB52 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene rnc CDS complement(455184..455573) product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(455573..456391) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene lepB-1 CDS complement(456476..458281) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQE7 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene lepA CDS complement(458345..458599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(458596..459999) product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene mucD CDS complement(460071..460535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(460532..461572) product sugar dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(461577..462245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(462352..462948) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 463086..464702 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene nadB tmRNA 464759..465118 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 sequence02 source 1..312553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 534..911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 1052..1381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 1591..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 tRNA complement(2924..3014) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(3514..4707) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(4785..7430) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene alaS CDS complement(7692..8585) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207654.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(8619..9092) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene recX CDS complement(9076..10095) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MH0 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene recA CDS 10274..11389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(11379..11912) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKD6 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene ligT CDS complement(11905..12399) product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 12539..15124 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene mutS CDS complement(15143..18778) product N-methylhydantoinase HyuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(18892..19284) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGR2 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene vapC CDS complement(19281..19502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(19833..21590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 21734..22669 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(22676..23758) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0F5 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(23828..25399) product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(25408..26511) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(26504..27937) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(27969..28502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 28544..29017 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene tspO CDS complement(29031..29516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 29645..31663 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAY7 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene metG CDS 31680..32273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 32349..32540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 32686..32979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 33094..33780 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK4 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene nth CDS complement(33789..35405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(35739..36503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(36577..37806) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 37967..39631 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45127 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene ettA CDS 39677..40438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 40736..42001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 42072..42284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 42304..42693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(42702..42947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(43089..43283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(43614..44546) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(44629..46092) product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ97 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene gcvPB CDS complement(46118..46618) product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57668 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene tpx CDS complement(46653..48011) product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ95 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene gcvPA CDS complement(48248..48637) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene gcvH CDS complement(48752..49834) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7E8 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene gcvT CDS 50365..52029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 52040..59554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 59578..60318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 60321..61055 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528770.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 61127..61891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 61948..62580 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rpoE CDS 62577..63251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 63251..64570 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637033.2 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 64750..66801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(67018..67428) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530666.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(67553..68644) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(68686..70836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(70833..72914) product dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 73063..73719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 73840..75189 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene mgtE CDS complement(75367..76032) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(76045..76401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(76439..77080) product curli production assembly protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(77568..78758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(79254..79943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(80023..80250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 80421..81458 product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5H9 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene rsgA CDS complement(81455..82396) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 82502..83521 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(83722..84609) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(84626..85360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 85811..86590 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene thiD CDS 86720..87349 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene thiE CDS 87346..88626 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P812 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene hemL CDS 88634..90679 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 90708..91637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 91673..92374 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene ftsE CDS 92361..93335 product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene ftsX CDS 93447..94313 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4M9 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene rpoH CDS complement(94395..94724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(94721..97810) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene acrD CDS complement(98061..101279) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(101296..102435) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene czcB CDS complement(102535..102819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 103173..103655 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB16 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene slyD CDS 103683..104573 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(104655..104960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(105216..105620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 105846..106151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 106199..107080 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ35 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene ttcA CDS 107089..108003 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(108028..108798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(108914..109234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 109583..110086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(110310..110993) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y17 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(111001..112272) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene ycaD CDS complement(112376..112966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(112953..113375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(113372..113974) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene rpoE CDS 114260..116431 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene priA CDS 116515..118272 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene argS CDS 118272..118877 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 118969..120963 product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 120963..121481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 121618..122130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 122215..123087 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(123451..125475) product extracellular protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23314 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 125819..126205 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 126485..127477 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 127506..128303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 128576..128839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(129114..131837) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P336 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene ppc CDS 132042..133472 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene ahcY CDS 133592..134452 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I687 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene metF CDS complement(134460..137237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 137402..138031 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 138028..138687 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS90 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene mtgA CDS complement(138718..138855) product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(139046..140356) product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene yeiM CDS complement(140398..141306) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 141403..142005 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EGP9 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene azoR CDS 142052..142918 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(142936..143742) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(143742..144947) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU91 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene hutI CDS complement(145027..146376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 146732..148897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 148953..149597 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(149605..152043) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene fyuA CDS 152486..153679 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene metK CDS complement(153765..153986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(154204..154761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 154646..155005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 tRNA 154996..155071 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 155217..156473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(156483..157343) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 157482..158300 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene ephC CDS 158440..160938 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene fadE CDS 160935..162470 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 162567..164303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 164296..166467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 166480..167130 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(167118..167783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(167785..168186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(168301..169482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 169554..170189 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 170219..171754 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU3 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene hutH CDS 171839..172786 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(172798..173589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(173594..175771) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP62 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene uvrD CDS complement(175830..177044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(177139..177762) product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002062720.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(177738..179288) product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene yhcX CDS 179495..180613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(180734..181609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(181616..182257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(182463..182933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(183010..184050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(184511..184858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(184855..185493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(185477..188368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(188365..190266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 190921..192063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 192425..192994 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene nasT CDS 192994..194178 product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 194243..194641 product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 194940..196385 product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 196503..197534 product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 197544..198524 product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 198584..201181 product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene nirB CDS 201178..201528 product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene nirD-2 CDS 201525..202745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 202807..205515 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene narB CDS complement(205677..206384) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(206398..207993) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene emrB CDS complement(208003..209067) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(209064..210371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(210407..211225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 211495..212157 product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(212259..213653) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(213678..214745) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 214854..215870 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene add CDS 215914..216963 product purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 216979..217824 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPI8 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene mtnN CDS 217883..219283 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 219499..221853 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(221869..222810) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(222865..224022) product purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(224372..226840) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(227265..228380) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 228784..229134 product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T56 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 229151..230608 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 230620..232926 product xanthine dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene xdhB CDS 233157..234263 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 234281..235786 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 235773..236843 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 236979..237908 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 237916..239148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 239145..240452 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 240845..241606 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 241625..242578 product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 242575..244326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 244338..245600 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 245637..245963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 245991..246167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(246371..247027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 247279..247737 product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 247750..249969 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 249969..250928 product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 250915..251517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(251521..251952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(251994..252350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 252459..253043 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJS4 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene mobA CDS 253040..254047 product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGG5 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene moaA CDS 254199..254441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 254444..254950 product molybdopterin converting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 254943..255881 product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene moaCB CDS 255878..256657 product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene modA CDS 256665..257336 product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene modB CDS 257344..258036 product molybdate-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Y1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene modC CDS 258030..259226 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene moeA CDS complement(259257..260192) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 260381..261715 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(261857..262888) product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(262885..263241) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 263372..263734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(263741..264136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(264182..265078) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(265180..266706) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 266826..267275 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(267289..269517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 269614..270081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 270081..271556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(271706..272827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(272973..276044) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene dnaE2 CDS complement(276062..277495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(277495..277911) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(277991..278374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(278455..278718) product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RC5 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene minE CDS complement(278718..279530) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene minD CDS complement(279601..280299) product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBJ4 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene minC CDS 280456..283773 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 283900..285420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 285420..286349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(286433..287239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 287437..288030 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 288027..288884 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 288990..290294 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD48 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene purD CDS 290291..290887 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(290959..292332) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP8 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene rho CDS complement(292453..292788) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene trxA CDS 293030..294322 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT4 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene rhlB CDS 294291..294443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 294500..295423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 295639..297225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 297345..298322 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene mdh CDS 298366..299328 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene corA CDS complement(299369..299983) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 300180..301457 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene mexE CDS 301487..304675 product resistance-nodulation-cell division multidrug efflux transporter MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene mexF CDS 304672..305016 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene trxA CDS 305049..306521 product multidrug efflux outer membrane protein OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene oprN CDS 306518..307207 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 307473..307838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 308742..309251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(309284..309502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 309676..310224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(310315..310473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(311473..311814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(311804..311974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 sequence03 source 1..256962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(813..3809) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4N7 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 4629..5216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 5209..6363 product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene pilW CDS 6365..6943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 6952..10686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 10683..11171 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 11413..11616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 11753..12898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(12906..14150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(14183..15364) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(15413..17446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(17443..18852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(18918..19778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(19778..21214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(21214..22230) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057605.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 22581..23378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 23490..24731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(24958..25938) product succinoglycan biosynthesis protein ExoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene exoO CDS complement(26002..26793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 26704..27036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(27437..28396) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW29 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene fabH CDS 28619..29782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(29789..30553) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 30645..31109 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 31106..31912 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 33015..35591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 35768..36523 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(36713..38170) product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene prpD CDS complement(38271..39524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(39622..41943) product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene icd2 CDS 42505..43167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 43230..45767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 46156..46812 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene gst14 CDS complement(46941..47429) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(47588..47797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(47885..48418) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene yafM CDS complement(48587..49774) product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(50070..50519) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(50576..53170) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene acnA CDS complement(53347..54501) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene prpC CDS complement(54514..55404) product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NU3 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene prpB CDS 55640..57262 product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene prpR CDS 57441..58220 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHX9 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene kynA CDS 58217..59449 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP4 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene kynU CDS 59693..61378 product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 61563..63686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 63787..64893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(64941..66098) product porin P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05695 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene oprP CDS complement(66277..67536) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(67545..68384) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA53 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(68381..69355) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(69449..70699) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(70717..71076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(71110..71526) product transcription initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(71833..72162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 72515..73318 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P242 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene map CDS complement(73366..74307) product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(74304..75392) product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(75622..76350) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(76425..78041) product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945834.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(78104..78790) product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(78787..79491) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3M7 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene ubiG CDS complement(79488..80813) product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 80960..81997 product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB2 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene mtnA CDS 82098..83759 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene pyrG CDS 83756..84592 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z5 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene kdsA CDS 84978..86456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 86469..88043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 88043..88885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(88953..91589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 91810..93117 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene eno CDS 93147..93422 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M2 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ftsB CDS 93441..94154 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ2 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene ispD CDS 94238..94717 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene ispF CDS 95210..97177 product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(97234..97770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 97824..98573 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KI21 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene surE CDS 98570..99241 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene pcm CDS 99243..99866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 99863..100630 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 100765..101973 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 101970..103283 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene hom CDS 103357..104472 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene thrC CDS 104469..106193 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene recJ CDS complement(106557..106718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(106770..109862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(110109..111374) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2S3 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene sufS CDS complement(111371..112585) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene sufD CDS complement(112582..113328) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(113443..114897) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene sufB CDS complement(114928..115404) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 115474..115923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 115920..116198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 116276..116683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(116717..117151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(117180..117692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 117759..118073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 118117..119535 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899402.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 119591..120709 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 120826..123408 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene pepN CDS 123493..124191 product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFJ6 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene phoB CDS 124274..125608 product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene phoR CDS 125812..126570 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA8 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(126704..127612) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(127612..128220) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(128220..128633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 128761..129690 product dialkylrecorsinol condensing protein DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene darA CDS complement(129744..130892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene darB CDS complement(131002..132225) product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(132212..132469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(132524..133627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(133627..135000) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 135255..136280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(136321..136827) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(136824..138506) product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(138671..139654) product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene cysB CDS 139805..141175 product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene cysG CDS 141185..142081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(142092..144029) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL3 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene dxs CDS complement(144211..145113) product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene ispA CDS complement(145110..145376) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGG5 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene xseB CDS 145622..147508 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene parE CDS complement(147544..148104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(148108..149562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 149783..152011 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene parC CDS 152092..152973 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWH2 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene htpX CDS complement(153541..155604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(155609..156619) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 156678..157247 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJV8 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene efp CDS 157320..158267 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIQ4 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene epmA CDS complement(158279..158587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(158668..159000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(159011..160426) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 note possible pseudo, frameshifted CDS complement(160512..160976) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene bcp CDS complement(161015..161554) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene gcvR CDS 161727..162605 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene dapA CDS 162609..162929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 tRNA 162978..163068 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(163489..164460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(164457..164870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 165133..167190 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene nicT CDS 167310..169778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(169803..170996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(170996..171277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 171396..172160 product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(172254..174590) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU3 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ppsA CDS 174723..175547 product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 175627..177327 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 177406..178065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(178099..179730) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 179787..180254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(180260..180733) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 180880..181260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 181257..181967 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 182057..183841 product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene aspS CDS 183862..185289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 185422..186519 product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRI0 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene nadA CDS 186557..187843 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH4 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene glyA CDS 188015..188545 product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene nrdR CDS 188559..189641 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX83 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene ribD CDS 189648..190244 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene ribE CDS 190246..191409 product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG9 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene ribB CDS 191446..191946 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene ribH CDS 191970..192404 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBR2 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene nusB CDS 192408..193358 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene thiL CDS 193355..193894 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene pgpA CDS 194021..195658 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 195730..196476 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene etfB CDS 196508..197446 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene etfA CDS 197633..198448 product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene atuE CDS 198639..199436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 199611..200108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 200194..201246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 201538..203274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 203322..204374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(204546..205040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(205092..205973) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 206135..206752 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MT8 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene cysC CDS 206798..207982 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene sat CDS 207984..208949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 209709..210614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 211060..211233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(211290..213818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(214018..215100) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(215131..216243) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(216388..216861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(216872..217918) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q9 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene mhpE CDS complement(218056..218967) product acetaldehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH39 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(218975..219772) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(219772..220602) product 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77044 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene mhpC CDS 220661..221539 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(221517..222734) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(222727..223938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 224213..224584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 224723..225214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(225229..226548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(226855..227994) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 228391..228771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(228778..229884) product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 230109..231320 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 231334..233079 product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 233205..233534 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 233623..234393 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(234398..234853) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene ysnE CDS complement(234862..235620) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM44 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene panB CDS complement(235679..237475) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(237472..238614) product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(238627..239835) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(239862..240542) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(240539..242161) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 242470..244512 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 244530..245708 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 245769..246545 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 246553..247560 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 247577..248635 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 248657..249880 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 249903..250712 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 250774..251223 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(251245..252591) product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene atoE CDS 252728..253327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(253340..253567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 253677..253901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(253998..254342) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(254462..254878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 254997..255326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 note possible pseudo, internal stop codon, frameshifted CDS 255831..256004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 note possible pseudo, internal stop codon CDS complement(256503..256718) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 sequence04 source 1..193111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..3661 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 3651..4583 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 4755..5870 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088680.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 5945..6703 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(6859..7641) product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 7773..9242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(9246..9848) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene msrQ CDS complement(9848..10816) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q46 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene msrP CDS complement(10918..12069) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR3 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene argE-2 CDS 12108..12671 product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 12698..14026 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene pepP CDS 14052..15245 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene ubiH CDS 15233..16399 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 16543..17142 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ64 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene petA CDS 17142..18383 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 18380..19132 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene petC CDS 19184..19807 product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene sspA CDS 19878..20282 product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene sspB CDS complement(20302..20949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(21072..21431) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX8 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(21422..23221) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 23323..24225 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rsmI CDS 24705..25628 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539164.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 26028..26453 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9N9 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene mraZ CDS 26586..27515 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK7 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene rsmH CDS 27512..27805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 27802..29541 product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene ftsI CDS 29541..31013 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY5 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene murE CDS 31010..32413 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene murF CDS 32415..33497 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene mraY CDS 33571..34932 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA3 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene murD CDS 34929..36113 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene ftsW CDS 36119..37171 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene murG CDS 37168..38601 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ8 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene murC CDS 38598..39521 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene murB CDS 39518..40501 product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene ddlB CDS 40491..41270 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ7 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene ftsQ CDS 41263..42498 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene ftsA CDS 42593..43783 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene ftsZ CDS 44061..44975 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene lpxC CDS complement(45055..45366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 45396..46325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 46449..49214 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH4 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene secA CDS 49303..50514 product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ4 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene argJ CDS 50495..51448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(51501..52061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 52205..54025 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene mmgC CDS 54273..54632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(54683..55450) product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGU4 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene djlA CDS 55700..56206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(56259..56513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 56579..57256 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q44069 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene lexA CDS 57458..58240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 58374..59744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 59744..60106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(60125..60898) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 61027..62037 product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene truD CDS 62161..63096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 63246..64250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 64250..65149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 65146..65604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 65601..66566 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 66563..67567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 note possible pseudo, frameshifted CDS 67567..68538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 note possible pseudo, internal stop codon, frameshifted CDS 68535..70310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 70384..70740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 70960..71373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(71417..72259) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 72453..72938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(72957..73820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(73997..75862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 76431..77324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 77394..78947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 79085..80914 product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(80931..81824) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(81818..83119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(83110..83304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 83715..84935 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 85252..87159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 87156..88385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 88530..89519 product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene pho2 CDS 89531..90184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(90201..91295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 91532..91915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 92164..93990 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E191 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(94333..94638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 94538..94933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 94957..95982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(96050..96703) product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(96840..97757) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(97846..98205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 note possible pseudo, frameshifted CDS 98744..99424 product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(99474..99920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 100092..100328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 100333..100761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(100818..101099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(101080..101268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 note possible pseudo, frameshifted CDS complement(101424..102590) product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL8 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene nrdB CDS complement(103812..105719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(106059..106247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(106355..108541) product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(108552..109625) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 109942..110439 product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(110535..113483) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene nrdA CDS 113971..115122 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene adiY CDS complement(115360..116715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(116738..118777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 119338..121476 product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 121587..122153 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8R5 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene paxA CDS 122153..123160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 123241..124224 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(124409..125710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 125844..127346 product putative fumarate reductase/succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 127494..128714 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene adcK4 CDS 128772..129416 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405490.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 129439..130860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 130872..131948 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 131953..135021 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene acrB5 CDS 135204..136361 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(136499..137389) product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene aguB CDS complement(137399..138436) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene aguA CDS complement(138682..138876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 139108..139626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(139654..140808) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DQ8 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(140913..141923) product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(141923..143047) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 143348..145471 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 145617..146864 product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 146857..147576 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J04 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene lolD CDS 147525..149792 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene comA CDS 149883..150830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 150928..151665 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene plaS CDS complement(151707..152183) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene hisI CDS 152227..152715 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(152822..153571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 153467..153718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 153771..155189 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCK0 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene gltX CDS 155245..157191 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene thrS CDS 157217..158296 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 158293..160362 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene ptrB CDS complement(160616..160864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 161175..162002 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 162021..162476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 162784..165072 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene bfrE CDS 165130..165810 product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P741 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 165820..166476 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 166487..167008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 167040..167852 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 167857..169275 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 169378..171156 product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D84 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene msbA CDS 171140..172195 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W5 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene lpxK CDS 172188..172376 product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDM0 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 172402..173169 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HI2 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene kdsB CDS complement(173265..176522) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY6 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene rne CDS complement(176604..176921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 176898..177776 product ribosomal large subunit pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM9 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene rluC CDS 177773..178432 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(178443..179024) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV4 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 179071..179502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 179595..179780 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E407 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene rpmF CDS 179874..180908 product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene plsX CDS complement(180942..181595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(181658..182479) product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene stp CDS complement(182496..185153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 185235..186584 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBF8 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene radA CDS 186733..189318 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX33 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene leuS CDS 189381..189953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 190028..190834 product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 190839..191156 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(191278..192759) product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene mltF tRNA 192898..192989 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence05 source 1..187190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(860..1096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1286..1732) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene pilE CDS 2066..2281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(2435..3727) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(3905..4720) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 4825..5589 product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 5673..7037 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUG1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene ffh CDS 7179..9689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 9686..11005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 11002..11514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 11511..11726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 11726..12904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 12939..13814 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH6 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 13912..14172 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC3 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rpsP CDS 14189..14668 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG24 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene rimM CDS 14683..15420 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V0 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene trmD CDS 15432..15779 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH70 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene rplS CDS 15973..16203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(16392..17009) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene gst CDS 17235..18233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39879 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(18265..18591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 18739..18972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 19199..20470 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 20507..21523 product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 21567..22091 product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3JDT8 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 22107..22352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(22360..23400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 23713..24240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 24252..24632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 24629..25546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 25663..26535 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene brkB CDS complement(26511..27476) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(27473..27625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 27879..29933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 29994..30899 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 30941..32893 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 33061..33549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 33717..35726 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 35751..36005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(36021..38429) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 38576..39568 product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 39734..40186 product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(40440..40619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(40742..42145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(42142..43539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(43658..44083) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(44167..44685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(44783..45670) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 45772..45978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(45975..47480) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(47477..50755) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(50819..52063) product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 52326..52961 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene nalD CDS complement(53016..54428) product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 54560..54934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(55188..55631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(55749..56315) product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 56437..57027 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX72 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 57011..58246 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(58285..59472) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 59620..60672 product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene ldh CDS 61079..66031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 66047..66760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(66765..67388) product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene ycgM CDS complement(67452..68078) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 68450..70132 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V893 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ilvB-1 CDS 70129..71181 product putative branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86505 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene ilvE CDS complement(71170..71898) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(71974..72726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 72998..74059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 74056..74499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(74506..74958) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PC83 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene gloA CDS 75263..76411 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene olE1 CDS complement(76481..76900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(77020..77634) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(77661..79811) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 79993..80532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 80610..81149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 81162..82370 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 82367..82738 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 82963..83379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 83376..83993 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZA7 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene msrA CDS 84174..84812 product Maf-like protein YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58629 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene yhdE CDS 84809..86278 product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene cafA CDS 86338..90201 product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 90260..91108 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 91095..92546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 92764..93111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 93185..94255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(94361..94663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(94966..95484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(95409..96044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 96190..96492 product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 96502..96882 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 96926..97486 product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32AR8 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene yhhF CDS 97491..97985 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene coaD CDS 98227..98490 product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene fdx1 CDS 98487..100244 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 100277..100927 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 100924..101322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 101319..101741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 101738..102445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 102531..103466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(103444..104310) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2L2 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene cobB CDS complement(104310..105407) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene pfkA CDS complement(105474..106082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(106079..106573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 106804..107052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 107113..107316 product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SJ8 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene slyX CDS complement(107341..107895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(108001..109389) product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene sthA CDS complement(109632..110591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 110772..111392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 111398..112945 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 113009..113626 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN0 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene msrA CDS complement(113650..113943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 114060..114365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 114362..115789 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 116011..116718 product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene gph CDS 116715..117794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971145.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(118012..120186) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene glcB CDS 120520..121365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 121475..122074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 122191..122733 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 122852..125179 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(125184..125759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 126282..126422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 126662..127486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 127489..128379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(128355..130448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(131011..131790) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QL1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene zapD CDS complement(131919..133367) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene nuoN CDS complement(133364..134902) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene nuoM CDS complement(134899..136716) product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene nuoL CDS 137514..139526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 139523..140590 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene cobT CDS 140568..141128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 141128..141868 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I463 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene cobS CDS 141957..142973 product polyhydroxybutyrate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(142984..143790) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500L8 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(143795..144490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(144551..144844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 144935..145357 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 145354..145773 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(145776..147287) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene putA CDS 147498..148640 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene acd CDS 148684..149280 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(149306..149758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(149891..152449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(153102..153299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(153487..154866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(154884..156521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(156857..159229) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(159226..160260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(160346..161551) product ketoacyl CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(161672..162124) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(162135..162788) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene fabG CDS 163128..164198 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 164208..167333 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 167408..168856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(168848..169906) product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 170119..170391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 170428..171111 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene pspA CDS 171142..171384 product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene pspB CDS 171374..171787 product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene pspC CDS 171950..172585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 172681..174018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 174116..174703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 174728..175048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 175091..175780 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene phoP CDS 175792..177117 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene phoQ CDS complement(177106..178008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 178122..178958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(178974..180524) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7N6 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene yceN CDS 180658..180930 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG9 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene rpsT CDS complement(181017..182144) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene proB CDS complement(182113..183192) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3H1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene obg CDS complement(183274..183525) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene rpmA CDS complement(183557..183871) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9D7 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene rplU CDS 184021..184989 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene ispB tRNA 185036..185112 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(185381..185995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(185983..186678) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene pgl tRNA 186838..186914 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence06 source 1..186033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..447) product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 688..3318 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(3344..3922) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087421.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 4061..6541 product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(6591..7877) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLU7 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene glgC-2 CDS complement(7957..8364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(8376..9080) product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene anr CDS complement(9238..10152) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 10268..10912 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 11017..13428 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene ppsA CDS 13518..14198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(14214..14861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(14908..15147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(15148..16188) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 16344..16682 product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene dskA CDS complement(16699..17346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(17355..17495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(17492..19711) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(19713..19913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(19910..21280) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(21277..21543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(21540..22466) product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWN5 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(22463..22612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(22609..23256) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(23253..24755) product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene ccoN CDS complement(24773..25120) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I69 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 25296..26678 product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RM6 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene hemN CDS 26757..27908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 27923..28534 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 28606..29046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 29158..29841 product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(29965..30756) product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 30856..31131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(31111..32520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205219.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(32705..33142) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(33197..33754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 33920..35419 product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(35431..36606) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(36617..37765) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(37765..38451) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene tptC CDS complement(38525..39751) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene acrE CDS complement(39953..40591) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CG5 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene cysH CDS 40637..41266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 41263..42207 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene poxA CDS 42249..42839 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QV1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 42836..43360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 43428..44429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 44534..45220 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(45230..45469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(45633..46283) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 46491..48920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(48925..49533) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 49684..50559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(50596..50973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(51083..52654) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUV9 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene purH CDS complement(52651..52926) product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD37 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(53069..53935) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV64 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene prmA CDS complement(53997..55343) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(55356..55823) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(55828..56274) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAX1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene aroQ CDS complement(56408..56917) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(56931..57254) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene cutA CDS complement(57375..58007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 58182..61361 product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene putA CDS complement(61380..62531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 62703..63482 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(63483..64802) product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene tolC CDS complement(64884..65198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 65431..66045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(66129..66956) product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene hmuV CDS complement(66940..68016) product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(68009..68863) product hemin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene bhuT CDS complement(68997..69179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 tRNA 69366..69450 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 69508..70836 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A851 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene tig CDS 70961..71581 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene clpP CDS 71669..72943 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene clpX CDS complement(72990..73163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 73196..75589 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU3 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene lon CDS 75904..76176 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene hupB tRNA 76202..76277 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 76340..76416 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 76483..78405 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YS0 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 78726..79529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(79607..80395) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(80481..81449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(81446..81991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(81988..82485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(82482..83114) product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(83174..83536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(83533..84213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(84200..87004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(87001..89379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(89461..90744) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(90741..91520) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPX6 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene gloB CDS 91656..92477 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 92474..92926 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S9 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rnhA CDS 92923..93639 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene dnaQ CDS complement(93636..94517) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(94631..95668) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(95703..96761) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 96907..100173 product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene mcm CDS 100254..101438 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 101449..102306 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene hbdA CDS 102343..104142 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(104311..104826) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(104926..105279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 105575..109594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 109757..112054 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene maeB1 CDS 112072..112458 product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene hslR CDS 112661..115021 product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I596 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 115163..116470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 116835..119066 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene fhuA CDS 119150..119506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 119518..121098 product flavin monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 121131..121679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene tdcF CDS complement(121990..122601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 122745..123224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 123227..128854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 129034..130212 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105512.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 130341..131333 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 131346..131708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 131701..131961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 132490..132756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 132743..133018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(133130..133408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 tRNA complement(133905..133981) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 134359..134832 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 134832..135110 product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 135107..135433 product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 135430..135990 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 135987..136418 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 136415..136780 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 136777..138252 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 138249..139775 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 139787..140056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 140049..141755 product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(141788..143242) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene nhaD CDS complement(143337..144212) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 144369..145043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 145040..146200 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(146197..146469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(146515..148569) product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene uvrB CDS 148712..151408 product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WB09 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(151440..152336) product isoleucine biosynthesis transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene ilvR CDS 152448..154286 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVW0 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ilvD CDS 154452..155561 product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT06 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene adhI CDS 155561..156403 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WS1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene fghA CDS complement(156410..157672) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene ycaD CDS 157849..158187 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene glnB CDS complement(158267..158593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 158693..159025 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene yajC CDS 159032..160891 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S34 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene secD CDS 160903..161838 product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene secF CDS 162379..166875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 166876..167319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 167374..167655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 167953..168426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(168554..169102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 169542..169913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(170424..170636) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(170825..172135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(172163..172957) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene suhB CDS 172996..173760 product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S30 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene trmJ CDS 173964..174698 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 174788..175288 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene ilvH CDS 175334..176356 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP6 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene ilvC CDS 176407..177027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 177029..177802 product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene pssA CDS 178059..179765 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPL1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene leuA CDS 179762..180289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 180366..181151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 181148..181630 product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rimI CDS 181611..182861 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 182946..183185 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 183189..183575 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4B2 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene vapC CDS complement(183709..184356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(184353..184682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 184575..184781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 184832..185194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 185602..185967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 sequence07 source 1..175292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..1054 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37965 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene glpQ CDS 1189..1659 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704532.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1790..3202 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 3212..4210 product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 4215..4334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 4331..4786 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E2 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 4865..6295 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene dapE CDS complement(6307..6555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 6809..7816 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 7873..8196 product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(8160..8684) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(8681..9034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(9089..9649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 9846..10562 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 10640..12367 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDT0 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 12380..13036 product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 13049..14017 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 14017..15054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 15051..16874 product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 16924..17373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 17444..17632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 17629..18399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 18396..19571 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 19613..21559 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 21678..22994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 23238..26924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 26938..28347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(28377..30083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(30041..31414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 31958..33298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 33295..34854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 34953..36401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 36398..37981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 38114..39109 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(39121..40575) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 40901..41947 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 41952..44984 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 44978..46441 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 46516..47439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(47579..48604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(48594..50834) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(50990..51313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 51537..54350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 54354..55991 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 56205..57554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 57751..58692 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(58744..60321) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(60416..60979) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene ahpC CDS 61177..61365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 note possible pseudo, internal stop codon, frameshifted CDS 61629..61826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(61854..63194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 63371..65038 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene phoD CDS complement(65085..66119) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 tRNA complement(66652..66727) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(66799..67512) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene coaX CDS complement(67509..68489) product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z317 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene birA CDS complement(68474..69121) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene plsY CDS complement(69134..70912) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 71268..72917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(72989..73258) product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IU9 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(73228..74301) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene mutY CDS complement(74294..74881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(74892..77096) product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(77300..78985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 79118..79552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(79565..81082) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(81079..82296) product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PC68 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(82349..84271) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(84698..85378) product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 85480..85779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 85784..87034 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene lysA CDS 87031..89784 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene polA CDS 90904..94071 product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene oar CDS 94161..94340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 94395..94811 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 94880..96661 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene atmA CDS 96836..97660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 97662..98618 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 98867..99334 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 99525..100466 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(100546..101328) product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(101431..102378) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(102545..103042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(103023..103643) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX20 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene pdxH CDS 103706..104701 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene yhdH CDS 104714..105082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(105100..107295) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(107292..107708) product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene zntR CDS 107837..108637 product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 108691..110076 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene cls CDS complement(110099..110494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(110496..111764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 111933..114107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 114200..114520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 114707..115252 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 115275..115850 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 115906..116478 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(116543..117712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(117768..120503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 120667..120963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(121090..121293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 121459..122721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 122718..123977 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 123974..127072 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(127218..127712) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU7 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene pitA CDS 127820..128458 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3N0 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rsmG CDS 128455..129249 product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 129249..130088 product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene spoOJ CDS 130381..131163 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 131405..131755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 131798..132637 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR95 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene atpB CDS 132718..132978 product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A308 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene atpE CDS 133020..133490 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL20 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene atpF CDS 133493..134029 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene atpH CDS 134059..135612 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ7 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene atpA CDS 135719..136582 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene atpG CDS 136653..138050 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43715 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene atpD CDS 138129..138545 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene atpC CDS 138892..140466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 140476..141846 product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 141899..143287 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene glmU CDS 143343..145178 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene glmS CDS complement(145623..145955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(146021..146320) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(146317..146586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(146773..147606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 147948..148133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(148304..148771) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(148755..149174) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 149572..150291 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene rph CDS 150301..151344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 151338..152507 product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 152500..152682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 152797..153042 product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene rpmE2 CDS 153303..154589 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8L5 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 154677..155072 product toxin-antitoxin system antidote Mnt family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 155062..155487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(155501..155956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(155958..157430) product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(157427..158149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 158530..159393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 159375..160487 product glycosyl hydrolase family 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530606.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 160544..161392 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(161716..161979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 162283..167433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 167437..169893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(170196..170726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 170948..172132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(172139..172960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 173163..174905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 sequence08 source 1..144184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 702..1364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1512..1736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1820..2320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(2664..3140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(3155..3589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 tRNA complement(3750..3825) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 3971..4615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 4644..4976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 4982..5833 product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 5826..6593 product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 6988..8178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 8288..9577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 9567..10226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 10277..13075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(13083..13460) product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 13716..13994 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 14077..15423 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene dinF CDS 15657..17291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(17297..18775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 18934..20523 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V6 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene prfC CDS complement(20540..21013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 21214..22752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 22829..23323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 23343..24278 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(24295..25035) product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(25017..26006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(26089..27561) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 27917..28738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(28714..29394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 29460..29897 product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 30157..30987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 31112..33103 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 33140..33892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(33899..34966) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene aroG CDS 35102..36061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 36126..37037 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 37097..39262 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene phuR CDS complement(39444..40940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 41149..42657 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 42832..44082 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 44148..45980 product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 46062..47222 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B32 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene mgtE CDS complement(47233..48162) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 48282..49274 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 49290..50084 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(50218..50859) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 51000..51755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 51740..52183 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(52223..52912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(53013..53954) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DV9 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene thrB CDS 54053..55768 product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMY5 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene nhaP2 CDS complement(55801..56394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(56910..58418) product Trk system potassium uptake protein TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN7 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene trkH CDS complement(58547..59920) product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene trkA CDS complement(59917..60195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(60192..61499) product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KD3 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene rsmB CDS 61640..62857 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 63021..64883 product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(64891..65856) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G0 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene fmt CDS complement(65884..66387) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene def CDS 66521..67690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 67698..68804 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene smf CDS 68910..69377 product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene smg CDS 69522..71927 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene topA CDS 72025..72636 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F2 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene tsaC CDS 72657..73568 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36553 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene hemF CDS 73655..74590 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 74635..75051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(75072..76451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(76587..78713) product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(78855..80090) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene aprA CDS 80243..82243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 82330..82947 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 83010..83873 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(83926..84789) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(84995..85885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 85977..89849 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene hrpA CDS 89851..90120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 90121..90429 product plasmid maintenance protein CcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 90430..91137 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT0 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene pyrF CDS 91179..92255 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NRT0 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene hemE CDS 92252..93181 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(93192..94745) product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(94742..95818) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(95872..96360) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(96451..97884) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(97881..101012) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene acrB CDS complement(101026..102168) product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene acrA CDS 102546..103031 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(103048..105786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(105794..106636) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31105 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene cheR CDS 107128..107673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(107858..109246) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLM2 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene dbpA CDS complement(109247..109798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene yaeQ CDS complement(109832..110428) product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDL4 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(110571..110978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(112043..112348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(112329..114410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(115167..115454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(115696..116124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(116182..117561) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENP8 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene hslU CDS complement(117605..118162) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene hslV CDS complement(118236..119129) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3A8 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene xerC CDS complement(119126..119821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(119818..120657) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ4 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene dapF CDS 120681..121088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 121218..122228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(122245..122826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(122826..123677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 123851..125311 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene putA CDS 125483..127840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(127982..128182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 128081..130387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(130600..131280) product transcriptional regulatory protein BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69228 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene baeR CDS complement(131277..132668) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 132818..133972 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 133969..135900 product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPB4 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene macB CDS 135897..137270 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390985.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(137286..138104) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 138278..138514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 138511..138786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(139335..141803) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(141826..142458) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 sequence09 source 1..134266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 534..609 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(800..3031) product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(3566..4726) product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(5033..7198) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 7492..7740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(7845..8414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 tRNA complement(8615..8690) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(8713..8788) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(10246..11187) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene wcaG CDS complement(11303..12403) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene gmd CDS complement(12575..13747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(13744..14706) product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(15640..16833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(16836..18176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(18423..19670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(19677..20120) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(20219..21706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(21703..22068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(22611..22847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(23256..25343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(25434..26660) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene wcaG CDS complement(27357..27848) product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DB2 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene rfaH CDS complement(27848..28276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(28389..29135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 30122..31447 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene ugd CDS 31885..33021 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 tRNA 33414..33488 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 33703..34887 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene rfaG CDS complement(34858..36369) product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HS4 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(36366..37598) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(37595..38716) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(38779..40098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(40133..41008) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(41087..43291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(43320..46208) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene wza CDS 46677..46973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 47129..47398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(47555..48172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706677.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(48331..48639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190530.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(48818..50950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(51026..51766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 note possible pseudo, internal stop codon CDS complement(51770..52705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 note possible pseudo, internal stop codon CDS 52904..53968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(54337..54972) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(55395..56753) product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene pmpM CDS complement(57096..57467) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035759.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 57664..58812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(59393..61165) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 61412..62305 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVS6 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene rdgC CDS 62354..62815 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 63055..63375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(63395..64762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(64803..65096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(65160..66443) product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(66618..67484) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 67602..68651 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 68638..69522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(69688..70428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(70425..71084) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene purN CDS complement(71081..72127) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPU5 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene purM CDS 72197..72859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 72884..74032 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene perM CDS 74029..74715 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(74660..75001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(74998..75591) product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 75705..76529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(76628..77905) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 78012..78707 product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 78832..79479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(79511..80146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(80175..81248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 81544..83361 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene asnB CDS complement(83381..83908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(84500..85525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(85962..86666) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175942.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene kdtX CDS 87040..88296 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene yfeW CDS complement(88331..88729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(88719..89009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(89014..91386) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009952308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 91533..94745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 95256..95393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(95431..96402) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 97198..97494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 note possible pseudo, internal stop codon CDS complement(97594..99789) product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene glgB CDS 99948..102485 product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(102551..103828) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLU7 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene glgC-2 CDS 104044..105477 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT93 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene glgA CDS complement(105484..106152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 106558..107856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 107961..109247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 109244..110104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(110188..111879) product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 111973..113061 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 113049..113681 product phosphoheptose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMN3 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene gmhA2 CDS 113681..114391 product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene hddC CDS 114388..115191 product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene tagA CDS 115188..116573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(116521..117300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 117437..118618 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 118637..119899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 119918..121138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 121147..122316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(122370..122675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(122672..123973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 124080..124628 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(124743..126071) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene rlmD CDS complement(126068..126859) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(127223..128113) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 128199..130514 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD98 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene gacS CDS 130568..134059 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene mfd sequence10 source 1..127968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..1490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1490..1714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1610..3466 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene recQ CDS 3682..4212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 4341..4622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(4664..5044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(5080..5967) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIW9 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene purC CDS 6073..6750 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene rpe CDS 6776..7975 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 8203..9627 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 9641..10222 product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene trpG CDS 10225..11262 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD71 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene trpD CDS 11259..12056 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNZ4 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene trpC CDS complement(12074..12709) product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 12789..13208 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 13319..14119 product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4I6 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene speD CDS complement(14144..14533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 14904..15158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 15484..18417 product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene oar CDS 18926..19654 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 19654..21015 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene ttpC CDS 21027..21551 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 21561..21971 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 21975..22604 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene tonB2 CDS 22617..23831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 23892..25532 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(25544..27034) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 27205..29433 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 29557..29985 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA10 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene rplM CDS 29990..30385 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44388 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rpsI tRNA 30447..30520 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(30856..31851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 31966..32796 product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKL4 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rlmJ CDS 32806..33351 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036074.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 33462..34565 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(34562..35197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(35200..36438) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene amt CDS 36751..38640 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FE9 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene thiC CDS 38774..40864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 40925..42034 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 42102..42494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 42544..44238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(44560..45387) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 45472..46065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 46185..46439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(46492..46977) product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S5 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(47025..47276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 47232..47813 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7H1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 47892..48797 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(48823..49134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(49139..50728) product iron-regulated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(50725..51072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(51184..53229) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene deaD CDS complement(53286..55946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(56003..56761) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 56857..57441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 57506..58519 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(58533..59210) product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X59 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene ribB CDS 59627..60064 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 60327..61103 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene fpr CDS 61244..62797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(62869..63393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 63669..64976 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X42 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene rhlE1 CDS 64973..65242 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(65448..66110) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT5 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene rpiA CDS complement(66163..66876) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 66935..67969 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene pilT CDS 67969..68541 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 68569..69735 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene pilT-2 CDS 69741..70832 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene uptC CDS 70833..71927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 71931..72854 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 72926..73732 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 73872..74672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(74874..77738) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH3 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene uvrA CDS 78023..79219 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 79423..79884 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ06 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene ssb CDS 80059..81228 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 81225..81881 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 82009..82944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(82994..84874) product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(85189..85575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 85743..87737 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM03 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 87813..88817 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene gapA CDS 88879..90063 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZB8 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene pgk CDS 90519..91832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 92401..92886 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene aspG CDS complement(92941..94221) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(94326..95033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 95060..95668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 95678..96556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 96474..97073 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 97112..97951 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 98175..98627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 98708..100384 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GV4 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene hutU CDS complement(100354..100905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 101025..101453 product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene osmC CDS 101498..102283 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene paaG CDS 102354..103748 product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIR3 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(103728..104021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(104018..104884) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene ada CDS 105029..106372 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV6 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene miaB CDS 106369..107406 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 107403..107864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 107848..108699 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 108818..110035 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 110125..111852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638263.2 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 111833..112381 product Ecf-type RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 112365..113225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 113393..114088 product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(114157..115485) product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene pilR CDS complement(115482..117092) product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene pilS CDS 117334..118491 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH00 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene sucC CDS 118506..119381 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRB4 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene sucD CDS 119513..121132 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene nadE CDS complement(121175..122104) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK82 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene yfiO CDS 122212..123120 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE7 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 123110..123889 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33663 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 124208..125155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 125175..127748 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 sequence11 source 1..123031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 tRNA complement(949..1025) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(1120..1536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(1520..1816) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSN4 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene ihfA CDS complement(1836..4193) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDX1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene pheT CDS complement(4227..5228) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene pheS CDS complement(5340..5699) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A159 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rplT CDS complement(5716..5913) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene rpmI CDS complement(6014..6547) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER8 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene infC CDS 6945..8288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 8292..8558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 8569..9300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 9320..10456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 10536..11429 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(11431..12768) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene dhs1 CDS 12951..13385 product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene hspA CDS 13452..14354 product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CJ2 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene cbpA CDS complement(14380..16428) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190520.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene fadH CDS complement(16461..16982) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 17065..18933 product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene atuH CDS 19036..19671 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene rplY CDS 19679..20260 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9L4 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene pth CDS 20382..21476 product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene ychF CDS complement(21548..23815) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(23885..25282) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(25439..25846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 26016..27221 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 27304..28659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 28671..31016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 30998..32494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 32487..33383 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 33376..33993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(34088..35692) product cytoplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN38 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene treF CDS 35777..36358 product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MII1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(36551..37510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(37574..38263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(38332..39087) product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(39161..40342) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LW1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene pncB CDS complement(40432..40932) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088942.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 41169..41702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 42011..42307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(42380..42835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(42875..43744) product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene cpo CDS complement(43758..44123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(44123..45721) product nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(45767..50620) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(50617..59502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(59631..60449) product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141901.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 tRNA 60657..60733 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 61004..61969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 62005..64182 product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene rlmL CDS complement(64232..66376) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene fauA CDS 66605..67771 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(67912..68898) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 68885..70294 product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 70291..71220 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 71533..72171 product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 72168..73121 product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 73118..75313 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037857.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene yagR CDS complement(75561..76979) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene nuoN CDS complement(76982..78469) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene nuoM CDS complement(78472..80355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(80352..80657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(80654..81262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(81259..82140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(82140..83123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(83114..83329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(83986..84144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(84446..84835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(84835..85467) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(85501..86103) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(86298..87497) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 87648..88556 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815402.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(88676..89755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 89959..90585 product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 90867..92960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 93162..93725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 93715..93972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(94118..94357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(94561..94782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 95253..96764 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 96781..97542 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 97818..99302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 100207..101595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(101597..102481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(102478..103077) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 103322..103540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 103550..104404 product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 104427..106070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 106067..106924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 106936..108363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 108541..109404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 109553..109996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 110062..110478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(110488..110778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(110775..111095) product DNA damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067437.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 111466..111930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 112022..112609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 113395..113709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 113821..114030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 114387..114749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 114784..115371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 115431..116528 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 note possible pseudo, internal stop codon, frameshifted CDS complement(116547..116675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(116685..116975) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(117051..117356) product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(117353..117601) product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58091 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene parD1 CDS complement(117869..118078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 118372..118893 product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR57 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 118929..119153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 119400..120035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 120123..122411 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 sequence12 source 1..108013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(402..1247) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 1418..2728 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene hmgA CDS complement(2851..3492) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene osmY CDS complement(3603..3767) product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGP0 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 4003..4446 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 4443..5576 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 5573..6031 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(6040..7476) product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL4 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene hldE CDS complement(7508..8431) product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene ilvE CDS complement(8578..11211) product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene glnE CDS 11585..11821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 12140..12400 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 12397..12795 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ZF7 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene ntrR2 CDS complement(12840..13814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 14081..14434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 14751..15350 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene pdxH CDS complement(15444..17075) product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD23 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene groL CDS complement(17121..17414) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19422 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene groS CDS 17815..18876 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene mopB CDS 18915..19748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 20021..21100 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene mopB CDS 21395..22669 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 22809..24143 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 24147..25805 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 25816..26898 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9E5 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene hemH CDS complement(26895..27689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(27873..28931) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 29245..30261 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene sohB CDS 30295..30927 product phosphatidylethanolamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 31040..32437 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene degQ CDS 32566..32760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 32757..33071 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87US0 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 33333..33959 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR3 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene ygfA CDS 34093..34728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 34728..35189 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(35229..36791) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I418 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ilvA2 CDS 36922..37737 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R27 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene proC CDS 37748..38305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 38307..39467 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57714 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene metX CDS 39464..40078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(40094..40312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(40327..40818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(40956..42311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(42448..43827) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene cabC1 CDS 43860..44303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(44328..44531) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(44753..47236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(47319..48011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(48008..48415) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(48412..48966) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(48938..50308) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(50305..51078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 51223..51594 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(51665..52159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(52247..52750) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P8 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene greB CDS complement(52747..53598) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(53768..56497) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(56498..57268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(57313..57504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 57709..58989 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976101.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 58979..60505 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V22 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(60526..61422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 61552..62487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 62676..64517 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66759 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene ilvB CDS 64592..66013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(66018..66326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(66536..67978) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 68124..68906 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 69287..69976 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(70048..71208) product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEL0 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene fadA CDS complement(71277..73427) product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene fadB CDS 73791..74471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(74543..76207) product phosphoethanolamine--lipid A transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 76472..77410 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(77382..77990) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(78027..79406) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(79403..80419) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(80416..80721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(81036..81515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(81545..82660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 82760..84526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 84523..85884 product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(85897..86415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(86423..88765) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(88806..89729) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 89795..90286 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 90381..91175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 91243..92079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 92076..92675 product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(92681..93805) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 94192..94692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(94698..94994) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I449 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 95264..95476 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 95634..96443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(96447..96803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(96826..97803) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 97932..98828 product DNA-binding transcriptional activator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 98838..99644 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948655.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 99690..100949 product D-amino acid dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene dadA CDS 101041..102534 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 102500..103057 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene ogt CDS 103437..104525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 104538..106520 product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(106876..107559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 sequence13 source 1..103788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..1173 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgctctgcggcgaagtccgcagcctcattgaagc CDS complement(1164..3161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 3566..5029 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene zwf CDS 5149..5568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(5590..6345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(6869..8470) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(8765..9889) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(9892..12654) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene rbbA CDS complement(12651..13724) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(13740..15104) product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(15388..16194) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(16256..17074) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090089.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(17328..18119) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(18140..20551) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(20548..21387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(21635..22489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(22688..22831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(22924..23598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 23768..25135 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LN4 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene astB CDS complement(25155..26240) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 26285..27358 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene adiY CDS 27355..27828 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 27979..29640 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene gspA CDS 29640..30452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(30466..30615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(30612..31337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(31355..32674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(32686..34869) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(35104..36009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(36139..37305) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L20 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene argD CDS complement(37497..38948) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene engA CDS complement(39063..40214) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene bamB CDS complement(40211..40849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(40887..42167) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y9 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene hisS CDS complement(42192..43319) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene ispG CDS complement(43369..44304) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKS1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene rodZ CDS complement(44301..45095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(45142..46224) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ42 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene rlmN CDS complement(46322..46753) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene ndk CDS complement(46899..47240) product HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(47231..47611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(47796..48950) product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene iscS CDS complement(49014..50168) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene nifS-2 CDS complement(50190..50981) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene cysE CDS complement(51212..51526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(51743..53509) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 53626..54969 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(54953..56080) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(56088..57074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 note possible pseudo, frameshifted CDS complement(57041..58876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 note possible pseudo, frameshifted CDS 59368..59556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 59883..60479 product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700856.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(60557..62401) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888262.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(62535..63620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(64660..65634) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(65704..67461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 67608..68603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(68681..69004) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIK0 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene grxD CDS 69288..69863 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31108 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene sodB CDS 70053..70877 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11724 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene argF CDS 70985..71908 product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene nadC CDS complement(71901..72734) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(72736..74586) product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS9 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(74723..75865) product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 76032..76634 product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 76709..77668 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW4 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene trxB CDS complement(78002..79297) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q86 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene hisD CDS complement(79290..79925) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene hisG CDS 80577..82202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(82218..83474) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P719 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene murA CDS complement(83488..83706) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(83767..84531) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q82 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(84528..85457) product ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 85625..87064 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene phr CDS 87146..88117 product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene kdsD CDS 88114..88653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 88653..89210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 89221..89775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 89775..90545 product lipopolysaccharide export system ATP-binding protein LptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45073 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene lptB CDS 90725..92134 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene rpoN CDS 92233..92556 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 92644..93090 product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene ptsN CDS 93131..94069 product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U365 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene hprK CDS 94085..94942 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WT7 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 94942..95352 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 95374..95649 product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391193.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 95654..97420 product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH74 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene ptsI CDS complement(97919..98737) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(98798..99673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(99686..100147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(100144..100722) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene algU CDS 100889..101428 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 101428..102063 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 102149..103654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 sequence14 source 1..102138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..1520 product glucosylglycerol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 1540..2211 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(2304..2771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(3271..5343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(5474..6451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 6688..7482 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(7510..8859) product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene pmbA CDS complement(8856..10208) product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP5 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene mpl CDS complement(10208..10777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 10828..11943 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene rnd CDS complement(12002..12574) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene adk CDS 12801..13331 product inorganic pyrophosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M7 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene ppa1 CDS 13517..13858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 13993..14646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(14670..15206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 15369..18095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 18092..18979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(18957..19898) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 20157..20342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(20343..22904) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(23163..24065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene rpfD CDS 24202..25389 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037018.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 25413..26309 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2B0 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene surE CDS 26390..26836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 27011..28258 product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536367.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(28464..29213) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene gpmA CDS complement(29238..29777) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene yrdA CDS complement(29774..30643) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 30912..31484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 31474..32433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 32465..33700 product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 33938..36022 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene prlC CDS 36019..37614 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene glt CDS complement(37713..38633) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269195.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(38655..39101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(39098..39568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 39733..41526 product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 41564..42340 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 42424..43464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(43452..43901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 44114..44377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(44430..44984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 45189..46247 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCQ8 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene fbp CDS 46330..46875 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IU1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene bsaA CDS complement(46933..47313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(47557..48489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 48708..50627 product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(50631..51518) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(52137..52565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 52758..53612 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(53618..54592) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 54846..55274 product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037892.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 55294..55821 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV7 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene apt CDS complement(56059..56649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(56912..58678) product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 58806..59750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 60456..62762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 62755..63594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706562.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 63591..64556 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 64699..65133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 65130..66560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 67052..67300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(67297..68511) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene argG CDS 68680..69345 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene rnt CDS 69342..70505 product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 70628..72103 product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLF1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene mdoG CDS 72100..74604 product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA6 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene opgH CDS 74669..75460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 75487..76269 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 76364..77350 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene lipA CDS complement(77464..78144) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(78144..79160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 79263..81440 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE0 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene lptD CDS 81476..82849 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene surA CDS 82863..83888 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19624 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene pdxA CDS 83881..84711 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene rsmA CDS 84751..85185 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(85170..88286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(88389..88643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(88676..89365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(89386..90324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(90324..91247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(91244..92479) product ATPase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene tadA CDS complement(92484..93671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093855.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene tadZ CDS complement(93751..95052) product exported fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(95163..96074) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(96162..96596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(96691..97140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(97193..97384) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920785.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene pilA CDS complement(97491..97658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 97582..99369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 99378..100328 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 100351..100734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(100731..100901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 101083..101916 product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene apaH sequence15 source 1..101448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 998..2251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2218..2799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 2796..4730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 5049..5531 product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 note possible pseudo, frameshifted CDS 5834..6727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 7139..7540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 7635..7979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 7990..8286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 8289..8939 product conjugal transfer protein TraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399776.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene traE CDS 8839..9585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 9585..10886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(10864..11136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(11461..12474) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 12555..12962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 13209..14342 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene czcC CDS 14339..15592 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 15603..18770 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 18797..19027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 19091..19768 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 19782..20375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 20435..21403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 21400..22146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 22143..23498 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 23759..26329 product type-IV secretion system protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene traC CDS 26326..26712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 26781..27251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 27232..27843 product conjugal transfer pilus assembly protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene traW CDS 27840..28844 product conjugal transfer protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene traU CDS 29141..29539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 29536..31482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 31479..32291 product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene traF CDS 32288..33712 product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene traH CDS 33732..36533 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene traG CDS complement(37027..39633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(39638..40822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(40815..42932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(42916..43950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(43962..46733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(46776..47330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(47408..48688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(48685..49425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(49568..49990) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(49987..50244) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884T6 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 50620..52260 product relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 52257..54293 product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 54280..54957 product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(54983..55324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 55454..55900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 56017..56745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 tRNA complement(56902..56977) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 57087..59276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 59555..59914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(59902..60681) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(60707..62092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063817.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(62135..62596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 62690..62944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 63074..65653 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene clpB CDS complement(65660..65977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(66169..67275) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(67297..68388) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 68541..69185 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(69189..69923) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U32 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene phoU CDS complement(70038..71111) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene oprO CDS 71131..71334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 71542..72642 product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VF5 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene pstS CDS 72719..73693 product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VF4 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene pstC CDS 73695..74564 product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCM6 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene pstA CDS 74561..75406 product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VF2 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene pstB CDS complement(75509..77434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(77545..78135) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 78304..79008 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261713.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene yfcG CDS 79034..79909 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(79941..80420) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene tadA CDS complement(80473..82068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(82123..82821) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(82848..83726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(84133..84822) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763967.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(84923..85351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083862.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(85426..86112) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406593.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(86189..87937) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103526.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 88211..88546 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 88539..89786 product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 90287..91009 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 91132..92340 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 92337..93206 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 93203..93820 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 93833..94447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(94573..94851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(95153..96493) product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816876.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene hipA CDS complement(96495..96734) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene hipB CDS 96941..97201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(97286..100438) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(100435..100821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 note possible pseudo, frameshifted CDS complement(100833..101228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 note possible pseudo, frameshifted sequence16 source 1..99242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(190..771) product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(771..1445) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UF7 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene ureG CDS complement(1442..2131) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UF8 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene ureF CDS complement(2831..3337) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCI2 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene ureE CDS complement(3354..5066) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH9 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene ureC CDS complement(5066..5689) product urease subunit gamma/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYJ3 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene ureAB CDS complement(5703..6617) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J149 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene ureD CDS 6861..7943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 7974..9263 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 9368..11014 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 11014..12099 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 12096..12929 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 12932..13627 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(13813..14010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(14336..15247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 note possible pseudo, frameshifted CDS complement(15724..18453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 18652..19065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 19442..20194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 20191..22680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 22685..22981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 23240..23734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(23924..24184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 24071..24871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(24879..26264) product N-formimino-L-glutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636952.2 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene sdeB CDS complement(26317..27219) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(27317..27994) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 28075..29601 product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 29765..31153 product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene argA CDS complement(31157..31594) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 31715..33067 product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I693 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene bioA CDS 33350..34852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 34852..36081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 36133..36390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 36377..36634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 36763..36993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 36993..37406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 37411..41538 product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 41599..41901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 41901..43115 product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943035.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 43105..44334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(44379..44756) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 44841..45563 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 45658..46992 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 46989..47963 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035633.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene ilvA CDS complement(47960..49576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(49809..50483) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(50703..51143) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 51260..51832 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene tag CDS complement(51944..53311) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene cysS CDS complement(53795..54274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(54276..55325) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(55322..56287) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(56397..57287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(57379..57846) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(57843..63875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(63878..64429) product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene pilI CDS complement(64438..64812) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene pilG CDS 65050..66357 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 66415..67374 product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPT4 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene gshB CDS 67365..68450 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXD0 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 68447..68809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 68806..69372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 69430..69990 product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 69987..70415 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAS1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 70376..70942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 70939..71934 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene pyrB CDS 71931..73214 product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene pyrC' CDS 73325..73690 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene pilH CDS 73759..75762 product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene pilJ CDS complement(75781..76128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 76295..77947 product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V6 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene pckA CDS complement(78008..79003) product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene dusB CDS 79063..79251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 79298..80251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 80491..80988 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931591.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(81007..81477) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPW6 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene rlmH CDS complement(81495..81848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_402253.2 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene ybeB CDS complement(81977..82660) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene nadD CDS complement(82690..83976) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene proA CDS complement(84068..85102) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene holA CDS complement(85238..85639) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U5 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene rplQ CDS complement(85673..86605) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene rpoA CDS complement(86808..87428) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66561 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene rpsD CDS complement(87444..87836) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF43 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene rpsK CDS complement(87861..88220) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR5 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene rpsM CDS complement(88452..89786) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK50 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene secY CDS complement(89799..90371) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q30 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene rplO CDS complement(90375..90563) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ8 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene rpmD CDS complement(90567..91097) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B48 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene rpsE CDS complement(91101..91457) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene rplR CDS complement(91507..92037) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I3 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene rplF CDS complement(92049..92444) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q25 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rpsH CDS complement(92457..92762) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene rpsN CDS complement(92777..93313) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTB9 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene rplE CDS complement(93330..93656) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV7 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene rplX CDS complement(93688..94053) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF31 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene rplN CDS complement(94058..94339) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC41 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene rpsQ CDS complement(94356..94562) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene rpmC CDS complement(94562..94975) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYN6 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene rplP CDS complement(94990..95667) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene rpsC CDS complement(95690..96022) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY9 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene rplV CDS complement(96034..96303) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK64 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene rpsS CDS complement(96326..97156) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY7 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene rplB CDS complement(97171..97467) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF23 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene rplW CDS complement(97464..98069) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD6 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene rplD CDS complement(98083..98715) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJA9 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rplC CDS complement(98727..99044) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP3 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene rpsJ sequence17 source 1..87594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..1884 product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene xanB CDS complement(2651..3592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(3589..7800) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P883 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 8224..8544 product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene fdxB tRNA complement(9039..9118) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(9436..9909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(10327..12015) product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(12041..12319) product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(12465..13529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(13529..15556) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(15842..17041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 17266..19215 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene acsA CDS 19227..19889 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene erdR CDS complement(20054..23401) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 23638..24585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(24658..27135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(27197..27880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 28126..30603 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene fadE CDS 30644..30922 product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(31100..32389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(32389..33399) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 33549..35006 product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 35003..35785 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 35782..36678 product acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene bah CDS complement(36808..37299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 37431..42278 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 42495..46877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 46874..47434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(47614..48696) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW5 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene zapE CDS complement(48693..49448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 49495..50445 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene xerD CDS 50553..51380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene dsbC CDS 51386..52663 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(52636..56010) product nuclease/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(56007..58637) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 58802..61438 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140731.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(62244..62567) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(62675..63253) product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 63503..64072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(64102..65988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(65988..66395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(66392..67192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(67224..67715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(67712..68188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(68281..68766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 69087..69986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 69979..70509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 70506..71048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 71045..71395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 71401..73056 product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 73079..74026 product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417458.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene mshM CDS 74023..75162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 75159..76640 product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 76653..77873 product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(77882..78214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 78264..79058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 79055..79432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 note possible pseudo, internal stop codon, frameshifted CDS 79429..80871 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 80868..81494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 81498..84449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 84497..85249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 tRNA complement(85405..85492) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 85573..86640 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P867 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene queA CDS 86722..87132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 87143..87412 product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 sequence18 source 1..79804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..2161 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(2186..4093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 4265..4693 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770721.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 4750..6453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 6450..7382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038755.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(7392..7898) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(7953..8654) product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198629.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 9007..9615 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 9612..10823 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(11139..11852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 12185..13483 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 13546..13785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 14095..14949 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230898.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 14946..16790 product putative acyltransferase plsB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI59 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene plsB1 CDS 16787..18232 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 18291..19796 product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AQ82 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 19793..20659 product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNZ7 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(20676..22232) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(22269..23066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726862.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(23199..24320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 24596..25711 product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(25718..26629) product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(26676..28019) product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(28016..29188) product R-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255773.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene fldC CDS 29380..30087 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201020.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(30112..30909) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898131.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 31026..32459 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228616.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(32526..34496) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(34614..35501) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388294.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 35663..36667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 36699..37895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 37897..38445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 38448..39227 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 39296..40081 product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 40156..41532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 41578..41925 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 41922..42320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 42332..42787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 42801..43190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703796.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 43271..44296 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(44310..45068) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 45351..45779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 45776..46993 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 46986..47291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 47311..48714 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975577.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 48722..49471 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene gst CDS 49485..53015 product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 53077..54477 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 54490..55272 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 55919..58429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 58499..59980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 60333..61499 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 61847..64093 product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(64159..64767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 65014..66084 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337803.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 66245..66943 product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 67026..67817 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene menB CDS 67828..69117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 69117..69548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 69545..69964 product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 69967..71223 product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 71261..72175 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 72275..73012 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 73012..73665 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene pcaJ CDS 73681..74847 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 74862..75314 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(75353..76207) product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 76389..77843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 77860..79062 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 sequence19 source 1..75751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..1341 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene ephD CDS 1403..2026 product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035721.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(2270..6661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(6925..7416) product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(7681..8406) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969942.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(8403..9467) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(9464..9985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(9982..10311) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 10464..11066 product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UK86 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 11170..11670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 11729..12796 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW8 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene dinB CDS 12920..13132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(13202..14857) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 15278..15502 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 15612..15944 product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813572.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(16062..17981) product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene oliA CDS complement(18116..18685) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(18814..20088) product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene nhaP CDS complement(20224..20466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 20709..21479 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 21580..22728 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 22820..23905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 23895..24740 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 24834..26009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 26081..26557 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 26568..27386 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 27491..28597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 28594..29613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 29610..31385 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 31378..32331 product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(32291..33439) product glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(34032..35078) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 35195..36598 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 36855..38516 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(38701..39930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(39995..40297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 40502..41470 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919048.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(41583..42515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(42512..43735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 43741..44625 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919042.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 44727..45170 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 45198..46382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 46379..47446 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 47443..48657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 48654..49778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 49775..50575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(50565..51365) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(51441..52073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 52277..54238 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 54519..56270 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 56321..56542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 56539..57744 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 57782..58207 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 58253..62749 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(62831..63934) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 64061..64678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(64683..65486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 65739..65960 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 65960..66442 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 66524..68206 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene ggt CDS 68404..71142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 71309..71746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 71755..73191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 73398..73724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 73773..74660 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085766.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(74974..75531) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene ogt sequence20 source 1..75635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1612..2184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 2184..2531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 3038..3670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 3704..4525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 5086..5604 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 5667..5987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 5984..6271 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 6276..6443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 6524..6772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 6772..7080 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 7167..8018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(8025..8519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 8743..9339 product DNA-invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905027.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 9434..10345 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(10979..12322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(12319..12753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(13133..13423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 13862..14920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(14967..16682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(16685..18700) product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919852.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 18877..20382 product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene yclF CDS 20516..22171 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 22206..22823 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFP9 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene clpP3 CDS 22904..23353 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MNK8 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene nudD CDS complement(23549..24865) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096258.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene amgS CDS complement(24882..25604) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene ompR CDS complement(25728..26555) product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene mttC CDS complement(26545..28365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(28441..29097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 29315..29872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 29931..30593 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 30821..31543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 31564..32004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 32092..35688 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMY0 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 35709..36554 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 36568..37125 product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene cheB2 CDS 37122..38138 product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(38150..39100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 39502..40095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 40130..41617 product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(41626..44433) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene valS CDS complement(44615..45733) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 45929..46813 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 46827..47918 product PAPS-dependent sulfotransferase Stf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLG1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene stf3 CDS complement(48608..49792) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(49836..51389) product putative MFS-type transporter YhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54585 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene yhcA CDS complement(51604..51975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(51972..52415) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene holC CDS complement(52480..53991) product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene pepA CDS 54268..55356 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375972.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 55353..56417 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 56425..56895 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 56886..57374 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 57407..58369 product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKN0 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene nagZ CDS 58404..58973 product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 58981..59727 product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 59947..61908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 61970..63061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(63080..64828) product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(64882..66258) product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene xseA CDS 66257..67807 product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene guaB CDS 67846..69420 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X5 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene guaA CDS 69729..70925 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(71401..72075) product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859460.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene ymfK CDS 72141..72458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 72448..73965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202097.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 73952..74554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 sequence21 source 1..73075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..1487 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(1525..3357) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene algA CDS 3648..5414 product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088823.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 5708..5878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(5975..7003) product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(7063..9471) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene lig3 CDS complement(9468..10370) product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE77 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene ku CDS 10684..11331 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 11319..14255 product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 14252..15610 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 15607..16140 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 16137..16781 product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 16778..17809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 17806..18180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 18177..18986 product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 18983..19945 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF38 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 19932..21560 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF39 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 21557..22198 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 22195..22494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 22744..23928 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(23935..24825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918996.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(24827..27505) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 27745..28695 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene yadG CDS 28692..29456 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4P8 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene yadH CDS complement(29776..29904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 30071..31084 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 31081..31842 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(31919..32134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 32133..32657 product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YI2 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene dksA CDS 33014..33868 product periplasmic solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073270.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(33956..34396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(34468..35286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(35471..36763) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene purA CDS complement(36862..37842) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene hisZ CDS complement(37839..38033) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175502.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(38033..38902) product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene hflC CDS complement(38902..40017) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene hflK CDS complement(40134..41438) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene hflX CDS complement(41458..41664) product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene hfq CDS complement(41785..42726) product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCB3 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene miaA CDS complement(42727..44544) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene mutL CDS complement(44655..46064) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(46191..46664) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(46661..48160) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 48159..49238 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene queG CDS complement(49259..50182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 tRNA 50072..50158 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(50249..50626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(50671..52311) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene pgi CDS complement(52407..53060) product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(53068..53448) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene panD CDS complement(53702..54565) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene panC CDS complement(54575..55390) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R49 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene panB CDS complement(55478..55963) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene folK-2 CDS complement(55967..57379) product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T2 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene pcnB CDS complement(57376..58629) product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(58777..59436) product fructose 2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(59433..60356) product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702781.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(60372..61034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 tRNA 61305..61380 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(61557..61874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(62041..62910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(62936..64309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(64554..65963) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(65957..67312) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(67519..69042) product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(69058..69366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228958.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(69381..70391) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226196.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(70391..71560) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(71564..72010) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085743.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 72197..72961 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 sequence22 source 1..69026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263613.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(847..1839) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(1836..2657) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(2805..4097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(4094..5065) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(5062..6393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(6390..7241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(7277..8074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(8192..9526) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 9687..10844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 10850..11815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(11885..14131) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 14379..15005 product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GL3 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 15080..16018 product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(16174..17382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 17481..19388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(19597..21555) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036316.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(21682..22164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 22362..24842 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW7 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene plsB CDS 24934..25671 product putative FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYI8 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene fkpA CDS complement(25740..26357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(26461..29091) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene mrcA CDS 29261..30346 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105329.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene pilM CDS 30354..30938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 30935..31612 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene pilO CDS 31609..32133 product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene pilP CDS 32143..34218 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 34277..35761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 35779..36309 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene aroK CDS 36306..37412 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene aroB CDS 37409..38563 product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P707 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(38767..39459) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(39538..39963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(39967..40227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 40505..44971 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene gltB CDS 45146..46564 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene gltD CDS 46682..47299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(47290..47910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 47991..49388 product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 49385..50158 product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVL3 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(50196..51014) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036079.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 51069..51656 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(51778..52326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 52416..52691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(52701..53540) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(53592..54578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(54721..55278) product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene folE2 CDS 55407..56204 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 56263..57141 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 57131..57883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(58064..60010) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K98 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene mnmG CDS 60141..60365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 60627..61985 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Y0 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene nqrA CDS 61985..63199 product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene nqrB CDS 63207..63974 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene nqrC CDS 63990..64652 product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene nqrD CDS 64656..65261 product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene nqrE CDS 65292..66512 product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M8 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene nqrF CDS 66664..68706 product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948307.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene pepO CDS complement(68667..68861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 sequence23 source 1..68851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 201..929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(1161..1985) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(1991..3172) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene ltp1 CDS complement(3233..4099) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088088.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 4262..5131 product 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 5176..5985 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 6006..6857 product 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 7128..7781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(7874..9070) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896175.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(9176..10354) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728212.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(10357..11550) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064840.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(11568..12794) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(12805..13929) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640506.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(13962..14369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 14705..14890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 14998..15702 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene fabG CDS 15979..17574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 17619..18992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 19120..20178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 20221..22704 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 22717..23061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 23078..23926 product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 24025..24780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 24917..26551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085471.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 26607..27608 product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 27810..29441 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 29477..30568 product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705632.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 30626..31624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(31688..32449) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228925.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 32503..33027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(33014..33844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 33987..35288 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene acd CDS complement(35343..36140) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 36354..38366 product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(38407..39111) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144329.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(39135..40067) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 40215..40898 product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene pcaI CDS 40895..41563 product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 41640..42791 product beta-ketoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6R0 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene pcaF CDS 42807..43112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(43186..43968) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525174.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(44012..46234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 46505..47734 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810300.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(47814..49469) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 49680..51149 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(51162..51719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(51955..53271) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(53346..54539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(54601..55890) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 56252..58546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 58543..59397 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 59394..60953 product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 60950..61744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 61953..62513 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 62902..64083 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 64163..64945 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 65034..65195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 65247..65981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(66065..66634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401859.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(66637..67020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 sequence24 source 1..61296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 565..864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(1477..2796) product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 2999..3430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 3852..4763 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808483.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 4812..5801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246206.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 6204..7208 product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene mphL CDS 7238..7510 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene mphM CDS 7581..9122 product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene mphN CDS 9148..9507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 9524..10585 product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene mphP CDS 10716..11636 product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 11707..13167 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 13176..13961 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 14001..14912 product acetaldehyde dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4S7 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene mhpF CDS 14939..16000 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51020 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene mhpE CDS 15997..16782 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 16840..17856 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405029.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 17900..18250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 18711..19826 product benzoate 1,2-dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene benC CDS 19962..20630 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707287.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(20664..22394) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene mphR CDS 23747..26161 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 26263..27654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 27767..28795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 28841..30856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 31023..33254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 33251..33565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 33799..35301 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 35792..36301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 36914..37432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 37582..37944 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 38248..38754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 note possible pseudo, frameshifted CDS 38931..40292 product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVI7 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene paaK CDS 40289..41491 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene pcaF CDS 41910..43205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 43328..45796 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 45982..46863 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142546.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(46950..47882) product phenylacetic acid degradation operon negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813301.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene paaX CDS 48039..49031 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene paaA CDS 49049..49333 product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene paaB CDS 49389..50144 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene paaC CDS 50131..50691 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709130.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene paaJ CDS 50708..51784 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene paaE CDS 51790..52566 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 52596..54629 product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene paaZ CDS 54644..55438 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene paaG CDS 55446..56993 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 57007..57474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 57614..57925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 58553..59311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 59530..61026 product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 sequence25 source 1..56470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 201..1070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(1282..2241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(2684..4537) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 5097..6755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(6862..7071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 6973..7260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 7364..7960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 8236..8484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 8584..8892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 8946..9350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 9527..10426 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144318.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 10614..11888 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene czcC CDS 11893..12975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 12972..16154 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 16692..18650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 18669..19814 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 19811..22936 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(22958..23677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(23713..26604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 26982..27416 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene fxsA CDS complement(27548..27739) product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 27825..28259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(28295..29059) product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L6M3 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene tatC CDS complement(29056..29436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(29460..29681) product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene tatA CDS complement(29691..30023) product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA47 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene hisE CDS complement(30098..30868) product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene hisF1 CDS complement(30892..31623) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPK3 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene hisA CDS complement(31820..32473) product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene hisH1 CDS complement(32480..33070) product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene hisB CDS complement(33190..34386) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(34383..36329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(36331..37263) product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene hemC CDS complement(37315..38070) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene algR CDS complement(38067..39140) product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 39310..40704 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene argH CDS 40810..42777 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TP86 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(42964..43878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 44159..45640 product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene glpK1 CDS complement(45674..45994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(46069..47043) product pteridine-dependent deoxygenase like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639353.2 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene rapK tRNA 47433..47514 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 47545..48222 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194211.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 48299..48895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 48924..49292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(49464..50774) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(50774..51445) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 51547..52818 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene entS CDS 52859..53554 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 53551..54519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 54810..55784 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226787.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(55884..56225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 sequence26 source 1..55181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 1174..1929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(1971..2189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(2522..4690) product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036603.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene dcp CDS 4823..6016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 6013..6639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 6773..7366 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(7373..8848) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene yehZ CDS complement(8845..9639) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035421.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene yehX CDS 9687..10532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 10532..11071 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 11068..11502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474275.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(11516..12211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(12214..12654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(12795..13001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(13019..13747) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(13771..14181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 14637..19190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 19339..20004 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(20018..24238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 24525..26714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 26920..28092 product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 28218..28388 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R8 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene rubA CDS 28473..29354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706414.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 29398..30630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142974.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 30627..31781 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(31951..34950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(34947..35345) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(35345..37213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(37387..38802) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(38812..39105) product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(39117..40241) product putative NAD(P) transhydrogenase, alpha1 subunit PntAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 40390..41286 product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene exo CDS 41418..42977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 42990..43253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 43482..43940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 43990..45759 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene asnB CDS 45806..47545 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 47526..48686 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767612.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(48705..49964) product D-amino acid dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene dadA CDS complement(50068..50934) product cytochrome c550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807140.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 51683..52702 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 52812..53639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 53659..54684 product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 sequence27 source 1..53585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1339..1659) product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene fdxB CDS complement(1722..2522) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 2734..4269 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 4299..5081 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK05 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene mhpD CDS 5084..6046 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77580 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene mhpF CDS 6043..7047 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene mhpE CDS 7231..8538 product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 8535..9059 product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105327.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 9075..10118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 10134..11045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 11052..11795 product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 11825..12661 product 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene mhpC CDS 12730..13935 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 13947..16079 product fatty oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 16277..16663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 16710..19484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 19519..21111 product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene fadD3 CDS 21534..22193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 22230..23093 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 23321..24100 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 24097..24552 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 24549..25637 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893450.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 tRNA 24736..24829 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 25674..26849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 tRNA 26042..26127 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 26902..27687 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063792.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 27711..28880 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene acdA CDS 29133..30071 product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704170.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 30397..31608 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 31753..34059 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene fyuA CDS complement(34285..35511) product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene mct CDS complement(35508..37244) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene caiA CDS complement(37234..38085) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(38100..38948) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(38958..40448) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene paaH CDS complement(40476..41246) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(41246..42448) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(42451..43923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(44493..44858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 note possible pseudo, frameshifted CDS complement(44762..45307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 note possible pseudo, frameshifted CDS 45439..45744 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082849.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 45741..46568 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970408.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(46588..46773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(46770..47534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(47531..47785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 48197..48481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 48466..49818 product serine/threonine-protein kinase HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIX3 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene hipA CDS 49988..50371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 50374..50943 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 51160..51453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(52279..53436) product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 sequence28 source 1..53294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(361..981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 1304..3574 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene fadE CDS 3683..4747 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(4779..6593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 6817..8466 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(8485..9354) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP8 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene purU CDS complement(9421..9819) product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114826.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(10055..11377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(11387..12154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(12157..13236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(13233..14279) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(14307..15095) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 15329..16048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(16030..18831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(19092..21893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(22393..24564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(24578..25921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(26006..28009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(28388..29260) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRR3 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene yrfI CDS complement(29358..30800) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene gatB CDS complement(30812..32269) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene gatA CDS complement(32352..32735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 32847..33884 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene mreB CDS 33981..34988 product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene mreC CDS 34985..35473 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CL67 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene mreD CDS 35624..37570 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene pbpA CDS 37567..38682 product cell wall shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131717.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene mrdB CDS 38682..39716 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 39713..40558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 40596..41813 product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene dacC CDS 41817..42080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 42077..42712 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VW6 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene lipB CDS 42974..43762 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene mlaF CDS 43759..44529 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 44545..45024 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 45029..45676 product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 45701..45982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 45979..46692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(46759..50604) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene purL CDS complement(50627..51388) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(51399..51734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947249.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 52020..52445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 52442..52918 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528863.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 sequence29 source 1..52495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..1409) product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103681.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene cobC CDS complement(1402..2337) product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I469 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene cobD CDS complement(2334..3617) product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I471 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene cobB CDS complement(3617..4222) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene cobO CDS complement(4219..4800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638412.2 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(4797..5366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036033.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(5386..7230) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 7718..9859 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 10089..11195 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene carA CDS 11195..11614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 11618..14839 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2C7 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene carB CDS 14959..15435 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6W7 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene greA CDS 15465..16103 product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene rlmE CDS 16242..18158 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT2 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene ftsH CDS 18239..19075 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene folP CDS 19114..20412 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF81 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene glmM CDS 20459..21220 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene tpiA CDS 21245..21664 product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene secG tRNA 21738..21822 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 21958..22034 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 22089..22544 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene rimP CDS 22563..24059 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ4 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene nusA CDS 24126..26798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 26818..27183 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene rbfA CDS 27196..28104 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene truB CDS 28196..28465 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV58 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene rpsO CDS 28506..30614 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene pnp CDS complement(31428..31922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(31956..32795) product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP04 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene gluQ CDS 33111..33878 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(33838..34689) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813917.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(34862..35362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(35433..36179) product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AW2 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(36263..36748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 36845..40351 product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVF8 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene smc CDS 40348..41265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 41262..43325 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF3 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene ligA CDS 43530..44582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870187.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 44676..45851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(45809..46090) product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(46092..46394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(46400..46933) product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65198 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene yciB CDS 47000..47644 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980794.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 47689..48354 product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 48438..49415 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJF2 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene trpS CDS 49412..50242 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CP8 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene scpA CDS 50259..51041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 51056..51805 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC0 transl_table 11 codon_start 1 locus_tag LOCUS_32790 sequence30 source 1..52491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..1014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 1019..1918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 1977..4037 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene pepO CDS complement(4104..4433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 4570..5076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(5375..5815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(6387..7496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(7559..8062) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(8118..9014) product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 9169..11469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 11560..13497 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene pepN CDS 13627..13842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(14081..14608) product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(14601..15476) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(15532..16437) product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027569.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(16434..16760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(16921..17526) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815769.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(17733..17909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 18118..18729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(18826..20568) product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SM0 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene pdhB CDS complement(20572..23265) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4T1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene aceE CDS 23370..24281 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(24318..27146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140503.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(27275..28177) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG0 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene cyoE CDS complement(28174..29190) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene ctaA CDS complement(29220..29816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530955.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(29813..30460) product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 30569..30808 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(30874..31752) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene cox3 CDS complement(31986..33593) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene coxA CDS complement(33644..34873) product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene coxB CDS complement(34892..35413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(35501..36202) product ATP-dependent dethiobiotin synthetase BioD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X821 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene bioD1 CDS complement(36204..37415) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene bioF CDS complement(37439..38455) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I618 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene bioB CDS 38544..39233 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 39324..40556 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(40568..41449) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEP9 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene ubiA CDS complement(41507..43624) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene recG CDS complement(43664..44047) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(44087..46264) product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene spoT CDS complement(46408..46677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(46716..47372) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene gmk CDS complement(47362..48213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(48462..48911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 49064..49849 product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 49846..50574 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(50952..51779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106266.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 rRNA complement(52007..52115) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence31 source 1..51804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..1255) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266300.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(1252..1755) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(1770..3632) product putative potassium transport system protein kup 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AK4 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene kup1 CDS complement(3725..4492) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene dapB CDS complement(4612..5727) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene dnaJ CDS complement(5821..7743) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene dnaK CDS complement(7853..8479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(8535..9140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(9137..9682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879652.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(9768..12536) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089510.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(12575..14389) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX35 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(14386..16605) product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY9 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(16716..17744) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R42 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene hrcA CDS 17875..18825 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVT9 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene nadK CDS 18856..20535 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene recN CDS complement(20584..20994) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene fur CDS 21059..21487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(21494..21811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(21808..23190) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 23310..23783 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NSB8 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene smpB CDS complement(23792..24157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(24207..24455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V6 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 24518..25279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(25408..26187) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHJ9 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene sdhB CDS complement(26196..26735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(26754..28541) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N0 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(28541..28924) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(28935..29336) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene sdhC CDS complement(29420..29614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 29720..30676 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(30745..32244) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L3G6 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene lysS CDS complement(32279..33325) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E1JGJ8 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene prfB CDS 33524..34771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(35070..38144) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087092.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(38158..39309) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(39349..40671) product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(41078..41842) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene folD CDS 42449..42763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(43203..43577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 43722..44237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 44434..45486 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene intD tRNA complement(45510..45586) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 45759..46748 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8Q0 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene glk CDS complement(46772..47398) product KHG/KDPG aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201629.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene eda CDS complement(47421..49298) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726837.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene edd CDS 49679..49906 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450529.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene mvpT CDS 49906..50310 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H9 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene vapC CDS 50459..51544 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124092.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 sequence32 source 1..49121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(572..1237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(1234..4527) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(4947..6287) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene mnmE CDS complement(6307..8034) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ7 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene yidC CDS complement(8248..8547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 8434..8652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 8970..10292 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT2 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene dnaA CDS 10976..11692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 11707..12810 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene recF CDS 12907..15312 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2I4 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene gyrB CDS complement(16084..17625) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene gatAX CDS 17847..18794 product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F9 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 18828..19595 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(19605..20687) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U22 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene purK CDS complement(20684..21178) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V5 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene purE CDS complement(21281..22039) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 22172..22720 product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 22743..23129 product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene apaG CDS complement(23122..24435) product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(24535..25350) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene mutM CDS 25461..26063 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene argA CDS complement(26060..26953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(26963..28348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(28359..29102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102804.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(29104..30045) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(30166..31041) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene htrB CDS 31842..32261 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVD2 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene dtd CDS complement(32268..33455) product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E56 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene purT CDS 33551..34987 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene pykA CDS 35083..35853 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 35941..38052 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene ppk CDS complement(38101..39618) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene ppx CDS complement(39618..40025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 40257..40592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 40622..40957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 41296..41940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(42044..42634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(42854..44701) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene rpoD CDS complement(44826..46574) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGI6 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene dnaG CDS complement(46614..47060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(47178..47393) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66536 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene rpsU CDS 47511..48587 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS54 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene tsaD CDS 48584..48940 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW6 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene folB sequence33 source 1..47835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..2049 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene fadD-2 CDS complement(2123..2737) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036299.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(2882..4879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 5047..6384 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119153.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(6407..6841) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531117.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(6838..7812) product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 7908..8258 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene arsC CDS 8363..9616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(9738..10466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(10601..11473) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(11470..11766) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(11941..12399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(12429..12764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(12771..14045) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene ufaM CDS complement(14058..14843) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(14840..16114) product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(16170..16820) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene tesA CDS 16819..17532 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 17529..19997 product inner membrane transport permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(20292..20951) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 21017..21814 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene cysQ CDS 21804..22643 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene murI CDS 22640..23179 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036332.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(23243..23920) product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene mtnC CDS complement(23943..24503) product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67785 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene mtnD CDS complement(24524..25138) product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene mtnB CDS complement(25228..26685) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I7 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene mgtE CDS complement(26819..26986) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57187 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene rpmG CDS complement(26997..27233) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44364 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene rpmB CDS complement(27375..28046) product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 28144..29367 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene coaBC CDS 29381..29824 product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HL1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene dut CDS 29827..30714 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene argB CDS complement(30721..31389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(31438..32076) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8N9 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene pyrE CDS 32153..32929 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene exoA CDS 32926..34308 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene ampG CDS complement(34301..34597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(34770..35159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(35244..36173) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC81 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene prk CDS complement(36170..36928) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJK1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene trmB CDS complement(36913..37509) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(37524..38318) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene thiG CDS complement(38318..38539) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 tRNA 38596..38669 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(38856..39107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(39107..39433) product addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(39487..43056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639423.2 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(43083..44813) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705450.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 44940..45380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038193.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(45402..46124) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(46200..47528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 sequence34 source 1..46344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(245..1075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(1072..2583) product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IX0 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene atpA2 CDS complement(2570..3292) product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCB8 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene atpF CDS complement(3300..3551) product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WB27 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene atpE-2 CDS complement(3578..4243) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IW7 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene atpB CDS complement(4240..4506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(4503..4787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(4784..5188) product ATP synthase epsilon chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKH5 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene atpC2 CDS complement(5185..6597) product ATP synthase subunit beta 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IW3 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene atpD2 CDS complement(6786..7118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(7203..7889) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704277.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(7900..10446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(10462..11526) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene dmsE CDS 11851..12531 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(12787..13587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 13828..14232 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 14229..15482 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 15489..15893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(15901..16581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 16501..16770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(16990..17709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(17737..18642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(18639..19064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(19125..19538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 19675..20607 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816435.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 20696..20950 product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 20947..21180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(21549..22334) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 22524..22949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(23088..23513) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(23646..24803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(24815..26350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(26618..27073) product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(27094..27357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719771.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 27556..29157 product putative phosphate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65713 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(29189..30454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(30451..30957) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene folA CDS complement(31220..32110) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W9 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene thyA CDS complement(32142..32948) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLV4 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene lgt CDS 33170..33535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 33614..34327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(34331..35533) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 35638..36078 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI29 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene nuoA CDS 36084..36758 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ8 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene nuoB CDS 36758..38539 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ7 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene nuoC CDS 38526..39050 product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 39047..40354 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210276.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene nuoF CDS 40512..43346 product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ4 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene nuoG CDS 43669..44664 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRI7 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene nuoH CDS 44661..45197 product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ2 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene nuoI CDS 45214..45720 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J3 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene nuoJ CDS 45717..46037 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ0 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene nuoK sequence35 source 1..39480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 117..1808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 1823..2947 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 3194..6247 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 6488..6952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 6949..7473 product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(7478..8284) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907861.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 8325..8942 product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(8956..9756) product vitamin B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBM3 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene btuF CDS complement(9825..10685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(10682..11254) product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 11360..14149 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(14242..14547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 14647..14952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 14949..15407 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH4 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene trmL CDS complement(15408..16592) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(16744..17469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(17663..18679) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJM6 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene gpsA CDS complement(18694..19188) product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL70 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene secB CDS complement(19194..19463) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene grx3 CDS complement(19499..19924) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208978.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 19973..21181 product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 21331..22683 product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 22703..23542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096069.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(23481..25070) product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene ubiB CDS complement(25067..25693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(25690..26457) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V5 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene ubiE CDS complement(26786..27043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 27334..28332 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene mopB CDS 28363..29268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(29706..30413) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC17 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(30534..31847) product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268583.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(31977..35579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(36033..36899) product 5'-3' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44176 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(36899..37774) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(37895..38260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(38409..39302) product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 sequence36 source 1..38867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 445..816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(827..1600) product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene ptr1 CDS 1692..2471 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ9 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene uppP CDS complement(2485..3702) product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V3 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene cca CDS complement(3699..5654) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 5826..6617 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 6722..7162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 7225..7746 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(7752..8405) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(8420..9433) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920388.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 9598..10437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(10509..11594) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(11638..12441) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene phhA CDS complement(12548..13507) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(13543..13983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 14072..16009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(16024..16866) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W6 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene aroE CDS complement(16851..17846) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene hemB CDS 17858..18685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 18879..19433 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 19430..20170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706665.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(20154..20804) product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT81 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene engB CDS 20919..21533 product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene cc4 CDS 21545..22189 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene dsbA CDS 22193..23131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS complement(23346..24524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(24584..25558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 25731..26747 product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene waaF CDS 26744..27835 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(27951..28865) product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene lpxL CDS complement(28869..29885) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene uge CDS 29972..31219 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene waaA CDS complement(31287..31739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 tRNA 32162..32238 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 32477..32923 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G7G8 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene stbB CDS complement(33038..33661) product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035502.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 33832..34995 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 34992..36599 product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035500.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene accD CDS 36685..38673 product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene accC sequence37 source 1..36364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 51..664 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcaatgaggctgcggacttcgccgcagagcaac CDS complement(875..1165) product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H35 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene cas2 CDS complement(1173..2888) product CRISPR-associated exonuclease Cas4/endonuclease Cas1 fusion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H36 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene cas4-cas1 CDS 2945..3199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 3181..3564 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QN4 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene vapC CDS complement(3630..5300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(5306..6340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(6355..9342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(9332..11623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(11880..12338) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(12464..12697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 12838..13119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(13294..14322) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(14455..15936) product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN18 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene astD CDS 16137..17606 product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene davD CDS 17677..19332 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 19386..19964 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226551.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 19961..20377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204056.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(20387..21199) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 21421..22029 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268173.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 22026..22664 product paraquat-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 22657..24330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064078.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 24330..24938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(24964..25239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 25424..27280 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0M8 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene htpG CDS complement(27319..27900) product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(27932..28858) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 29021..30688 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene cstA CDS 30685..30960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 30951..31934 product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 32064..33770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(33752..34834) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene nerA CDS 34995..36230 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene serA sequence38 source 1..34332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 461..760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 778..1044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 1041..1298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 1440..2387 product integrase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62592 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene int CDS 2420..3544 product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene tgt CDS complement(3568..4053) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH0 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(4068..6350) product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638382.2 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(6534..7559) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6G0 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene astA CDS complement(7666..8880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 9103..10518 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 10680..11951 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene ybjY CDS 12002..12709 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene ycfV CDS 12723..14030 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene ybjZ CDS 14033..15244 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene ybjZ CDS 15250..16557 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene ybjZ CDS 16560..17789 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene ybjZ CDS 17807..19114 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene ybjZ CDS 19127..20353 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene ybjZ CDS 20373..21710 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene ntrC CDS 21741..23072 product histidine kinase/response regulator hybrid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635954.2 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 23224..24696 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 24839..27064 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 27071..27544 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 27541..29490 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 tRNA 29551..29627 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(29992..30723) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001312908.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(30837..31100) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937862.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(31311..33605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 misc_feature complement(33736..>34332) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_293978.1:putative transposase locus_tag LOCUS_36550 sequence39 source 1..29271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1015..1347 product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene fdxB CDS 1445..2209 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 2270..3691 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 3803..5056 product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene yjiB CDS 5081..6331 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 6494..8935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 9077..9781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228943.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 10023..10544 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205446.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 10548..10856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 11244..11705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 11739..12848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 12845..13276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 13273..14418 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 14431..15822 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 15812..17017 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929936.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 17014..17448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 17448..18542 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 18542..20146 product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 20143..20949 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808419.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 21055..22035 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene acoA CDS 22045..23025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 note possible pseudo, internal stop codon CDS 23050..23280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 23277..24047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 note possible pseudo, frameshifted CDS 24114..24494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 25040..27250 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene fyuA CDS 27656..28819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 sequence40 source 1..28628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1879) product strU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637377.2 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(1876..2436) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene rfbD CDS complement(2426..3484) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(3481..4260) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(4318..5427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730934.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(5617..7332) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene proS CDS 7539..8990 product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene alsT CDS complement(9000..9422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(9415..10158) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene moeB CDS complement(10155..10985) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCC8 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene hemK CDS complement(11009..11413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(11410..12498) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47849 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene prfA CDS complement(12609..13865) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene hemA CDS 14122..15759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 15765..16382 product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AQ2 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene lolB CDS 16379..17242 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC64 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene ispE CDS 17505..20327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 tRNA complement(18321..18398) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 20465..20539 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 20590..21648 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC63 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene prs CDS complement(21778..23298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 23427..24335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 24356..25351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 25351..27321 product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene tgpA sequence41 source 1..27119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1279 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P556:microcystinase C locus_tag LOCUS_37040 CDS 1358..2959 product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P556 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 3068..4672 product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P556 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 4932..6167 product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene gltP CDS 6606..7664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 7649..8641 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920949.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 8952..9875 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(9897..13046) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(13051..14160) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 15078..18035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 18109..19518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53195 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 19671..20783 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 21403..24048 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene btuB CDS 24262..24987 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 24984..26390 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 26423..26962 product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene exbB sequence42 source 1..26457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..479 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 476..862 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 963..2696 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene pilB CDS 2779..3996 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene pilC CDS 3996..4859 product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U2 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene pilD CDS 4856..5458 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56764 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene coaE CDS complement(5376..7280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 7697..8329 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(8351..10540) product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(10549..12456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 12599..13744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 note possible pseudo, frameshifted CDS 13647..13997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 14100..14315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 14460..15788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 15803..16807 product sulfate transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391147.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 16814..17053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 17058..17684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 17728..18591 product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 18588..19490 product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530874.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 19515..20645 product sulfate/thiosulfate import ATP-binding protein CysA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92XW1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene cysA1 CDS 20787..21200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 21266..21523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 21732..22193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 22525..23904 product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene intA CDS 23923..24150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 24157..24483 product addiction module killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 24449..24805 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994576.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 24811..25218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 25219..25701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 25735..26241 product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349509.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 sequence43 source 1..25967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..1663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 1678..3498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 3495..4013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(4168..4371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 4521..4763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 4756..5988 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926852.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(6053..6370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 6399..6656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 6659..7072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 7126..7551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 7548..7985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 8422..9873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 10335..10703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 10714..11499 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 11649..11912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 11909..12823 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 12820..13518 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 13522..14160 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(14567..15577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(15610..16698) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950844.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(16950..19370) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(19383..20324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(20587..21954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(21982..23583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 24710..25258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 sequence44 source 1..19378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(657..938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(935..1207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(1265..2551) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976209.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(2655..3032) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(3007..3552) product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X71 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(3580..4095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(4095..6191) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene glyS CDS 6408..7937 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMS0 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(8003..9451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(9587..10489) product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene glyQ CDS 10759..12171 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTP9 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 12343..12882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456803.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 12973..14043 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 14040..15488 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602497.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene glnG CDS 15554..15931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(15944..16816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 16855..17706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(18128..19039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37930 sequence45 source 1..18363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 242..317 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 411..806 product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET6 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene secE CDS 803..1336 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN2 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene nusG CDS 1458..1889 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene rplK CDS 1893..2585 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAP2 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene rplA CDS 2781..3332 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ2 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene rplJ CDS 3401..3775 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene rplL CDS 3988..8061 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC56 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene rpoB CDS 8105..12385 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene rpoC CDS complement(12497..14785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 15129..15506 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L43 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene rpsL CDS 15563..16036 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ97 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene rpsG CDS 16078..18180 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene fusA sequence46 source 1..12012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 986..2173 product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 2185..2376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 note possible pseudo, frameshifted CDS 2538..4673 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 4735..4881 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R8 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene rubA CDS complement(5448..6458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 6707..9487 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 9604..9897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 note possible pseudo, frameshifted CDS 10329..11795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLN7 transl_table 11 codon_start 1 locus_tag LOCUS_38130 sequence47 source 1..10159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..738) product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349509.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(847..1356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(1353..1760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(1846..2250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(2240..3670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090968.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(3657..4082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(4082..4285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(4285..4506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(4599..5579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(5619..5990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(5980..6231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(6228..6635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(6815..8038) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(8254..9933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 sequence48 source 1..9423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 1479..2000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 2231..2485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 2696..4198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 4276..4539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 4595..4930 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 4997..5329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 5350..6336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 6750..7580 product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(7630..7929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 8073..8294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(8232..9146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(9168..9422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 sequence49 source 1..9233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(489..564) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(600..673) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(736..821) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(936..3392) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 3474..4388 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene czcD.1 CDS 4420..5301 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene tesB CDS 5336..6919 product glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C6 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene opgD CDS 7012..8970 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 sequence50 source 1..7750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(591..824) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK01 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(883..1626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(1812..7154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 sequence51 source 1..7081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..1101) product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene hprA CDS complement(1171..1359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(1538..1951) product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJE5 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene mscL CDS complement(2069..2932) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 2931..3956 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(3965..4723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 4925..6757 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene typA sequence52 source 1..6235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1016..1318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 1953..2402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 2457..2702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 2699..2995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 3062..3646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 3656..3961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(4391..4570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 4781..5272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 5358..5807 product DUF4826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072584.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(5866..6081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 sequence53 source 1..4229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(345..998) product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TA7 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(1002..1409) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(1479..2018) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(2086..3537) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 misc_feature complement(3534..>4229) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707199.1:DUF3450 domain-containing protein locus_tag LOCUS_38710 sequence54 source 1..3681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1927..3402) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 sequence55 source 1..3502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..817) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(805..1062) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8M1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(1660..1908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(1901..2182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(2393..3451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 sequence56 source 1..3333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 note possible pseudo, frameshifted CDS complement(271..645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 note possible pseudo, frameshifted CDS 841..1185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 note possible pseudo, frameshifted CDS 1218..1547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 1531..1899 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331436.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 sequence57 source 1..3313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 364..2766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 2858..3100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 sequence58 source 1..2132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..1303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(1292..1807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 sequence59 source 1..2080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence60 source 1..1954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..1699) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene manB sequence61 source 1..1894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 438..674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 646..999 product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G1UB28 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(1162..1329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(1346..1675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 sequence62 source 1..1766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1469) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene aspC sequence63 source 1..1618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 336..662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 616..1014 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331436.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 sequence64 source 1..1490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(632..1009) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887809.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 note possible pseudo, frameshifted CDS complement(946..1437) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056095.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 sequence65 source 1..1370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..1287) product ISL3 family transposase ISMac21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 sequence66 source 1..1235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 690..1058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 sequence67 source 1..1222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 34..>1222 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggctgcggacttcgccgcagagcaac sequence68 source 1..1182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39000 sequence69 source 1..1179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence70 source 1..1067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@