>Feature sequence001 <1 1112 gene locus_tag LOCUS_00010 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P72174:UvrABC system protein B 1249 2694 gene locus_tag LOCUS_00020 gene nhaD 1249 2694 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_00020 2741 2817 gene locus_tag LOCUS_t00010 2741 2817 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3292 4311 gene locus_tag LOCUS_00030 3292 4311 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_00030 4359 6116 gene locus_tag LOCUS_00040 4359 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7293 6136 gene locus_tag LOCUS_00050 gene dapE 7293 6136 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T00 protein_id gnl|my_center|LOCUS_00050 8125 7301 gene locus_tag LOCUS_00060 gene dapD 8125 7301 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9D8 protein_id gnl|my_center|LOCUS_00060 10820 8148 gene locus_tag LOCUS_00070 gene glnD 10820 8148 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_00070 11621 10839 gene locus_tag LOCUS_00080 gene map 11621 10839 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P242 protein_id gnl|my_center|LOCUS_00080 11833 12609 gene locus_tag LOCUS_00090 gene rpsB 11833 12609 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS8 protein_id gnl|my_center|LOCUS_00090 12606 13487 gene locus_tag LOCUS_00100 gene tsf 12606 13487 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG4 protein_id gnl|my_center|LOCUS_00100 13589 14308 gene locus_tag LOCUS_00110 gene pyrH 13589 14308 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_00110 14336 14893 gene locus_tag LOCUS_00120 gene frr 14336 14893 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_00120 14961 15617 gene locus_tag LOCUS_00130 gene uppS 14961 15617 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P248 protein_id gnl|my_center|LOCUS_00130 15621 16442 gene locus_tag LOCUS_00140 gene cdsA-1 15621 16442 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_00140 16439 17632 gene locus_tag LOCUS_00150 gene dxr 16439 17632 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYC4 protein_id gnl|my_center|LOCUS_00150 17629 18990 gene locus_tag LOCUS_00160 gene yaeL 17629 18990 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N843 protein_id gnl|my_center|LOCUS_00160 19010 21313 gene locus_tag LOCUS_00170 gene bamA 19010 21313 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_00170 21347 21853 gene locus_tag LOCUS_00180 21347 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21857 22924 gene locus_tag LOCUS_00190 gene lpxD 21857 22924 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_00190 22930 23379 gene locus_tag LOCUS_00200 gene fabZ 22930 23379 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61452 protein_id gnl|my_center|LOCUS_00200 23376 24158 gene locus_tag LOCUS_00210 gene lpxA 23376 24158 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZN9 protein_id gnl|my_center|LOCUS_00210 24166 25305 gene locus_tag LOCUS_00220 gene lpxB 24166 25305 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW6 protein_id gnl|my_center|LOCUS_00220 25302 25883 gene locus_tag LOCUS_00230 gene rnhB 25302 25883 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_00230 25880 29410 gene locus_tag LOCUS_00240 gene dnaE 25880 29410 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_00240 29472 30431 gene locus_tag LOCUS_00250 gene accA 29472 30431 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH9 protein_id gnl|my_center|LOCUS_00250 30469 31767 gene locus_tag LOCUS_00260 gene tilS 30469 31767 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 protein_id gnl|my_center|LOCUS_00260 31878 34505 gene locus_tag LOCUS_00270 gene gyrA 31878 34505 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 protein_id gnl|my_center|LOCUS_00270 34521 35603 gene locus_tag LOCUS_00280 gene serC 34521 35603 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ94 protein_id gnl|my_center|LOCUS_00280 35687 36853 gene locus_tag LOCUS_00290 35687 36853 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_00290 36853 37959 gene locus_tag LOCUS_00300 36853 37959 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_00300 38132 39274 gene locus_tag LOCUS_00310 gene hisC2 38132 39274 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_00310 39271 40155 gene locus_tag LOCUS_00320 39271 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40157 41479 gene locus_tag LOCUS_00330 40157 41479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00330 41476 42168 gene locus_tag LOCUS_00340 gene cmk 41476 42168 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_00340 42260 43936 gene locus_tag LOCUS_00350 gene rpsA 42260 43936 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 protein_id gnl|my_center|LOCUS_00350 44066 44377 gene locus_tag LOCUS_00360 gene ihfB 44066 44377 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0U2 protein_id gnl|my_center|LOCUS_00360 44370 44672 gene locus_tag LOCUS_00370 44370 44672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44675 45823 gene locus_tag LOCUS_00380 gene lapB 44675 45823 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CIL3 protein_id gnl|my_center|LOCUS_00380 46013 47008 gene locus_tag LOCUS_00390 gene hpnA 46013 47008 CDS product HpnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121915.1 protein_id gnl|my_center|LOCUS_00390 48532 47033 gene locus_tag LOCUS_00400 48532 47033 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_00400 49446 48532 gene locus_tag LOCUS_00410 49446 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 50057 49443 gene locus_tag LOCUS_00420 gene senC 50057 49443 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_00420 50163 51098 gene locus_tag LOCUS_00430 gene prmB 50163 51098 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM8 protein_id gnl|my_center|LOCUS_00430 51107 52222 gene locus_tag LOCUS_00440 gene aroC 51107 52222 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KU7 protein_id gnl|my_center|LOCUS_00440 52226 53434 gene locus_tag LOCUS_00450 52226 53434 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_00450 54632 53382 gene locus_tag LOCUS_00460 54632 53382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54813 56219 gene locus_tag LOCUS_00470 gene leuC 54813 56219 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEZ0 protein_id gnl|my_center|LOCUS_00470 56219 56866 gene locus_tag LOCUS_00480 gene leuD 56219 56866 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_00480 56863 57939 gene locus_tag LOCUS_00490 gene leuB 56863 57939 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_00490 57973 58995 gene locus_tag LOCUS_00500 gene asd 57973 58995 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT63 protein_id gnl|my_center|LOCUS_00500 59106 62396 gene locus_tag LOCUS_00510 gene fimV 59106 62396 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_00510 62402 63085 gene locus_tag LOCUS_00520 62402 63085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63085 63861 gene locus_tag LOCUS_00530 gene truA 63085 63861 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD27 protein_id gnl|my_center|LOCUS_00530 63883 64527 gene locus_tag LOCUS_00540 gene trpF 63883 64527 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R6 protein_id gnl|my_center|LOCUS_00540 64508 65722 gene locus_tag LOCUS_00550 gene trpB 64508 65722 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_00550 66807 65728 gene locus_tag LOCUS_00560 66807 65728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 66688 66933 gene locus_tag LOCUS_00570 66688 66933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68393 66915 gene locus_tag LOCUS_00580 68393 66915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_00580 68713 69528 gene locus_tag LOCUS_00590 gene trpA 68713 69528 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_00590 69580 70455 gene locus_tag LOCUS_00600 gene accD 69580 70455 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_00600 70487 71701 gene locus_tag LOCUS_00610 gene folC 70487 71701 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_00610 71694 72350 gene locus_tag LOCUS_00620 71694 72350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72426 72959 gene locus_tag LOCUS_00630 72426 72959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_00630 72965 74491 gene locus_tag LOCUS_00640 gene purF 72965 74491 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_00640 74484 75680 gene locus_tag LOCUS_00650 gene metZ 74484 75680 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_00650 75687 76484 gene locus_tag LOCUS_00660 75687 76484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_00660 78633 76642 gene locus_tag LOCUS_00670 78633 76642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79442 78711 gene locus_tag LOCUS_00680 gene lpxH 79442 78711 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 protein_id gnl|my_center|LOCUS_00680 80020 79439 gene locus_tag LOCUS_00690 gene ppiA 80020 79439 CDS product peptidyl-prolyl cis-trans isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59641 protein_id gnl|my_center|LOCUS_00690 80964 80017 gene locus_tag LOCUS_00700 gene dusA 80964 80017 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TW5 protein_id gnl|my_center|LOCUS_00700 81188 82234 gene locus_tag LOCUS_00710 81188 82234 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_00710 82329 82883 gene locus_tag LOCUS_00720 82329 82883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 83106 82876 gene locus_tag LOCUS_00730 83106 82876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83332 83099 gene locus_tag LOCUS_00740 83332 83099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 83587 83336 gene locus_tag LOCUS_00750 83587 83336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 83933 83580 gene locus_tag LOCUS_00760 83933 83580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 84195 83926 gene locus_tag LOCUS_00770 84195 83926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence002 <1 1162 gene locus_tag LOCUS_00780 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942184.1:ATPase AAA 1164 2042 gene locus_tag LOCUS_00790 1164 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 3285 2050 gene locus_tag LOCUS_00800 gene argD1 3285 2050 CDS product acetylornithine aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885K0 protein_id gnl|my_center|LOCUS_00800 3414 3339 gene locus_tag LOCUS_t00020 3414 3339 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4239 3460 gene locus_tag LOCUS_00810 4239 3460 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_00810 5763 4249 gene locus_tag LOCUS_00820 5763 4249 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_00820 5978 6190 gene locus_tag LOCUS_00830 5978 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6952 6224 gene locus_tag LOCUS_00840 6952 6224 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706658.1 protein_id gnl|my_center|LOCUS_00840 7072 9735 gene locus_tag LOCUS_00850 gene clpB 7072 9735 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_00850 10289 9765 gene locus_tag LOCUS_00860 10289 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 10446 10261 gene locus_tag LOCUS_00870 10446 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 11255 10482 gene locus_tag LOCUS_00880 gene zapD 11255 10482 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GU2 protein_id gnl|my_center|LOCUS_00880 11951 11310 gene locus_tag LOCUS_00890 gene coaE 11951 11310 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7C397 protein_id gnl|my_center|LOCUS_00890 12799 11951 gene locus_tag LOCUS_00900 12799 11951 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_00900 14020 12803 gene locus_tag LOCUS_00910 gene pilC 14020 12803 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_00910 15788 14046 gene locus_tag LOCUS_00920 gene pilB 15788 14046 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_00920 15897 16754 gene locus_tag LOCUS_00930 15897 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 19309 16889 gene locus_tag LOCUS_00940 19309 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 19829 19738 gene locus_tag LOCUS_t00030 19829 19738 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20133 19936 gene locus_tag LOCUS_00950 gene csrA 20133 19936 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF9 protein_id gnl|my_center|LOCUS_00950 21412 20177 gene locus_tag LOCUS_00960 gene lysC 21412 20177 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_00960 24038 21414 gene locus_tag LOCUS_00970 gene alaS 24038 21414 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X0 protein_id gnl|my_center|LOCUS_00970 24559 24137 gene locus_tag LOCUS_00980 gene recX 24559 24137 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ5 protein_id gnl|my_center|LOCUS_00980 25622 24600 gene locus_tag LOCUS_00990 gene recA 25622 24600 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_00990 26161 25664 gene locus_tag LOCUS_01000 26161 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 protein_id gnl|my_center|LOCUS_01000 26255 28804 gene locus_tag LOCUS_01010 gene mutS 26255 28804 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB5 protein_id gnl|my_center|LOCUS_01010 29080 28844 gene locus_tag LOCUS_01020 29080 28844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719749.1 protein_id gnl|my_center|LOCUS_01020 29592 29092 gene locus_tag LOCUS_01030 29592 29092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 31030 29669 gene locus_tag LOCUS_01040 31030 29669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_01040 32561 31131 gene locus_tag LOCUS_01050 gene cabC1 32561 31131 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_01050 32713 33186 gene locus_tag LOCUS_01060 32713 33186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013314.1 protein_id gnl|my_center|LOCUS_01060 35735 33174 gene locus_tag LOCUS_01070 35735 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 36397 35714 gene locus_tag LOCUS_01080 36397 35714 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JU3 protein_id gnl|my_center|LOCUS_01080 36809 36405 gene locus_tag LOCUS_01090 36809 36405 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_01090 37360 36806 gene locus_tag LOCUS_01100 37360 36806 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_01100 38663 37353 gene locus_tag LOCUS_01110 gene ttpC 38663 37353 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_01110 39571 38717 gene locus_tag LOCUS_01120 39571 38717 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_01120 40459 39614 gene locus_tag LOCUS_01130 40459 39614 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_01130 40721 40488 gene locus_tag LOCUS_01140 40721 40488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 41341 40811 gene locus_tag LOCUS_01150 gene greB 41341 40811 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P8 protein_id gnl|my_center|LOCUS_01150 42183 41338 gene locus_tag LOCUS_01160 42183 41338 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530170.1 protein_id gnl|my_center|LOCUS_01160 44957 42216 gene locus_tag LOCUS_01170 44957 42216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_01170 45710 44961 gene locus_tag LOCUS_01180 45710 44961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 45929 46930 gene locus_tag LOCUS_01190 45929 46930 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDK1 protein_id gnl|my_center|LOCUS_01190 46977 48149 gene locus_tag LOCUS_01200 46977 48149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_01200 48642 50957 gene locus_tag LOCUS_01210 48642 50957 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 protein_id gnl|my_center|LOCUS_01210 52376 50979 gene locus_tag LOCUS_01220 52376 50979 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_01220 52836 52384 gene locus_tag LOCUS_01230 52836 52384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_01230 54402 52960 gene locus_tag LOCUS_01240 54402 52960 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 protein_id gnl|my_center|LOCUS_01240 55318 54383 gene locus_tag LOCUS_01250 55318 54383 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_01250 55435 56265 gene locus_tag LOCUS_01260 55435 56265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230389.1 protein_id gnl|my_center|LOCUS_01260 56401 57486 gene locus_tag LOCUS_01270 56401 57486 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205170.1 protein_id gnl|my_center|LOCUS_01270 58637 57516 gene locus_tag LOCUS_01280 58637 57516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 62586 58783 gene locus_tag LOCUS_01290 62586 58783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 62931 66401 gene locus_tag LOCUS_01300 gene icmF 62931 66401 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F222 protein_id gnl|my_center|LOCUS_01300 66428 66970 gene locus_tag LOCUS_01310 66428 66970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701028.1 protein_id gnl|my_center|LOCUS_01310 67596 66979 gene locus_tag LOCUS_01320 gene pmtA 67596 66979 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_01320 68023 67655 gene locus_tag LOCUS_01330 68023 67655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence003 504 34 gene locus_tag LOCUS_01340 gene smg 504 34 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_01340 1654 536 gene locus_tag LOCUS_01350 gene smf 1654 536 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_01350 2844 1651 gene locus_tag LOCUS_01360 2844 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01360 2926 3432 gene locus_tag LOCUS_01370 gene def 2926 3432 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRZ1 protein_id gnl|my_center|LOCUS_01370 3443 4366 gene locus_tag LOCUS_01380 gene fmt 3443 4366 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85732 protein_id gnl|my_center|LOCUS_01380 4363 5700 gene locus_tag LOCUS_01390 gene rsmB 4363 5700 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4G1 protein_id gnl|my_center|LOCUS_01390 5817 7448 gene locus_tag LOCUS_01400 5817 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 8318 7470 gene locus_tag LOCUS_01410 8318 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_01410 8989 8600 gene locus_tag LOCUS_01420 8989 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9646 9050 gene locus_tag LOCUS_01430 9646 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 9784 11160 gene locus_tag LOCUS_01440 gene trkA 9784 11160 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_01440 11160 12578 gene locus_tag LOCUS_01450 11160 12578 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPV3 protein_id gnl|my_center|LOCUS_01450 12652 14370 gene locus_tag LOCUS_01460 12652 14370 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529248.1 protein_id gnl|my_center|LOCUS_01460 14429 15367 gene locus_tag LOCUS_01470 gene thrB 14429 15367 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU4 protein_id gnl|my_center|LOCUS_01470 15364 15921 gene locus_tag LOCUS_01480 15364 15921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 15921 17288 gene locus_tag LOCUS_01490 15921 17288 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_01490 17711 17295 gene locus_tag LOCUS_01500 17711 17295 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921393.1 protein_id gnl|my_center|LOCUS_01500 18436 17696 gene locus_tag LOCUS_01510 18436 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 19228 18458 gene locus_tag LOCUS_01520 19228 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 19766 19233 gene locus_tag LOCUS_01530 19766 19233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19836 20303 gene locus_tag LOCUS_01540 19836 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_01540 21253 20306 gene locus_tag LOCUS_01550 21253 20306 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 protein_id gnl|my_center|LOCUS_01550 21348 22010 gene locus_tag LOCUS_01560 gene azoR 21348 22010 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWP8 protein_id gnl|my_center|LOCUS_01560 22919 21972 gene locus_tag LOCUS_01570 22919 21972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 23048 24115 gene locus_tag LOCUS_01580 gene aroG 23048 24115 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_01580 26481 24487 gene locus_tag LOCUS_01590 26481 24487 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 protein_id gnl|my_center|LOCUS_01590 27020 26595 gene locus_tag LOCUS_01600 27020 26595 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 protein_id gnl|my_center|LOCUS_01600 27098 27766 gene locus_tag LOCUS_01610 27098 27766 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770116.1 protein_id gnl|my_center|LOCUS_01610 27786 30113 gene locus_tag LOCUS_01620 27786 30113 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404440.1 protein_id gnl|my_center|LOCUS_01620 30110 30532 gene locus_tag LOCUS_01630 gene mrpB 30110 30532 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_01630 30532 30879 gene locus_tag LOCUS_01640 gene mrpC 30532 30879 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_01640 30876 32372 gene locus_tag LOCUS_01650 30876 32372 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_01650 32369 32842 gene locus_tag LOCUS_01660 32369 32842 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404436.1 protein_id gnl|my_center|LOCUS_01660 32839 33102 gene locus_tag LOCUS_01670 32839 33102 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883000.1 protein_id gnl|my_center|LOCUS_01670 33099 33455 gene locus_tag LOCUS_01680 gene shaG 33099 33455 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_01680 33862 33452 gene locus_tag LOCUS_01690 gene sufE 33862 33452 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_01690 34026 34745 gene locus_tag LOCUS_01700 gene rph 34026 34745 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_01700 34742 35347 gene locus_tag LOCUS_01710 34742 35347 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6A8 protein_id gnl|my_center|LOCUS_01710 35347 36519 gene locus_tag LOCUS_01720 35347 36519 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_01720 36516 36701 gene locus_tag LOCUS_01730 36516 36701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639145.2 protein_id gnl|my_center|LOCUS_01730 36808 37011 gene locus_tag LOCUS_01740 gene rpmE 36808 37011 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS9 protein_id gnl|my_center|LOCUS_01740 37128 38399 gene locus_tag LOCUS_01750 37128 38399 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_01750 38406 39695 gene locus_tag LOCUS_01760 gene gltA 38406 39695 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33915 protein_id gnl|my_center|LOCUS_01760 39736 41136 gene locus_tag LOCUS_01770 39736 41136 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_01770 41288 41887 gene locus_tag LOCUS_01780 41288 41887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 43465 42233 gene locus_tag LOCUS_01790 43465 42233 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_01790 43832 43494 gene locus_tag LOCUS_01800 gene glnK 43832 43494 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_01800 43990 44250 gene locus_tag LOCUS_01810 43990 44250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096478.1 protein_id gnl|my_center|LOCUS_01810 44252 45793 gene locus_tag LOCUS_01820 44252 45793 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_01820 46596 45874 gene locus_tag LOCUS_01830 46596 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_01830 47268 46747 gene locus_tag LOCUS_01840 47268 46747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 47364 47783 gene locus_tag LOCUS_01850 47364 47783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 47932 48387 gene locus_tag LOCUS_01860 47932 48387 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228997.1 protein_id gnl|my_center|LOCUS_01860 49405 48344 gene locus_tag LOCUS_01870 49405 48344 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_01870 50139 49402 gene locus_tag LOCUS_01880 50139 49402 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239389.1 protein_id gnl|my_center|LOCUS_01880 50664 50164 gene locus_tag LOCUS_01890 50664 50164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 50984 50649 gene locus_tag LOCUS_01900 gene arsR 50984 50649 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809062.1 protein_id gnl|my_center|LOCUS_01900 51020 51775 gene locus_tag LOCUS_01910 51020 51775 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_01910 51772 52599 gene locus_tag LOCUS_01920 51772 52599 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_01920 52608 53189 gene locus_tag LOCUS_01930 52608 53189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 53368 54009 gene locus_tag LOCUS_01940 gene alkB 53368 54009 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815451.1 protein_id gnl|my_center|LOCUS_01940 54599 54006 gene locus_tag LOCUS_01950 54599 54006 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205541.1 protein_id gnl|my_center|LOCUS_01950 55865 54720 gene locus_tag LOCUS_01960 55865 54720 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_01960 56638 56003 gene locus_tag LOCUS_01970 56638 56003 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_01970 56818 57408 gene locus_tag LOCUS_01980 56818 57408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 58687 57383 gene locus_tag LOCUS_01990 58687 57383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence004 304 1281 gene locus_tag LOCUS_02000 304 1281 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926402.1 protein_id gnl|my_center|LOCUS_02000 1576 1247 gene locus_tag LOCUS_02010 1576 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1794 1573 gene locus_tag LOCUS_02020 1794 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2272 1937 gene locus_tag LOCUS_02030 2272 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2603 2319 gene locus_tag LOCUS_02040 2603 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3023 2805 gene locus_tag LOCUS_02050 3023 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3210 3016 gene locus_tag LOCUS_02060 3210 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 3692 3210 gene locus_tag LOCUS_02070 3692 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3885 3685 gene locus_tag LOCUS_02080 3885 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4156 3878 gene locus_tag LOCUS_02090 4156 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 4743 4156 gene locus_tag LOCUS_02100 4743 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104848.1 protein_id gnl|my_center|LOCUS_02100 5289 4753 gene locus_tag LOCUS_02110 5289 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6319 5516 gene locus_tag LOCUS_02120 6319 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268024.1 protein_id gnl|my_center|LOCUS_02120 6699 6319 gene locus_tag LOCUS_02130 6699 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553171.1 protein_id gnl|my_center|LOCUS_02130 7128 6724 gene locus_tag LOCUS_02140 7128 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 7631 7200 gene locus_tag LOCUS_02150 7631 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 8209 7631 gene locus_tag LOCUS_02160 8209 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8949 8206 gene locus_tag LOCUS_02170 8949 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9922 8942 gene locus_tag LOCUS_02180 9922 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10823 9915 gene locus_tag LOCUS_02190 10823 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11239 10820 gene locus_tag LOCUS_02200 11239 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 11874 11236 gene locus_tag LOCUS_02210 11874 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 12206 11874 gene locus_tag LOCUS_02220 12206 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 12291 12815 gene locus_tag LOCUS_02230 12291 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 13672 12821 gene locus_tag LOCUS_02240 13672 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13776 13979 gene locus_tag LOCUS_02250 13776 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 14479 14123 gene locus_tag LOCUS_02260 14479 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14501 14761 gene locus_tag LOCUS_02270 14501 14761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14764 15771 gene locus_tag LOCUS_02280 14764 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15764 16330 gene locus_tag LOCUS_02290 15764 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 16330 16608 gene locus_tag LOCUS_02300 16330 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 16601 17158 gene locus_tag LOCUS_02310 16601 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 17496 17170 gene locus_tag LOCUS_02320 17496 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 17582 17998 gene locus_tag LOCUS_02330 17582 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 17985 18227 gene locus_tag LOCUS_02340 17985 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18224 18595 gene locus_tag LOCUS_02350 18224 18595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 18592 18975 gene locus_tag LOCUS_02360 18592 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 18972 19349 gene locus_tag LOCUS_02370 18972 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 19353 19895 gene locus_tag LOCUS_02380 19353 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 20195 20437 gene locus_tag LOCUS_02390 20195 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 20437 21033 gene locus_tag LOCUS_02400 20437 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268910.1 protein_id gnl|my_center|LOCUS_02400 21207 21626 gene locus_tag LOCUS_02410 21207 21626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 21626 21892 gene locus_tag LOCUS_02420 21626 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 21873 22397 gene locus_tag LOCUS_02430 21873 22397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 22440 22844 gene locus_tag LOCUS_02440 22440 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 22884 23390 gene locus_tag LOCUS_02450 22884 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 23387 24070 gene locus_tag LOCUS_02460 23387 24070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24067 24282 gene locus_tag LOCUS_02470 24067 24282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 24285 24878 gene locus_tag LOCUS_02480 24285 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 24884 26422 gene locus_tag LOCUS_02490 24884 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 26422 28536 gene locus_tag LOCUS_02500 26422 28536 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787512.1 protein_id gnl|my_center|LOCUS_02500 28694 29755 gene locus_tag LOCUS_02510 28694 29755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344999.1 protein_id gnl|my_center|LOCUS_02510 29768 30997 gene locus_tag LOCUS_02520 29768 30997 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214480.1 protein_id gnl|my_center|LOCUS_02520 31009 31434 gene locus_tag LOCUS_02530 31009 31434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 31497 31922 gene locus_tag LOCUS_02540 31497 31922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31926 32606 gene locus_tag LOCUS_02550 31926 32606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 32730 33227 gene locus_tag LOCUS_02560 32730 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 33224 33832 gene locus_tag LOCUS_02570 33224 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 33845 35194 gene locus_tag LOCUS_02580 33845 35194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 35197 36894 gene locus_tag LOCUS_02590 35197 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 36906 39536 gene locus_tag LOCUS_02600 36906 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 39537 40613 gene locus_tag LOCUS_02610 39537 40613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 40603 41049 gene locus_tag LOCUS_02620 40603 41049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 41046 41681 gene locus_tag LOCUS_02630 41046 41681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 41693 42163 gene locus_tag LOCUS_02640 41693 42163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 42166 42423 gene locus_tag LOCUS_02650 42166 42423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 42433 43896 gene locus_tag LOCUS_02660 42433 43896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 43896 58043 gene locus_tag LOCUS_02670 43896 58043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 58163 58017 gene locus_tag LOCUS_02680 58163 58017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 58514 58430 gene locus_tag LOCUS_t00040 58514 58430 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 234 1400 gene locus_tag LOCUS_02690 gene sucC 234 1400 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53592 protein_id gnl|my_center|LOCUS_02690 1404 2279 gene locus_tag LOCUS_02700 gene sucD 1404 2279 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_02700 2304 3920 gene locus_tag LOCUS_02710 2304 3920 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926542.1 protein_id gnl|my_center|LOCUS_02710 4843 3926 gene locus_tag LOCUS_02720 4843 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4859 5836 gene locus_tag LOCUS_02730 gene rluD 4859 5836 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7D7 protein_id gnl|my_center|LOCUS_02730 5842 6585 gene locus_tag LOCUS_02740 5842 6585 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_02740 6869 9094 gene locus_tag LOCUS_02750 6869 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_02750 9238 10212 gene locus_tag LOCUS_02760 9238 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_02760 10264 12882 gene locus_tag LOCUS_02770 10264 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 14331 12964 gene locus_tag LOCUS_02780 14331 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 15275 14433 gene locus_tag LOCUS_02790 gene apaH 15275 14433 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST8 protein_id gnl|my_center|LOCUS_02790 15402 16547 gene locus_tag LOCUS_02800 15402 16547 CDS product phosphoesterase PA-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531773.1 protein_id gnl|my_center|LOCUS_02800 16595 17701 gene locus_tag LOCUS_02810 16595 17701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 protein_id gnl|my_center|LOCUS_02810 17800 17994 gene locus_tag LOCUS_02820 17800 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 18021 18467 gene locus_tag LOCUS_02830 18021 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 18524 18973 gene locus_tag LOCUS_02840 18524 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 19004 19972 gene locus_tag LOCUS_02850 19004 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 19972 21372 gene locus_tag LOCUS_02860 19972 21372 CDS product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269002.1 protein_id gnl|my_center|LOCUS_02860 21385 22587 gene locus_tag LOCUS_02870 gene tadZ 21385 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093855.1 protein_id gnl|my_center|LOCUS_02870 22584 23804 gene locus_tag LOCUS_02880 22584 23804 CDS product type II/IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763182.1 protein_id gnl|my_center|LOCUS_02880 23801 24736 gene locus_tag LOCUS_02890 23801 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 24733 25665 gene locus_tag LOCUS_02900 24733 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 25673 26359 gene locus_tag LOCUS_02910 25673 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 26362 26652 gene locus_tag LOCUS_02920 26362 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 26666 28459 gene locus_tag LOCUS_02930 26666 28459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 28515 30884 gene locus_tag LOCUS_02940 28515 30884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 31353 30916 gene locus_tag LOCUS_02950 31353 30916 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_02950 32208 31372 gene locus_tag LOCUS_02960 gene rsmA 32208 31372 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_02960 33245 32205 gene locus_tag LOCUS_02970 gene pdxA 33245 32205 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32K42 protein_id gnl|my_center|LOCUS_02970 34518 33229 gene locus_tag LOCUS_02980 gene surA 34518 33229 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_02980 36738 34579 gene locus_tag LOCUS_02990 gene lptD 36738 34579 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE0 protein_id gnl|my_center|LOCUS_02990 36839 37864 gene locus_tag LOCUS_03000 36839 37864 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_03000 37870 38532 gene locus_tag LOCUS_03010 37870 38532 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_03010 39461 38529 gene locus_tag LOCUS_03020 gene lipA 39461 38529 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 protein_id gnl|my_center|LOCUS_03020 40359 39556 gene locus_tag LOCUS_03030 40359 39556 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_03030 41218 40424 gene locus_tag LOCUS_03040 41218 40424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_03040 42007 41372 gene locus_tag LOCUS_03050 gene rnt 42007 41372 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_03050 42090 43298 gene locus_tag LOCUS_03060 gene argG 42090 43298 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_03060 44147 43383 gene locus_tag LOCUS_03070 44147 43383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 44341 45666 gene locus_tag LOCUS_03080 44341 45666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 46043 45663 gene locus_tag LOCUS_03090 46043 45663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence006 1707 382 gene locus_tag LOCUS_03100 1707 382 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_03100 3495 1756 gene locus_tag LOCUS_03110 gene atuH 3495 1756 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_03110 3817 4473 gene locus_tag LOCUS_03120 3817 4473 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230170.1 protein_id gnl|my_center|LOCUS_03120 4505 5347 gene locus_tag LOCUS_03130 4505 5347 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_03130 5347 7629 gene locus_tag LOCUS_03140 5347 7629 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_03140 7638 8960 gene locus_tag LOCUS_03150 7638 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 9303 8962 gene locus_tag LOCUS_03160 9303 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10184 9303 gene locus_tag LOCUS_03170 gene dapA 10184 9303 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_03170 10236 10841 gene locus_tag LOCUS_03180 10236 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10991 11458 gene locus_tag LOCUS_03190 10991 11458 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 protein_id gnl|my_center|LOCUS_03190 11510 12952 gene locus_tag LOCUS_03200 11510 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_03200 13802 12957 gene locus_tag LOCUS_03210 gene epmA 13802 12957 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z197 protein_id gnl|my_center|LOCUS_03210 14458 13889 gene locus_tag LOCUS_03220 gene efp 14458 13889 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_03220 14595 15551 gene locus_tag LOCUS_03230 14595 15551 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_03230 15566 17641 gene locus_tag LOCUS_03240 15566 17641 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 protein_id gnl|my_center|LOCUS_03240 18644 17757 gene locus_tag LOCUS_03250 gene htpX 18644 17757 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P283 protein_id gnl|my_center|LOCUS_03250 20973 18703 gene locus_tag LOCUS_03260 gene parC 20973 18703 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_03260 22880 20997 gene locus_tag LOCUS_03270 gene parE 22880 20997 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_03270 23016 23282 gene locus_tag LOCUS_03280 23016 23282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 23279 24196 gene locus_tag LOCUS_03290 23279 24196 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095843.1 protein_id gnl|my_center|LOCUS_03290 24333 26186 gene locus_tag LOCUS_03300 gene dxs 24333 26186 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL3 protein_id gnl|my_center|LOCUS_03300 27584 26202 gene locus_tag LOCUS_03310 27584 26202 CDS product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 protein_id gnl|my_center|LOCUS_03310 28668 27661 gene locus_tag LOCUS_03320 gene paaG 28668 27661 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228967.1 protein_id gnl|my_center|LOCUS_03320 29234 28680 gene locus_tag LOCUS_03330 29234 28680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 protein_id gnl|my_center|LOCUS_03330 29326 30381 gene locus_tag LOCUS_03340 29326 30381 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265765.1 protein_id gnl|my_center|LOCUS_03340 30444 31373 gene locus_tag LOCUS_03350 30444 31373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_03350 31370 32131 gene locus_tag LOCUS_03360 31370 32131 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWM8 protein_id gnl|my_center|LOCUS_03360 32214 33020 gene locus_tag LOCUS_03370 32214 33020 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_03370 33112 33906 gene locus_tag LOCUS_03380 33112 33906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_03380 33903 34532 gene locus_tag LOCUS_03390 33903 34532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 34552 36051 gene locus_tag LOCUS_03400 34552 36051 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_03400 36146 36643 gene locus_tag LOCUS_03410 36146 36643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 36640 38247 gene locus_tag LOCUS_03420 36640 38247 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_03420 38259 39236 gene locus_tag LOCUS_03430 38259 39236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 40990 39575 gene locus_tag LOCUS_03440 40990 39575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 41387 43966 gene locus_tag LOCUS_03450 41387 43966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 45173 44028 gene locus_tag LOCUS_03460 45173 44028 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence007 229 11 gene locus_tag LOCUS_03470 229 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 262 639 gene locus_tag LOCUS_03480 262 639 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_03480 1808 759 gene locus_tag LOCUS_03490 1808 759 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701468.1 protein_id gnl|my_center|LOCUS_03490 3401 1899 gene locus_tag LOCUS_03500 3401 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4307 3501 gene locus_tag LOCUS_03510 4307 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_03510 6802 4304 gene locus_tag LOCUS_03520 6802 4304 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_03520 7073 7525 gene locus_tag LOCUS_03530 7073 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893800.1 protein_id gnl|my_center|LOCUS_03530 7608 9329 gene locus_tag LOCUS_03540 7608 9329 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 protein_id gnl|my_center|LOCUS_03540 9370 10134 gene locus_tag LOCUS_03550 9370 10134 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266208.1 protein_id gnl|my_center|LOCUS_03550 10279 11871 gene locus_tag LOCUS_03560 gene fadD3 10279 11871 CDS product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 protein_id gnl|my_center|LOCUS_03560 11868 12737 gene locus_tag LOCUS_03570 11868 12737 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_03570 12853 13638 gene locus_tag LOCUS_03580 12853 13638 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029480.1 protein_id gnl|my_center|LOCUS_03580 13733 14524 gene locus_tag LOCUS_03590 13733 14524 CDS product putative steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703552.1 protein_id gnl|my_center|LOCUS_03590 14514 15311 gene locus_tag LOCUS_03600 14514 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702031.1 protein_id gnl|my_center|LOCUS_03600 16426 15365 gene locus_tag LOCUS_03610 16426 15365 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_03610 17295 16432 gene locus_tag LOCUS_03620 17295 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_03620 18280 17288 gene locus_tag LOCUS_03630 18280 17288 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974548.1 protein_id gnl|my_center|LOCUS_03630 19518 18277 gene locus_tag LOCUS_03640 19518 18277 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_03640 20266 19511 gene locus_tag LOCUS_03650 gene ditI 20266 19511 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_03650 22042 20312 gene locus_tag LOCUS_03660 22042 20312 CDS product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224391.1 protein_id gnl|my_center|LOCUS_03660 23246 22053 gene locus_tag LOCUS_03670 23246 22053 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_03670 23472 24581 gene locus_tag LOCUS_03680 23472 24581 CDS product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 protein_id gnl|my_center|LOCUS_03680 25062 24637 gene locus_tag LOCUS_03690 25062 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701948.1 protein_id gnl|my_center|LOCUS_03690 25207 26418 gene locus_tag LOCUS_03700 25207 26418 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971791.1 protein_id gnl|my_center|LOCUS_03700 26510 27244 gene locus_tag LOCUS_03710 26510 27244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 27332 28345 gene locus_tag LOCUS_03720 27332 28345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701235.1 protein_id gnl|my_center|LOCUS_03720 28357 28779 gene locus_tag LOCUS_03730 28357 28779 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_03730 29712 28801 gene locus_tag LOCUS_03740 29712 28801 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_03740 29814 30821 gene locus_tag LOCUS_03750 29814 30821 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_03750 30842 31165 gene locus_tag LOCUS_03760 30842 31165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 31218 31565 gene locus_tag LOCUS_03770 31218 31565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 32753 31581 gene locus_tag LOCUS_03780 32753 31581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_03780 33847 32765 gene locus_tag LOCUS_03790 33847 32765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_03790 34014 34151 gene locus_tag LOCUS_03800 34014 34151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 35548 34148 gene locus_tag LOCUS_03810 35548 34148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 37368 35635 gene locus_tag LOCUS_03820 37368 35635 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_03820 38094 37408 gene locus_tag LOCUS_03830 38094 37408 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_03830 38369 38166 gene locus_tag LOCUS_03840 38369 38166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 38269 40677 gene locus_tag LOCUS_03850 38269 40677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 40702 41769 gene locus_tag LOCUS_03860 40702 41769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 protein_id gnl|my_center|LOCUS_03860 41852 42073 gene locus_tag LOCUS_03870 41852 42073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 42194 42403 gene locus_tag LOCUS_03880 42194 42403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 <43219 42488 gene locus_tag LOCUS_03890 <43219 42488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895174.1:alcohol dehydrogenase >Feature sequence008 752 198 gene locus_tag LOCUS_03900 752 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1681 749 gene locus_tag LOCUS_03910 gene secF 1681 749 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_03910 3550 1697 gene locus_tag LOCUS_03920 gene secD 3550 1697 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_03920 3966 3634 gene locus_tag LOCUS_03930 gene yajC 3966 3634 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_03930 4214 5965 gene locus_tag LOCUS_03940 4214 5965 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533660.1 protein_id gnl|my_center|LOCUS_03940 6202 7380 gene locus_tag LOCUS_03950 6202 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403213.1 protein_id gnl|my_center|LOCUS_03950 7471 8835 gene locus_tag LOCUS_03960 gene ycaD 7471 8835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_03960 8875 11142 gene locus_tag LOCUS_03970 8875 11142 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638382.2 protein_id gnl|my_center|LOCUS_03970 12667 11111 gene locus_tag LOCUS_03980 12667 11111 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_03980 12769 13251 gene locus_tag LOCUS_03990 12769 13251 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH0 protein_id gnl|my_center|LOCUS_03990 14393 13263 gene locus_tag LOCUS_04000 gene tgt 14393 13263 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_04000 15966 14515 gene locus_tag LOCUS_04010 gene hemN-2 15966 14515 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WL89 protein_id gnl|my_center|LOCUS_04010 16691 16059 gene locus_tag LOCUS_04020 16691 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 16838 16698 gene locus_tag LOCUS_04030 16838 16698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 19084 16850 gene locus_tag LOCUS_04040 19084 16850 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766952.1 protein_id gnl|my_center|LOCUS_04040 19263 19081 gene locus_tag LOCUS_04050 19263 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 20636 19260 gene locus_tag LOCUS_04060 20636 19260 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_04060 20924 20664 gene locus_tag LOCUS_04070 20924 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 21820 20921 gene locus_tag LOCUS_04080 21820 20921 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P319 protein_id gnl|my_center|LOCUS_04080 21984 21817 gene locus_tag LOCUS_04090 21984 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 22595 21984 gene locus_tag LOCUS_04100 22595 21984 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_04100 24025 22592 gene locus_tag LOCUS_04110 gene ccoN 24025 22592 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_04110 24359 24964 gene locus_tag LOCUS_04120 24359 24964 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887023.1 protein_id gnl|my_center|LOCUS_04120 24957 25751 gene locus_tag LOCUS_04130 24957 25751 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 protein_id gnl|my_center|LOCUS_04130 25791 26981 gene locus_tag LOCUS_04140 gene phaC1 25791 26981 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_04140 28166 27000 gene locus_tag LOCUS_04150 28166 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 28623 28549 gene locus_tag LOCUS_t00050 28623 28549 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29039 28842 gene locus_tag LOCUS_04160 29039 28842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 30627 29092 gene locus_tag LOCUS_04170 30627 29092 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933883.1 protein_id gnl|my_center|LOCUS_04170 31312 30701 gene locus_tag LOCUS_04180 gene cysC 31312 30701 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP33 protein_id gnl|my_center|LOCUS_04180 31521 31958 gene locus_tag LOCUS_04190 gene hspA 31521 31958 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_04190 32029 32904 gene locus_tag LOCUS_04200 gene cbpA 32029 32904 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CJ2 protein_id gnl|my_center|LOCUS_04200 32970 34049 gene locus_tag LOCUS_04210 32970 34049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_04210 35521 34046 gene locus_tag LOCUS_04220 35521 34046 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_04220 37506 35716 gene locus_tag LOCUS_04230 37506 35716 CDS product acyl-CoA dehydrogenase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_04230 38574 37675 gene locus_tag LOCUS_04240 38574 37675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 39676 38612 gene locus_tag LOCUS_04250 gene mopB 39676 38612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_04250 41857 39944 gene locus_tag LOCUS_04260 41857 39944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204480.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence009 <1 634 gene locus_tag LOCUS_04270 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037632.1:short-chain dehydrogenase 1355 540 gene locus_tag LOCUS_04280 1355 540 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC0 protein_id gnl|my_center|LOCUS_04280 2116 1352 gene locus_tag LOCUS_04290 2116 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2973 2113 gene locus_tag LOCUS_04300 2973 2113 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_04300 3986 2970 gene locus_tag LOCUS_04310 gene trpS 3986 2970 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJF2 protein_id gnl|my_center|LOCUS_04310 4639 3983 gene locus_tag LOCUS_04320 4639 3983 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809953.1 protein_id gnl|my_center|LOCUS_04320 5276 4647 gene locus_tag LOCUS_04330 5276 4647 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980794.1 protein_id gnl|my_center|LOCUS_04330 5380 5952 gene locus_tag LOCUS_04340 5380 5952 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D36 protein_id gnl|my_center|LOCUS_04340 5949 6263 gene locus_tag LOCUS_04350 5949 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_04350 6260 6556 gene locus_tag LOCUS_04360 6260 6556 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_04360 7099 6578 gene locus_tag LOCUS_04370 7099 6578 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_04370 7946 7299 gene locus_tag LOCUS_04380 7946 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 8889 8071 gene locus_tag LOCUS_04390 8889 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_04390 9451 8993 gene locus_tag LOCUS_04400 9451 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9855 9577 gene locus_tag LOCUS_04410 9855 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 10515 9892 gene locus_tag LOCUS_04420 10515 9892 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_04420 11254 10613 gene locus_tag LOCUS_04430 11254 10613 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_04430 12041 11436 gene locus_tag LOCUS_04440 12041 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 12921 12199 gene locus_tag LOCUS_04450 gene gufA 12921 12199 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_04450 13366 13025 gene locus_tag LOCUS_04460 13366 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 14232 13408 gene locus_tag LOCUS_04470 14232 13408 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_04470 14878 14399 gene locus_tag LOCUS_04480 14878 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 15427 14960 gene locus_tag LOCUS_04490 15427 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679517.1 protein_id gnl|my_center|LOCUS_04490 15819 15436 gene locus_tag LOCUS_04500 15819 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 16301 15843 gene locus_tag LOCUS_04510 16301 15843 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 protein_id gnl|my_center|LOCUS_04510 17501 16533 gene locus_tag LOCUS_04520 17501 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368513.1 protein_id gnl|my_center|LOCUS_04520 18116 17589 gene locus_tag LOCUS_04530 18116 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_04530 18784 18311 gene locus_tag LOCUS_04540 18784 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 19064 19780 gene locus_tag LOCUS_04550 19064 19780 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_04550 19869 20672 gene locus_tag LOCUS_04560 19869 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438774.1 protein_id gnl|my_center|LOCUS_04560 21049 20732 gene locus_tag LOCUS_04570 21049 20732 CDS product putative multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703374.1 protein_id gnl|my_center|LOCUS_04570 21402 21172 gene locus_tag LOCUS_04580 21402 21172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 21328 22590 gene locus_tag LOCUS_04590 21328 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 23726 22779 gene locus_tag LOCUS_04600 23726 22779 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389869.1 protein_id gnl|my_center|LOCUS_04600 23917 24789 gene locus_tag LOCUS_04610 23917 24789 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943999.1 protein_id gnl|my_center|LOCUS_04610 25770 24940 gene locus_tag LOCUS_04620 25770 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_04620 26004 25825 gene locus_tag LOCUS_04630 26004 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 26212 27267 gene locus_tag LOCUS_04640 26212 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 27415 27837 gene locus_tag LOCUS_04650 27415 27837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 28063 28569 gene locus_tag LOCUS_04660 28063 28569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 28992 28624 gene locus_tag LOCUS_04670 28992 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 29454 29158 gene locus_tag LOCUS_04680 29454 29158 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_04680 29631 30455 gene locus_tag LOCUS_04690 29631 30455 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199949.1 protein_id gnl|my_center|LOCUS_04690 30940 30509 gene locus_tag LOCUS_04700 30940 30509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 31756 31025 gene locus_tag LOCUS_04710 31756 31025 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027180.1 protein_id gnl|my_center|LOCUS_04710 32804 31890 gene locus_tag LOCUS_04720 32804 31890 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 protein_id gnl|my_center|LOCUS_04720 33963 33052 gene locus_tag LOCUS_04730 33963 33052 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027411.1 protein_id gnl|my_center|LOCUS_04730 34670 34029 gene locus_tag LOCUS_04740 gene catB 34670 34029 CDS product type B chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073960.1 protein_id gnl|my_center|LOCUS_04740 35416 34826 gene locus_tag LOCUS_04750 35416 34826 CDS product putative menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703693.1 protein_id gnl|my_center|LOCUS_04750 36182 35547 gene locus_tag LOCUS_04760 36182 35547 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_04760 36691 36326 gene locus_tag LOCUS_04770 36691 36326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707579.1 protein_id gnl|my_center|LOCUS_04770 37323 36859 gene locus_tag LOCUS_04780 37323 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 37993 37448 gene locus_tag LOCUS_04790 37993 37448 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_04790 38106 38618 gene locus_tag LOCUS_04800 38106 38618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence010 261 1592 gene locus_tag LOCUS_04810 261 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1589 4708 gene locus_tag LOCUS_04820 gene cusA 1589 4708 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_04820 4810 7116 gene locus_tag LOCUS_04830 4810 7116 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_04830 7143 7409 gene locus_tag LOCUS_04840 7143 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7547 7987 gene locus_tag LOCUS_04850 gene copG 7547 7987 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_04850 8028 8309 gene locus_tag LOCUS_04860 8028 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 8322 9647 gene locus_tag LOCUS_04870 8322 9647 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_04870 10766 9657 gene locus_tag LOCUS_04880 10766 9657 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_04880 10878 12311 gene locus_tag LOCUS_04890 10878 12311 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_04890 12406 12810 gene locus_tag LOCUS_04900 12406 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 13111 12884 gene locus_tag LOCUS_04910 13111 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13790 13254 gene locus_tag LOCUS_04920 13790 13254 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011716.1 protein_id gnl|my_center|LOCUS_04920 14389 13967 gene locus_tag LOCUS_04930 14389 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085846.1 protein_id gnl|my_center|LOCUS_04930 14421 14960 gene locus_tag LOCUS_04940 14421 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 15022 16281 gene locus_tag LOCUS_04950 gene czcC 15022 16281 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_04950 16278 17516 gene locus_tag LOCUS_04960 16278 17516 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_04960 17526 20630 gene locus_tag LOCUS_04970 17526 20630 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_04970 21562 20717 gene locus_tag LOCUS_04980 gene motB 21562 20717 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_04980 22362 21565 gene locus_tag LOCUS_04990 22362 21565 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_04990 22667 23065 gene locus_tag LOCUS_05000 22667 23065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721251.1 protein_id gnl|my_center|LOCUS_05000 24428 23109 gene locus_tag LOCUS_05010 24428 23109 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_05010 25162 24494 gene locus_tag LOCUS_05020 25162 24494 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_05020 25506 25159 gene locus_tag LOCUS_05030 25506 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_05030 25682 26152 gene locus_tag LOCUS_05040 25682 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 26402 27688 gene locus_tag LOCUS_05050 26402 27688 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188263.1 protein_id gnl|my_center|LOCUS_05050 27811 28833 gene locus_tag LOCUS_05060 gene truD 27811 28833 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_05060 28950 29873 gene locus_tag LOCUS_05070 28950 29873 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_05070 30341 29925 gene locus_tag LOCUS_05080 30341 29925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 30521 30886 gene locus_tag LOCUS_05090 30521 30886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 31072 31677 gene locus_tag LOCUS_05100 31072 31677 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225519.1 protein_id gnl|my_center|LOCUS_05100 31670 32581 gene locus_tag LOCUS_05110 31670 32581 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728159.1 protein_id gnl|my_center|LOCUS_05110 32578 33075 gene locus_tag LOCUS_05120 32578 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 33081 33620 gene locus_tag LOCUS_05130 33081 33620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 34817 33603 gene locus_tag LOCUS_05140 34817 33603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 protein_id gnl|my_center|LOCUS_05140 36079 34928 gene locus_tag LOCUS_05150 36079 34928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207673.1 protein_id gnl|my_center|LOCUS_05150 36460 36122 gene locus_tag LOCUS_05160 36460 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 38430 36613 gene locus_tag LOCUS_05170 gene mmgC 38430 36613 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence011 <1 2227 gene locus_tag LOCUS_05180 <1 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103390.1:cellulose synthase 2227 2688 gene locus_tag LOCUS_05190 2227 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3608 2685 gene locus_tag LOCUS_05200 3608 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3995 3919 gene locus_tag LOCUS_t00060 3995 3919 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4487 4086 gene locus_tag LOCUS_05210 4487 4086 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_05210 4775 4494 gene locus_tag LOCUS_05220 gene ihfA 4775 4494 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_05220 7168 4778 gene locus_tag LOCUS_05230 gene pheT 7168 4778 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MFR2 protein_id gnl|my_center|LOCUS_05230 8160 7165 gene locus_tag LOCUS_05240 gene pheS 8160 7165 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_05240 8608 8252 gene locus_tag LOCUS_05250 gene rplT 8608 8252 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_05250 8818 8621 gene locus_tag LOCUS_05260 gene rpmI 8818 8621 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C12 protein_id gnl|my_center|LOCUS_05260 9343 8906 gene locus_tag LOCUS_05270 9343 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10170 9544 gene locus_tag LOCUS_05280 10170 9544 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726881.1 protein_id gnl|my_center|LOCUS_05280 10281 11156 gene locus_tag LOCUS_05290 10281 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 12017 11178 gene locus_tag LOCUS_05300 12017 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 12299 14542 gene locus_tag LOCUS_05310 12299 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 14553 15380 gene locus_tag LOCUS_05320 14553 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 15377 16279 gene locus_tag LOCUS_05330 15377 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 17513 16437 gene locus_tag LOCUS_05340 17513 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267183.1 protein_id gnl|my_center|LOCUS_05340 19921 17525 gene locus_tag LOCUS_05350 19921 17525 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_05350 21617 20124 gene locus_tag LOCUS_05360 21617 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_05360 21921 24044 gene locus_tag LOCUS_05370 21921 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 protein_id gnl|my_center|LOCUS_05370 25461 24139 gene locus_tag LOCUS_05380 25461 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 25646 25735 gene locus_tag LOCUS_t00070 25646 25735 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26235 27143 gene locus_tag LOCUS_05390 26235 27143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941237.1 protein_id gnl|my_center|LOCUS_05390 28117 27278 gene locus_tag LOCUS_05400 28117 27278 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083235.1 protein_id gnl|my_center|LOCUS_05400 29064 28168 gene locus_tag LOCUS_05410 29064 28168 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 protein_id gnl|my_center|LOCUS_05410 29154 29633 gene locus_tag LOCUS_05420 29154 29633 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 protein_id gnl|my_center|LOCUS_05420 30294 29674 gene locus_tag LOCUS_05430 30294 29674 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195674.1 protein_id gnl|my_center|LOCUS_05430 30345 31151 gene locus_tag LOCUS_05440 30345 31151 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533441.1 protein_id gnl|my_center|LOCUS_05440 32109 31216 gene locus_tag LOCUS_05450 32109 31216 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_05450 33120 32182 gene locus_tag LOCUS_05460 33120 32182 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113598.1 protein_id gnl|my_center|LOCUS_05460 33535 33954 gene locus_tag LOCUS_05470 33535 33954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534706.1 protein_id gnl|my_center|LOCUS_05470 35156 34173 gene locus_tag LOCUS_05480 35156 34173 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968518.1 protein_id gnl|my_center|LOCUS_05480 35845 35210 gene locus_tag LOCUS_05490 35845 35210 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_05490 36438 35839 gene locus_tag LOCUS_05500 36438 35839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088555.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence012 1765 263 gene locus_tag LOCUS_05510 gene mltF 1765 263 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN1 protein_id gnl|my_center|LOCUS_05510 2126 2216 gene locus_tag LOCUS_t00080 2126 2216 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2333 2635 gene locus_tag LOCUS_05520 2333 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2805 3797 gene locus_tag LOCUS_05530 2805 3797 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706561.1 protein_id gnl|my_center|LOCUS_05530 3982 4389 gene locus_tag LOCUS_05540 3982 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4627 4397 gene locus_tag LOCUS_05550 4627 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5663 4710 gene locus_tag LOCUS_05560 5663 4710 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204922.1 protein_id gnl|my_center|LOCUS_05560 6309 5668 gene locus_tag LOCUS_05570 6309 5668 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035502.1 protein_id gnl|my_center|LOCUS_05570 6397 7560 gene locus_tag LOCUS_05580 gene acdA 6397 7560 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035501.1 protein_id gnl|my_center|LOCUS_05580 9561 8035 gene locus_tag LOCUS_05590 9561 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9762 9950 gene locus_tag LOCUS_05600 9762 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 11848 9947 gene locus_tag LOCUS_05610 gene prpE 11848 9947 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_05610 13457 11937 gene locus_tag LOCUS_05620 gene sbcB 13457 11937 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_05620 13475 14581 gene locus_tag LOCUS_05630 13475 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_05630 15544 14678 gene locus_tag LOCUS_05640 15544 14678 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ00 protein_id gnl|my_center|LOCUS_05640 16315 15653 gene locus_tag LOCUS_05650 16315 15653 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAI9 protein_id gnl|my_center|LOCUS_05650 17228 16320 gene locus_tag LOCUS_05660 17228 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 17363 18013 gene locus_tag LOCUS_05670 17363 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 19173 18244 gene locus_tag LOCUS_05680 19173 18244 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 protein_id gnl|my_center|LOCUS_05680 19942 19160 gene locus_tag LOCUS_05690 19942 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_05690 20590 19979 gene locus_tag LOCUS_05700 20590 19979 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884291.1 protein_id gnl|my_center|LOCUS_05700 23702 20625 gene locus_tag LOCUS_05710 gene acrB5 23702 20625 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_05710 24784 23714 gene locus_tag LOCUS_05720 24784 23714 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920955.1 protein_id gnl|my_center|LOCUS_05720 26222 24771 gene locus_tag LOCUS_05730 26222 24771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 26865 26224 gene locus_tag LOCUS_05740 26865 26224 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966053.1 protein_id gnl|my_center|LOCUS_05740 27141 28277 gene locus_tag LOCUS_05750 gene olE1 27141 28277 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_05750 29318 28338 gene locus_tag LOCUS_05760 29318 28338 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_05760 30406 29525 gene locus_tag LOCUS_05770 30406 29525 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_05770 30840 30403 gene locus_tag LOCUS_05780 30840 30403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 31211 30840 gene locus_tag LOCUS_05790 31211 30840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence013 1641 1072 gene locus_tag LOCUS_05800 1641 1072 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_05800 3064 1691 gene locus_tag LOCUS_05810 gene pncB2 3064 1691 CDS product nicotinate phosphoribosyltransferase pncB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJI7 protein_id gnl|my_center|LOCUS_05810 3658 3125 gene locus_tag LOCUS_05820 3658 3125 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403323.1 protein_id gnl|my_center|LOCUS_05820 4773 3748 gene locus_tag LOCUS_05830 4773 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5810 4821 gene locus_tag LOCUS_05840 5810 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6187 5831 gene locus_tag LOCUS_05850 6187 5831 CDS product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813572.1 protein_id gnl|my_center|LOCUS_05850 6992 6282 gene locus_tag LOCUS_05860 6992 6282 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 protein_id gnl|my_center|LOCUS_05860 8361 7198 gene locus_tag LOCUS_05870 8361 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 9340 8411 gene locus_tag LOCUS_05880 9340 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 9737 9417 gene locus_tag LOCUS_05890 9737 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10039 9770 gene locus_tag LOCUS_05900 10039 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 10561 10070 gene locus_tag LOCUS_05910 10561 10070 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 protein_id gnl|my_center|LOCUS_05910 16680 10558 gene locus_tag LOCUS_05920 16680 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 17228 16683 gene locus_tag LOCUS_05930 gene pilI 17228 16683 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_05930 17662 17225 gene locus_tag LOCUS_05940 gene pilG 17662 17225 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_05940 17726 19021 gene locus_tag LOCUS_05950 17726 19021 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_05950 19018 19977 gene locus_tag LOCUS_05960 gene gshB 19018 19977 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_05960 19980 21035 gene locus_tag LOCUS_05970 19980 21035 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXD0 protein_id gnl|my_center|LOCUS_05970 21032 21391 gene locus_tag LOCUS_05980 21032 21391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 21375 21938 gene locus_tag LOCUS_05990 21375 21938 CDS product heptaprenyl diphosphate synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_05990 21974 22561 gene locus_tag LOCUS_06000 21974 22561 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_06000 22574 22990 gene locus_tag LOCUS_06010 22574 22990 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I87 protein_id gnl|my_center|LOCUS_06010 22939 23460 gene locus_tag LOCUS_06020 22939 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 23457 24425 gene locus_tag LOCUS_06030 gene pyrB 23457 24425 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_06030 24422 25726 gene locus_tag LOCUS_06040 gene pyrC' 24422 25726 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_06040 25768 26133 gene locus_tag LOCUS_06050 25768 26133 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_06050 26141 28174 gene locus_tag LOCUS_06060 gene pilJ 26141 28174 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621029.1 protein_id gnl|my_center|LOCUS_06060 28249 29901 gene locus_tag LOCUS_06070 gene pckA 28249 29901 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLL5 protein_id gnl|my_center|LOCUS_06070 30041 30670 gene locus_tag LOCUS_06080 30041 30670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926725.1 protein_id gnl|my_center|LOCUS_06080 30667 31290 gene locus_tag LOCUS_06090 30667 31290 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397169.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence014 214 471 gene locus_tag LOCUS_06100 214 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 468 677 gene locus_tag LOCUS_06110 468 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 674 991 gene locus_tag LOCUS_06120 674 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 988 1242 gene locus_tag LOCUS_06130 988 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 1239 1547 gene locus_tag LOCUS_06140 1239 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1544 1735 gene locus_tag LOCUS_06150 1544 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1732 1971 gene locus_tag LOCUS_06160 1732 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1968 2528 gene locus_tag LOCUS_06170 1968 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2515 3135 gene locus_tag LOCUS_06180 2515 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3132 3578 gene locus_tag LOCUS_06190 gene ssb 3132 3578 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40947 protein_id gnl|my_center|LOCUS_06190 3581 4234 gene locus_tag LOCUS_06200 3581 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4231 4476 gene locus_tag LOCUS_06210 4231 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4473 4652 gene locus_tag LOCUS_06220 4473 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4639 5163 gene locus_tag LOCUS_06230 4639 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5160 5321 gene locus_tag LOCUS_06240 5160 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5314 5697 gene locus_tag LOCUS_06250 5314 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5771 6121 gene locus_tag LOCUS_06260 5771 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6239 6571 gene locus_tag LOCUS_06270 6239 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6639 6977 gene locus_tag LOCUS_06280 6639 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 6974 7231 gene locus_tag LOCUS_06290 6974 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7228 7407 gene locus_tag LOCUS_06300 7228 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7583 9160 gene locus_tag LOCUS_06310 7583 9160 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538220.1 protein_id gnl|my_center|LOCUS_06310 9206 9691 gene locus_tag LOCUS_06320 9206 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_06320 9684 9929 gene locus_tag LOCUS_06330 9684 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9939 10235 gene locus_tag LOCUS_06340 9939 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10435 10232 gene locus_tag LOCUS_06350 10435 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11468 10545 gene locus_tag LOCUS_06360 11468 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11837 11472 gene locus_tag LOCUS_06370 11837 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 12336 11830 gene locus_tag LOCUS_06380 12336 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 12616 12401 gene locus_tag LOCUS_06390 12616 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 13035 12613 gene locus_tag LOCUS_06400 13035 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14159 13032 gene locus_tag LOCUS_06410 14159 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 14329 14162 gene locus_tag LOCUS_06420 14329 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 14943 14329 gene locus_tag LOCUS_06430 14943 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15260 14943 gene locus_tag LOCUS_06440 15260 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15657 15262 gene locus_tag LOCUS_06450 15657 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16556 15654 gene locus_tag LOCUS_06460 16556 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 20614 16553 gene locus_tag LOCUS_06470 20614 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 21419 21114 gene locus_tag LOCUS_06480 21419 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 21844 21440 gene locus_tag LOCUS_06490 21844 21440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 22839 21913 gene locus_tag LOCUS_06500 22839 21913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 23095 22904 gene locus_tag LOCUS_06510 23095 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 23502 23095 gene locus_tag LOCUS_06520 23502 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 23903 23499 gene locus_tag LOCUS_06530 23903 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816470.1 protein_id gnl|my_center|LOCUS_06530 24265 23900 gene locus_tag LOCUS_06540 24265 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 24813 24262 gene locus_tag LOCUS_06550 24813 24262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039673.1 protein_id gnl|my_center|LOCUS_06550 25246 24908 gene locus_tag LOCUS_06560 25246 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 26260 25304 gene locus_tag LOCUS_06570 26260 25304 CDS product coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254228.1 protein_id gnl|my_center|LOCUS_06570 27111 26395 gene locus_tag LOCUS_06580 27111 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 27647 27108 gene locus_tag LOCUS_06590 27647 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 28174 27635 gene locus_tag LOCUS_06600 28174 27635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 28420 28232 gene locus_tag LOCUS_06610 28420 28232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 30652 28430 gene locus_tag LOCUS_06620 30652 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence015 <1 846 gene locus_tag LOCUS_06630 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100703.1:3-hydroxyacyl-CoA dehydrogenase 934 3171 gene locus_tag LOCUS_06640 gene fadE 934 3171 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_06640 4364 3255 gene locus_tag LOCUS_06650 4364 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_06650 4472 6145 gene locus_tag LOCUS_06660 4472 6145 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_06660 6962 6207 gene locus_tag LOCUS_06670 6962 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 7972 6938 gene locus_tag LOCUS_06680 7972 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_06680 9063 8014 gene locus_tag LOCUS_06690 9063 8014 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_06690 9270 10850 gene locus_tag LOCUS_06700 9270 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268952.1 protein_id gnl|my_center|LOCUS_06700 10937 11356 gene locus_tag LOCUS_06710 10937 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11474 12787 gene locus_tag LOCUS_06720 11474 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_06720 13323 12850 gene locus_tag LOCUS_06730 13323 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13489 14298 gene locus_tag LOCUS_06740 13489 14298 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_06740 16179 14704 gene locus_tag LOCUS_06750 16179 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 17772 16531 gene locus_tag LOCUS_06760 17772 16531 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_06760 18760 17861 gene locus_tag LOCUS_06770 gene hslO 18760 17861 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_06770 20364 18892 gene locus_tag LOCUS_06780 gene gatB 20364 18892 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 protein_id gnl|my_center|LOCUS_06780 21815 20361 gene locus_tag LOCUS_06790 gene gatA 21815 20361 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_06790 22123 21836 gene locus_tag LOCUS_06800 gene gatC 22123 21836 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS0 protein_id gnl|my_center|LOCUS_06800 22321 23358 gene locus_tag LOCUS_06810 gene mreB 22321 23358 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9X8 protein_id gnl|my_center|LOCUS_06810 23545 24480 gene locus_tag LOCUS_06820 gene mreC 23545 24480 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_06820 24477 24959 gene locus_tag LOCUS_06830 24477 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 24963 26846 gene locus_tag LOCUS_06840 gene pbpA 24963 26846 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_06840 26843 27967 gene locus_tag LOCUS_06850 gene mrdB 26843 27967 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707028.1 protein_id gnl|my_center|LOCUS_06850 27967 28992 gene locus_tag LOCUS_06860 gene mltB 27967 28992 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence016 462 1862 gene locus_tag LOCUS_06870 462 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1862 3136 gene locus_tag LOCUS_06880 1862 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3137 4570 gene locus_tag LOCUS_06890 3137 4570 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_06890 4567 4992 gene locus_tag LOCUS_06900 4567 4992 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105006.1 protein_id gnl|my_center|LOCUS_06900 5033 7234 gene locus_tag LOCUS_06910 5033 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7299 8519 gene locus_tag LOCUS_06920 7299 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 8574 9668 gene locus_tag LOCUS_06930 8574 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 10983 9682 gene locus_tag LOCUS_06940 gene rhlB 10983 9682 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT4 protein_id gnl|my_center|LOCUS_06940 11295 11621 gene locus_tag LOCUS_06950 gene trxA 11295 11621 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_06950 11605 13044 gene locus_tag LOCUS_06960 gene rho 11605 13044 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A25 protein_id gnl|my_center|LOCUS_06960 13104 14171 gene locus_tag LOCUS_06970 13104 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 14373 15728 gene locus_tag LOCUS_06980 14373 15728 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS2 protein_id gnl|my_center|LOCUS_06980 16989 15721 gene locus_tag LOCUS_06990 gene purD 16989 15721 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD48 protein_id gnl|my_center|LOCUS_06990 17493 17050 gene locus_tag LOCUS_07000 17493 17050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 18313 17558 gene locus_tag LOCUS_07010 gene phbB 18313 17558 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037438.1 protein_id gnl|my_center|LOCUS_07010 19527 18349 gene locus_tag LOCUS_07020 gene atoB 19527 18349 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A8 protein_id gnl|my_center|LOCUS_07020 20042 19602 gene locus_tag LOCUS_07030 20042 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20282 21247 gene locus_tag LOCUS_07040 20282 21247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 21250 22332 gene locus_tag LOCUS_07050 gene phbC 21250 22332 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_07050 23234 22329 gene locus_tag LOCUS_07060 23234 22329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532147.1 protein_id gnl|my_center|LOCUS_07060 24052 23237 gene locus_tag LOCUS_07070 24052 23237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 23948 24763 gene locus_tag LOCUS_07080 23948 24763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_07080 25716 24772 gene locus_tag LOCUS_07090 25716 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_07090 27179 25719 gene locus_tag LOCUS_07100 27179 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_07100 27476 28246 gene locus_tag LOCUS_07110 gene minC 27476 28246 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ7 protein_id gnl|my_center|LOCUS_07110 >Feature sequence017 71 2425 gene locus_tag LOCUS_07120 gene fadJ 71 2425 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_07120 2431 3699 gene locus_tag LOCUS_07130 2431 3699 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_07130 4003 5226 gene locus_tag LOCUS_07140 4003 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 protein_id gnl|my_center|LOCUS_07140 5235 7202 gene locus_tag LOCUS_07150 5235 7202 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_07150 7214 10117 gene locus_tag LOCUS_07160 7214 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 10368 11726 gene locus_tag LOCUS_07170 10368 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11751 13328 gene locus_tag LOCUS_07180 11751 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 14093 13389 gene locus_tag LOCUS_07190 14093 13389 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_07190 14389 15192 gene locus_tag LOCUS_07200 14389 15192 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061743.1 protein_id gnl|my_center|LOCUS_07200 15363 15199 gene locus_tag LOCUS_07210 15363 15199 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 protein_id gnl|my_center|LOCUS_07210 15503 15706 gene locus_tag LOCUS_07220 15503 15706 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV61 protein_id gnl|my_center|LOCUS_07220 15703 15888 gene locus_tag LOCUS_07230 15703 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 16131 17384 gene locus_tag LOCUS_07240 16131 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 17484 17882 gene locus_tag LOCUS_07250 17484 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 17902 18477 gene locus_tag LOCUS_07260 17902 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 19097 18495 gene locus_tag LOCUS_07270 gene exoD 19097 18495 CDS product protein exod inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971485.1 protein_id gnl|my_center|LOCUS_07270 21599 19197 gene locus_tag LOCUS_07280 21599 19197 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268078.1 protein_id gnl|my_center|LOCUS_07280 22294 21596 gene locus_tag LOCUS_07290 22294 21596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 22921 22463 gene locus_tag LOCUS_07300 22921 22463 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709522.1 protein_id gnl|my_center|LOCUS_07300 23093 23542 gene locus_tag LOCUS_07310 23093 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709523.1 protein_id gnl|my_center|LOCUS_07310 25438 23582 gene locus_tag LOCUS_07320 25438 23582 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_07320 26184 25444 gene locus_tag LOCUS_07330 26184 25444 CDS product putative isochorismatase hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704161.1 protein_id gnl|my_center|LOCUS_07330 26220 26480 gene locus_tag LOCUS_07340 26220 26480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 26648 26911 gene locus_tag LOCUS_07350 26648 26911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence018 370 1152 gene locus_tag LOCUS_07360 370 1152 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_07360 2232 1195 gene locus_tag LOCUS_07370 gene oppF 2232 1195 CDS product oligopeptide transport ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45051 protein_id gnl|my_center|LOCUS_07370 2672 2205 gene locus_tag LOCUS_07380 2672 2205 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_07380 3723 2764 gene locus_tag LOCUS_07390 3723 2764 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257108.1 protein_id gnl|my_center|LOCUS_07390 4289 3870 gene locus_tag LOCUS_07400 4289 3870 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_07400 4555 4349 gene locus_tag LOCUS_07410 4555 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5826 4606 gene locus_tag LOCUS_07420 gene nqrF 5826 4606 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M8 protein_id gnl|my_center|LOCUS_07420 6444 5839 gene locus_tag LOCUS_07430 gene nqrE 6444 5839 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_07430 7119 6457 gene locus_tag LOCUS_07440 gene nqrD 7119 6457 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_07440 7899 7123 gene locus_tag LOCUS_07450 gene nqrC 7899 7123 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E0 protein_id gnl|my_center|LOCUS_07450 9118 7901 gene locus_tag LOCUS_07460 gene nqrB 9118 7901 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_07460 10482 9124 gene locus_tag LOCUS_07470 gene nqrA 10482 9124 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M3 protein_id gnl|my_center|LOCUS_07470 11620 10574 gene locus_tag LOCUS_07480 11620 10574 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_07480 12540 11635 gene locus_tag LOCUS_07490 gene rimK 12540 11635 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_07490 12971 12537 gene locus_tag LOCUS_07500 12971 12537 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_07500 13006 13320 gene locus_tag LOCUS_07510 13006 13320 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 protein_id gnl|my_center|LOCUS_07510 13509 15395 gene locus_tag LOCUS_07520 gene mnmG 13509 15395 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_07520 17166 15403 gene locus_tag LOCUS_07530 17166 15403 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_07530 18566 17790 gene locus_tag LOCUS_07540 gene parB 18566 17790 CDS product putative chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AH2 protein_id gnl|my_center|LOCUS_07540 18644 19204 gene locus_tag LOCUS_07550 gene folE2 18644 19204 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_07550 19322 20305 gene locus_tag LOCUS_07560 19322 20305 CDS product putative acyl-[acyl-carrier protein] desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705127.1 protein_id gnl|my_center|LOCUS_07560 20408 21250 gene locus_tag LOCUS_07570 20408 21250 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 protein_id gnl|my_center|LOCUS_07570 21524 21225 gene locus_tag LOCUS_07580 gene acyP 21524 21225 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JL8 protein_id gnl|my_center|LOCUS_07580 21546 22238 gene locus_tag LOCUS_07590 21546 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 22242 23603 gene locus_tag LOCUS_07600 22242 23603 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_07600 25202 23610 gene locus_tag LOCUS_07610 gene prfC 25202 23610 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V6 protein_id gnl|my_center|LOCUS_07610 >Feature sequence019 1164 2945 gene locus_tag LOCUS_07620 1164 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808496.1 protein_id gnl|my_center|LOCUS_07620 2633 2541 gene locus_tag LOCUS_t00090 2633 2541 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2945 3556 gene locus_tag LOCUS_07630 gene lolB 2945 3556 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AQ2 protein_id gnl|my_center|LOCUS_07630 3546 4451 gene locus_tag LOCUS_07640 gene ispE 3546 4451 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX1 protein_id gnl|my_center|LOCUS_07640 4473 4547 gene locus_tag LOCUS_t00100 4473 4547 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4644 5597 gene locus_tag LOCUS_07650 gene prs 4644 5597 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_07650 5709 6365 gene locus_tag LOCUS_07660 gene rplY 5709 6365 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_07660 6405 6977 gene locus_tag LOCUS_07670 gene pth 6405 6977 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9L4 protein_id gnl|my_center|LOCUS_07670 7046 8140 gene locus_tag LOCUS_07680 gene ychF 7046 8140 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_07680 8492 8259 gene locus_tag LOCUS_07690 8492 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8400 9425 gene locus_tag LOCUS_07700 8400 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9521 10858 gene locus_tag LOCUS_07710 9521 10858 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707477.1 protein_id gnl|my_center|LOCUS_07710 10965 13274 gene locus_tag LOCUS_07720 10965 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 13271 14752 gene locus_tag LOCUS_07730 13271 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144206.1 protein_id gnl|my_center|LOCUS_07730 14749 15627 gene locus_tag LOCUS_07740 14749 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 15624 17897 gene locus_tag LOCUS_07750 15624 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 18728 17916 gene locus_tag LOCUS_07760 18728 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 19615 18755 gene locus_tag LOCUS_07770 19615 18755 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700775.1 protein_id gnl|my_center|LOCUS_07770 21035 19659 gene locus_tag LOCUS_07780 21035 19659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 22274 21357 gene locus_tag LOCUS_07790 22274 21357 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 protein_id gnl|my_center|LOCUS_07790 23137 22271 gene locus_tag LOCUS_07800 23137 22271 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_07800 23436 23134 gene locus_tag LOCUS_07810 23436 23134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 25050 23446 gene locus_tag LOCUS_07820 25050 23446 CDS product nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_07820 <25854 25096 gene locus_tag LOCUS_07830 <25854 25096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144209.1:type I polyketide synthase >Feature sequence020 1269 2480 gene locus_tag LOCUS_07840 1269 2480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_07840 3394 2477 gene locus_tag LOCUS_07850 3394 2477 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702781.1 protein_id gnl|my_center|LOCUS_07850 4866 3409 gene locus_tag LOCUS_07860 4866 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937934.1 protein_id gnl|my_center|LOCUS_07860 5664 5107 gene locus_tag LOCUS_07870 gene mobA 5664 5107 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_07870 6121 5681 gene locus_tag LOCUS_07880 6121 5681 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_07880 6385 6131 gene locus_tag LOCUS_07890 6385 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6885 6382 gene locus_tag LOCUS_07900 gene moaC 6885 6382 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_07900 7892 6909 gene locus_tag LOCUS_07910 gene moaA 7892 6909 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL8 protein_id gnl|my_center|LOCUS_07910 8654 8124 gene locus_tag LOCUS_07920 gene moaB 8654 8124 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC70 protein_id gnl|my_center|LOCUS_07920 9914 8700 gene locus_tag LOCUS_07930 9914 8700 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_07930 11538 10168 gene locus_tag LOCUS_07940 gene crnA 11538 10168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_07940 14710 11960 gene locus_tag LOCUS_07950 gene nasA 14710 11960 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 protein_id gnl|my_center|LOCUS_07950 16380 14785 gene locus_tag LOCUS_07960 gene nasD 16380 14785 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207013.1 protein_id gnl|my_center|LOCUS_07960 18932 16380 gene locus_tag LOCUS_07970 gene nirB 18932 16380 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 protein_id gnl|my_center|LOCUS_07970 19534 20094 gene locus_tag LOCUS_07980 gene nasT 19534 20094 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 protein_id gnl|my_center|LOCUS_07980 20104 21279 gene locus_tag LOCUS_07990 20104 21279 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_07990 21633 21322 gene locus_tag LOCUS_08000 21633 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 22334 21630 gene locus_tag LOCUS_08010 22334 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 25185 22318 gene locus_tag LOCUS_08020 25185 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence021 364 606 gene locus_tag LOCUS_08030 364 606 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_08030 612 1016 gene locus_tag LOCUS_08040 gene vapC 612 1016 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND93 protein_id gnl|my_center|LOCUS_08040 3613 1310 gene locus_tag LOCUS_08050 3613 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5116 4034 gene locus_tag LOCUS_08060 5116 4034 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_08060 6642 5239 gene locus_tag LOCUS_08070 6642 5239 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_08070 7757 6951 gene locus_tag LOCUS_08080 gene paaG 7757 6951 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_08080 7836 9521 gene locus_tag LOCUS_08090 7836 9521 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_08090 9537 9704 gene locus_tag LOCUS_08100 9537 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9776 11599 gene locus_tag LOCUS_08110 9776 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 protein_id gnl|my_center|LOCUS_08110 11880 11668 gene locus_tag LOCUS_08120 11880 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 11776 12246 gene locus_tag LOCUS_08130 11776 12246 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67441 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08130 12913 12332 gene locus_tag LOCUS_08140 12913 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12967 13659 gene locus_tag LOCUS_08150 12967 13659 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_08150 13712 14035 gene locus_tag LOCUS_08160 13712 14035 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_08160 14958 14122 gene locus_tag LOCUS_08170 gene dsbC 14958 14122 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_08170 15904 15002 gene locus_tag LOCUS_08180 gene xerD 15904 15002 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJP8 protein_id gnl|my_center|LOCUS_08180 16002 16757 gene locus_tag LOCUS_08190 16002 16757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 16754 18055 gene locus_tag LOCUS_08200 16754 18055 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 protein_id gnl|my_center|LOCUS_08200 18052 19164 gene locus_tag LOCUS_08210 gene zapE 18052 19164 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF3 protein_id gnl|my_center|LOCUS_08210 23992 19172 gene locus_tag LOCUS_08220 23992 19172 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_08220 24765 24076 gene locus_tag LOCUS_08230 gene maiA 24765 24076 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_08230 25302 24847 gene locus_tag LOCUS_08240 25302 24847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence022 2239 1469 gene locus_tag LOCUS_08250 2239 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2567 3019 gene locus_tag LOCUS_08260 2567 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3211 5172 gene locus_tag LOCUS_08270 3211 5172 CDS product dTDP-D-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_08270 5419 6693 gene locus_tag LOCUS_08280 gene aprA 5419 6693 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206974.1 protein_id gnl|my_center|LOCUS_08280 7183 6758 gene locus_tag LOCUS_08290 7183 6758 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_08290 7611 7180 gene locus_tag LOCUS_08300 7611 7180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 protein_id gnl|my_center|LOCUS_08300 7743 8006 gene locus_tag LOCUS_08310 7743 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8048 8668 gene locus_tag LOCUS_08320 8048 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_08320 9458 8733 gene locus_tag LOCUS_08330 9458 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 9756 9430 gene locus_tag LOCUS_08340 9756 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 10124 9753 gene locus_tag LOCUS_08350 10124 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10822 10121 gene locus_tag LOCUS_08360 10822 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 10907 11812 gene locus_tag LOCUS_08370 10907 11812 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462297.1 protein_id gnl|my_center|LOCUS_08370 11942 12301 gene locus_tag LOCUS_08380 gene flgB 11942 12301 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1S6 protein_id gnl|my_center|LOCUS_08380 12310 12714 gene locus_tag LOCUS_08390 12310 12714 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR0 protein_id gnl|my_center|LOCUS_08390 12714 13376 gene locus_tag LOCUS_08400 gene flgD 12714 13376 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B5 protein_id gnl|my_center|LOCUS_08400 13404 14621 gene locus_tag LOCUS_08410 gene flgE 13404 14621 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B6 protein_id gnl|my_center|LOCUS_08410 14637 15365 gene locus_tag LOCUS_08420 gene flgF 14637 15365 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHB5 protein_id gnl|my_center|LOCUS_08420 15377 16162 gene locus_tag LOCUS_08430 gene flgG 15377 16162 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B8 protein_id gnl|my_center|LOCUS_08430 16171 16830 gene locus_tag LOCUS_08440 gene flgH 16171 16830 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 protein_id gnl|my_center|LOCUS_08440 16840 17955 gene locus_tag LOCUS_08450 gene flgI 16840 17955 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C0 protein_id gnl|my_center|LOCUS_08450 17955 18863 gene locus_tag LOCUS_08460 gene flgJ 17955 18863 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_08460 18860 20716 gene locus_tag LOCUS_08470 gene flgK 18860 20716 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_08470 20719 21621 gene locus_tag LOCUS_08480 gene flgL 20719 21621 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ97 protein_id gnl|my_center|LOCUS_08480 21717 24212 gene locus_tag LOCUS_08490 21717 24212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence023 197 1192 gene locus_tag LOCUS_08500 gene qor 197 1192 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084319.1 protein_id gnl|my_center|LOCUS_08500 1268 2746 gene locus_tag LOCUS_08510 1268 2746 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_08510 3617 2754 gene locus_tag LOCUS_08520 3617 2754 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 protein_id gnl|my_center|LOCUS_08520 3726 4184 gene locus_tag LOCUS_08530 3726 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 5757 4249 gene locus_tag LOCUS_08540 5757 4249 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416069.1 protein_id gnl|my_center|LOCUS_08540 8261 5862 gene locus_tag LOCUS_08550 8261 5862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_08550 9000 8248 gene locus_tag LOCUS_08560 9000 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9063 10121 gene locus_tag LOCUS_08570 9063 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_08570 10298 11575 gene locus_tag LOCUS_08580 10298 11575 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_08580 13243 11708 gene locus_tag LOCUS_08590 13243 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 13809 13315 gene locus_tag LOCUS_08600 13809 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 protein_id gnl|my_center|LOCUS_08600 15178 13916 gene locus_tag LOCUS_08610 gene clsB 15178 13916 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA84 protein_id gnl|my_center|LOCUS_08610 15897 15175 gene locus_tag LOCUS_08620 gene ybhP 15897 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAW4 protein_id gnl|my_center|LOCUS_08620 16600 15965 gene locus_tag LOCUS_08630 16600 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 16976 16740 gene locus_tag LOCUS_08640 16976 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 17858 17094 gene locus_tag LOCUS_08650 gene fabG 17858 17094 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222161.1 protein_id gnl|my_center|LOCUS_08650 18708 17899 gene locus_tag LOCUS_08660 18708 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 19773 18727 gene locus_tag LOCUS_08670 19773 18727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_08670 20717 19770 gene locus_tag LOCUS_08680 20717 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 22738 20714 gene locus_tag LOCUS_08690 22738 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_08690 23518 22754 gene locus_tag LOCUS_08700 23518 22754 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence024 1457 138 gene locus_tag LOCUS_08710 gene hadHB 1457 138 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404210.1 protein_id gnl|my_center|LOCUS_08710 2293 1454 gene locus_tag LOCUS_08720 2293 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2593 4218 gene locus_tag LOCUS_08730 2593 4218 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH36 protein_id gnl|my_center|LOCUS_08730 4773 4231 gene locus_tag LOCUS_08740 4773 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_08740 5560 4874 gene locus_tag LOCUS_08750 5560 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_08750 5706 6137 gene locus_tag LOCUS_08760 5706 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_08760 7520 6159 gene locus_tag LOCUS_08770 7520 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 7930 10500 gene locus_tag LOCUS_08780 7930 10500 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114236.1 protein_id gnl|my_center|LOCUS_08780 10599 11750 gene locus_tag LOCUS_08790 10599 11750 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_08790 12106 11744 gene locus_tag LOCUS_08800 12106 11744 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082958.1 protein_id gnl|my_center|LOCUS_08800 12208 13224 gene locus_tag LOCUS_08810 12208 13224 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405029.1 protein_id gnl|my_center|LOCUS_08810 13458 13294 gene locus_tag LOCUS_08820 13458 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 15144 13561 gene locus_tag LOCUS_08830 15144 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 15396 16226 gene locus_tag LOCUS_08840 15396 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 16762 16223 gene locus_tag LOCUS_08850 16762 16223 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073013.1 protein_id gnl|my_center|LOCUS_08850 17304 16795 gene locus_tag LOCUS_08860 17304 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 18176 17301 gene locus_tag LOCUS_08870 18176 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_08870 18588 20459 gene locus_tag LOCUS_08880 18588 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 20456 23371 gene locus_tag LOCUS_08890 20456 23371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence025 2786 1824 gene locus_tag LOCUS_08900 gene pstS 2786 1824 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_08900 4055 2883 gene locus_tag LOCUS_08910 gene oprO 4055 2883 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038451.1 protein_id gnl|my_center|LOCUS_08910 5521 4142 gene locus_tag LOCUS_08920 gene phoR 5521 4142 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_08920 6230 5532 gene locus_tag LOCUS_08930 gene phoB 6230 5532 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFJ5 protein_id gnl|my_center|LOCUS_08930 8894 6288 gene locus_tag LOCUS_08940 gene pepN 8894 6288 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706141.1 protein_id gnl|my_center|LOCUS_08940 10056 8932 gene locus_tag LOCUS_08950 10056 8932 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_08950 11531 10140 gene locus_tag LOCUS_08960 11531 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12109 11531 gene locus_tag LOCUS_08970 12109 11531 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_08970 12416 12114 gene locus_tag LOCUS_08980 12416 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 12776 12417 gene locus_tag LOCUS_08990 12776 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 12791 13312 gene locus_tag LOCUS_09000 12791 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 13771 13319 gene locus_tag LOCUS_09010 13771 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_09010 13832 17443 gene locus_tag LOCUS_09020 13832 17443 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058005.1 protein_id gnl|my_center|LOCUS_09020 17440 18729 gene locus_tag LOCUS_09030 17440 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_09030 18817 19281 gene locus_tag LOCUS_09040 18817 19281 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_09040 19283 20731 gene locus_tag LOCUS_09050 gene ycf24 19283 20731 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_09050 20759 21505 gene locus_tag LOCUS_09060 gene ynhD 20759 21505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_09060 21502 22677 gene locus_tag LOCUS_09070 21502 22677 CDS product cysteine desulfurase activator complex subunit SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001006409.2 protein_id gnl|my_center|LOCUS_09070 >Feature sequence026 346 1662 gene locus_tag LOCUS_09080 gene aceA 346 1662 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_09080 1797 2456 gene locus_tag LOCUS_09090 gene uvrY 1797 2456 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 protein_id gnl|my_center|LOCUS_09090 2453 4264 gene locus_tag LOCUS_09100 gene uvrC 2453 4264 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8W9 protein_id gnl|my_center|LOCUS_09100 4323 4904 gene locus_tag LOCUS_09110 gene pgsA 4323 4904 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_09110 4942 5017 gene locus_tag LOCUS_t00110 4942 5017 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5068 5141 gene locus_tag LOCUS_t00120 5068 5141 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5193 5279 gene locus_tag LOCUS_t00130 5193 5279 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5356 5916 gene locus_tag LOCUS_09120 gene ccmA 5356 5916 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_09120 5913 6581 gene locus_tag LOCUS_09130 5913 6581 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF1 protein_id gnl|my_center|LOCUS_09130 6578 7324 gene locus_tag LOCUS_09140 gene ccmC 6578 7324 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_09140 7317 7478 gene locus_tag LOCUS_09150 7317 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7459 7947 gene locus_tag LOCUS_09160 gene ccmE 7459 7947 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_09160 7947 9920 gene locus_tag LOCUS_09170 7947 9920 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_09170 9920 10447 gene locus_tag LOCUS_09180 gene ccmG 9920 10447 CDS product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972490.1 protein_id gnl|my_center|LOCUS_09180 10444 10890 gene locus_tag LOCUS_09190 10444 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10887 11915 gene locus_tag LOCUS_09200 10887 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 11986 12900 gene locus_tag LOCUS_09210 gene galU 11986 12900 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G7 protein_id gnl|my_center|LOCUS_09210 12945 15812 gene locus_tag LOCUS_09220 gene sucA 12945 15812 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636859.2 protein_id gnl|my_center|LOCUS_09220 15857 17119 gene locus_tag LOCUS_09230 gene sucB 15857 17119 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY0 protein_id gnl|my_center|LOCUS_09230 17210 18316 gene locus_tag LOCUS_09240 17210 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 18421 19866 gene locus_tag LOCUS_09250 gene lpdG 18421 19866 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_09250 19895 20470 gene locus_tag LOCUS_09260 19895 20470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 20494 21246 gene locus_tag LOCUS_09270 20494 21246 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH19 protein_id gnl|my_center|LOCUS_09270 21259 21780 gene locus_tag LOCUS_09280 gene ruvC 21259 21780 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QV1 protein_id gnl|my_center|LOCUS_09280 21777 22382 gene locus_tag LOCUS_09290 gene ruvA 21777 22382 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_09290 >Feature sequence027 85 747 gene locus_tag LOCUS_09300 85 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 748 1437 gene locus_tag LOCUS_09310 748 1437 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_09310 1434 2441 gene locus_tag LOCUS_09320 gene yhdH 1434 2441 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124125.1 protein_id gnl|my_center|LOCUS_09320 3057 2452 gene locus_tag LOCUS_09330 3057 2452 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV4 protein_id gnl|my_center|LOCUS_09330 3121 3603 gene locus_tag LOCUS_09340 3121 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3540 3791 gene locus_tag LOCUS_09350 3540 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3815 4864 gene locus_tag LOCUS_09360 gene plsX 3815 4864 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_09360 4925 6301 gene locus_tag LOCUS_09370 gene radA 4925 6301 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBF8 protein_id gnl|my_center|LOCUS_09370 7573 6308 gene locus_tag LOCUS_09380 gene corB 7573 6308 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261309.1 protein_id gnl|my_center|LOCUS_09380 8440 7658 gene locus_tag LOCUS_09390 8440 7658 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266932.1 protein_id gnl|my_center|LOCUS_09390 8538 9302 gene locus_tag LOCUS_09400 8538 9302 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_09400 9383 10843 gene locus_tag LOCUS_09410 gene ffh 9383 10843 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK91 protein_id gnl|my_center|LOCUS_09410 11011 11280 gene locus_tag LOCUS_09420 gene rpsP 11011 11280 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH3 protein_id gnl|my_center|LOCUS_09420 11306 11827 gene locus_tag LOCUS_09430 gene rimM 11306 11827 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQB0 protein_id gnl|my_center|LOCUS_09430 11833 12585 gene locus_tag LOCUS_09440 gene trmD 11833 12585 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7F0 protein_id gnl|my_center|LOCUS_09440 12582 12935 gene locus_tag LOCUS_09450 gene rplS 12582 12935 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG26 protein_id gnl|my_center|LOCUS_09450 13186 13386 gene locus_tag LOCUS_09460 13186 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14025 13408 gene locus_tag LOCUS_09470 gene gst-1 14025 13408 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 protein_id gnl|my_center|LOCUS_09470 15029 14076 gene locus_tag LOCUS_09480 gene trxB1 15029 14076 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_09480 15746 15144 gene locus_tag LOCUS_09490 15746 15144 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_09490 15919 17838 gene locus_tag LOCUS_09500 gene sppA 15919 17838 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 protein_id gnl|my_center|LOCUS_09500 17835 18632 gene locus_tag LOCUS_09510 17835 18632 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_09510 19582 18650 gene locus_tag LOCUS_09520 19582 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 20441 19524 gene locus_tag LOCUS_09530 gene nadC 20441 19524 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_09530 21411 20473 gene locus_tag LOCUS_09540 gene argF 21411 20473 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11724 protein_id gnl|my_center|LOCUS_09540 22055 21480 gene locus_tag LOCUS_09550 gene sodB 22055 21480 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53641 protein_id gnl|my_center|LOCUS_09550 >Feature sequence028 3303 2134 gene locus_tag LOCUS_09560 3303 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 7567 3296 gene locus_tag LOCUS_09570 7567 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 8152 7688 gene locus_tag LOCUS_09580 8152 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 8661 8170 gene locus_tag LOCUS_09590 8661 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 8908 9639 gene locus_tag LOCUS_09600 8908 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 9614 11002 gene locus_tag LOCUS_09610 gene tolC 9614 11002 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817216.1 protein_id gnl|my_center|LOCUS_09610 10999 12162 gene locus_tag LOCUS_09620 10999 12162 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_09620 12217 15327 gene locus_tag LOCUS_09630 12217 15327 CDS product MexW/MexI family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 protein_id gnl|my_center|LOCUS_09630 17597 15429 gene locus_tag LOCUS_09640 17597 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_09640 17801 18496 gene locus_tag LOCUS_09650 17801 18496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 18477 19142 gene locus_tag LOCUS_09660 18477 19142 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894979.1 protein_id gnl|my_center|LOCUS_09660 19189 19998 gene locus_tag LOCUS_09670 19189 19998 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 protein_id gnl|my_center|LOCUS_09670 20314 20048 gene locus_tag LOCUS_09680 20314 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 21387 20449 gene locus_tag LOCUS_09690 21387 20449 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence029 810 289 gene locus_tag LOCUS_09700 810 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2100 1009 gene locus_tag LOCUS_09710 2100 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2360 3382 gene locus_tag LOCUS_09720 2360 3382 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_09720 3482 4363 gene locus_tag LOCUS_09730 3482 4363 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_09730 6163 4370 gene locus_tag LOCUS_09740 6163 4370 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_09740 6331 6588 gene locus_tag LOCUS_09750 6331 6588 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 protein_id gnl|my_center|LOCUS_09750 6695 7969 gene locus_tag LOCUS_09760 gene MltB 6695 7969 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_09760 11084 8016 gene locus_tag LOCUS_09770 11084 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 12165 11245 gene locus_tag LOCUS_09780 12165 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_09780 12305 12790 gene locus_tag LOCUS_09790 12305 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12841 13413 gene locus_tag LOCUS_09800 12841 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918014.1 protein_id gnl|my_center|LOCUS_09800 14345 13428 gene locus_tag LOCUS_09810 14345 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 15040 14471 gene locus_tag LOCUS_09820 15040 14471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 protein_id gnl|my_center|LOCUS_09820 16454 15114 gene locus_tag LOCUS_09830 16454 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_09830 16885 16451 gene locus_tag LOCUS_09840 16885 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 17340 17122 gene locus_tag LOCUS_09850 17340 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 17934 17383 gene locus_tag LOCUS_09860 17934 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 19478 17931 gene locus_tag LOCUS_09870 19478 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 19659 20729 gene locus_tag LOCUS_09880 19659 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 20786 21307 gene locus_tag LOCUS_09890 gene slyD 20786 21307 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB16 protein_id gnl|my_center|LOCUS_09890 >Feature sequence030 51 1211 gene locus_tag LOCUS_09900 51 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1784 1449 gene locus_tag LOCUS_09910 1784 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2815 1919 gene locus_tag LOCUS_09920 2815 1919 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_09920 2950 4203 gene locus_tag LOCUS_09930 2950 4203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_09930 4477 4857 gene locus_tag LOCUS_09940 gene dksA 4477 4857 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBV2 protein_id gnl|my_center|LOCUS_09940 4918 4993 gene locus_tag LOCUS_t00140 4918 4993 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7576 5159 gene locus_tag LOCUS_09950 7576 5159 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_09950 8425 7745 gene locus_tag LOCUS_09960 8425 7745 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_09960 8557 9945 gene locus_tag LOCUS_09970 8557 9945 CDS product Epi-isozizaene 5-monooxygenase/(E)-beta-farnesene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K498 protein_id gnl|my_center|LOCUS_09970 10080 11189 gene locus_tag LOCUS_09980 10080 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_09980 11952 11170 gene locus_tag LOCUS_09990 11952 11170 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_09990 13098 11965 gene locus_tag LOCUS_10000 13098 11965 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192764.1 protein_id gnl|my_center|LOCUS_10000 13120 14040 gene locus_tag LOCUS_10010 13120 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 14132 14845 gene locus_tag LOCUS_10020 14132 14845 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_10020 14853 17240 gene locus_tag LOCUS_10030 14853 17240 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_10030 17237 18469 gene locus_tag LOCUS_10040 17237 18469 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090709.1 protein_id gnl|my_center|LOCUS_10040 18572 19249 gene locus_tag LOCUS_10050 18572 19249 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 protein_id gnl|my_center|LOCUS_10050 19246 19911 gene locus_tag LOCUS_10060 19246 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19908 20252 gene locus_tag LOCUS_10070 19908 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 20286 20669 gene locus_tag LOCUS_10080 20286 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence031 104 505 gene locus_tag LOCUS_10090 104 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 938 4468 gene locus_tag LOCUS_10100 gene rne 938 4468 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_10100 4776 4552 gene locus_tag LOCUS_10110 4776 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7335 5233 gene locus_tag LOCUS_10120 gene pnp 7335 5233 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V1 protein_id gnl|my_center|LOCUS_10120 7638 7369 gene locus_tag LOCUS_10130 gene rpsO 7638 7369 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMU7 protein_id gnl|my_center|LOCUS_10130 8646 7726 gene locus_tag LOCUS_10140 gene truB 8646 7726 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE1 protein_id gnl|my_center|LOCUS_10140 9032 8649 gene locus_tag LOCUS_10150 9032 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 11827 9053 gene locus_tag LOCUS_10160 11827 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 13373 11886 gene locus_tag LOCUS_10170 gene nusA 13373 11886 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 protein_id gnl|my_center|LOCUS_10170 13871 13398 gene locus_tag LOCUS_10180 gene rimP 13871 13398 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M00 protein_id gnl|my_center|LOCUS_10180 13988 13912 gene locus_tag LOCUS_t00150 13988 13912 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14174 14088 gene locus_tag LOCUS_t00160 14174 14088 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14597 14139 gene locus_tag LOCUS_10190 14597 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 15401 14634 gene locus_tag LOCUS_10200 gene tpiA 15401 14634 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 protein_id gnl|my_center|LOCUS_10200 16788 15445 gene locus_tag LOCUS_10210 gene glmM 16788 15445 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT4 protein_id gnl|my_center|LOCUS_10210 17654 16785 gene locus_tag LOCUS_10220 gene folP 17654 16785 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKJ1 protein_id gnl|my_center|LOCUS_10220 19601 17718 gene locus_tag LOCUS_10230 gene ftsH 19601 17718 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT2 protein_id gnl|my_center|LOCUS_10230 20322 19696 gene locus_tag LOCUS_10240 gene rlmE 20322 19696 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT1 protein_id gnl|my_center|LOCUS_10240 20885 20412 gene locus_tag LOCUS_10250 gene greA 20885 20412 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L4D3 protein_id gnl|my_center|LOCUS_10250 >Feature sequence032 1589 2245 gene locus_tag LOCUS_10260 1589 2245 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_10260 3963 2254 gene locus_tag LOCUS_10270 3963 2254 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097323.1 protein_id gnl|my_center|LOCUS_10270 5558 3960 gene locus_tag LOCUS_10280 5558 3960 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929714.1 protein_id gnl|my_center|LOCUS_10280 6648 5647 gene locus_tag LOCUS_10290 6648 5647 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268936.1 protein_id gnl|my_center|LOCUS_10290 8150 6729 gene locus_tag LOCUS_10300 8150 6729 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 protein_id gnl|my_center|LOCUS_10300 8313 8681 gene locus_tag LOCUS_10310 8313 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 8804 10753 gene locus_tag LOCUS_10320 gene thiC 8804 10753 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9E7 protein_id gnl|my_center|LOCUS_10320 10833 11252 gene locus_tag LOCUS_10330 10833 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 11309 13156 gene locus_tag LOCUS_10340 11309 13156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246686.1 protein_id gnl|my_center|LOCUS_10340 13590 13150 gene locus_tag LOCUS_10350 13590 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 13665 14777 gene locus_tag LOCUS_10360 13665 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_10360 15116 15553 gene locus_tag LOCUS_10370 gene mraZ 15116 15553 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 protein_id gnl|my_center|LOCUS_10370 15560 16486 gene locus_tag LOCUS_10380 gene rsmH 15560 16486 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIP3 protein_id gnl|my_center|LOCUS_10380 16483 16743 gene locus_tag LOCUS_10390 16483 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 16740 18473 gene locus_tag LOCUS_10400 gene ftsI 16740 18473 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_10400 18470 19960 gene locus_tag LOCUS_10410 gene murE 18470 19960 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_10410 >Feature sequence033 1247 4063 gene locus_tag LOCUS_10420 1247 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4047 4733 gene locus_tag LOCUS_10430 4047 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4745 5161 gene locus_tag LOCUS_10440 4745 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5224 5859 gene locus_tag LOCUS_10450 5224 5859 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_10450 5856 6350 gene locus_tag LOCUS_10460 5856 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6347 6880 gene locus_tag LOCUS_10470 6347 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 6883 7860 gene locus_tag LOCUS_10480 6883 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7891 8679 gene locus_tag LOCUS_10490 7891 8679 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_10490 10014 8734 gene locus_tag LOCUS_10500 gene gltP 10014 8734 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_10500 11972 10050 gene locus_tag LOCUS_10510 11972 10050 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R77 protein_id gnl|my_center|LOCUS_10510 12141 12065 gene locus_tag LOCUS_t00170 12141 12065 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12243 12168 gene locus_tag LOCUS_t00180 12243 12168 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12538 12266 gene locus_tag LOCUS_10520 gene hupB 12538 12266 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_10520 15105 12709 gene locus_tag LOCUS_10530 gene lon 15105 12709 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_10530 16497 15229 gene locus_tag LOCUS_10540 gene clpX 16497 15229 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_10540 17228 16602 gene locus_tag LOCUS_10550 gene clpP 17228 16602 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHI5 protein_id gnl|my_center|LOCUS_10550 18585 17266 gene locus_tag LOCUS_10560 gene tig 18585 17266 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_10560 18756 18672 gene locus_tag LOCUS_t00190 18756 18672 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 244 41 gene locus_tag LOCUS_10570 244 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3156 1009 gene locus_tag LOCUS_10580 3156 1009 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_10580 3352 4314 gene locus_tag LOCUS_10590 3352 4314 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_10590 4970 4404 gene locus_tag LOCUS_10600 4970 4404 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_10600 5113 5862 gene locus_tag LOCUS_10610 5113 5862 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_10610 5955 7409 gene locus_tag LOCUS_10620 gene rpoN 5955 7409 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_10620 7441 7776 gene locus_tag LOCUS_10630 7441 7776 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_10630 7835 8278 gene locus_tag LOCUS_10640 7835 8278 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687701.1 protein_id gnl|my_center|LOCUS_10640 8283 9245 gene locus_tag LOCUS_10650 gene hprK 8283 9245 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P709 protein_id gnl|my_center|LOCUS_10650 9260 10117 gene locus_tag LOCUS_10660 9260 10117 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_10660 10114 10536 gene locus_tag LOCUS_10670 10114 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_10670 10529 10798 gene locus_tag LOCUS_10680 gene ptsH 10529 10798 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_10680 10845 12587 gene locus_tag LOCUS_10690 10845 12587 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XV0 protein_id gnl|my_center|LOCUS_10690 13443 12616 gene locus_tag LOCUS_10700 13443 12616 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103709.1 protein_id gnl|my_center|LOCUS_10700 13867 13511 gene locus_tag LOCUS_10710 13867 13511 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_10710 14761 13937 gene locus_tag LOCUS_10720 14761 13937 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_10720 16385 14838 gene locus_tag LOCUS_10730 gene purH 16385 14838 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPY5 protein_id gnl|my_center|LOCUS_10730 16687 16382 gene locus_tag LOCUS_10740 16687 16382 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD37 protein_id gnl|my_center|LOCUS_10740 17683 16799 gene locus_tag LOCUS_10750 gene prmA 17683 16799 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_10750 19035 17683 gene locus_tag LOCUS_10760 19035 17683 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence035 3779 3324 gene locus_tag LOCUS_10770 3779 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4674 3898 gene locus_tag LOCUS_10780 gene fpr 4674 3898 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_10780 4913 5608 gene locus_tag LOCUS_10790 4913 5608 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_10790 5605 6501 gene locus_tag LOCUS_10800 5605 6501 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_10800 6506 7462 gene locus_tag LOCUS_10810 6506 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7812 7435 gene locus_tag LOCUS_10820 7812 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 8029 8982 gene locus_tag LOCUS_10830 8029 8982 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_10830 9568 8993 gene locus_tag LOCUS_10840 9568 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_10840 9842 9769 gene locus_tag LOCUS_t00200 9842 9769 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9974 10966 gene locus_tag LOCUS_10850 gene thiG 9974 10966 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_10850 10963 11679 gene locus_tag LOCUS_10860 gene trmB 10963 11679 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_10860 11672 12583 gene locus_tag LOCUS_10870 11672 12583 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGY1 protein_id gnl|my_center|LOCUS_10870 12558 13592 gene locus_tag LOCUS_10880 12558 13592 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883815.1 protein_id gnl|my_center|LOCUS_10880 13791 14093 gene locus_tag LOCUS_10890 13791 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 15442 14090 gene locus_tag LOCUS_10900 15442 14090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_10900 16236 15439 gene locus_tag LOCUS_10910 gene exoA 16236 15439 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 protein_id gnl|my_center|LOCUS_10910 16296 16937 gene locus_tag LOCUS_10920 gene pyrE 16296 16937 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T92 protein_id gnl|my_center|LOCUS_10920 16987 17664 gene locus_tag LOCUS_10930 gene hly3 16987 17664 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_10930 17755 18924 gene locus_tag LOCUS_10940 17755 18924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence036 352 882 gene locus_tag LOCUS_10950 352 882 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_10950 958 1416 gene locus_tag LOCUS_10960 958 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1483 2325 gene locus_tag LOCUS_10970 1483 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2327 3319 gene locus_tag LOCUS_10980 2327 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3356 3667 gene locus_tag LOCUS_10990 3356 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3723 4220 gene locus_tag LOCUS_11000 3723 4220 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035788.1 protein_id gnl|my_center|LOCUS_11000 5197 4196 gene locus_tag LOCUS_11010 5197 4196 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244718.1 protein_id gnl|my_center|LOCUS_11010 6723 5194 gene locus_tag LOCUS_11020 6723 5194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267423.1 protein_id gnl|my_center|LOCUS_11020 8966 6873 gene locus_tag LOCUS_11030 8966 6873 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705259.1 protein_id gnl|my_center|LOCUS_11030 10044 9049 gene locus_tag LOCUS_11040 10044 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 11264 10128 gene locus_tag LOCUS_11050 11264 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 11378 12934 gene locus_tag LOCUS_11060 gene yhcX 11378 12934 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_11060 15718 12944 gene locus_tag LOCUS_11070 gene malT 15718 12944 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228248.1 protein_id gnl|my_center|LOCUS_11070 15958 16713 gene locus_tag LOCUS_11080 15958 16713 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 protein_id gnl|my_center|LOCUS_11080 16745 17515 gene locus_tag LOCUS_11090 16745 17515 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225354.1 protein_id gnl|my_center|LOCUS_11090 17709 18716 gene locus_tag LOCUS_11100 17709 18716 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence037 160 1095 gene locus_tag LOCUS_11110 160 1095 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 protein_id gnl|my_center|LOCUS_11110 2093 1053 gene locus_tag LOCUS_11120 gene virS 2093 1053 CDS product HTH-type transcriptional regulator VirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ3 protein_id gnl|my_center|LOCUS_11120 2156 3049 gene locus_tag LOCUS_11130 gene ephD 2156 3049 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_11130 3046 3882 gene locus_tag LOCUS_11140 3046 3882 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_11140 3893 5386 gene locus_tag LOCUS_11150 3893 5386 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_11150 5799 5383 gene locus_tag LOCUS_11160 5799 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6028 6720 gene locus_tag LOCUS_11170 6028 6720 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_11170 6914 7510 gene locus_tag LOCUS_11180 gene ompW 6914 7510 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_11180 7605 8333 gene locus_tag LOCUS_11190 7605 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 8438 9127 gene locus_tag LOCUS_11200 8438 9127 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_11200 10094 9207 gene locus_tag LOCUS_11210 10094 9207 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_11210 11071 10178 gene locus_tag LOCUS_11220 11071 10178 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_11220 12296 11061 gene locus_tag LOCUS_11230 gene proV 12296 11061 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_11230 12406 12825 gene locus_tag LOCUS_11240 12406 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_11240 13762 12812 gene locus_tag LOCUS_11250 13762 12812 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_11250 13857 15029 gene locus_tag LOCUS_11260 gene chrA 13857 15029 CDS product chromate efflux pump, ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337376.1 protein_id gnl|my_center|LOCUS_11260 15605 15018 gene locus_tag LOCUS_11270 15605 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 16870 15602 gene locus_tag LOCUS_11280 16870 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 17131 18510 gene locus_tag LOCUS_11290 17131 18510 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence038 974 51 gene locus_tag LOCUS_11300 gene ilvE 974 51 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_11300 3867 1009 gene locus_tag LOCUS_11310 gene glnE 3867 1009 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN4 protein_id gnl|my_center|LOCUS_11310 3965 5572 gene locus_tag LOCUS_11320 3965 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7292 5646 gene locus_tag LOCUS_11330 gene groL 7292 5646 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_11330 7633 7343 gene locus_tag LOCUS_11340 gene groS 7633 7343 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19422 protein_id gnl|my_center|LOCUS_11340 7842 9116 gene locus_tag LOCUS_11350 7842 9116 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_11350 9124 10503 gene locus_tag LOCUS_11360 9124 10503 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_11360 10537 12186 gene locus_tag LOCUS_11370 10537 12186 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_11370 12217 13290 gene locus_tag LOCUS_11380 gene hemH 12217 13290 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL51 protein_id gnl|my_center|LOCUS_11380 14566 13439 gene locus_tag LOCUS_11390 14566 13439 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_11390 14787 15797 gene locus_tag LOCUS_11400 14787 15797 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769160.1 protein_id gnl|my_center|LOCUS_11400 16072 17403 gene locus_tag LOCUS_11410 gene degQ 16072 17403 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886707.1 protein_id gnl|my_center|LOCUS_11410 17461 17658 gene locus_tag LOCUS_11420 17461 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 17651 17959 gene locus_tag LOCUS_11430 gene zapA 17651 17959 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_11430 >Feature sequence039 1425 775 gene locus_tag LOCUS_11440 gene gst 1425 775 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_11440 2829 1582 gene locus_tag LOCUS_11450 2829 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3229 4749 gene locus_tag LOCUS_11460 gene oprN 3229 4749 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_11460 4856 5812 gene locus_tag LOCUS_11470 4856 5812 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_11470 5812 8940 gene locus_tag LOCUS_11480 5812 8940 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_11480 8981 9526 gene locus_tag LOCUS_11490 8981 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_11490 10596 9523 gene locus_tag LOCUS_11500 10596 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 11114 10872 gene locus_tag LOCUS_11510 11114 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 11622 11140 gene locus_tag LOCUS_11520 11622 11140 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_11520 11865 12758 gene locus_tag LOCUS_11530 11865 12758 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_11530 12972 14300 gene locus_tag LOCUS_11540 gene ycaD 12972 14300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_11540 14728 14306 gene locus_tag LOCUS_11550 14728 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 15130 16839 gene locus_tag LOCUS_11560 15130 16839 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765488.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence040 829 62 gene locus_tag LOCUS_11570 829 62 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_11570 3238 854 gene locus_tag LOCUS_11580 gene gyrB 3238 854 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVX3 protein_id gnl|my_center|LOCUS_11580 4448 3375 gene locus_tag LOCUS_11590 gene recF 4448 3375 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH3 protein_id gnl|my_center|LOCUS_11590 5636 4539 gene locus_tag LOCUS_11600 gene dnaN 5636 4539 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_11600 7206 5878 gene locus_tag LOCUS_11610 gene dnaA 7206 5878 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK8 protein_id gnl|my_center|LOCUS_11610 7278 7478 gene locus_tag LOCUS_11620 7278 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7479 7823 gene locus_tag LOCUS_11630 gene rnpA 7479 7823 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_11630 7790 8062 gene locus_tag LOCUS_11640 7790 8062 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I5 protein_id gnl|my_center|LOCUS_11640 8069 9781 gene locus_tag LOCUS_11650 gene yidC 8069 9781 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_11650 9789 11120 gene locus_tag LOCUS_11660 gene mnmE 9789 11120 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94612 protein_id gnl|my_center|LOCUS_11660 11167 11607 gene locus_tag LOCUS_11670 11167 11607 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405501.1 protein_id gnl|my_center|LOCUS_11670 11604 12107 gene locus_tag LOCUS_11680 11604 12107 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_11680 12227 16009 gene locus_tag LOCUS_11690 gene metH 12227 16009 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence041 1096 167 gene locus_tag LOCUS_11700 gene thiL 1096 167 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY5 protein_id gnl|my_center|LOCUS_11700 1585 1109 gene locus_tag LOCUS_11710 gene nusB 1585 1109 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_11710 2079 1582 gene locus_tag LOCUS_11720 gene ribH 2079 1582 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 protein_id gnl|my_center|LOCUS_11720 3270 2092 gene locus_tag LOCUS_11730 gene ribA 3270 2092 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 protein_id gnl|my_center|LOCUS_11730 3869 3267 gene locus_tag LOCUS_11740 gene ribE 3869 3267 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_11740 5002 3872 gene locus_tag LOCUS_11750 gene ribD 5002 3872 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX83 protein_id gnl|my_center|LOCUS_11750 5689 5168 gene locus_tag LOCUS_11760 gene nrdR 5689 5168 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN3 protein_id gnl|my_center|LOCUS_11760 7005 5719 gene locus_tag LOCUS_11770 gene glyA 7005 5719 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH4 protein_id gnl|my_center|LOCUS_11770 8167 7070 gene locus_tag LOCUS_11780 gene nadA 8167 7070 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNR5 protein_id gnl|my_center|LOCUS_11780 9951 8215 gene locus_tag LOCUS_11790 9951 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11777 9948 gene locus_tag LOCUS_11800 gene aspS 11777 9948 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y31 protein_id gnl|my_center|LOCUS_11800 12175 11828 gene locus_tag LOCUS_11810 12175 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 12435 13373 gene locus_tag LOCUS_11820 12435 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 13378 14070 gene locus_tag LOCUS_11830 13378 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 14259 15590 gene locus_tag LOCUS_11840 14259 15590 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_11840 15598 16599 gene locus_tag LOCUS_11850 gene uge 15598 16599 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence042 923 474 gene locus_tag LOCUS_11860 gene zntR 923 474 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_11860 2020 1043 gene locus_tag LOCUS_11870 2020 1043 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_11870 3282 2017 gene locus_tag LOCUS_11880 3282 2017 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035424.1 protein_id gnl|my_center|LOCUS_11880 3421 4557 gene locus_tag LOCUS_11890 3421 4557 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035423.1 protein_id gnl|my_center|LOCUS_11890 4747 6948 gene locus_tag LOCUS_11900 4747 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7030 7695 gene locus_tag LOCUS_11910 7030 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_11910 8131 7634 gene locus_tag LOCUS_11920 8131 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 9014 8325 gene locus_tag LOCUS_11930 9014 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9498 9422 gene locus_tag LOCUS_t00210 9498 9422 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9904 9548 gene locus_tag LOCUS_11940 9904 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 10314 11861 gene locus_tag LOCUS_11950 10314 11861 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404766.1 protein_id gnl|my_center|LOCUS_11950 12766 11858 gene locus_tag LOCUS_11960 gene sulA 12766 11858 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_11960 13449 12766 gene locus_tag LOCUS_11970 13449 12766 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_11970 15908 13449 gene locus_tag LOCUS_11980 gene lhr2 15908 13449 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036482.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence043 3054 574 gene locus_tag LOCUS_11990 3054 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6031 3197 gene locus_tag LOCUS_12000 gene uvrA 6031 3197 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_12000 6135 7301 gene locus_tag LOCUS_12010 6135 7301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_12010 7312 7785 gene locus_tag LOCUS_12020 gene ssb 7312 7785 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ06 protein_id gnl|my_center|LOCUS_12020 9074 7857 gene locus_tag LOCUS_12030 9074 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 11789 9513 gene locus_tag LOCUS_12040 gene dme 11789 9513 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708222.1 protein_id gnl|my_center|LOCUS_12040 12865 11942 gene locus_tag LOCUS_12050 12865 11942 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810407.1 protein_id gnl|my_center|LOCUS_12050 12929 15628 gene locus_tag LOCUS_12060 gene aceE 12929 15628 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD6 protein_id gnl|my_center|LOCUS_12060 15628 16626 gene locus_tag LOCUS_12070 15628 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence044 <1 807 gene locus_tag LOCUS_12080 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038189.1:membrane protein 838 2607 gene locus_tag LOCUS_12090 838 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4791 2671 gene locus_tag LOCUS_12100 4791 2671 CDS product siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086926.1 protein_id gnl|my_center|LOCUS_12100 5189 4908 gene locus_tag LOCUS_12110 5189 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6720 5191 gene locus_tag LOCUS_12120 6720 5191 CDS product iron uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 protein_id gnl|my_center|LOCUS_12120 6980 6717 gene locus_tag LOCUS_12130 6980 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9170 7110 gene locus_tag LOCUS_12140 gene prlC 9170 7110 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114658.1 protein_id gnl|my_center|LOCUS_12140 10186 9239 gene locus_tag LOCUS_12150 10186 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_12150 10766 10194 gene locus_tag LOCUS_12160 10766 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_12160 10897 11826 gene locus_tag LOCUS_12170 10897 11826 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_12170 11823 12350 gene locus_tag LOCUS_12180 gene yrdA 11823 12350 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946314.1 protein_id gnl|my_center|LOCUS_12180 12502 13254 gene locus_tag LOCUS_12190 gene gpmA 12502 13254 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 protein_id gnl|my_center|LOCUS_12190 13643 15217 gene locus_tag LOCUS_12200 13643 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 15740 15195 gene locus_tag LOCUS_12210 15740 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence045 <1 747 gene locus_tag LOCUS_12220 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9C4:flagellin 854 1168 gene locus_tag LOCUS_12230 854 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1200 2558 gene locus_tag LOCUS_12240 gene fliD 1200 2558 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_12240 2628 3044 gene locus_tag LOCUS_12250 gene fliS 2628 3044 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3P3 protein_id gnl|my_center|LOCUS_12250 3041 3364 gene locus_tag LOCUS_12260 3041 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3351 3878 gene locus_tag LOCUS_12270 3351 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3908 4570 gene locus_tag LOCUS_12280 3908 4570 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 protein_id gnl|my_center|LOCUS_12280 4779 6158 gene locus_tag LOCUS_12290 gene rpoN 4779 6158 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D0 protein_id gnl|my_center|LOCUS_12290 6188 7315 gene locus_tag LOCUS_12300 6188 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7363 7707 gene locus_tag LOCUS_12310 gene fliE 7363 7707 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT2 protein_id gnl|my_center|LOCUS_12310 7718 9331 gene locus_tag LOCUS_12320 gene fliF 7718 9331 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D9 protein_id gnl|my_center|LOCUS_12320 9324 10358 gene locus_tag LOCUS_12330 gene fliG 9324 10358 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E0 protein_id gnl|my_center|LOCUS_12330 10351 10923 gene locus_tag LOCUS_12340 10351 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 10920 12284 gene locus_tag LOCUS_12350 gene fliI 10920 12284 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037089.1 protein_id gnl|my_center|LOCUS_12350 12281 12709 gene locus_tag LOCUS_12360 12281 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12706 14196 gene locus_tag LOCUS_12370 12706 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14311 14769 gene locus_tag LOCUS_12380 14311 14769 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_12380 14766 15788 gene locus_tag LOCUS_12390 gene fliM 14766 15788 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E6 protein_id gnl|my_center|LOCUS_12390 15792 16220 gene locus_tag LOCUS_12400 gene fliN 15792 16220 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E7 protein_id gnl|my_center|LOCUS_12400 >Feature sequence046 1271 645 gene locus_tag LOCUS_12410 1271 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1390 1587 gene locus_tag LOCUS_12420 1390 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1803 2195 gene locus_tag LOCUS_12430 1803 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2257 2523 gene locus_tag LOCUS_12440 2257 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2524 3225 gene locus_tag LOCUS_12450 2524 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3222 4952 gene locus_tag LOCUS_12460 3222 4952 CDS product DNA primase/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107640.1 protein_id gnl|my_center|LOCUS_12460 4953 5354 gene locus_tag LOCUS_12470 4953 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5290 5715 gene locus_tag LOCUS_12480 5290 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 5712 5912 gene locus_tag LOCUS_12490 5712 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5986 6300 gene locus_tag LOCUS_12500 5986 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6509 7165 gene locus_tag LOCUS_12510 6509 7165 CDS product bacteriophage lambda NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267993.1 protein_id gnl|my_center|LOCUS_12510 7162 7527 gene locus_tag LOCUS_12520 7162 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7524 7901 gene locus_tag LOCUS_12530 7524 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7898 8350 gene locus_tag LOCUS_12540 7898 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8393 8746 gene locus_tag LOCUS_12550 8393 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 9416 9111 gene locus_tag LOCUS_12560 9416 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9594 9406 gene locus_tag LOCUS_12570 9594 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9870 10289 gene locus_tag LOCUS_12580 9870 10289 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254221.1 protein_id gnl|my_center|LOCUS_12580 10258 11496 gene locus_tag LOCUS_12590 10258 11496 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566296.1 protein_id gnl|my_center|LOCUS_12590 11493 12929 gene locus_tag LOCUS_12600 11493 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390339.1 protein_id gnl|my_center|LOCUS_12600 12916 14172 gene locus_tag LOCUS_12610 12916 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 14172 14585 gene locus_tag LOCUS_12620 14172 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14582 15037 gene locus_tag LOCUS_12630 14582 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 15041 15211 gene locus_tag LOCUS_12640 15041 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence047 791 2941 gene locus_tag LOCUS_12650 gene fadB 791 2941 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA0 protein_id gnl|my_center|LOCUS_12650 2960 4120 gene locus_tag LOCUS_12660 gene fadA 2960 4120 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2H8 protein_id gnl|my_center|LOCUS_12660 4846 4184 gene locus_tag LOCUS_12670 4846 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5671 4901 gene locus_tag LOCUS_12680 5671 4901 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_12680 6256 5708 gene locus_tag LOCUS_12690 6256 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7233 6262 gene locus_tag LOCUS_12700 7233 6262 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_12700 7991 7230 gene locus_tag LOCUS_12710 7991 7230 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_12710 9039 7975 gene locus_tag LOCUS_12720 9039 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390198.1 protein_id gnl|my_center|LOCUS_12720 10893 9055 gene locus_tag LOCUS_12730 10893 9055 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 protein_id gnl|my_center|LOCUS_12730 11057 11611 gene locus_tag LOCUS_12740 gene ilvH 11057 11611 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_12740 11667 12689 gene locus_tag LOCUS_12750 gene ilvC 11667 12689 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP6 protein_id gnl|my_center|LOCUS_12750 12670 13314 gene locus_tag LOCUS_12760 gene psd 12670 13314 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7H2 protein_id gnl|my_center|LOCUS_12760 13319 14101 gene locus_tag LOCUS_12770 gene pssA 13319 14101 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_12770 14318 16000 gene locus_tag LOCUS_12780 gene leuA 14318 16000 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXK5 protein_id gnl|my_center|LOCUS_12780 >Feature sequence048 1 327 gene locus_tag LOCUS_12790 1 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 324 1577 gene locus_tag LOCUS_12800 324 1577 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_12800 1663 3150 gene locus_tag LOCUS_12810 gene dacB 1663 3150 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201777.1 protein_id gnl|my_center|LOCUS_12810 3260 4288 gene locus_tag LOCUS_12820 gene icd 3260 4288 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_12820 6036 4456 gene locus_tag LOCUS_12830 6036 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6848 6033 gene locus_tag LOCUS_12840 6848 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 7347 6943 gene locus_tag LOCUS_12850 7347 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_12850 9083 7380 gene locus_tag LOCUS_12860 gene recJ 9083 7380 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_12860 10222 9083 gene locus_tag LOCUS_12870 gene thrC 10222 9083 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_12870 11552 10251 gene locus_tag LOCUS_12880 11552 10251 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY1 protein_id gnl|my_center|LOCUS_12880 12733 11552 gene locus_tag LOCUS_12890 12733 11552 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785618.1 protein_id gnl|my_center|LOCUS_12890 13534 12800 gene locus_tag LOCUS_12900 13534 12800 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203979.1 protein_id gnl|my_center|LOCUS_12900 14160 13531 gene locus_tag LOCUS_12910 14160 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_12910 14843 14157 gene locus_tag LOCUS_12920 gene pcm 14843 14157 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_12920 15517 14822 gene locus_tag LOCUS_12930 gene surE 15517 14822 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KI21 protein_id gnl|my_center|LOCUS_12930 >Feature sequence049 1181 708 gene locus_tag LOCUS_12940 1181 708 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_12940 1745 1239 gene locus_tag LOCUS_12950 gene dsbB 1745 1239 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 protein_id gnl|my_center|LOCUS_12950 3276 1756 gene locus_tag LOCUS_12960 3276 1756 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAC6 protein_id gnl|my_center|LOCUS_12960 4720 3350 gene locus_tag LOCUS_12970 gene fumC 4720 3350 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_12970 4846 6225 gene locus_tag LOCUS_12980 gene purB 4846 6225 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K9 protein_id gnl|my_center|LOCUS_12980 6659 6222 gene locus_tag LOCUS_12990 6659 6222 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948553.1 protein_id gnl|my_center|LOCUS_12990 8171 6957 gene locus_tag LOCUS_13000 8171 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 9247 8237 gene locus_tag LOCUS_13010 gene pyrD 9247 8237 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TV1 protein_id gnl|my_center|LOCUS_13010 11253 9247 gene locus_tag LOCUS_13020 11253 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 11894 11256 gene locus_tag LOCUS_13030 gene ribA 11894 11256 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY1 protein_id gnl|my_center|LOCUS_13030 12040 12228 gene locus_tag LOCUS_13040 12040 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 12300 13385 gene locus_tag LOCUS_13050 12300 13385 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 protein_id gnl|my_center|LOCUS_13050 13398 14294 gene locus_tag LOCUS_13060 13398 14294 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_13060 14321 15082 gene locus_tag LOCUS_13070 14321 15082 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267696.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence050 858 2102 gene locus_tag LOCUS_13080 858 2102 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190545.1 protein_id gnl|my_center|LOCUS_13080 2219 3127 gene locus_tag LOCUS_13090 2219 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205721.1 protein_id gnl|my_center|LOCUS_13090 3131 4198 gene locus_tag LOCUS_13100 3131 4198 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_13100 4198 4890 gene locus_tag LOCUS_13110 gene gpmA 4198 4890 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_13110 4906 5652 gene locus_tag LOCUS_13120 4906 5652 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_13120 5680 6162 gene locus_tag LOCUS_13130 5680 6162 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 protein_id gnl|my_center|LOCUS_13130 7071 6226 gene locus_tag LOCUS_13140 7071 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_13140 7262 8224 gene locus_tag LOCUS_13150 7262 8224 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547412.1 protein_id gnl|my_center|LOCUS_13150 9083 8226 gene locus_tag LOCUS_13160 9083 8226 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_13160 9555 10367 gene locus_tag LOCUS_13170 9555 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 10367 11203 gene locus_tag LOCUS_13180 10367 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11325 12422 gene locus_tag LOCUS_13190 11325 12422 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_13190 12486 13373 gene locus_tag LOCUS_13200 12486 13373 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142502.1 protein_id gnl|my_center|LOCUS_13200 14212 13400 gene locus_tag LOCUS_13210 14212 13400 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_13210 15228 14209 gene locus_tag LOCUS_13220 gene yjgB 15228 14209 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence051 2764 3369 gene locus_tag LOCUS_13230 2764 3369 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_13230 3933 3382 gene locus_tag LOCUS_13240 3933 3382 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_13240 4025 4855 gene locus_tag LOCUS_13250 4025 4855 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907861.1 protein_id gnl|my_center|LOCUS_13250 5505 4852 gene locus_tag LOCUS_13260 5505 4852 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_13260 5605 6108 gene locus_tag LOCUS_13270 gene rppH 5605 6108 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL1 protein_id gnl|my_center|LOCUS_13270 6105 6731 gene locus_tag LOCUS_13280 6105 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6924 7175 gene locus_tag LOCUS_13290 6924 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7365 7832 gene locus_tag LOCUS_13300 gene bfr 7365 7832 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAK9 protein_id gnl|my_center|LOCUS_13300 8335 7919 gene locus_tag LOCUS_13310 8335 7919 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_13310 8404 9435 gene locus_tag LOCUS_13320 gene argC 8404 9435 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_13320 9436 10200 gene locus_tag LOCUS_13330 9436 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10204 10713 gene locus_tag LOCUS_13340 10204 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10737 11087 gene locus_tag LOCUS_13350 gene erpA 10737 11087 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBH1 protein_id gnl|my_center|LOCUS_13350 12202 11084 gene locus_tag LOCUS_13360 gene anmK 12202 11084 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMW8 protein_id gnl|my_center|LOCUS_13360 13596 12208 gene locus_tag LOCUS_13370 13596 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_13370 13823 15046 gene locus_tag LOCUS_13380 gene tyrS 13823 15046 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_13380 >Feature sequence052 2022 808 gene locus_tag LOCUS_13390 2022 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4103 2046 gene locus_tag LOCUS_13400 4103 2046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_13400 7671 4222 gene locus_tag LOCUS_13410 7671 4222 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4N7 protein_id gnl|my_center|LOCUS_13410 8442 7750 gene locus_tag LOCUS_13420 gene queC 8442 7750 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK2 protein_id gnl|my_center|LOCUS_13420 9159 8452 gene locus_tag LOCUS_13430 gene queE 9159 8452 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_13430 10013 9162 gene locus_tag LOCUS_13440 10013 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10561 10013 gene locus_tag LOCUS_13450 10561 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859700.1 protein_id gnl|my_center|LOCUS_13450 11940 10606 gene locus_tag LOCUS_13460 gene tolB 11940 10606 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_13460 12926 11937 gene locus_tag LOCUS_13470 12926 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 13369 12926 gene locus_tag LOCUS_13480 gene tolR 13369 12926 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_13480 14049 13369 gene locus_tag LOCUS_13490 gene tolQ 14049 13369 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_13490 14483 14046 gene locus_tag LOCUS_13500 14483 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 <15507 14496 gene locus_tag LOCUS_13510 <15507 14496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWL1:Holliday junction ATP-dependent DNA helicase RuvB >Feature sequence053 159 602 gene locus_tag LOCUS_13520 159 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 699 1433 gene locus_tag LOCUS_13530 699 1433 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_13530 1452 1838 gene locus_tag LOCUS_13540 gene hslR 1452 1838 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_13540 1915 3249 gene locus_tag LOCUS_13550 1915 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4019 3288 gene locus_tag LOCUS_13560 4019 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4678 4019 gene locus_tag LOCUS_13570 gene purN 4678 4019 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJJ9 protein_id gnl|my_center|LOCUS_13570 5709 4675 gene locus_tag LOCUS_13580 gene purM 5709 4675 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH0 protein_id gnl|my_center|LOCUS_13580 5825 6892 gene locus_tag LOCUS_13590 gene perM 5825 6892 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_13590 6885 7571 gene locus_tag LOCUS_13600 6885 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707509.1 protein_id gnl|my_center|LOCUS_13600 7945 7568 gene locus_tag LOCUS_13610 7945 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 8609 8010 gene locus_tag LOCUS_13620 gene wrbA 8609 8010 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_13620 9340 8624 gene locus_tag LOCUS_13630 9340 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 11851 9509 gene locus_tag LOCUS_13640 gene acyII 11851 9509 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036584.1 protein_id gnl|my_center|LOCUS_13640 12540 11959 gene locus_tag LOCUS_13650 12540 11959 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_13650 14209 12506 gene locus_tag LOCUS_13660 gene proS 14209 12506 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_13660 14737 14273 gene locus_tag LOCUS_13670 14737 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_13670 <15489 14734 gene locus_tag LOCUS_13680 <15489 14734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q888C0:release factor glutamine methyltransferase >Feature sequence054 <1 1258 gene locus_tag LOCUS_13690 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVZ9:UDP-N-acetylmuramoylalanine--D-glutamate ligase 1255 2451 gene locus_tag LOCUS_13700 gene ftsW 1255 2451 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_13700 2448 3503 gene locus_tag LOCUS_13710 gene murG 2448 3503 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_13710 3500 4942 gene locus_tag LOCUS_13720 gene murC 3500 4942 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ8 protein_id gnl|my_center|LOCUS_13720 4939 5895 gene locus_tag LOCUS_13730 gene murB 4939 5895 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F16 protein_id gnl|my_center|LOCUS_13730 5892 6830 gene locus_tag LOCUS_13740 gene ddlB 5892 6830 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ8 protein_id gnl|my_center|LOCUS_13740 6830 7549 gene locus_tag LOCUS_13750 6830 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7549 8787 gene locus_tag LOCUS_13760 gene ftsA 7549 8787 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F13 protein_id gnl|my_center|LOCUS_13760 8829 10028 gene locus_tag LOCUS_13770 gene ftsZ 8829 10028 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SG0 protein_id gnl|my_center|LOCUS_13770 10195 11112 gene locus_tag LOCUS_13780 gene lpxC 10195 11112 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ5 protein_id gnl|my_center|LOCUS_13780 11611 11255 gene locus_tag LOCUS_13790 11611 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 11610 12539 gene locus_tag LOCUS_13800 11610 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence055 3124 2234 gene locus_tag LOCUS_13810 gene ttcA 3124 2234 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H2 protein_id gnl|my_center|LOCUS_13810 3251 4018 gene locus_tag LOCUS_13820 3251 4018 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 protein_id gnl|my_center|LOCUS_13820 4023 4964 gene locus_tag LOCUS_13830 4023 4964 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_13830 6865 4940 gene locus_tag LOCUS_13840 6865 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_13840 7422 6943 gene locus_tag LOCUS_13850 7422 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_13850 7651 8775 gene locus_tag LOCUS_13860 7651 8775 CDS product putative NAD(P) transhydrogenase, alpha1 subunit PntAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705302.1 protein_id gnl|my_center|LOCUS_13860 8778 9080 gene locus_tag LOCUS_13870 gene pntAB 8778 9080 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770065.1 protein_id gnl|my_center|LOCUS_13870 9090 10505 gene locus_tag LOCUS_13880 9090 10505 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 protein_id gnl|my_center|LOCUS_13880 11149 10655 gene locus_tag LOCUS_13890 11149 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 11302 12087 gene locus_tag LOCUS_13900 11302 12087 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_13900 12193 12582 gene locus_tag LOCUS_13910 12193 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 12785 13234 gene locus_tag LOCUS_13920 12785 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 13414 13785 gene locus_tag LOCUS_13930 13414 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 13898 14680 gene locus_tag LOCUS_13940 13898 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence056 1650 1441 gene locus_tag LOCUS_13950 1650 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2407 1772 gene locus_tag LOCUS_13960 2407 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3504 2434 gene locus_tag LOCUS_13970 gene mopB 3504 2434 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_13970 3786 4706 gene locus_tag LOCUS_13980 3786 4706 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_13980 4756 5514 gene locus_tag LOCUS_13990 gene truC 4756 5514 CDS product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 protein_id gnl|my_center|LOCUS_13990 5593 6834 gene locus_tag LOCUS_14000 5593 6834 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684307.1 protein_id gnl|my_center|LOCUS_14000 6831 7649 gene locus_tag LOCUS_14010 6831 7649 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688306.1 protein_id gnl|my_center|LOCUS_14010 8658 7690 gene locus_tag LOCUS_14020 8658 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702108.1 protein_id gnl|my_center|LOCUS_14020 8843 9376 gene locus_tag LOCUS_14030 8843 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 10802 9426 gene locus_tag LOCUS_14040 10802 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_14040 11333 11932 gene locus_tag LOCUS_14050 11333 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 12338 12000 gene locus_tag LOCUS_14060 12338 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12235 12675 gene locus_tag LOCUS_14070 12235 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence057 723 2282 gene locus_tag LOCUS_14080 gene ilvA1 723 2282 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_14080 3102 2320 gene locus_tag LOCUS_14090 3102 2320 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_14090 3085 3336 gene locus_tag LOCUS_14100 3085 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3343 3939 gene locus_tag LOCUS_14110 gene petA 3343 3939 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD50 protein_id gnl|my_center|LOCUS_14110 3939 5180 gene locus_tag LOCUS_14120 3939 5180 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_14120 5190 5939 gene locus_tag LOCUS_14130 5190 5939 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_14130 5941 6606 gene locus_tag LOCUS_14140 gene sspA 5941 6606 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210135.1 protein_id gnl|my_center|LOCUS_14140 6617 7024 gene locus_tag LOCUS_14150 gene sspB 6617 7024 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_14150 8419 7034 gene locus_tag LOCUS_14160 gene dld 8419 7034 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_14160 8781 8416 gene locus_tag LOCUS_14170 8781 8416 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FK61 protein_id gnl|my_center|LOCUS_14170 10543 8771 gene locus_tag LOCUS_14180 10543 8771 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_14180 10442 10690 gene locus_tag LOCUS_14190 10442 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 10683 11603 gene locus_tag LOCUS_14200 gene rsmI 10683 11603 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPW7 protein_id gnl|my_center|LOCUS_14200 12162 13754 gene locus_tag LOCUS_14210 12162 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13769 14128 gene locus_tag LOCUS_14220 13769 14128 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_14220 14137 14736 gene locus_tag LOCUS_14230 14137 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence058 1069 119 gene locus_tag LOCUS_14240 1069 119 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 protein_id gnl|my_center|LOCUS_14240 1171 2106 gene locus_tag LOCUS_14250 1171 2106 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535091.1 protein_id gnl|my_center|LOCUS_14250 2190 3959 gene locus_tag LOCUS_14260 2190 3959 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389742.1 protein_id gnl|my_center|LOCUS_14260 4012 5754 gene locus_tag LOCUS_14270 4012 5754 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111433.1 protein_id gnl|my_center|LOCUS_14270 5766 6938 gene locus_tag LOCUS_14280 5766 6938 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402538.1 protein_id gnl|my_center|LOCUS_14280 6954 8693 gene locus_tag LOCUS_14290 6954 8693 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705450.1 protein_id gnl|my_center|LOCUS_14290 8702 12340 gene locus_tag LOCUS_14300 8702 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 12717 12394 gene locus_tag LOCUS_14310 12717 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 14088 12763 gene locus_tag LOCUS_14320 14088 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence059 972 1955 gene locus_tag LOCUS_14330 gene cysB 972 1955 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_14330 2820 1975 gene locus_tag LOCUS_14340 gene fghA 2820 1975 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WS1 protein_id gnl|my_center|LOCUS_14340 3953 2820 gene locus_tag LOCUS_14350 gene adhI 3953 2820 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT06 protein_id gnl|my_center|LOCUS_14350 4026 4916 gene locus_tag LOCUS_14360 4026 4916 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_14360 5824 4913 gene locus_tag LOCUS_14370 5824 4913 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_14370 6883 5993 gene locus_tag LOCUS_14380 6883 5993 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_14380 7223 7678 gene locus_tag LOCUS_14390 7223 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 8641 7715 gene locus_tag LOCUS_14400 gene czcD.1 8641 7715 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_14400 8940 8638 gene locus_tag LOCUS_14410 8940 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9030 9842 gene locus_tag LOCUS_14420 9030 9842 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 protein_id gnl|my_center|LOCUS_14420 13052 9846 gene locus_tag LOCUS_14430 gene czcA 13052 9846 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_14430 14220 13045 gene locus_tag LOCUS_14440 gene acrA 14220 13045 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 protein_id gnl|my_center|LOCUS_14440 <14828 14217 gene locus_tag LOCUS_14450 <14828 14217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783789.1:multidrug transporter >Feature sequence060 <1 879 gene locus_tag LOCUS_14460 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83E13:DNA gyrase subunit A 1408 881 gene locus_tag LOCUS_14470 1408 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2118 1453 gene locus_tag LOCUS_14480 gene rpiA 2118 1453 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5S1 protein_id gnl|my_center|LOCUS_14480 2858 2160 gene locus_tag LOCUS_14490 2858 2160 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_14490 2916 3959 gene locus_tag LOCUS_14500 gene pilT 2916 3959 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_14500 3968 5128 gene locus_tag LOCUS_14510 gene pilU 3968 5128 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_14510 5125 6219 gene locus_tag LOCUS_14520 gene uptC 5125 6219 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_14520 6611 6237 gene locus_tag LOCUS_14530 6611 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6852 7544 gene locus_tag LOCUS_14540 6852 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 10933 7586 gene locus_tag LOCUS_14550 10933 7586 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_14550 13635 10930 gene locus_tag LOCUS_14560 13635 10930 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence061 166 1170 gene locus_tag LOCUS_14570 166 1170 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_14570 1855 1208 gene locus_tag LOCUS_14580 1855 1208 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_14580 3371 1848 gene locus_tag LOCUS_14590 3371 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3489 4424 gene locus_tag LOCUS_14600 3489 4424 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_14600 4487 5377 gene locus_tag LOCUS_14610 4487 5377 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_14610 5697 6629 gene locus_tag LOCUS_14620 5697 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_14620 6876 7382 gene locus_tag LOCUS_14630 6876 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7379 7762 gene locus_tag LOCUS_14640 7379 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8013 7937 gene locus_tag LOCUS_t00220 8013 7937 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8191 9024 gene locus_tag LOCUS_14650 8191 9024 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141901.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence062 41 1141 gene locus_tag LOCUS_14660 41 1141 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730968.1 protein_id gnl|my_center|LOCUS_14660 1138 1929 gene locus_tag LOCUS_14670 gene echA20 1138 1929 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419315.1 protein_id gnl|my_center|LOCUS_14670 1926 3092 gene locus_tag LOCUS_14680 1926 3092 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_14680 3104 4207 gene locus_tag LOCUS_14690 gene acd 3104 4207 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_14690 4222 5373 gene locus_tag LOCUS_14700 gene atoB 4222 5373 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_14700 5445 6323 gene locus_tag LOCUS_14710 5445 6323 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 protein_id gnl|my_center|LOCUS_14710 6451 7554 gene locus_tag LOCUS_14720 gene acd 6451 7554 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_14720 7554 8747 gene locus_tag LOCUS_14730 7554 8747 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_14730 8794 9579 gene locus_tag LOCUS_14740 gene fabG 8794 9579 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_14740 9592 10050 gene locus_tag LOCUS_14750 9592 10050 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225720.1 protein_id gnl|my_center|LOCUS_14750 10059 11270 gene locus_tag LOCUS_14760 10059 11270 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_14760 11355 12392 gene locus_tag LOCUS_14770 11355 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence063 166 648 gene locus_tag LOCUS_14780 gene dfrA 166 648 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UPJ9 protein_id gnl|my_center|LOCUS_14780 645 1928 gene locus_tag LOCUS_14790 645 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1978 2238 gene locus_tag LOCUS_14800 1978 2238 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_14800 3050 2271 gene locus_tag LOCUS_14810 3050 2271 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815026.1 protein_id gnl|my_center|LOCUS_14810 4895 3090 gene locus_tag LOCUS_14820 gene kefB 4895 3090 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918093.1 protein_id gnl|my_center|LOCUS_14820 6667 5003 gene locus_tag LOCUS_14830 6667 5003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046772.1 protein_id gnl|my_center|LOCUS_14830 7320 6775 gene locus_tag LOCUS_14840 7320 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 8421 7711 gene locus_tag LOCUS_14850 8421 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_14850 8733 8494 gene locus_tag LOCUS_14860 8733 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 9437 8733 gene locus_tag LOCUS_14870 9437 8733 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_14870 9904 9449 gene locus_tag LOCUS_14880 9904 9449 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_14880 10687 9917 gene locus_tag LOCUS_14890 10687 9917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369500.1 protein_id gnl|my_center|LOCUS_14890 11508 10684 gene locus_tag LOCUS_14900 11508 10684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083183.1 protein_id gnl|my_center|LOCUS_14900 12186 11533 gene locus_tag LOCUS_14910 gene lipB 12186 11533 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_14910 12476 12183 gene locus_tag LOCUS_14920 12476 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 13608 12469 gene locus_tag LOCUS_14930 gene dacC 13608 12469 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_14930 13921 13694 gene locus_tag LOCUS_14940 13921 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence064 325 624 gene locus_tag LOCUS_14950 gene rplW 325 624 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS44 protein_id gnl|my_center|LOCUS_14950 636 1472 gene locus_tag LOCUS_14960 gene rplB 636 1472 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_14960 1485 1757 gene locus_tag LOCUS_14970 gene rpsS 1485 1757 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF25 protein_id gnl|my_center|LOCUS_14970 1760 2092 gene locus_tag LOCUS_14980 gene rplV 1760 2092 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY9 protein_id gnl|my_center|LOCUS_14980 2111 2788 gene locus_tag LOCUS_14990 gene rpsC 2111 2788 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_14990 2806 3216 gene locus_tag LOCUS_15000 gene rplP 2806 3216 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W4 protein_id gnl|my_center|LOCUS_15000 3216 3416 gene locus_tag LOCUS_15010 gene rpmC 3216 3416 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 protein_id gnl|my_center|LOCUS_15010 3431 3721 gene locus_tag LOCUS_15020 gene rpsQ 3431 3721 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_15020 3732 4097 gene locus_tag LOCUS_15030 gene rplN 3732 4097 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 protein_id gnl|my_center|LOCUS_15030 4118 4444 gene locus_tag LOCUS_15040 gene rplX 4118 4444 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV7 protein_id gnl|my_center|LOCUS_15040 4437 5000 gene locus_tag LOCUS_15050 gene rplE 4437 5000 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK57 protein_id gnl|my_center|LOCUS_15050 5012 5317 gene locus_tag LOCUS_15060 gene rpsN 5012 5317 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU4 protein_id gnl|my_center|LOCUS_15060 5329 5724 gene locus_tag LOCUS_15070 gene rpsH 5329 5724 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTB7 protein_id gnl|my_center|LOCUS_15070 5761 6291 gene locus_tag LOCUS_15080 gene rplF 5761 6291 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ17 protein_id gnl|my_center|LOCUS_15080 6311 6670 gene locus_tag LOCUS_15090 gene rplR 6311 6670 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_15090 6674 7210 gene locus_tag LOCUS_15100 gene rpsE 6674 7210 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ95 protein_id gnl|my_center|LOCUS_15100 7203 7391 gene locus_tag LOCUS_15110 gene rpmD 7203 7391 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS9 protein_id gnl|my_center|LOCUS_15110 7434 7880 gene locus_tag LOCUS_15120 gene rplO 7434 7880 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q30 protein_id gnl|my_center|LOCUS_15120 7989 9275 gene locus_tag LOCUS_15130 gene secY 7989 9275 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK50 protein_id gnl|my_center|LOCUS_15130 9583 9948 gene locus_tag LOCUS_15140 gene rpsM 9583 9948 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5U9 protein_id gnl|my_center|LOCUS_15140 9970 10365 gene locus_tag LOCUS_15150 gene rpsK 9970 10365 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF43 protein_id gnl|my_center|LOCUS_15150 10380 11003 gene locus_tag LOCUS_15160 gene rpsD 10380 11003 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5V1 protein_id gnl|my_center|LOCUS_15160 11079 12056 gene locus_tag LOCUS_15170 gene rpoA 11079 12056 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_15170 12091 12507 gene locus_tag LOCUS_15180 gene rplQ 12091 12507 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKL3 protein_id gnl|my_center|LOCUS_15180 12618 13661 gene locus_tag LOCUS_15190 gene holA 12618 13661 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence065 <1 1098 gene locus_tag LOCUS_15200 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B7K8:isocitrate dehydrogenase [NADP] 1088 1903 gene locus_tag LOCUS_15210 1088 1903 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_15210 2840 1926 gene locus_tag LOCUS_15220 2840 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_15220 5323 2945 gene locus_tag LOCUS_15230 gene ppsA 5323 2945 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0I2 protein_id gnl|my_center|LOCUS_15230 5404 6225 gene locus_tag LOCUS_15240 5404 6225 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVB2 protein_id gnl|my_center|LOCUS_15240 6388 8175 gene locus_tag LOCUS_15250 6388 8175 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462598.1 protein_id gnl|my_center|LOCUS_15250 8332 8610 gene locus_tag LOCUS_15260 8332 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 10248 8632 gene locus_tag LOCUS_15270 10248 8632 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057811.1 protein_id gnl|my_center|LOCUS_15270 10296 10739 gene locus_tag LOCUS_15280 10296 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 11115 12770 gene locus_tag LOCUS_15290 11115 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 12796 13152 gene locus_tag LOCUS_15300 12796 13152 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJQ6 protein_id gnl|my_center|LOCUS_15300 >Feature sequence066 1747 1049 gene locus_tag LOCUS_15310 gene lolA 1747 1049 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57068 protein_id gnl|my_center|LOCUS_15310 4259 1836 gene locus_tag LOCUS_15320 gene ftsK 4259 1836 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 protein_id gnl|my_center|LOCUS_15320 4445 4813 gene locus_tag LOCUS_15330 4445 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4856 6016 gene locus_tag LOCUS_15340 4856 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_15340 6026 6772 gene locus_tag LOCUS_15350 gene aat 6026 6772 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P996 protein_id gnl|my_center|LOCUS_15350 6766 7482 gene locus_tag LOCUS_15360 gene ate 6766 7482 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH8 protein_id gnl|my_center|LOCUS_15360 7552 7746 gene locus_tag LOCUS_15370 gene infA 7552 7746 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_15370 7981 9657 gene locus_tag LOCUS_15380 7981 9657 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918343.1 protein_id gnl|my_center|LOCUS_15380 11994 9724 gene locus_tag LOCUS_15390 gene clpA 11994 9724 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_15390 12308 11994 gene locus_tag LOCUS_15400 gene clpS 12308 11994 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 protein_id gnl|my_center|LOCUS_15400 13525 12359 gene locus_tag LOCUS_15410 gene gcdH 13525 12359 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038935.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence067 3 2015 gene locus_tag LOCUS_15420 3 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2272 3390 gene locus_tag LOCUS_15430 gene flhB 2272 3390 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_15430 3387 5465 gene locus_tag LOCUS_15440 gene flhA 3387 5465 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037075.1 protein_id gnl|my_center|LOCUS_15440 5485 6735 gene locus_tag LOCUS_15450 5485 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6728 7591 gene locus_tag LOCUS_15460 gene fleN 6728 7591 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037073.1 protein_id gnl|my_center|LOCUS_15460 7588 8310 gene locus_tag LOCUS_15470 gene fliA 7588 8310 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9F9 protein_id gnl|my_center|LOCUS_15470 8333 8725 gene locus_tag LOCUS_15480 gene cheY 8333 8725 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51455 protein_id gnl|my_center|LOCUS_15480 8728 9333 gene locus_tag LOCUS_15490 8728 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 9344 11101 gene locus_tag LOCUS_15500 9344 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 11101 11841 gene locus_tag LOCUS_15510 gene motC 11101 11841 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_15510 11854 12687 gene locus_tag LOCUS_15520 gene motB 11854 12687 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_15520 12684 13445 gene locus_tag LOCUS_15530 12684 13445 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637668.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence068 189 878 gene locus_tag LOCUS_15540 189 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_15540 1236 847 gene locus_tag LOCUS_15550 1236 847 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105334.1 protein_id gnl|my_center|LOCUS_15550 2615 1236 gene locus_tag LOCUS_15560 gene hslU 2615 1236 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENP8 protein_id gnl|my_center|LOCUS_15560 3174 2623 gene locus_tag LOCUS_15570 gene hslV 3174 2623 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_15570 4152 3232 gene locus_tag LOCUS_15580 gene xerC 4152 3232 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B4 protein_id gnl|my_center|LOCUS_15580 4863 4156 gene locus_tag LOCUS_15590 4863 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064713.1 protein_id gnl|my_center|LOCUS_15590 5717 4848 gene locus_tag LOCUS_15600 gene dapF 5717 4848 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V327 protein_id gnl|my_center|LOCUS_15600 6628 5714 gene locus_tag LOCUS_15610 gene dhmA1 6628 5714 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_15610 6726 7763 gene locus_tag LOCUS_15620 6726 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 protein_id gnl|my_center|LOCUS_15620 9130 7760 gene locus_tag LOCUS_15630 9130 7760 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKA7 protein_id gnl|my_center|LOCUS_15630 9278 10729 gene locus_tag LOCUS_15640 gene putA 9278 10729 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_15640 10782 13028 gene locus_tag LOCUS_15650 10782 13028 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123688.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence069 1216 443 gene locus_tag LOCUS_15660 1216 443 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_15660 1686 2480 gene locus_tag LOCUS_15670 gene thiD 1686 2480 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_15670 2477 3136 gene locus_tag LOCUS_15680 gene thiE 2477 3136 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R7 protein_id gnl|my_center|LOCUS_15680 3133 4410 gene locus_tag LOCUS_15690 gene hemL 3133 4410 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB0 protein_id gnl|my_center|LOCUS_15690 4432 6423 gene locus_tag LOCUS_15700 4432 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6420 7364 gene locus_tag LOCUS_15710 gene ftsY 6420 7364 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AI3 protein_id gnl|my_center|LOCUS_15710 7372 8064 gene locus_tag LOCUS_15720 gene ftsE 7372 8064 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948369.1 protein_id gnl|my_center|LOCUS_15720 8061 9008 gene locus_tag LOCUS_15730 8061 9008 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF80 protein_id gnl|my_center|LOCUS_15730 9096 9971 gene locus_tag LOCUS_15740 gene rpoH 9096 9971 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGB3 protein_id gnl|my_center|LOCUS_15740 10180 11847 gene locus_tag LOCUS_15750 10180 11847 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_15750 11844 12809 gene locus_tag LOCUS_15760 11844 12809 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_15760 13267 12827 gene locus_tag LOCUS_15770 13267 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence070 322 1464 gene locus_tag LOCUS_15780 322 1464 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_15780 2582 1515 gene locus_tag LOCUS_15790 gene queG 2582 1515 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E0 protein_id gnl|my_center|LOCUS_15790 2597 4138 gene locus_tag LOCUS_15800 gene nnr 2597 4138 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_15800 4135 4635 gene locus_tag LOCUS_15810 4135 4635 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_15810 4892 4632 gene locus_tag LOCUS_15820 4892 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4776 6113 gene locus_tag LOCUS_15830 gene amiB 4776 6113 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_15830 6196 7992 gene locus_tag LOCUS_15840 gene oppA 6196 7992 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_15840 8008 8961 gene locus_tag LOCUS_15850 gene gsiC 8008 8961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_15850 8958 9839 gene locus_tag LOCUS_15860 8958 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9836 10810 gene locus_tag LOCUS_15870 9836 10810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_15870 10807 11787 gene locus_tag LOCUS_15880 10807 11787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence071 <1 1105 gene locus_tag LOCUS_15890 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704328.1:oligopeptidase B 1438 1154 gene locus_tag LOCUS_15900 1438 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_15900 3072 1546 gene locus_tag LOCUS_15910 gene mymA 3072 1546 CDS product putative FAD-containing monooxygenase MymA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNF7 protein_id gnl|my_center|LOCUS_15910 4313 3330 gene locus_tag LOCUS_15920 4313 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5215 4310 gene locus_tag LOCUS_15930 gene lpxO1 5215 4310 CDS product LPS biosynthetic protein LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 protein_id gnl|my_center|LOCUS_15930 5932 5366 gene locus_tag LOCUS_15940 5932 5366 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L3 protein_id gnl|my_center|LOCUS_15940 8261 5955 gene locus_tag LOCUS_15950 8261 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 8565 8212 gene locus_tag LOCUS_15960 8565 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10125 8716 gene locus_tag LOCUS_15970 10125 8716 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_15970 10805 10200 gene locus_tag LOCUS_15980 10805 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 <13033 10883 gene locus_tag LOCUS_15990 <13033 10883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUA6:glucans biosynthesis glucosyltransferase H >Feature sequence072 527 3952 gene locus_tag LOCUS_16000 527 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3959 8038 gene locus_tag LOCUS_16010 3959 8038 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258114.1 protein_id gnl|my_center|LOCUS_16010 10328 8154 gene locus_tag LOCUS_16020 10328 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 10632 10396 gene locus_tag LOCUS_16030 10632 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 11592 10642 gene locus_tag LOCUS_16040 11592 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 11891 11556 gene locus_tag LOCUS_16050 11891 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12190 12498 gene locus_tag LOCUS_16060 12190 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence073 47 1123 gene locus_tag LOCUS_16070 gene gcvT 47 1123 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_16070 1198 1578 gene locus_tag LOCUS_16080 gene gcvH 1198 1578 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJE8 protein_id gnl|my_center|LOCUS_16080 1643 3016 gene locus_tag LOCUS_16090 gene gcvPA 1643 3016 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B08 protein_id gnl|my_center|LOCUS_16090 3058 4533 gene locus_tag LOCUS_16100 gene gcvPB 3058 4533 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B09 protein_id gnl|my_center|LOCUS_16100 4869 5801 gene locus_tag LOCUS_16110 4869 5801 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_16110 5910 6713 gene locus_tag LOCUS_16120 gene lgt 5910 6713 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_16120 6840 7508 gene locus_tag LOCUS_16130 6840 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7569 8459 gene locus_tag LOCUS_16140 7569 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 10835 8490 gene locus_tag LOCUS_16150 10835 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 11538 10837 gene locus_tag LOCUS_16160 11538 10837 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339357.1 protein_id gnl|my_center|LOCUS_16160 12960 11590 gene locus_tag LOCUS_16170 12960 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence074 635 399 gene locus_tag LOCUS_16180 635 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 546 1028 gene locus_tag LOCUS_16190 546 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112524.1 protein_id gnl|my_center|LOCUS_16190 2538 1036 gene locus_tag LOCUS_16200 gene putA 2538 1036 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_16200 3404 2538 gene locus_tag LOCUS_16210 3404 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4859 3477 gene locus_tag LOCUS_16220 4859 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_16220 5465 4989 gene locus_tag LOCUS_16230 5465 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5658 5494 gene locus_tag LOCUS_16240 5658 5494 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868015.1 protein_id gnl|my_center|LOCUS_16240 6940 5660 gene locus_tag LOCUS_16250 6940 5660 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_16250 7718 6930 gene locus_tag LOCUS_16260 7718 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 8145 7822 gene locus_tag LOCUS_16270 gene fdx 8145 7822 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_16270 9229 8216 gene locus_tag LOCUS_16280 9229 8216 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_16280 10753 9335 gene locus_tag LOCUS_16290 10753 9335 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_16290 11874 10747 gene locus_tag LOCUS_16300 11874 10747 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228966.1 protein_id gnl|my_center|LOCUS_16300 11782 12108 gene locus_tag LOCUS_16310 11782 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12560 12105 gene locus_tag LOCUS_16320 12560 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence075 817 281 gene locus_tag LOCUS_16330 gene prtI 817 281 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971658.1 protein_id gnl|my_center|LOCUS_16330 959 1348 gene locus_tag LOCUS_16340 959 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2648 1389 gene locus_tag LOCUS_16350 2648 1389 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_16350 4148 2715 gene locus_tag LOCUS_16360 4148 2715 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_16360 4867 4148 gene locus_tag LOCUS_16370 gene rpe 4867 4148 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK14 protein_id gnl|my_center|LOCUS_16370 4934 5836 gene locus_tag LOCUS_16380 gene purC 4934 5836 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIW9 protein_id gnl|my_center|LOCUS_16380 5927 6241 gene locus_tag LOCUS_16390 5927 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6846 6352 gene locus_tag LOCUS_16400 6846 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 6992 8329 gene locus_tag LOCUS_16410 6992 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8397 10058 gene locus_tag LOCUS_16420 gene fadD 8397 10058 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039376.1 protein_id gnl|my_center|LOCUS_16420 10174 10569 gene locus_tag LOCUS_16430 10174 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 10878 10588 gene locus_tag LOCUS_16440 10878 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 11738 10887 gene locus_tag LOCUS_16450 gene minD 11738 10887 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 protein_id gnl|my_center|LOCUS_16450 11918 12553 gene locus_tag LOCUS_16460 11918 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 12886 12572 gene locus_tag LOCUS_16470 12886 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence076 262 1755 gene locus_tag LOCUS_16480 262 1755 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638408.2 protein_id gnl|my_center|LOCUS_16480 1743 2267 gene locus_tag LOCUS_16490 gene cobP 1743 2267 CDS product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 protein_id gnl|my_center|LOCUS_16490 2282 3343 gene locus_tag LOCUS_16500 gene cobT 2282 3343 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 protein_id gnl|my_center|LOCUS_16500 3333 4115 gene locus_tag LOCUS_16510 gene cobS 3333 4115 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ68 protein_id gnl|my_center|LOCUS_16510 4459 4130 gene locus_tag LOCUS_16520 4459 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7392 4582 gene locus_tag LOCUS_16530 7392 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8294 7500 gene locus_tag LOCUS_16540 8294 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_16540 9317 8310 gene locus_tag LOCUS_16550 9317 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 9474 10145 gene locus_tag LOCUS_16560 gene desT 9474 10145 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107570.1 protein_id gnl|my_center|LOCUS_16560 11326 10205 gene locus_tag LOCUS_16570 11326 10205 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086647.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence077 1905 2333 gene locus_tag LOCUS_16580 1905 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2432 2923 gene locus_tag LOCUS_16590 2432 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105926.1 protein_id gnl|my_center|LOCUS_16590 3733 2945 gene locus_tag LOCUS_16600 3733 2945 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_16600 4038 3739 gene locus_tag LOCUS_16610 4038 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3928 4797 gene locus_tag LOCUS_16620 gene gluQ 3928 4797 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAI1 protein_id gnl|my_center|LOCUS_16620 4875 5384 gene locus_tag LOCUS_16630 4875 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 protein_id gnl|my_center|LOCUS_16630 6158 5391 gene locus_tag LOCUS_16640 gene kdsB 6158 5391 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MHU6 protein_id gnl|my_center|LOCUS_16640 6353 6162 gene locus_tag LOCUS_16650 6353 6162 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDM0 protein_id gnl|my_center|LOCUS_16650 7405 6377 gene locus_tag LOCUS_16660 gene lpxK 7405 6377 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 protein_id gnl|my_center|LOCUS_16660 9183 7402 gene locus_tag LOCUS_16670 gene msbA 9183 7402 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGA9 protein_id gnl|my_center|LOCUS_16670 9301 9657 gene locus_tag LOCUS_16680 9301 9657 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_16680 9773 11440 gene locus_tag LOCUS_16690 9773 11440 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_16690 11467 12180 gene locus_tag LOCUS_16700 gene smuG1 11467 12180 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_16700 12726 12226 gene locus_tag LOCUS_16710 12726 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence078 4967 1644 gene locus_tag LOCUS_16720 4967 1644 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338623.1 protein_id gnl|my_center|LOCUS_16720 5139 7364 gene locus_tag LOCUS_16730 5139 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 7389 7988 gene locus_tag LOCUS_16740 7389 7988 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_16740 10466 7995 gene locus_tag LOCUS_16750 10466 7995 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence079 42 650 gene locus_tag LOCUS_16760 42 650 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_16760 2809 752 gene locus_tag LOCUS_16770 2809 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4066 2942 gene locus_tag LOCUS_16780 gene mcp 4066 2942 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_16780 5163 4075 gene locus_tag LOCUS_16790 gene cheB1 5163 4075 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_16790 5753 5160 gene locus_tag LOCUS_16800 gene cheD 5753 5160 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J6 protein_id gnl|my_center|LOCUS_16800 6589 5750 gene locus_tag LOCUS_16810 gene cheR 6589 5750 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J5 protein_id gnl|my_center|LOCUS_16810 8873 6789 gene locus_tag LOCUS_16820 8873 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9404 8895 gene locus_tag LOCUS_16830 gene cheW 9404 8895 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_16830 11421 9427 gene locus_tag LOCUS_16840 gene cheA 11421 9427 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_16840 11796 11434 gene locus_tag LOCUS_16850 gene cheY 11796 11434 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_16850 12117 11800 gene locus_tag LOCUS_16860 12117 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence080 180 1250 gene locus_tag LOCUS_16870 180 1250 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_16870 1243 1716 gene locus_tag LOCUS_16880 1243 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1737 3146 gene locus_tag LOCUS_16890 gene mucD 1737 3146 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_16890 3143 3388 gene locus_tag LOCUS_16900 3143 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3465 5264 gene locus_tag LOCUS_16910 gene lepA 3465 5264 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E312 protein_id gnl|my_center|LOCUS_16910 5271 6062 gene locus_tag LOCUS_16920 gene lepB-1 5271 6062 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_16920 6073 6447 gene locus_tag LOCUS_16930 6073 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 6444 7112 gene locus_tag LOCUS_16940 gene rnc 6444 7112 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN9 protein_id gnl|my_center|LOCUS_16940 7105 7986 gene locus_tag LOCUS_16950 gene era 7105 7986 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 protein_id gnl|my_center|LOCUS_16950 7993 8730 gene locus_tag LOCUS_16960 gene recO 7993 8730 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LS7 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 8727 9482 gene locus_tag LOCUS_16970 gene pdxJ 8727 9482 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_16970 9494 9886 gene locus_tag LOCUS_16980 gene acpS 9494 9886 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LR5 protein_id gnl|my_center|LOCUS_16980 10401 9883 gene locus_tag LOCUS_16990 10401 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10552 11193 gene locus_tag LOCUS_17000 gene msrA 10552 11193 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN0 protein_id gnl|my_center|LOCUS_17000 11405 11330 gene locus_tag LOCUS_t00230 11405 11330 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 669 1589 gene locus_tag LOCUS_17010 gene lpxL 669 1589 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_17010 1673 2698 gene locus_tag LOCUS_17020 1673 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2962 4185 gene locus_tag LOCUS_17030 2962 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5152 4163 gene locus_tag LOCUS_17040 5152 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5797 5159 gene locus_tag LOCUS_17050 gene dsbA 5797 5159 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_17050 6467 5844 gene locus_tag LOCUS_17060 gene cycA 6467 5844 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260948.1 protein_id gnl|my_center|LOCUS_17060 6555 7166 gene locus_tag LOCUS_17070 gene engB 6555 7166 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT81 protein_id gnl|my_center|LOCUS_17070 10228 7520 gene locus_tag LOCUS_17080 gene polA 10228 7520 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_17080 11498 10221 gene locus_tag LOCUS_17090 gene lysA 11498 10221 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_17090 11706 11488 gene locus_tag LOCUS_17100 11706 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 11796 12476 gene locus_tag LOCUS_17110 11796 12476 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence082 379 2607 gene locus_tag LOCUS_17120 379 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2604 3638 gene locus_tag LOCUS_17130 gene rsxD 2604 3638 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NB84 protein_id gnl|my_center|LOCUS_17130 3635 4330 gene locus_tag LOCUS_17140 3635 4330 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT90 protein_id gnl|my_center|LOCUS_17140 4327 5013 gene locus_tag LOCUS_17150 4327 5013 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_17150 5010 5663 gene locus_tag LOCUS_17160 gene nth 5010 5663 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VZ2 protein_id gnl|my_center|LOCUS_17160 7429 5660 gene locus_tag LOCUS_17170 7429 5660 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930488.1 protein_id gnl|my_center|LOCUS_17170 8207 7551 gene locus_tag LOCUS_17180 8207 7551 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 protein_id gnl|my_center|LOCUS_17180 8581 9468 gene locus_tag LOCUS_17190 8581 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 9843 9529 gene locus_tag LOCUS_17200 9843 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <12520 9863 gene locus_tag LOCUS_17210 <12520 9863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase >Feature sequence083 143 1075 gene locus_tag LOCUS_17220 143 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1072 1974 gene locus_tag LOCUS_17230 1072 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2873 1956 gene locus_tag LOCUS_17240 2873 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3754 2897 gene locus_tag LOCUS_17250 3754 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4605 3766 gene locus_tag LOCUS_17260 4605 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4733 5770 gene locus_tag LOCUS_17270 4733 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5887 6099 gene locus_tag LOCUS_17280 5887 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 9048 6124 gene locus_tag LOCUS_17290 gene dnaE2 9048 6124 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_17290 8944 9198 gene locus_tag LOCUS_17300 8944 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 10608 9220 gene locus_tag LOCUS_17310 10608 9220 CDS product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036300.1 protein_id gnl|my_center|LOCUS_17310 11270 10653 gene locus_tag LOCUS_17320 11270 10653 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036299.1 protein_id gnl|my_center|LOCUS_17320 11869 11267 gene locus_tag LOCUS_17330 gene lexA 11869 11267 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A274 protein_id gnl|my_center|LOCUS_17330 12081 12006 gene locus_tag LOCUS_t00240 12081 12006 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12286 12177 gene locus_tag LOCUS_r00010 12286 12177 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence084 <1 1798 gene locus_tag LOCUS_17340 <1 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245595.1:fimbrial protein 1795 2397 gene locus_tag LOCUS_17350 gene aroK 1795 2397 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_17350 2394 3509 gene locus_tag LOCUS_17360 gene aroB 2394 3509 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_17360 3509 4657 gene locus_tag LOCUS_17370 3509 4657 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P707 protein_id gnl|my_center|LOCUS_17370 4891 9360 gene locus_tag LOCUS_17380 gene gltB 4891 9360 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_17380 9374 10789 gene locus_tag LOCUS_17390 gene gltD 9374 10789 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_17390 10877 11683 gene locus_tag LOCUS_17400 10877 11683 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence085 186 1337 gene locus_tag LOCUS_17410 gene moeB 186 1337 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037152.1 protein_id gnl|my_center|LOCUS_17410 2183 1380 gene locus_tag LOCUS_17420 2183 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2932 2219 gene locus_tag LOCUS_17430 gene coaX 2932 2219 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y1 protein_id gnl|my_center|LOCUS_17430 3903 2929 gene locus_tag LOCUS_17440 gene birA 3903 2929 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV39 protein_id gnl|my_center|LOCUS_17440 4532 3879 gene locus_tag LOCUS_17450 gene plsY 4532 3879 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U809 protein_id gnl|my_center|LOCUS_17450 6352 4529 gene locus_tag LOCUS_17460 6352 4529 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_17460 6415 7389 gene locus_tag LOCUS_17470 6415 7389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_17470 7389 7823 gene locus_tag LOCUS_17480 7389 7823 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 protein_id gnl|my_center|LOCUS_17480 7901 9301 gene locus_tag LOCUS_17490 gene miaB 7901 9301 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV6 protein_id gnl|my_center|LOCUS_17490 9298 10266 gene locus_tag LOCUS_17500 9298 10266 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17500 10158 10379 gene locus_tag LOCUS_17510 10158 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 10376 10804 gene locus_tag LOCUS_17520 gene ybeY 10376 10804 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_17520 10844 11710 gene locus_tag LOCUS_17530 gene ybeX 10844 11710 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence086 116 445 gene locus_tag LOCUS_17540 116 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 442 927 gene locus_tag LOCUS_17550 gene trmL 442 927 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XU1 protein_id gnl|my_center|LOCUS_17550 2030 1023 gene locus_tag LOCUS_17560 gene gpsA 2030 1023 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNT0 protein_id gnl|my_center|LOCUS_17560 2512 2033 gene locus_tag LOCUS_17570 gene secB 2512 2033 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_17570 2786 2505 gene locus_tag LOCUS_17580 gene grxC 2786 2505 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772051.1 protein_id gnl|my_center|LOCUS_17580 3214 2783 gene locus_tag LOCUS_17590 3214 2783 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_17590 3311 4468 gene locus_tag LOCUS_17600 3311 4468 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_17600 4575 5963 gene locus_tag LOCUS_17610 4575 5963 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767110.1 protein_id gnl|my_center|LOCUS_17610 5974 6771 gene locus_tag LOCUS_17620 5974 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096069.1 protein_id gnl|my_center|LOCUS_17620 8317 6728 gene locus_tag LOCUS_17630 gene ubiB 8317 6728 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_17630 8931 8314 gene locus_tag LOCUS_17640 8931 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 9704 8946 gene locus_tag LOCUS_17650 gene ubiE 9704 8946 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NV33 protein_id gnl|my_center|LOCUS_17650 9905 10657 gene locus_tag LOCUS_17660 9905 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946129.1 protein_id gnl|my_center|LOCUS_17660 10678 12141 gene locus_tag LOCUS_17670 10678 12141 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence087 671 123 gene locus_tag LOCUS_17680 671 123 CDS product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_17680 1910 711 gene locus_tag LOCUS_17690 gene purT 1910 711 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E56 protein_id gnl|my_center|LOCUS_17690 2142 1921 gene locus_tag LOCUS_17700 2142 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2163 3599 gene locus_tag LOCUS_17710 gene pykA 2163 3599 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WU4 protein_id gnl|my_center|LOCUS_17710 3596 4312 gene locus_tag LOCUS_17720 3596 4312 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 protein_id gnl|my_center|LOCUS_17720 4355 6475 gene locus_tag LOCUS_17730 gene ppk 4355 6475 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_17730 6494 7594 gene locus_tag LOCUS_17740 6494 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7621 8268 gene locus_tag LOCUS_17750 7621 8268 CDS product peptidase C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_17750 8352 9509 gene locus_tag LOCUS_17760 8352 9509 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_17760 9587 9754 gene locus_tag LOCUS_17770 gene rubA 9587 9754 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R8 protein_id gnl|my_center|LOCUS_17770 9755 10909 gene locus_tag LOCUS_17780 9755 10909 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_17780 10938 11237 gene locus_tag LOCUS_17790 10938 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 11317 11835 gene locus_tag LOCUS_17800 11317 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence088 2117 1440 gene locus_tag LOCUS_17810 2117 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2285 2947 gene locus_tag LOCUS_17820 2285 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112747.1 protein_id gnl|my_center|LOCUS_17820 2980 3759 gene locus_tag LOCUS_17830 2980 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3764 4234 gene locus_tag LOCUS_17840 3764 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4231 7773 gene locus_tag LOCUS_17850 4231 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7912 8946 gene locus_tag LOCUS_17860 7912 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 9422 8943 gene locus_tag LOCUS_17870 9422 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 10045 9419 gene locus_tag LOCUS_17880 10045 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_17880 11201 10050 gene locus_tag LOCUS_17890 gene metX 11201 10050 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57714 protein_id gnl|my_center|LOCUS_17890 11761 11204 gene locus_tag LOCUS_17900 gene yggT 11761 11204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence089 <1 1093 gene locus_tag LOCUS_17910 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114080.1:two-component sensor 1697 1026 gene locus_tag LOCUS_17920 gene tcsR 1697 1026 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_17920 3694 1697 gene locus_tag LOCUS_17930 gene acsA 3694 1697 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_17930 3889 5088 gene locus_tag LOCUS_17940 3889 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_17940 5214 5609 gene locus_tag LOCUS_17950 5214 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5606 7717 gene locus_tag LOCUS_17960 5606 7717 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_17960 7698 8804 gene locus_tag LOCUS_17970 7698 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 10762 8987 gene locus_tag LOCUS_17980 10762 8987 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_17980 11035 10769 gene locus_tag LOCUS_17990 11035 10769 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_17990 11577 11329 gene locus_tag LOCUS_18000 11577 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence090 354 1292 gene locus_tag LOCUS_18010 354 1292 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_18010 2977 1289 gene locus_tag LOCUS_18020 gene ggt 2977 1289 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_18020 3196 3675 gene locus_tag LOCUS_18030 3196 3675 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 protein_id gnl|my_center|LOCUS_18030 3955 4605 gene locus_tag LOCUS_18040 3955 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5254 4616 gene locus_tag LOCUS_18050 5254 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5254 6144 gene locus_tag LOCUS_18060 5254 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7414 6461 gene locus_tag LOCUS_18070 7414 6461 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638865.2 protein_id gnl|my_center|LOCUS_18070 8246 7494 gene locus_tag LOCUS_18080 8246 7494 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537391.1 protein_id gnl|my_center|LOCUS_18080 8397 8549 gene locus_tag LOCUS_18090 8397 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 8652 8960 gene locus_tag LOCUS_18100 8652 8960 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314310.1 protein_id gnl|my_center|LOCUS_18100 9017 9751 gene locus_tag LOCUS_18110 9017 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence091 1847 483 gene locus_tag LOCUS_18120 1847 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3639 1987 gene locus_tag LOCUS_18130 3639 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6374 3864 gene locus_tag LOCUS_18140 6374 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8059 6506 gene locus_tag LOCUS_18150 gene prpD 8059 6506 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537805.1 protein_id gnl|my_center|LOCUS_18150 8860 8270 gene locus_tag LOCUS_18160 8860 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 9830 9222 gene locus_tag LOCUS_18170 9830 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence092 3425 2316 gene locus_tag LOCUS_18180 gene mnmA 3425 2316 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWW0 protein_id gnl|my_center|LOCUS_18180 3882 3430 gene locus_tag LOCUS_18190 3882 3430 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_18190 4640 3882 gene locus_tag LOCUS_18200 4640 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5146 4637 gene locus_tag LOCUS_18210 5146 4637 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TC8 protein_id gnl|my_center|LOCUS_18210 6363 5143 gene locus_tag LOCUS_18220 6363 5143 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094962.1 protein_id gnl|my_center|LOCUS_18220 7338 6370 gene locus_tag LOCUS_18230 gene xcpX 7338 6370 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_18230 8051 7335 gene locus_tag LOCUS_18240 gene xcpW 8051 7335 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_18240 8428 8048 gene locus_tag LOCUS_18250 gene xcpV 8428 8048 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_18250 8955 8431 gene locus_tag LOCUS_18260 gene gspH 8955 8431 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 protein_id gnl|my_center|LOCUS_18260 9425 8973 gene locus_tag LOCUS_18270 gene xcpT 9425 8973 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_18270 9417 10076 gene locus_tag LOCUS_18280 9417 10076 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 protein_id gnl|my_center|LOCUS_18280 10113 11039 gene locus_tag LOCUS_18290 gene fabD 10113 11039 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7J5 protein_id gnl|my_center|LOCUS_18290 >Feature sequence093 3 401 gene locus_tag LOCUS_18300 3 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 924 412 gene locus_tag LOCUS_18310 924 412 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 protein_id gnl|my_center|LOCUS_18310 984 1994 gene locus_tag LOCUS_18320 984 1994 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_18320 2434 1997 gene locus_tag LOCUS_18330 gene pilE 2434 1997 CDS product type IV minor pilin protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_18330 7628 2439 gene locus_tag LOCUS_18340 7628 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8322 7639 gene locus_tag LOCUS_18350 8322 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 9327 8326 gene locus_tag LOCUS_18360 9327 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 9839 9324 gene locus_tag LOCUS_18370 9839 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 10336 9836 gene locus_tag LOCUS_18380 10336 9836 CDS product general secretion pathway protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769263.1 protein_id gnl|my_center|LOCUS_18380 10540 10615 gene locus_tag LOCUS_t00250 10540 10615 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <11499 10700 gene locus_tag LOCUS_18390 <11499 10700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947770.1:integrase >Feature sequence094 1031 501 gene locus_tag LOCUS_18400 gene pilP 1031 501 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_18400 1681 1028 gene locus_tag LOCUS_18410 gene pilO 1681 1028 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765501.1 protein_id gnl|my_center|LOCUS_18410 2255 1671 gene locus_tag LOCUS_18420 gene pilN 2255 1671 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946663.1 protein_id gnl|my_center|LOCUS_18420 3299 2265 gene locus_tag LOCUS_18430 3299 2265 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_18430 3539 6046 gene locus_tag LOCUS_18440 gene mrcA 3539 6046 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_18440 6122 6766 gene locus_tag LOCUS_18450 6122 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 8048 6777 gene locus_tag LOCUS_18460 8048 6777 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_18460 8827 8048 gene locus_tag LOCUS_18470 8827 8048 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_18470 10101 8824 gene locus_tag LOCUS_18480 10101 8824 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_18480 10763 10125 gene locus_tag LOCUS_18490 10763 10125 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence095 130 1161 gene locus_tag LOCUS_18500 130 1161 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_18500 2424 1195 gene locus_tag LOCUS_18510 2424 1195 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_18510 3479 2478 gene locus_tag LOCUS_18520 3479 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3478 4557 gene locus_tag LOCUS_18530 3478 4557 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_18530 4582 5244 gene locus_tag LOCUS_18540 4582 5244 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_18540 5338 7554 gene locus_tag LOCUS_18550 5338 7554 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_18550 7547 8467 gene locus_tag LOCUS_18560 7547 8467 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_18560 8461 9795 gene locus_tag LOCUS_18570 8461 9795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_18570 11187 9814 gene locus_tag LOCUS_18580 gene mltF 11187 9814 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPA2 protein_id gnl|my_center|LOCUS_18580 >Feature sequence096 1843 3186 gene locus_tag LOCUS_18590 1843 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3202 3573 gene locus_tag LOCUS_18600 3202 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6296 3726 gene locus_tag LOCUS_18610 6296 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7008 8033 gene locus_tag LOCUS_18620 7008 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_18620 8105 8599 gene locus_tag LOCUS_18630 8105 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 8690 9358 gene locus_tag LOCUS_18640 8690 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 9361 10275 gene locus_tag LOCUS_18650 9361 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 10801 10337 gene locus_tag LOCUS_18660 10801 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence097 2602 1226 gene locus_tag LOCUS_18670 2602 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3815 2661 gene locus_tag LOCUS_18680 gene argE 3815 2661 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_18680 5231 3933 gene locus_tag LOCUS_18690 5231 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5473 6045 gene locus_tag LOCUS_18700 5473 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6055 7407 gene locus_tag LOCUS_18710 gene pepP 6055 7407 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_18710 7404 8594 gene locus_tag LOCUS_18720 7404 8594 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703430.1 protein_id gnl|my_center|LOCUS_18720 8591 9784 gene locus_tag LOCUS_18730 gene ubiF 8591 9784 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105378.1 protein_id gnl|my_center|LOCUS_18730 10177 9785 gene locus_tag LOCUS_18740 10177 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence098 1492 242 gene locus_tag LOCUS_18750 1492 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1777 4092 gene locus_tag LOCUS_18760 1777 4092 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 protein_id gnl|my_center|LOCUS_18760 5504 4089 gene locus_tag LOCUS_18770 5504 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056019.1 protein_id gnl|my_center|LOCUS_18770 6384 5575 gene locus_tag LOCUS_18780 gene djlA 6384 5575 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGU4 protein_id gnl|my_center|LOCUS_18780 6435 6803 gene locus_tag LOCUS_18790 6435 6803 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_18790 7085 6873 gene locus_tag LOCUS_18800 7085 6873 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553156.1 protein_id gnl|my_center|LOCUS_18800 7425 8990 gene locus_tag LOCUS_18810 7425 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_18810 9003 9305 gene locus_tag LOCUS_18820 9003 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 9744 9346 gene locus_tag LOCUS_18830 9744 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 10940 9804 gene locus_tag LOCUS_18840 10940 9804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence099 1577 219 gene locus_tag LOCUS_18850 1577 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_18850 2636 1695 gene locus_tag LOCUS_18860 2636 1695 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_18860 3553 2633 gene locus_tag LOCUS_18870 gene hemF 3553 2633 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FI90 protein_id gnl|my_center|LOCUS_18870 4104 3553 gene locus_tag LOCUS_18880 gene tsaC 4104 3553 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F2 protein_id gnl|my_center|LOCUS_18880 6638 4104 gene locus_tag LOCUS_18890 gene topA 6638 4104 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_18890 8003 6915 gene locus_tag LOCUS_18900 8003 6915 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086644.1 protein_id gnl|my_center|LOCUS_18900 10221 8224 gene locus_tag LOCUS_18910 10221 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence100 1059 2036 gene locus_tag LOCUS_18920 gene mdh 1059 2036 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_18920 2091 3032 gene locus_tag LOCUS_18930 gene rapK 2091 3032 CDS product pteridine-dependent deoxygenase like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639353.2 protein_id gnl|my_center|LOCUS_18930 4527 3049 gene locus_tag LOCUS_18940 gene glpK1 4527 3049 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_18940 5337 4591 gene locus_tag LOCUS_18950 5337 4591 CDS product anti-sigma K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528491.1 protein_id gnl|my_center|LOCUS_18950 5912 5334 gene locus_tag LOCUS_18960 5912 5334 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706664.1 protein_id gnl|my_center|LOCUS_18960 6717 5926 gene locus_tag LOCUS_18970 6717 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_18970 6864 7823 gene locus_tag LOCUS_18980 gene hemB 6864 7823 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W3 protein_id gnl|my_center|LOCUS_18980 7820 8650 gene locus_tag LOCUS_18990 gene aroE 7820 8650 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3W6 protein_id gnl|my_center|LOCUS_18990 9691 8666 gene locus_tag LOCUS_19000 gene pyrC 9691 8666 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ9 protein_id gnl|my_center|LOCUS_19000 10251 9817 gene locus_tag LOCUS_19010 gene ytfP 10251 9817 CDS product gamma-glutamylcyclotransferase family protein YtfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AE48 protein_id gnl|my_center|LOCUS_19010 >Feature sequence101 <1 1026 gene locus_tag LOCUS_19020 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269389.1:phosphate ABC transporter permease 1035 2714 gene locus_tag LOCUS_19030 gene pstA 1035 2714 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_19030 2736 3572 gene locus_tag LOCUS_19040 gene pstB 2736 3572 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM15 protein_id gnl|my_center|LOCUS_19040 3738 4463 gene locus_tag LOCUS_19050 gene phoU 3738 4463 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_19050 4555 6837 gene locus_tag LOCUS_19060 gene mrcB 4555 6837 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_19060 6846 7421 gene locus_tag LOCUS_19070 6846 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 7411 9408 gene locus_tag LOCUS_19080 gene yoaA 7411 9408 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence102 154 1284 gene locus_tag LOCUS_19090 gene rlmN 154 1284 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ42 protein_id gnl|my_center|LOCUS_19090 1281 2072 gene locus_tag LOCUS_19100 1281 2072 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 protein_id gnl|my_center|LOCUS_19100 2069 2995 gene locus_tag LOCUS_19110 2069 2995 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_19110 3066 4196 gene locus_tag LOCUS_19120 gene ispG 3066 4196 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_19120 4193 5470 gene locus_tag LOCUS_19130 gene hisS 4193 5470 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E771 protein_id gnl|my_center|LOCUS_19130 5485 6120 gene locus_tag LOCUS_19140 gene yfgM 5485 6120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_19140 6120 7295 gene locus_tag LOCUS_19150 gene bamB 6120 7295 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_19150 7302 8708 gene locus_tag LOCUS_19160 gene der 7302 8708 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV99 protein_id gnl|my_center|LOCUS_19160 9595 8732 gene locus_tag LOCUS_19170 9595 8732 CDS product nucleotide-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228291.1 protein_id gnl|my_center|LOCUS_19170 9822 9592 gene locus_tag LOCUS_19180 9822 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence103 277 969 gene locus_tag LOCUS_19190 gene bioD 277 969 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTW5 protein_id gnl|my_center|LOCUS_19190 1931 960 gene locus_tag LOCUS_19200 1931 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2344 1928 gene locus_tag LOCUS_19210 2344 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2794 2384 gene locus_tag LOCUS_19220 2794 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2678 4444 gene locus_tag LOCUS_19230 gene hmuA 2678 4444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_19230 4453 5184 gene locus_tag LOCUS_19240 4453 5184 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977394.1 protein_id gnl|my_center|LOCUS_19240 5260 5802 gene locus_tag LOCUS_19250 5260 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5900 7033 gene locus_tag LOCUS_19260 gene coxB 5900 7033 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_19260 7057 8685 gene locus_tag LOCUS_19270 gene coxA 7057 8685 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_19270 8802 9368 gene locus_tag LOCUS_19280 gene ctaG 8802 9368 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence104 1079 1510 gene locus_tag LOCUS_19290 1079 1510 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_19290 1500 2537 gene locus_tag LOCUS_19300 gene panE-3 1500 2537 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WL63 protein_id gnl|my_center|LOCUS_19300 3028 2528 gene locus_tag LOCUS_19310 3028 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3127 3993 gene locus_tag LOCUS_19320 3127 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4754 3990 gene locus_tag LOCUS_19330 4754 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4876 6705 gene locus_tag LOCUS_19340 gene typA 4876 6705 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_19340 6734 7303 gene locus_tag LOCUS_19350 6734 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8170 7364 gene locus_tag LOCUS_19360 8170 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9139 8240 gene locus_tag LOCUS_19370 9139 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10045 9287 gene locus_tag LOCUS_19380 10045 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence105 1674 310 gene locus_tag LOCUS_19390 gene dnaB 1674 310 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXJ3 protein_id gnl|my_center|LOCUS_19390 2238 1783 gene locus_tag LOCUS_19400 gene rplI 2238 1783 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAH5 protein_id gnl|my_center|LOCUS_19400 2478 2248 gene locus_tag LOCUS_19410 gene rpsR 2478 2248 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_19410 2913 2482 gene locus_tag LOCUS_19420 2913 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3406 3062 gene locus_tag LOCUS_19430 3406 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3509 3910 gene locus_tag LOCUS_19440 3509 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3903 4760 gene locus_tag LOCUS_19450 3903 4760 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_19450 5516 4767 gene locus_tag LOCUS_19460 gene rlmB 5516 4767 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 protein_id gnl|my_center|LOCUS_19460 6220 5522 gene locus_tag LOCUS_19470 6220 5522 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403125.1 protein_id gnl|my_center|LOCUS_19470 8716 6230 gene locus_tag LOCUS_19480 gene rnr 8716 6230 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG7 protein_id gnl|my_center|LOCUS_19480 8756 8840 gene locus_tag LOCUS_t00260 8756 8840 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <10020 9053 gene locus_tag LOCUS_19490 <10020 9053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941581.1:heme ABC transporter ATPase >Feature sequence106 2691 1258 gene locus_tag LOCUS_19500 2691 1258 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_19500 5813 2688 gene locus_tag LOCUS_19510 5813 2688 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_19510 7012 5813 gene locus_tag LOCUS_19520 7012 5813 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_19520 7060 7668 gene locus_tag LOCUS_19530 gene acrR 7060 7668 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972840.1 protein_id gnl|my_center|LOCUS_19530 <9949 7653 gene locus_tag LOCUS_19540 <9949 7653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent helicase >Feature sequence107 463 714 gene locus_tag LOCUS_19550 gene hfq 463 714 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ69 protein_id gnl|my_center|LOCUS_19550 733 2055 gene locus_tag LOCUS_19560 gene hflX 733 2055 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ5 protein_id gnl|my_center|LOCUS_19560 2111 3274 gene locus_tag LOCUS_19570 gene hflK 2111 3274 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 protein_id gnl|my_center|LOCUS_19570 3274 4143 gene locus_tag LOCUS_19580 3274 4143 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_19580 4153 4344 gene locus_tag LOCUS_19590 4153 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 4341 5318 gene locus_tag LOCUS_19600 gene hisZ 4341 5318 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX6 protein_id gnl|my_center|LOCUS_19600 5350 6645 gene locus_tag LOCUS_19610 gene purA 5350 6645 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_19610 8381 6762 gene locus_tag LOCUS_19620 8381 6762 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence108 236 565 gene locus_tag LOCUS_19630 236 565 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_19630 567 1157 gene locus_tag LOCUS_19640 567 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_19640 2092 1187 gene locus_tag LOCUS_19650 2092 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_19650 2220 4421 gene locus_tag LOCUS_19660 2220 4421 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF6 protein_id gnl|my_center|LOCUS_19660 4426 5193 gene locus_tag LOCUS_19670 4426 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_19670 6727 5198 gene locus_tag LOCUS_19680 gene leuB 6727 5198 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_19680 7097 6735 gene locus_tag LOCUS_19690 7097 6735 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404784.1 protein_id gnl|my_center|LOCUS_19690 9379 7094 gene locus_tag LOCUS_19700 9379 7094 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0W8 protein_id gnl|my_center|LOCUS_19700 >Feature sequence109 2472 1036 gene locus_tag LOCUS_19710 2472 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 protein_id gnl|my_center|LOCUS_19710 3381 2533 gene locus_tag LOCUS_19720 3381 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_19720 4361 3498 gene locus_tag LOCUS_19730 4361 3498 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_19730 4696 4361 gene locus_tag LOCUS_19740 4696 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44269 protein_id gnl|my_center|LOCUS_19740 5380 4769 gene locus_tag LOCUS_19750 5380 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_19750 5583 6467 gene locus_tag LOCUS_19760 5583 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 7369 6470 gene locus_tag LOCUS_19770 gene poxA 7369 6470 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_19770 7983 7390 gene locus_tag LOCUS_19780 7983 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence110 <1 1393 gene locus_tag LOCUS_19790 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705253.1:acyl-CoA dehydrogenase 1514 1852 gene locus_tag LOCUS_19800 gene glnK 1514 1852 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_19800 1914 3506 gene locus_tag LOCUS_19810 1914 3506 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_19810 3745 3503 gene locus_tag LOCUS_19820 3745 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3807 4202 gene locus_tag LOCUS_19830 3807 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5086 4229 gene locus_tag LOCUS_19840 gene speE 5086 4229 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_19840 5142 7040 gene locus_tag LOCUS_19850 gene speA 5142 7040 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 protein_id gnl|my_center|LOCUS_19850 7991 7050 gene locus_tag LOCUS_19860 gene bioH 7991 7050 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_19860 8066 9283 gene locus_tag LOCUS_19870 8066 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence111 1745 906 gene locus_tag LOCUS_19880 gene ephD 1745 906 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_19880 2719 1787 gene locus_tag LOCUS_19890 2719 1787 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_19890 4016 2925 gene locus_tag LOCUS_19900 4016 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_19900 5187 4144 gene locus_tag LOCUS_19910 5187 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 5411 6349 gene locus_tag LOCUS_19920 5411 6349 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114421.1 protein_id gnl|my_center|LOCUS_19920 7783 6401 gene locus_tag LOCUS_19930 7783 6401 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702784.1 protein_id gnl|my_center|LOCUS_19930 8115 7795 gene locus_tag LOCUS_19940 gene fdxB 8115 7795 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 protein_id gnl|my_center|LOCUS_19940 8215 9315 gene locus_tag LOCUS_19950 gene oruR 8215 9315 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_19950 >Feature sequence112 495 707 gene locus_tag LOCUS_19960 495 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2056 620 gene locus_tag LOCUS_19970 gene cls 2056 620 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_19970 2804 2040 gene locus_tag LOCUS_19980 2804 2040 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_19980 5063 2916 gene locus_tag LOCUS_19990 gene cheA-1 5063 2916 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_19990 5377 5060 gene locus_tag LOCUS_20000 5377 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 6685 5390 gene locus_tag LOCUS_20010 6685 5390 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704849.1 protein_id gnl|my_center|LOCUS_20010 7806 6691 gene locus_tag LOCUS_20020 gene cheB-3 7806 6691 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL95 protein_id gnl|my_center|LOCUS_20020 8336 7809 gene locus_tag LOCUS_20030 gene cheW-1 8336 7809 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_20030 <9453 8349 gene locus_tag LOCUS_20040 <9453 8349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266628.1:methyl-accepting chemotaxis protein >Feature sequence113 3301 1943 gene locus_tag LOCUS_20050 3301 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267182.1 protein_id gnl|my_center|LOCUS_20050 4894 3326 gene locus_tag LOCUS_20060 4894 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_20060 5857 5012 gene locus_tag LOCUS_20070 5857 5012 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_20070 7106 5877 gene locus_tag LOCUS_20080 7106 5877 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_20080 8264 7173 gene locus_tag LOCUS_20090 8264 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 <9322 8338 gene locus_tag LOCUS_20100 <9322 8338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:RND transporter >Feature sequence114 1195 191 gene locus_tag LOCUS_20110 gene dusB 1195 191 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH1 protein_id gnl|my_center|LOCUS_20110 1767 1192 gene locus_tag LOCUS_20120 1767 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1953 2150 gene locus_tag LOCUS_20130 1953 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2174 3130 gene locus_tag LOCUS_20140 2174 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4434 3127 gene locus_tag LOCUS_20150 4434 3127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_20150 5145 4546 gene locus_tag LOCUS_20160 5145 4546 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_20160 5782 5195 gene locus_tag LOCUS_20170 5782 5195 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194156.1 protein_id gnl|my_center|LOCUS_20170 6363 5779 gene locus_tag LOCUS_20180 6363 5779 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_20180 6919 6449 gene locus_tag LOCUS_20190 gene rlmH 6919 6449 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6V2 protein_id gnl|my_center|LOCUS_20190 7289 6927 gene locus_tag LOCUS_20200 gene rsfS 7289 6927 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAT8 protein_id gnl|my_center|LOCUS_20200 7920 7291 gene locus_tag LOCUS_20210 gene nadD 7920 7291 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_20210 9184 7949 gene locus_tag LOCUS_20220 gene proA 9184 7949 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_20220 >Feature sequence115 1736 180 gene locus_tag LOCUS_20230 gene mdoG 1736 180 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLF1 protein_id gnl|my_center|LOCUS_20230 2389 1976 gene locus_tag LOCUS_20240 2389 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3668 2502 gene locus_tag LOCUS_20250 3668 2502 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_20250 4673 3726 gene locus_tag LOCUS_20260 4673 3726 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_20260 6256 4754 gene locus_tag LOCUS_20270 6256 4754 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ0 protein_id gnl|my_center|LOCUS_20270 6623 6288 gene locus_tag LOCUS_20280 6623 6288 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG33 protein_id gnl|my_center|LOCUS_20280 6745 7368 gene locus_tag LOCUS_20290 6745 7368 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089582.1 protein_id gnl|my_center|LOCUS_20290 7422 8228 gene locus_tag LOCUS_20300 7422 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709090.1 protein_id gnl|my_center|LOCUS_20300 8424 8218 gene locus_tag LOCUS_20310 8424 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 <9299 8428 gene locus_tag LOCUS_20320 <9299 8428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGD0:uroporphyrinogen decarboxylase >Feature sequence116 <1 585 gene locus_tag LOCUS_20330 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102518.1:3-hydroxyacyl-CoA dehydrogenase 759 1616 gene locus_tag LOCUS_20340 759 1616 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_20340 2026 1613 gene locus_tag LOCUS_20350 2026 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3513 2023 gene locus_tag LOCUS_20360 3513 2023 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_20360 4162 3497 gene locus_tag LOCUS_20370 4162 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5055 4159 gene locus_tag LOCUS_20380 5055 4159 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_20380 5695 5126 gene locus_tag LOCUS_20390 5695 5126 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_20390 6907 5750 gene locus_tag LOCUS_20400 gene prpC 6907 5750 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_20400 7829 6951 gene locus_tag LOCUS_20410 gene prpB 7829 6951 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUP4 protein_id gnl|my_center|LOCUS_20410 7996 8937 gene locus_tag LOCUS_20420 7996 8937 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence117 3813 2560 gene locus_tag LOCUS_20430 3813 2560 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102993.1 protein_id gnl|my_center|LOCUS_20430 3918 4613 gene locus_tag LOCUS_20440 3918 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4614 6323 gene locus_tag LOCUS_20450 4614 6323 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_20450 6355 8208 gene locus_tag LOCUS_20460 6355 8208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence118 316 1389 gene locus_tag LOCUS_20470 316 1389 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_20470 1386 2885 gene locus_tag LOCUS_20480 gene ntrC 1386 2885 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_20480 4289 2898 gene locus_tag LOCUS_20490 gene ndh 4289 2898 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_20490 5322 4372 gene locus_tag LOCUS_20500 5322 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056387.1 protein_id gnl|my_center|LOCUS_20500 5321 6097 gene locus_tag LOCUS_20510 5321 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_20510 6081 6590 gene locus_tag LOCUS_20520 6081 6590 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG04 protein_id gnl|my_center|LOCUS_20520 7693 6482 gene locus_tag LOCUS_20530 7693 6482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_20530 8437 7694 gene locus_tag LOCUS_20540 gene ptr1 8437 7694 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_20540 <9082 8495 gene locus_tag LOCUS_20550 <9082 8495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZMF8:multifunctional CCA protein >Feature sequence119 792 523 gene locus_tag LOCUS_20560 792 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1484 831 gene locus_tag LOCUS_20570 gene gmk 1484 831 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU6 protein_id gnl|my_center|LOCUS_20570 2328 1477 gene locus_tag LOCUS_20580 2328 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_20580 2892 2416 gene locus_tag LOCUS_20590 2892 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3013 3852 gene locus_tag LOCUS_20600 3013 3852 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886760.1 protein_id gnl|my_center|LOCUS_20600 3963 5177 gene locus_tag LOCUS_20610 3963 5177 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529278.1 protein_id gnl|my_center|LOCUS_20610 5307 7568 gene locus_tag LOCUS_20620 5307 7568 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732543.1 protein_id gnl|my_center|LOCUS_20620 7571 8650 gene locus_tag LOCUS_20630 gene mutY 7571 8650 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 protein_id gnl|my_center|LOCUS_20630 8647 8937 gene locus_tag LOCUS_20640 8647 8937 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0N2 protein_id gnl|my_center|LOCUS_20640 >Feature sequence120 <1 2291 gene locus_tag LOCUS_20650 <1 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639902.1:TonB-dependent receptor 2385 3104 gene locus_tag LOCUS_20660 2385 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3285 6047 gene locus_tag LOCUS_20670 3285 6047 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_20670 6057 7166 gene locus_tag LOCUS_20680 6057 7166 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_20680 7673 7224 gene locus_tag LOCUS_20690 7673 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7823 8353 gene locus_tag LOCUS_20700 7823 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence121 1347 1652 gene locus_tag LOCUS_20710 1347 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035654.1 protein_id gnl|my_center|LOCUS_20710 3035 1677 gene locus_tag LOCUS_20720 3035 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3825 3049 gene locus_tag LOCUS_20730 3825 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5512 3890 gene locus_tag LOCUS_20740 5512 3890 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_20740 7004 5499 gene locus_tag LOCUS_20750 7004 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_20750 7980 6994 gene locus_tag LOCUS_20760 7980 6994 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532499.1 protein_id gnl|my_center|LOCUS_20760 <8594 8055 gene locus_tag LOCUS_20770 <8594 8055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390821.1:phosphoesterase >Feature sequence122 1612 239 gene locus_tag LOCUS_20780 1612 239 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKA7 protein_id gnl|my_center|LOCUS_20780 2431 1670 gene locus_tag LOCUS_20790 2431 1670 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724030.1 protein_id gnl|my_center|LOCUS_20790 2696 2860 gene locus_tag LOCUS_20800 2696 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3326 2868 gene locus_tag LOCUS_20810 3326 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 protein_id gnl|my_center|LOCUS_20810 4504 3350 gene locus_tag LOCUS_20820 gene phaC1 4504 3350 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_20820 4701 6467 gene locus_tag LOCUS_20830 4701 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 7353 6481 gene locus_tag LOCUS_20840 7353 6481 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404720.1 protein_id gnl|my_center|LOCUS_20840 7923 7426 gene locus_tag LOCUS_20850 7923 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence123 <1 759 gene locus_tag LOCUS_20860 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731359.1:dehydrogenase 809 1480 gene locus_tag LOCUS_20870 809 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1950 1477 gene locus_tag LOCUS_20880 1950 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2824 1955 gene locus_tag LOCUS_20890 2824 1955 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_20890 2823 3842 gene locus_tag LOCUS_20900 2823 3842 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_20900 3912 5414 gene locus_tag LOCUS_20910 3912 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 5553 6173 gene locus_tag LOCUS_20920 5553 6173 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_20920 7433 6255 gene locus_tag LOCUS_20930 7433 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_20930 <8403 7433 gene locus_tag LOCUS_20940 <8403 7433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000183814.1:heme biosynthesis operon protein HemX >Feature sequence124 104 652 gene locus_tag LOCUS_20950 104 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_20950 679 1806 gene locus_tag LOCUS_20960 679 1806 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_20960 2597 1821 gene locus_tag LOCUS_20970 2597 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2654 3574 gene locus_tag LOCUS_20980 gene lipG 2654 3574 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403314.1 protein_id gnl|my_center|LOCUS_20980 3638 5347 gene locus_tag LOCUS_20990 3638 5347 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_20990 5392 5754 gene locus_tag LOCUS_21000 5392 5754 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_21000 6068 6460 gene locus_tag LOCUS_21010 gene rnk 6068 6460 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968462.1 protein_id gnl|my_center|LOCUS_21010 7339 6524 gene locus_tag LOCUS_21020 7339 6524 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975445.1 protein_id gnl|my_center|LOCUS_21020 7997 8265 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctatgcggcagtgaac >Feature sequence125 1533 769 gene locus_tag LOCUS_21030 gene fkpA 1533 769 CDS product putative FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYI8 protein_id gnl|my_center|LOCUS_21030 4077 1600 gene locus_tag LOCUS_21040 gene plsB 4077 1600 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW7 protein_id gnl|my_center|LOCUS_21040 4185 4691 gene locus_tag LOCUS_21050 4185 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5741 4680 gene locus_tag LOCUS_21060 5741 4680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_21060 7281 5734 gene locus_tag LOCUS_21070 7281 5734 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103094.1 protein_id gnl|my_center|LOCUS_21070 <8257 7334 gene locus_tag LOCUS_21080 <8257 7334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTX3:putative binding protein component of ABC iron transporter >Feature sequence126 818 18 gene locus_tag LOCUS_21090 gene speD 818 18 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4I6 protein_id gnl|my_center|LOCUS_21090 1350 925 gene locus_tag LOCUS_21100 1350 925 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_21100 2168 1371 gene locus_tag LOCUS_21110 gene trpC 2168 1371 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAS8 protein_id gnl|my_center|LOCUS_21110 3202 2165 gene locus_tag LOCUS_21120 gene trpD 3202 2165 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD71 protein_id gnl|my_center|LOCUS_21120 3914 3315 gene locus_tag LOCUS_21130 gene trpG 3914 3315 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_21130 4045 4497 gene locus_tag LOCUS_21140 4045 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 6384 4519 gene locus_tag LOCUS_21150 6384 4519 CDS product putative peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702891.1 protein_id gnl|my_center|LOCUS_21150 7218 6496 gene locus_tag LOCUS_21160 7218 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 7403 8074 gene locus_tag LOCUS_21170 7403 8074 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence127 1 267 gene locus_tag LOCUS_21180 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 264 695 gene locus_tag LOCUS_21190 gene holC 264 695 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_21190 786 3545 gene locus_tag LOCUS_21200 gene valS 786 3545 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_21200 5084 3585 gene locus_tag LOCUS_21210 5084 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_21210 5198 6109 gene locus_tag LOCUS_21220 gene moxR 5198 6109 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_21220 6121 7107 gene locus_tag LOCUS_21230 6121 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence128 1341 25 gene locus_tag LOCUS_21240 1341 25 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_21240 2237 1419 gene locus_tag LOCUS_21250 gene mutM 2237 1419 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_21250 3145 2237 gene locus_tag LOCUS_21260 3145 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4514 3162 gene locus_tag LOCUS_21270 4514 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5271 4525 gene locus_tag LOCUS_21280 5271 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008686591.1 protein_id gnl|my_center|LOCUS_21280 6233 5268 gene locus_tag LOCUS_21290 6233 5268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_21290 7421 6318 gene locus_tag LOCUS_21300 7421 6318 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_21300 <8045 7444 gene locus_tag LOCUS_21310 <8045 7444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038820.1:lipid A biosynthesis lauroyl acyltransferase >Feature sequence129 1958 882 gene locus_tag LOCUS_21320 1958 882 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_21320 3993 2002 gene locus_tag LOCUS_21330 3993 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5035 4076 gene locus_tag LOCUS_21340 gene fabH 5035 4076 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIK2 protein_id gnl|my_center|LOCUS_21340 5600 5319 gene locus_tag LOCUS_21350 5600 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5737 6216 gene locus_tag LOCUS_21360 5737 6216 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037892.1 protein_id gnl|my_center|LOCUS_21360 6272 6739 gene locus_tag LOCUS_21370 6272 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7833 6736 gene locus_tag LOCUS_21380 7833 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040164.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence130 1769 642 gene locus_tag LOCUS_21390 1769 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2295 1813 gene locus_tag LOCUS_21400 2295 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4316 2301 gene locus_tag LOCUS_21410 gene fadH 4316 2301 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 protein_id gnl|my_center|LOCUS_21410 5125 4313 gene locus_tag LOCUS_21420 5125 4313 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 protein_id gnl|my_center|LOCUS_21420 6620 5259 gene locus_tag LOCUS_21430 gene fabG 6620 5259 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_21430 7535 6705 gene locus_tag LOCUS_21440 7535 6705 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226826.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence131 240 2108 gene locus_tag LOCUS_21450 240 2108 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_21450 3290 2124 gene locus_tag LOCUS_21460 gene pqqE 3290 2124 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A84 protein_id gnl|my_center|LOCUS_21460 3600 3277 gene locus_tag LOCUS_21470 3600 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4421 3597 gene locus_tag LOCUS_21480 gene pqqC 4421 3597 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C2 protein_id gnl|my_center|LOCUS_21480 5217 4396 gene locus_tag LOCUS_21490 gene pqqB 5217 4396 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C3 protein_id gnl|my_center|LOCUS_21490 6475 5657 gene locus_tag LOCUS_21500 gene suhB 6475 5657 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_21500 6487 7251 gene locus_tag LOCUS_21510 gene trmJ 6487 7251 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ30 protein_id gnl|my_center|LOCUS_21510 >Feature sequence132 <1 991 gene locus_tag LOCUS_21520 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459330.1:flagellar motor protein MotA 988 1617 gene locus_tag LOCUS_21530 988 1617 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_21530 1614 2030 gene locus_tag LOCUS_21540 1614 2030 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_21540 2027 2668 gene locus_tag LOCUS_21550 2027 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2673 3818 gene locus_tag LOCUS_21560 2673 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3803 6868 gene locus_tag LOCUS_21570 gene fecA 3803 6868 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence133 3997 2537 gene locus_tag LOCUS_21580 gene cafA 3997 2537 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_21580 4584 3994 gene locus_tag LOCUS_21590 gene maf-2 4584 3994 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS4 protein_id gnl|my_center|LOCUS_21590 5295 4654 gene locus_tag LOCUS_21600 gene msrA 5295 4654 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_21600 5735 5292 gene locus_tag LOCUS_21610 5735 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 6240 5872 gene locus_tag LOCUS_21620 6240 5872 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_21620 6620 6240 gene locus_tag LOCUS_21630 6620 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 <7764 6617 gene locus_tag LOCUS_21640 <7764 6617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031138.1:saccharopine dehydrogenase >Feature sequence134 450 85 gene locus_tag LOCUS_tm00010 450 85 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1027 545 gene locus_tag LOCUS_21650 gene smpB 1027 545 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T34 protein_id gnl|my_center|LOCUS_21650 1071 2522 gene locus_tag LOCUS_21660 1071 2522 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_21660 2489 2824 gene locus_tag LOCUS_21670 2489 2824 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43994 protein_id gnl|my_center|LOCUS_21670 3175 2852 gene locus_tag LOCUS_21680 3175 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3110 3379 gene locus_tag LOCUS_21690 3110 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3357 3770 gene locus_tag LOCUS_21700 gene fur 3357 3770 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_21700 5487 3805 gene locus_tag LOCUS_21710 5487 3805 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP5 protein_id gnl|my_center|LOCUS_21710 6367 5498 gene locus_tag LOCUS_21720 gene nadK 6367 5498 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_21720 6461 7498 gene locus_tag LOCUS_21730 gene hrcA 6461 7498 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence135 160 906 gene locus_tag LOCUS_21740 gene fliP 160 906 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E9 protein_id gnl|my_center|LOCUS_21740 903 1172 gene locus_tag LOCUS_21750 gene fliQ 903 1172 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_21750 1180 1956 gene locus_tag LOCUS_21760 gene fliR 1180 1956 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9F1 protein_id gnl|my_center|LOCUS_21760 2201 3643 gene locus_tag LOCUS_21770 2201 3643 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_21770 3759 5291 gene locus_tag LOCUS_21780 3759 5291 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_21780 6542 5334 gene locus_tag LOCUS_21790 6542 5334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704849.1 protein_id gnl|my_center|LOCUS_21790 6906 6553 gene locus_tag LOCUS_21800 6906 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence136 660 1190 gene locus_tag LOCUS_21810 660 1190 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_21810 1213 1584 gene locus_tag LOCUS_21820 1213 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_21820 1620 2408 gene locus_tag LOCUS_21830 1620 2408 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_21830 3373 2405 gene locus_tag LOCUS_21840 3373 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4080 3436 gene locus_tag LOCUS_21850 4080 3436 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_21850 4135 4608 gene locus_tag LOCUS_21860 4135 4608 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_21860 5201 4605 gene locus_tag LOCUS_21870 5201 4605 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119078.1 protein_id gnl|my_center|LOCUS_21870 6338 5268 gene locus_tag LOCUS_21880 6338 5268 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642344.1 protein_id gnl|my_center|LOCUS_21880 <7584 6335 gene locus_tag LOCUS_21890 <7584 6335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899914.1:alkyldihydroxyacetonephosphate synthase >Feature sequence137 1239 859 gene locus_tag LOCUS_21900 1239 859 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388958.1 protein_id gnl|my_center|LOCUS_21900 1620 1267 gene locus_tag LOCUS_21910 1620 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1917 1705 gene locus_tag LOCUS_21920 1917 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1971 2840 gene locus_tag LOCUS_21930 1971 2840 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225281.1 protein_id gnl|my_center|LOCUS_21930 <7555 2837 gene locus_tag LOCUS_21940 <7555 2837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase >Feature sequence138 282 1451 gene locus_tag LOCUS_21950 282 1451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884049.1 protein_id gnl|my_center|LOCUS_21950 1472 2275 gene locus_tag LOCUS_21960 1472 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2282 3274 gene locus_tag LOCUS_21970 2282 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 3490 4020 gene locus_tag LOCUS_21980 3490 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4519 4307 gene locus_tag LOCUS_21990 4519 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036936.1 protein_id gnl|my_center|LOCUS_21990 6811 4724 gene locus_tag LOCUS_22000 6811 4724 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404623.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence139 1312 2 gene locus_tag LOCUS_22010 gene hisD 1312 2 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV5 protein_id gnl|my_center|LOCUS_22010 1965 1309 gene locus_tag LOCUS_22020 gene hisG 1965 1309 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64347 protein_id gnl|my_center|LOCUS_22020 3239 1962 gene locus_tag LOCUS_22030 gene murA 3239 1962 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P719 protein_id gnl|my_center|LOCUS_22030 3464 3246 gene locus_tag LOCUS_22040 gene bolA 3464 3246 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150944.1 protein_id gnl|my_center|LOCUS_22040 3611 4033 gene locus_tag LOCUS_22050 3611 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4071 4925 gene locus_tag LOCUS_22060 4071 4925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_22060 5674 4907 gene locus_tag LOCUS_22070 5674 4907 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG20 protein_id gnl|my_center|LOCUS_22070 6599 5664 gene locus_tag LOCUS_22080 6599 5664 CDS product ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205265.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence140 1301 390 gene locus_tag LOCUS_22090 1301 390 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_22090 1877 1362 gene locus_tag LOCUS_22100 1877 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2020 2784 gene locus_tag LOCUS_22110 2020 2784 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_22110 4752 3049 gene locus_tag LOCUS_22120 4752 3049 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_22120 5072 4815 gene locus_tag LOCUS_22130 gene fdx1 5072 4815 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_22130 5574 5077 gene locus_tag LOCUS_22140 gene coaD 5574 5077 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJN9 protein_id gnl|my_center|LOCUS_22140 6170 5562 gene locus_tag LOCUS_22150 6170 5562 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 protein_id gnl|my_center|LOCUS_22150 7352 6174 gene locus_tag LOCUS_22160 7352 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence141 877 164 gene locus_tag LOCUS_22170 gene mtnC 877 164 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_22170 1557 997 gene locus_tag LOCUS_22180 gene mtnD 1557 997 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67785 protein_id gnl|my_center|LOCUS_22180 2225 1554 gene locus_tag LOCUS_22190 gene mtnB 2225 1554 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_22190 2752 2576 gene locus_tag LOCUS_22200 gene rpmG 2752 2576 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57187 protein_id gnl|my_center|LOCUS_22200 2992 2756 gene locus_tag LOCUS_22210 gene rpmB 2992 2756 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM9 protein_id gnl|my_center|LOCUS_22210 3759 3088 gene locus_tag LOCUS_22220 3759 3088 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_22220 3831 5066 gene locus_tag LOCUS_22230 gene coaBC 3831 5066 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_22230 5063 5506 gene locus_tag LOCUS_22240 gene dut 5063 5506 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM6 protein_id gnl|my_center|LOCUS_22240 5506 6369 gene locus_tag LOCUS_22250 gene argB 5506 6369 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 protein_id gnl|my_center|LOCUS_22250 >Feature sequence142 439 1152 gene locus_tag LOCUS_22260 439 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1267 2892 gene locus_tag LOCUS_22270 gene atuC 1267 2892 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_22270 2947 3771 gene locus_tag LOCUS_22280 gene atuE 2947 3771 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_22280 3923 5938 gene locus_tag LOCUS_22290 gene atuF 3923 5938 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_22290 6409 5990 gene locus_tag LOCUS_22300 6409 5990 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence143 4662 3475 gene locus_tag LOCUS_22310 gene dhaT 4662 3475 CDS product alcohol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_22310 5170 4667 gene locus_tag LOCUS_22320 5170 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_22320 5978 5286 gene locus_tag LOCUS_22330 5978 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 <6940 5985 gene locus_tag LOCUS_22340 <6940 5985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PD06:acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence144 132 1220 gene locus_tag LOCUS_22350 132 1220 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W88 protein_id gnl|my_center|LOCUS_22350 1326 1712 gene locus_tag LOCUS_22360 1326 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1764 5939 gene locus_tag LOCUS_22370 1764 5939 CDS product intein-containing adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_22370 6876 5944 gene locus_tag LOCUS_22380 6876 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence145 1377 2561 gene locus_tag LOCUS_22390 gene aatA 1377 2561 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZE1 protein_id gnl|my_center|LOCUS_22390 2615 2690 gene locus_tag LOCUS_t00270 2615 2690 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3050 3403 gene locus_tag LOCUS_22400 3050 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5457 3400 gene locus_tag LOCUS_22410 5457 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5752 5828 gene locus_tag LOCUS_t00280 5752 5828 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 2472 958 gene locus_tag LOCUS_22420 gene dhaS 2472 958 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_22420 4710 2527 gene locus_tag LOCUS_22430 4710 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 6378 4837 gene locus_tag LOCUS_22440 6378 4837 CDS product putative long-chain-fatty-acid CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705282.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence147 1655 741 gene locus_tag LOCUS_22450 1655 741 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_22450 1870 2241 gene locus_tag LOCUS_22460 1870 2241 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 protein_id gnl|my_center|LOCUS_22460 2392 2961 gene locus_tag LOCUS_22470 gene ybcL 2392 2961 CDS product UPF0098 protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77368 protein_id gnl|my_center|LOCUS_22470 3046 4065 gene locus_tag LOCUS_22480 3046 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4640 4062 gene locus_tag LOCUS_22490 4640 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927005.1 protein_id gnl|my_center|LOCUS_22490 4770 5684 gene locus_tag LOCUS_22500 4770 5684 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence148 1768 734 gene locus_tag LOCUS_22510 1768 734 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHQ3 protein_id gnl|my_center|LOCUS_22510 2652 1765 gene locus_tag LOCUS_22520 2652 1765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_22520 3538 2726 gene locus_tag LOCUS_22530 gene uppP1 3538 2726 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_22530 4709 3591 gene locus_tag LOCUS_22540 gene tal 4709 3591 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ7 protein_id gnl|my_center|LOCUS_22540 5724 4861 gene locus_tag LOCUS_22550 5724 4861 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence149 864 2480 gene locus_tag LOCUS_22560 864 2480 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 protein_id gnl|my_center|LOCUS_22560 4008 2656 gene locus_tag LOCUS_22570 4008 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 6142 4094 gene locus_tag LOCUS_22580 6142 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence150 <1 968 gene locus_tag LOCUS_22590 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KL98:alanine racemase 2197 962 gene locus_tag LOCUS_22600 gene xcpS 2197 962 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_22600 3728 2208 gene locus_tag LOCUS_22610 gene xcpR 3728 2208 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_22610 5689 3725 gene locus_tag LOCUS_22620 5689 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 <6485 5743 gene locus_tag LOCUS_22630 <6485 5743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262834.1:type II secretion system protein GspC >Feature sequence151 8 1222 gene locus_tag LOCUS_22640 8 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1358 2221 gene locus_tag LOCUS_22650 gene ubiA 1358 2221 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_22650 2211 3152 gene locus_tag LOCUS_22660 2211 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3868 3131 gene locus_tag LOCUS_22670 3868 3131 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_22670 3991 4650 gene locus_tag LOCUS_22680 3991 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4679 5455 gene locus_tag LOCUS_22690 4679 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 <6397 5434 gene locus_tag LOCUS_22700 <6397 5434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I693:adenosylmethionine-8-amino-7-oxononanoate aminotransferase >Feature sequence152 581 907 gene locus_tag LOCUS_22710 581 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1287 904 gene locus_tag LOCUS_22720 1287 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1655 1314 gene locus_tag LOCUS_22730 1655 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2362 1658 gene locus_tag LOCUS_22740 2362 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3211 2372 gene locus_tag LOCUS_22750 3211 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4077 3211 gene locus_tag LOCUS_22760 4077 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 5558 4074 gene locus_tag LOCUS_22770 5558 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 <6389 5555 gene locus_tag LOCUS_22780 <6389 5555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336903.1:tail tape measure protein >Feature sequence153 430 651 gene locus_tag LOCUS_22790 430 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1870 632 gene locus_tag LOCUS_22800 1870 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_22800 2539 1967 gene locus_tag LOCUS_22810 2539 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2685 3545 gene locus_tag LOCUS_22820 2685 3545 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701513.1 protein_id gnl|my_center|LOCUS_22820 3542 4183 gene locus_tag LOCUS_22830 3542 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 4414 5934 gene locus_tag LOCUS_22840 gene aldA 4414 5934 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence154 <1 642 gene locus_tag LOCUS_22850 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZL7:lipoprotein-releasing system ATP-binding protein LolD 702 2870 gene locus_tag LOCUS_22860 gene comA 702 2870 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_22860 3343 2867 gene locus_tag LOCUS_22870 gene hisI 3343 2867 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QB5 protein_id gnl|my_center|LOCUS_22870 3257 3868 gene locus_tag LOCUS_22880 3257 3868 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_22880 4840 3950 gene locus_tag LOCUS_22890 gene queD 4840 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_22890 4890 6320 gene locus_tag LOCUS_22900 gene gltX 4890 6320 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43818 protein_id gnl|my_center|LOCUS_22900 >Feature sequence155 321 719 gene locus_tag LOCUS_22910 321 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22910 1502 684 gene locus_tag LOCUS_22920 1502 684 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229950.1 protein_id gnl|my_center|LOCUS_22920 1645 2061 gene locus_tag LOCUS_22930 1645 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2480 2058 gene locus_tag LOCUS_22940 2480 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2662 4029 gene locus_tag LOCUS_22950 2662 4029 CDS product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HMW0 protein_id gnl|my_center|LOCUS_22950 4622 4026 gene locus_tag LOCUS_22960 gene tag 4622 4026 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_22960 6001 4667 gene locus_tag LOCUS_22970 6001 4667 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence156 378 2288 gene locus_tag LOCUS_22980 378 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_22980 3029 2343 gene locus_tag LOCUS_22990 3029 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3440 3033 gene locus_tag LOCUS_23000 3440 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067451.1 protein_id gnl|my_center|LOCUS_23000 4670 3492 gene locus_tag LOCUS_23010 4670 3492 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_23010 4680 5330 gene locus_tag LOCUS_23020 4680 5330 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence157 1519 1962 gene locus_tag LOCUS_23030 1519 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2036 2605 gene locus_tag LOCUS_23040 2036 2605 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY9 protein_id gnl|my_center|LOCUS_23040 2602 3012 gene locus_tag LOCUS_23050 2602 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3027 3515 gene locus_tag LOCUS_23060 3027 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4168 3512 gene locus_tag LOCUS_23070 gene tpm 4168 3512 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_23070 4328 4735 gene locus_tag LOCUS_23080 4328 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4739 5290 gene locus_tag LOCUS_23090 4739 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23090 <6243 5295 gene locus_tag LOCUS_23100 <6243 5295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888962.1:potassium channel >Feature sequence158 925 11 gene locus_tag LOCUS_23110 925 11 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_23110 2166 919 gene locus_tag LOCUS_23120 2166 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_23120 2542 2306 gene locus_tag LOCUS_23130 2542 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3021 2539 gene locus_tag LOCUS_23140 3021 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3236 3736 gene locus_tag LOCUS_23150 3236 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 4363 3764 gene locus_tag LOCUS_23160 4363 3764 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401297.1 protein_id gnl|my_center|LOCUS_23160 4590 5894 gene locus_tag LOCUS_23170 gene fadI 4590 5894 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD46 protein_id gnl|my_center|LOCUS_23170 >Feature sequence159 716 75 gene locus_tag LOCUS_23180 gene adk 716 75 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 protein_id gnl|my_center|LOCUS_23180 826 2094 gene locus_tag LOCUS_23190 gene pfp 826 2094 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_23190 2147 2680 gene locus_tag LOCUS_23200 gene ppa 2147 2680 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK21 protein_id gnl|my_center|LOCUS_23200 2739 3128 gene locus_tag LOCUS_23210 2739 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_23210 3136 3633 gene locus_tag LOCUS_23220 3136 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4141 3551 gene locus_tag LOCUS_23230 4141 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 5091 4138 gene locus_tag LOCUS_23240 5091 4138 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence160 1101 46 gene locus_tag LOCUS_23250 1101 46 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_23250 1352 1564 gene locus_tag LOCUS_23260 1352 1564 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_23260 1697 2713 gene locus_tag LOCUS_23270 1697 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4136 2769 gene locus_tag LOCUS_23280 4136 2769 CDS product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 protein_id gnl|my_center|LOCUS_23280 4776 4291 gene locus_tag LOCUS_23290 4776 4291 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082473.1 protein_id gnl|my_center|LOCUS_23290 5642 4779 gene locus_tag LOCUS_23300 5642 4779 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence161 <1 2828 gene locus_tag LOCUS_23310 <1 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144210.1:polyketide synthase >Feature sequence162 987 598 gene locus_tag LOCUS_23320 987 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2646 1009 gene locus_tag LOCUS_23330 gene pgi 2646 1009 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SC4 protein_id gnl|my_center|LOCUS_23330 3341 2712 gene locus_tag LOCUS_23340 3341 2712 CDS product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_23340 3739 3359 gene locus_tag LOCUS_23350 gene panD 3739 3359 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_23350 4767 3922 gene locus_tag LOCUS_23360 gene panC 4767 3922 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_23360 5586 4771 gene locus_tag LOCUS_23370 gene panB 5586 4771 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HD8 protein_id gnl|my_center|LOCUS_23370 >Feature sequence163 1242 760 gene locus_tag LOCUS_23380 1242 760 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_23380 1718 1242 gene locus_tag LOCUS_23390 1718 1242 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_23390 3039 1702 gene locus_tag LOCUS_23400 gene rlmD 3039 1702 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_23400 3951 3073 gene locus_tag LOCUS_23410 3951 3073 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_23410 4517 4263 gene locus_tag LOCUS_23420 4517 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence164 1767 937 gene locus_tag LOCUS_23430 gene kdsA 1767 937 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B43 protein_id gnl|my_center|LOCUS_23430 3461 1764 gene locus_tag LOCUS_23440 gene pyrG 3461 1764 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_23440 4763 3537 gene locus_tag LOCUS_23450 4763 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5493 4936 gene locus_tag LOCUS_23460 5493 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence165 1616 669 gene locus_tag LOCUS_23470 gene hemC 1616 669 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPS4 protein_id gnl|my_center|LOCUS_23470 2365 1613 gene locus_tag LOCUS_23480 gene algR 2365 1613 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_23480 3455 2346 gene locus_tag LOCUS_23490 3455 2346 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318424.1 protein_id gnl|my_center|LOCUS_23490 3519 4895 gene locus_tag LOCUS_23500 gene argH 3519 4895 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_23500 >Feature sequence166 3851 2475 gene locus_tag LOCUS_23510 gene pmpM 3851 2475 CDS product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 protein_id gnl|my_center|LOCUS_23510 3928 4254 gene locus_tag LOCUS_23520 3928 4254 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_23520 4259 4762 gene locus_tag LOCUS_23530 4259 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4856 5296 gene locus_tag LOCUS_23540 gene aroQ 4856 5296 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM50 protein_id gnl|my_center|LOCUS_23540 >Feature sequence167 1223 390 gene locus_tag LOCUS_23550 1223 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1543 1226 gene locus_tag LOCUS_23560 1543 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2426 1563 gene locus_tag LOCUS_23570 gene dhaA 2426 1563 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_23570 3036 2416 gene locus_tag LOCUS_23580 3036 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 5113 3287 gene locus_tag LOCUS_23590 gene glmS 5113 3287 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83IY4 protein_id gnl|my_center|LOCUS_23590 >Feature sequence168 2413 2093 gene locus_tag LOCUS_23600 2413 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2889 2419 gene locus_tag LOCUS_23610 2889 2419 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_23610 3661 2921 gene locus_tag LOCUS_23620 3661 2921 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_23620 4198 3719 gene locus_tag LOCUS_23630 4198 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence169 752 3649 gene locus_tag LOCUS_23640 752 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4386 3646 gene locus_tag LOCUS_23650 4386 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5146 4694 gene locus_tag LOCUS_23660 5146 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence170 1230 2651 gene locus_tag LOCUS_23670 1230 2651 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67207 protein_id gnl|my_center|LOCUS_23670 2990 2670 gene locus_tag LOCUS_23680 gene fdx 2990 2670 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_23680 4246 3011 gene locus_tag LOCUS_23690 4246 3011 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_23690 <5300 4509 gene locus_tag LOCUS_23700 <5300 4509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895546.1:short-chain dehydrogenase >Feature sequence171 514 1140 gene locus_tag LOCUS_23710 514 1140 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_23710 1236 2000 gene locus_tag LOCUS_23720 1236 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404719.1 protein_id gnl|my_center|LOCUS_23720 2115 4304 gene locus_tag LOCUS_23730 gene glcB1 2115 4304 CDS product malate synthase G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AB2 protein_id gnl|my_center|LOCUS_23730 4410 4973 gene locus_tag LOCUS_23740 4410 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035986.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence172 697 308 gene locus_tag LOCUS_23750 gene tatB 697 308 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH0 protein_id gnl|my_center|LOCUS_23750 964 719 gene locus_tag LOCUS_23760 gene tatA 964 719 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GF0 protein_id gnl|my_center|LOCUS_23760 1320 967 gene locus_tag LOCUS_23770 gene hisE 1320 967 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA47 protein_id gnl|my_center|LOCUS_23770 2121 1336 gene locus_tag LOCUS_23780 gene hisF 2121 1336 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_23780 2856 2125 gene locus_tag LOCUS_23790 gene hisA 2856 2125 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA51 protein_id gnl|my_center|LOCUS_23790 3590 2949 gene locus_tag LOCUS_23800 gene hisH1 3590 2949 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_23800 4193 3603 gene locus_tag LOCUS_23810 gene hisB 4193 3603 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBH3 protein_id gnl|my_center|LOCUS_23810 4788 4348 gene locus_tag LOCUS_23820 gene dtd 4788 4348 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4H1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence173 <1 1371 gene locus_tag LOCUS_23830 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114249.1:AMP-binding protein 2268 1402 gene locus_tag LOCUS_23840 gene folD 2268 1402 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 protein_id gnl|my_center|LOCUS_23840 2398 2322 gene locus_tag LOCUS_t00290 2398 2322 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2810 2734 gene locus_tag LOCUS_t00300 2810 2734 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3047 3122 gene locus_tag LOCUS_t00310 3047 3122 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3138 3212 gene locus_tag LOCUS_t00320 3138 3212 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4326 3448 gene locus_tag LOCUS_23850 4326 3448 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066952.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence174 839 393 gene locus_tag LOCUS_23860 gene pilE 839 393 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_23860 2797 1181 gene locus_tag LOCUS_23870 gene guaA 2797 1181 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX09 protein_id gnl|my_center|LOCUS_23870 4325 2805 gene locus_tag LOCUS_23880 gene guaB 4325 2805 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_23880 >Feature sequence175 1144 1449 gene locus_tag LOCUS_23890 1144 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1804 1457 gene locus_tag LOCUS_23900 1804 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1979 2812 gene locus_tag LOCUS_23910 1979 2812 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_23910 4420 2948 gene locus_tag LOCUS_23920 4420 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 5131 4811 gene locus_tag LOCUS_23930 5131 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence176 1889 480 gene locus_tag LOCUS_23940 1889 480 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_23940 2227 3120 gene locus_tag LOCUS_23950 gene glyQ 2227 3120 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_23950 >Feature sequence177 <1 755 gene locus_tag LOCUS_23960 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45199:anaerobic regulatory protein 831 1988 gene locus_tag LOCUS_23970 831 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2571 1990 gene locus_tag LOCUS_23980 gene pdxH 2571 1990 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6X5 protein_id gnl|my_center|LOCUS_23980 3415 2708 gene locus_tag LOCUS_23990 3415 2708 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_23990 4671 3412 gene locus_tag LOCUS_24000 4671 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4907 4668 gene locus_tag LOCUS_24010 4907 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence178 2270 636 gene locus_tag LOCUS_24020 2270 636 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_24020 3058 2402 gene locus_tag LOCUS_24030 3058 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_24030 4827 3061 gene locus_tag LOCUS_24040 gene argS 4827 3061 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 protein_id gnl|my_center|LOCUS_24040 >Feature sequence179 514 1221 gene locus_tag LOCUS_24050 514 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2013 1261 gene locus_tag LOCUS_24060 2013 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2171 3106 gene locus_tag LOCUS_24070 2171 3106 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence180 252 1469 gene locus_tag LOCUS_24080 gene sat 252 1469 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_24080 1466 1972 gene locus_tag LOCUS_24090 1466 1972 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 protein_id gnl|my_center|LOCUS_24090 1969 2370 gene locus_tag LOCUS_24100 1969 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3335 2385 gene locus_tag LOCUS_24110 3335 2385 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_24110 >Feature sequence181 213 1172 gene locus_tag LOCUS_24120 213 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 3440 1179 gene locus_tag LOCUS_24130 3440 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_24130 4474 3455 gene locus_tag LOCUS_24140 4474 3455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence182 1025 432 gene locus_tag LOCUS_24150 1025 432 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_24150 1181 2809 gene locus_tag LOCUS_24160 gene nadB 1181 2809 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_24160 3397 2810 gene locus_tag LOCUS_24170 gene blc 3397 2810 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_24170 3846 3397 gene locus_tag LOCUS_24180 3846 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 4090 3824 gene locus_tag LOCUS_24190 4090 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V6 protein_id gnl|my_center|LOCUS_24190 4801 4133 gene locus_tag LOCUS_24200 4801 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence183 273 992 gene locus_tag LOCUS_24210 gene dnaQ 273 992 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_24210 1902 1006 gene locus_tag LOCUS_24220 gene aguB 1902 1006 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_24220 2921 1899 gene locus_tag LOCUS_24230 gene aguA 2921 1899 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_24230 3428 3063 gene locus_tag LOCUS_24240 3428 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3511 4758 gene locus_tag LOCUS_24250 3511 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence184 546 43 gene locus_tag LOCUS_24260 gene sixA 546 43 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_24260 1136 543 gene locus_tag LOCUS_24270 1136 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1289 1648 gene locus_tag LOCUS_24280 1289 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_24280 1651 2280 gene locus_tag LOCUS_24290 1651 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2277 2657 gene locus_tag LOCUS_24300 2277 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3454 2678 gene locus_tag LOCUS_24310 3454 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_24310 4252 3467 gene locus_tag LOCUS_24320 4252 3467 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_24320 4747 4319 gene locus_tag LOCUS_24330 4747 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence185 80 769 gene locus_tag LOCUS_24340 80 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2167 800 gene locus_tag LOCUS_24350 gene pmbA 2167 800 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_24350 3554 2217 gene locus_tag LOCUS_24360 gene mpl 3554 2217 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP5 protein_id gnl|my_center|LOCUS_24360 4112 3558 gene locus_tag LOCUS_24370 4112 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence186 1064 2407 gene locus_tag LOCUS_24380 1064 2407 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_24380 2404 3105 gene locus_tag LOCUS_24390 gene ubiG 2404 3105 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_24390 3102 3767 gene locus_tag LOCUS_24400 gene gph-1 3102 3767 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190123.1 protein_id gnl|my_center|LOCUS_24400 3768 4421 gene locus_tag LOCUS_24410 3768 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence187 122 1909 gene locus_tag LOCUS_24420 122 1909 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_24420 2599 1934 gene locus_tag LOCUS_24430 gene fabG 2599 1934 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 protein_id gnl|my_center|LOCUS_24430 4106 2724 gene locus_tag LOCUS_24440 4106 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4460 4194 gene locus_tag LOCUS_24450 4460 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence188 1616 2560 gene locus_tag LOCUS_24460 gene btuF 1616 2560 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_24460 2557 3531 gene locus_tag LOCUS_24470 2557 3531 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_24470 3528 4307 gene locus_tag LOCUS_24480 3528 4307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_24480 4498 4304 gene locus_tag LOCUS_24490 4498 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence189 61 1032 gene locus_tag LOCUS_24500 gene kdsD 61 1032 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_24500 1029 1547 gene locus_tag LOCUS_24510 1029 1547 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707616.1 protein_id gnl|my_center|LOCUS_24510 1547 2104 gene locus_tag LOCUS_24520 1547 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2157 2624 gene locus_tag LOCUS_24530 2157 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2621 3382 gene locus_tag LOCUS_24540 gene lptB 2621 3382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_24540 3893 3429 gene locus_tag LOCUS_24550 3893 3429 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_24550 <4453 3927 gene locus_tag LOCUS_24560 <4453 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTW2:5-formyltetrahydrofolate cyclo-ligase >Feature sequence190 108 2501 gene locus_tag LOCUS_24570 gene fasD 108 2501 CDS product outer membrane usher protein FasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636753.2 protein_id gnl|my_center|LOCUS_24570 2606 3520 gene locus_tag LOCUS_24580 2606 3520 CDS product spore coat protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036570.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence191 1720 854 gene locus_tag LOCUS_24590 1720 854 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_24590 2643 1717 gene locus_tag LOCUS_24600 gene oppB 2643 1717 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_24600 4181 2640 gene locus_tag LOCUS_24610 4181 2640 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence192 792 442 gene locus_tag LOCUS_24620 792 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1036 821 gene locus_tag LOCUS_24630 1036 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1277 2827 gene locus_tag LOCUS_24640 1277 2827 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266304.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence193 1303 443 gene locus_tag LOCUS_24650 1303 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2953 1424 gene locus_tag LOCUS_24660 2953 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3773 2961 gene locus_tag LOCUS_24670 3773 2961 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence194 3284 1488 gene locus_tag LOCUS_24680 gene atuA 3284 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_24680 3931 3392 gene locus_tag LOCUS_24690 gene pgpA 3931 3392 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_24690 >Feature sequence195 1844 573 gene locus_tag LOCUS_24700 1844 573 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_24700 2866 1841 gene locus_tag LOCUS_24710 2866 1841 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence196 1033 2688 gene locus_tag LOCUS_24720 1033 2688 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190516.1 protein_id gnl|my_center|LOCUS_24720 2723 4150 gene locus_tag LOCUS_24730 2723 4150 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence197 257 472 gene locus_tag LOCUS_24740 257 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1945 572 gene locus_tag LOCUS_24750 1945 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_24750 2106 2765 gene locus_tag LOCUS_24760 2106 2765 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence198 400 197 gene locus_tag LOCUS_24770 400 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 433 1164 gene locus_tag LOCUS_24780 433 1164 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P484 protein_id gnl|my_center|LOCUS_24780 1161 1766 gene locus_tag LOCUS_24790 1161 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_24790 1763 2791 gene locus_tag LOCUS_24800 1763 2791 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_24800 2788 3708 gene locus_tag LOCUS_24810 gene cyoE 2788 3708 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG0 protein_id gnl|my_center|LOCUS_24810 >Feature sequence199 135 1211 gene locus_tag LOCUS_24820 135 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_24820 2005 1265 gene locus_tag LOCUS_24830 2005 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3162 2002 gene locus_tag LOCUS_24840 3162 2002 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_24840 4243 3164 gene locus_tag LOCUS_24850 4243 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence200 1099 404 gene locus_tag LOCUS_24860 1099 404 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 protein_id gnl|my_center|LOCUS_24860 1863 1096 gene locus_tag LOCUS_24870 gene modA 1863 1096 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 protein_id gnl|my_center|LOCUS_24870 1979 2872 gene locus_tag LOCUS_24880 1979 2872 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_24880 4230 2941 gene locus_tag LOCUS_24890 4230 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence201 2655 1219 gene locus_tag LOCUS_24900 2655 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_24900 2813 3010 gene locus_tag LOCUS_24910 2813 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3052 3753 gene locus_tag LOCUS_24920 3052 3753 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087255.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence202 1084 2154 gene locus_tag LOCUS_24930 gene lptF 1084 2154 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_24930 2151 3215 gene locus_tag LOCUS_24940 2151 3215 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_24940 <4146 3232 gene locus_tag LOCUS_24950 <4146 3232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C0F6:sensory/regulatory protein RpfC >Feature sequence203 <1 677 gene locus_tag LOCUS_24960 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUL5:peptide chain release factor 2 674 2188 gene locus_tag LOCUS_24970 gene lysS 674 2188 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L3G6 protein_id gnl|my_center|LOCUS_24970 >Feature sequence204 119 46 gene locus_tag LOCUS_t00330 119 46 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 572 177 gene locus_tag LOCUS_24980 gene rpsI 572 177 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_24980 1015 587 gene locus_tag LOCUS_24990 gene rplM 1015 587 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44387 protein_id gnl|my_center|LOCUS_24990 1198 1779 gene locus_tag LOCUS_25000 1198 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2748 1786 gene locus_tag LOCUS_25010 2748 1786 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_25010 3326 2778 gene locus_tag LOCUS_25020 3326 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 <4143 3326 gene locus_tag LOCUS_25030 <4143 3326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUF0:ribosomal RNA large subunit methyltransferase J >Feature sequence205 39 1619 gene locus_tag LOCUS_25040 39 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3327 1867 gene locus_tag LOCUS_25050 3327 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3552 3337 gene locus_tag LOCUS_25060 3552 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence206 <1 3450 gene locus_tag LOCUS_25070 <1 3450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZV82:transcription-repair-coupling factor 3447 4061 gene locus_tag LOCUS_25080 3447 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence207 2243 1191 gene locus_tag LOCUS_25090 2243 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2956 2267 gene locus_tag LOCUS_25100 gene gloB 2956 2267 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_25100 3048 3854 gene locus_tag LOCUS_25110 3048 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence208 1846 497 gene locus_tag LOCUS_25120 gene trpE 1846 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_25120 3083 1839 gene locus_tag LOCUS_25130 gene fabF1 3083 1839 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_25130 3374 3129 gene locus_tag LOCUS_25140 gene acpP 3374 3129 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP4 protein_id gnl|my_center|LOCUS_25140 >Feature sequence209 <1 1681 gene locus_tag LOCUS_25150 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919171.1:two-component sensor histidine kinase 1918 2469 gene locus_tag LOCUS_25160 1918 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_25160 <3898 2687 gene locus_tag LOCUS_25170 <3898 2687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIV5:catalase-peroxidase 2 >Feature sequence210 2667 424 gene locus_tag LOCUS_25180 2667 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_25180 2917 3762 gene locus_tag LOCUS_25190 2917 3762 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415986.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence211 <1 1203 gene locus_tag LOCUS_25200 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269202.1:membrane protein 1200 2678 gene locus_tag LOCUS_25210 1200 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 protein_id gnl|my_center|LOCUS_25210 2668 3609 gene locus_tag LOCUS_25220 2668 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence212 784 80 gene locus_tag LOCUS_25230 784 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 890 2110 gene locus_tag LOCUS_25240 gene glcF-2 890 2110 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP9 protein_id gnl|my_center|LOCUS_25240 2675 2118 gene locus_tag LOCUS_25250 2675 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 <3820 2672 gene locus_tag LOCUS_25260 <3820 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HX33:leucine--tRNA ligase >Feature sequence213 3494 480 gene locus_tag LOCUS_25270 3494 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence214 <1 1098 gene locus_tag LOCUS_25280 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206178.1:cyclohexanone monooxygenase 1189 1914 gene locus_tag LOCUS_25290 1189 1914 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_25290 2020 2481 gene locus_tag LOCUS_25300 2020 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 <3696 2524 gene locus_tag LOCUS_25310 <3696 2524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538457.1:cytochrome c >Feature sequence215 1693 290 gene locus_tag LOCUS_25320 1693 290 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266589.1 protein_id gnl|my_center|LOCUS_25320 3261 1690 gene locus_tag LOCUS_25330 gene pilS 3261 1690 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 protein_id gnl|my_center|LOCUS_25330 3469 3254 gene locus_tag LOCUS_25340 3469 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence216 2848 1898 gene locus_tag LOCUS_25350 2848 1898 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202848.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence217 977 360 gene locus_tag LOCUS_25360 gene cobO 977 360 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_25360 2252 1047 gene locus_tag LOCUS_25370 2252 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3195 2269 gene locus_tag LOCUS_25380 3195 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence218 577 1461 gene locus_tag LOCUS_25390 577 1461 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_25390 1542 2156 gene locus_tag LOCUS_25400 gene ycaC 1542 2156 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167611.1 protein_id gnl|my_center|LOCUS_25400 2253 3167 gene locus_tag LOCUS_25410 2253 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence219 1459 848 gene locus_tag LOCUS_25420 1459 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1607 2794 gene locus_tag LOCUS_25430 1607 2794 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105544.1 protein_id gnl|my_center|LOCUS_25430 2794 3420 gene locus_tag LOCUS_25440 2794 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence220 <1 913 gene locus_tag LOCUS_25450 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404368.1:lysyl endopeptidase 947 1900 gene locus_tag LOCUS_25460 947 1900 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_25460 3181 1853 gene locus_tag LOCUS_25470 gene adcK4 3181 1853 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence221 98 1387 gene locus_tag LOCUS_25480 gene cobB 98 1387 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I471 protein_id gnl|my_center|LOCUS_25480 1384 2034 gene locus_tag LOCUS_25490 1384 2034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185643.1 protein_id gnl|my_center|LOCUS_25490 2031 2840 gene locus_tag LOCUS_25500 2031 2840 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence222 3 1850 gene locus_tag LOCUS_25510 3 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2131 2574 gene locus_tag LOCUS_25520 2131 2574 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_25520 2571 3017 gene locus_tag LOCUS_25530 2571 3017 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence223 >Feature sequence224 1838 180 gene locus_tag LOCUS_25540 gene ilvD 1838 180 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ69 protein_id gnl|my_center|LOCUS_25540 1995 2855 gene locus_tag LOCUS_25550 gene catR 1995 2855 CDS product transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence225 2962 1757 gene locus_tag LOCUS_25560 2962 1757 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence226 1943 1041 gene locus_tag LOCUS_25570 gene cztR 1943 1041 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_25570 2387 1971 gene locus_tag LOCUS_25580 2387 1971 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114826.1 protein_id gnl|my_center|LOCUS_25580 <3365 2479 gene locus_tag LOCUS_25590 <3365 2479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826015.1:alpha/beta hydrolase >Feature sequence227 697 149 gene locus_tag LOCUS_25600 697 149 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_25600 808 1533 gene locus_tag LOCUS_25610 808 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1651 2118 gene locus_tag LOCUS_25620 gene purE 1651 2118 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7V5 protein_id gnl|my_center|LOCUS_25620 2115 3257 gene locus_tag LOCUS_25630 gene purK 2115 3257 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY0 protein_id gnl|my_center|LOCUS_25630 >Feature sequence228 <3321 2743 gene locus_tag LOCUS_25640 <3321 2743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVM3:riboflavin biosynthesis protein >Feature sequence229 2707 1931 gene locus_tag LOCUS_25650 2707 1931 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_25650 3044 2712 gene locus_tag LOCUS_25660 3044 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence230 1237 683 gene locus_tag LOCUS_25670 gene orn 1237 683 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_25670 1316 2158 gene locus_tag LOCUS_25680 1316 2158 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_25680 2189 2527 gene locus_tag LOCUS_25690 2189 2527 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_25690 2851 2540 gene locus_tag LOCUS_25700 2851 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 3226 2867 gene locus_tag LOCUS_25710 3226 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence231 217 390 gene locus_tag LOCUS_25720 217 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1545 499 gene locus_tag LOCUS_25730 gene mhpE 1545 499 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q9 protein_id gnl|my_center|LOCUS_25730 2802 1885 gene locus_tag LOCUS_25740 gene mhpF 2802 1885 CDS product acetaldehyde dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4S7 protein_id gnl|my_center|LOCUS_25740 >Feature sequence232 <1 1423 gene locus_tag LOCUS_25750 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZG0:ribosomal RNA large subunit methyltransferase K/L 1426 2169 gene locus_tag LOCUS_25760 1426 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2251 3084 gene locus_tag LOCUS_25770 2251 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence233 900 70 gene locus_tag LOCUS_25780 900 70 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_25780 2046 973 gene locus_tag LOCUS_25790 2046 973 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_25790 <3087 2052 gene locus_tag LOCUS_25800 <3087 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNL4:threonine--tRNA ligase >Feature sequence234 526 1134 gene locus_tag LOCUS_25810 526 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_25810 1142 1660 gene locus_tag LOCUS_25820 1142 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1664 2353 gene locus_tag LOCUS_25830 1664 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 <3065 2378 gene locus_tag LOCUS_25840 <3065 2378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGW0:hemin import ATP-binding protein HmuV >Feature sequence235 <1 902 gene locus_tag LOCUS_25850 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110600.1:A/G-specific adenine glycosylase 899 1189 gene locus_tag LOCUS_25860 899 1189 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCJ9 protein_id gnl|my_center|LOCUS_25860 1200 1850 gene locus_tag LOCUS_25870 gene coq7 1200 1850 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4P1 protein_id gnl|my_center|LOCUS_25870 2202 1858 gene locus_tag LOCUS_25880 2202 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2248 2940 gene locus_tag LOCUS_25890 2248 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence236 1675 2292 gene locus_tag LOCUS_25900 1675 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2345 2734 gene locus_tag LOCUS_25910 2345 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence237 <1 2313 gene locus_tag LOCUS_25920 <1 2313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56883:DNA mismatch repair protein MutS <2983 2310 gene locus_tag LOCUS_25930 <2983 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528052.1:adenosine kinase >Feature sequence238 327 1514 gene locus_tag LOCUS_25940 327 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721110.1 protein_id gnl|my_center|LOCUS_25940 2285 1623 gene locus_tag LOCUS_25950 2285 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 <2895 2322 gene locus_tag LOCUS_25960 <2895 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705782.1:LysR family transcriptional regulator >Feature sequence239 324 1343 gene locus_tag LOCUS_25970 324 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1340 1651 gene locus_tag LOCUS_25980 1340 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence240 1238 240 gene locus_tag LOCUS_25990 1238 240 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 protein_id gnl|my_center|LOCUS_25990 2540 1254 gene locus_tag LOCUS_26000 gene waaA 2540 1254 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence241 787 712 gene locus_tag LOCUS_t00340 787 712 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1024 951 gene locus_tag LOCUS_t00350 1024 951 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1315 1231 gene locus_tag LOCUS_t00360 1315 1231 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 <2830 1394 gene locus_tag LOCUS_26010 <2830 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405451.1:ATP-dependent helicase HrpB >Feature sequence242 1532 816 gene locus_tag LOCUS_26020 1532 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 <2718 1529 gene locus_tag LOCUS_26030 <2718 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3I6:chromosome partition protein Smc >Feature sequence243 2072 825 gene locus_tag LOCUS_26040 gene moeA 2072 825 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_26040 2570 2079 gene locus_tag LOCUS_26050 gene moaC 2570 2079 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y0 protein_id gnl|my_center|LOCUS_26050 >Feature sequence244 1897 1598 gene locus_tag LOCUS_26060 1897 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 <2713 1908 gene locus_tag LOCUS_26070 <2713 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389868.1:sulfotransferase >Feature sequence245 <1 2091 gene locus_tag LOCUS_26080 <1 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769571.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 2143 2541 gene locus_tag LOCUS_26090 2143 2541 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687566.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence246 1553 2602 gene locus_tag LOCUS_26100 1553 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence247 410 1564 gene locus_tag LOCUS_26110 410 1564 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_26110 1567 2586 gene locus_tag LOCUS_26120 1567 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence248 537 2006 gene locus_tag LOCUS_26130 537 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence249 156 1184 gene locus_tag LOCUS_26140 gene tsaD 156 1184 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRN6 protein_id gnl|my_center|LOCUS_26140 1177 1551 gene locus_tag LOCUS_26150 gene folB 1177 1551 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJU5 protein_id gnl|my_center|LOCUS_26150 2025 1570 gene locus_tag LOCUS_26160 2025 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 <2577 2056 gene locus_tag LOCUS_26170 <2577 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63X70:glycine--tRNA ligase beta subunit >Feature sequence250 2054 39 gene locus_tag LOCUS_26180 2054 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence251 2020 137 gene locus_tag LOCUS_26190 2020 137 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence252 <2529 977 gene locus_tag LOCUS_26200 <2529 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113975.1:lytic transglycosylase >Feature sequence253 1176 94 gene locus_tag LOCUS_26210 gene mraY 1176 94 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_26210 <2512 1157 gene locus_tag LOCUS_26220 <2512 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83F27:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence254 670 1098 gene locus_tag LOCUS_26230 670 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1216 1599 gene locus_tag LOCUS_26240 1216 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence255 76 1059 gene locus_tag LOCUS_26250 76 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_26250 1056 1679 gene locus_tag LOCUS_26260 gene tmk 1056 1679 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX2 protein_id gnl|my_center|LOCUS_26260 >Feature sequence256 184 1467 gene locus_tag LOCUS_26270 gene yfeW 184 1467 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_26270 2280 1477 gene locus_tag LOCUS_26280 2280 1477 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence257 399 1574 gene locus_tag LOCUS_26290 gene ivd 399 1574 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence258 <1 1277 gene locus_tag LOCUS_26300 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037738.1:DUF3971 domain-containing protein 1274 2098 gene locus_tag LOCUS_26310 1274 2098 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence259 1835 807 gene locus_tag LOCUS_26320 1835 807 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_26320 <2420 1820 gene locus_tag LOCUS_26330 <2420 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140583.1:hemin ABC transporter substrate-binding protein >Feature sequence260 2196 976 gene locus_tag LOCUS_26340 2196 976 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence261 2388 1210 gene locus_tag LOCUS_26350 gene umuC 2388 1210 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence262 999 1083 gene locus_tag LOCUS_t00370 999 1083 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence263 295 510 gene locus_tag LOCUS_26360 gene rpsU 295 510 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66536 protein_id gnl|my_center|LOCUS_26360 528 974 gene locus_tag LOCUS_26370 528 974 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence264 193 266 gene locus_tag LOCUS_t00380 193 266 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 354 1253 gene locus_tag LOCUS_26380 gene rdgC 354 1253 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1R9 protein_id gnl|my_center|LOCUS_26380 1853 1275 gene locus_tag LOCUS_26390 1853 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence265 <1 1078 gene locus_tag LOCUS_26400 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071945.1:flagellar motor protein MotA 1075 1611 gene locus_tag LOCUS_26410 gene exbB 1075 1611 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_26410 1608 2027 gene locus_tag LOCUS_26420 1608 2027 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence266 <1 1011 gene locus_tag LOCUS_26430 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036209.1:membrane protein 1478 990 gene locus_tag LOCUS_26440 gene rimI 1478 990 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_26440 2103 1462 gene locus_tag LOCUS_26450 2103 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence267 <1 569 gene locus_tag LOCUS_26460 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974901.1:sucrose phosphorylase >Feature sequence268 <1 671 gene locus_tag LOCUS_26470 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000164216.1:phosphomannomutase >Feature sequence269 1096 287 gene locus_tag LOCUS_26480 1096 287 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence270 2066 852 gene locus_tag LOCUS_26490 gene argJ 2066 852 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_26490 >Feature sequence271 <1 965 gene locus_tag LOCUS_26500 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004531119.1:MATE family efflux transporter 1028 1486 gene locus_tag LOCUS_26510 1028 1486 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence272 1176 178 gene locus_tag LOCUS_26520 1176 178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_26520 1752 1186 gene locus_tag LOCUS_26530 1752 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence273 330 79 gene locus_tag LOCUS_26540 gene rpmA 330 79 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR69 protein_id gnl|my_center|LOCUS_26540 681 367 gene locus_tag LOCUS_26550 gene rplU 681 367 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 protein_id gnl|my_center|LOCUS_26550 872 1840 gene locus_tag LOCUS_26560 gene ispB 872 1840 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_26560 1870 1946 gene locus_tag LOCUS_t00390 1870 1946 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence274 709 1851 gene locus_tag LOCUS_26570 709 1851 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence275 <1 946 gene locus_tag LOCUS_26580 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBH0:GTPase Obg >Feature sequence276 1397 597 gene locus_tag LOCUS_26590 1397 597 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_26590 1748 1407 gene locus_tag LOCUS_26600 1748 1407 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918289.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence277 <1 741 gene locus_tag LOCUS_26610 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140499.1:methyltransferase 808 1239 gene locus_tag LOCUS_26620 808 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence278 1822 818 gene locus_tag LOCUS_26630 gene bioB 1822 818 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDK6 protein_id gnl|my_center|LOCUS_26630 >Feature sequence279 >Feature sequence280 <1919 1095 gene locus_tag LOCUS_26640 <1919 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640168.1:ribonuclease Z >Feature sequence281 324 896 gene locus_tag LOCUS_26650 324 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 949 1371 gene locus_tag LOCUS_26660 949 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence282 >Feature sequence283 1020 739 gene locus_tag LOCUS_26670 gene ftsB 1020 739 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ1 protein_id gnl|my_center|LOCUS_26670 <1852 1030 gene locus_tag LOCUS_26680 <1852 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXZ5:enolase >Feature sequence284 2 631 gene locus_tag LOCUS_26690 2 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence285 127 750 gene locus_tag LOCUS_26700 127 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence286 <1654 381 gene locus_tag LOCUS_26710 <1654 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256609.1:deoxyribodipyrimidine photo-lyase >Feature sequence287 <1649 470 gene locus_tag LOCUS_26720 <1649 470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036625.1:deoxyribodipyrimidine photo-lyase >Feature sequence288 282 860 gene locus_tag LOCUS_26730 gene hpt 282 860 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036478.1 protein_id gnl|my_center|LOCUS_26730 857 1615 gene locus_tag LOCUS_26740 857 1615 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence289 <1 1282 gene locus_tag LOCUS_26750 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704599.1:metallophosphatase >Feature sequence290 >Feature sequence291 <1 1050 gene locus_tag LOCUS_26760 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036483.1:ATP-dependent DNA ligase <1585 1057 gene locus_tag LOCUS_26770 <1585 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256111.1:membrane protein >Feature sequence292 >Feature sequence293 835 1233 gene locus_tag LOCUS_26780 835 1233 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence294 56 883 gene locus_tag LOCUS_26790 56 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence295 206 1405 gene locus_tag LOCUS_26800 206 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence296 358 1068 gene locus_tag LOCUS_26810 gene pyrF 358 1068 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT0 protein_id gnl|my_center|LOCUS_26810 >Feature sequence297 <1 910 gene locus_tag LOCUS_26820 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186079.1:SAM-dependent methyltransferase 1413 916 gene locus_tag LOCUS_26830 1413 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence298 >Feature sequence299 470 1264 gene locus_tag LOCUS_26840 470 1264 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_26840 >Feature sequence300 1211 123 gene locus_tag LOCUS_26850 gene prfA 1211 123 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIN3 protein_id gnl|my_center|LOCUS_26850 >Feature sequence301 1411 698 gene locus_tag LOCUS_26860 1411 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence302 >Feature sequence303 804 457 gene locus_tag LOCUS_26870 804 457 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_26870 1200 817 gene locus_tag LOCUS_26880 1200 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence304 <1409 770 gene locus_tag LOCUS_26890 <1409 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCI7:methylenetetrahydrofolate reductase >Feature sequence305 <1 651 gene locus_tag LOCUS_26900 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEG8:adenosylhomocysteinase >Feature sequence306 <1386 745 gene locus_tag LOCUS_26910 <1386 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103309.1:phosphoribosyltransferase >Feature sequence307 1080 175 gene locus_tag LOCUS_26920 1080 175 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309235.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence308 >Feature sequence309 1 741 gene locus_tag LOCUS_26930 1 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence310 <1 1050 gene locus_tag LOCUS_26940 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103011.1:aminopeptidase >Feature sequence311 1131 733 gene locus_tag LOCUS_26950 gene crcB2 1131 733 CDS product putative fluoride ion transporter CrcB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07591 protein_id gnl|my_center|LOCUS_26950 >Feature sequence312 182 625 gene locus_tag LOCUS_26960 182 625 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence313 <1 925 gene locus_tag LOCUS_26970 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531908.1:ATP-dependent DNA helicase RecG >Feature sequence314 >Feature sequence315 1247 438 gene locus_tag LOCUS_26980 1247 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence316 114 311 gene locus_tag LOCUS_26990 114 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 311 676 gene locus_tag LOCUS_27000 311 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 673 969 gene locus_tag LOCUS_27010 gene gp26 673 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence317 136 852 gene locus_tag LOCUS_27020 gene thiM 136 852 CDS product putative hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAS9 protein_id gnl|my_center|LOCUS_27020 >Feature sequence318 >Feature sequence319 446 27 gene locus_tag LOCUS_27030 446 27 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085743.1 protein_id gnl|my_center|LOCUS_27030 <1226 522 gene locus_tag LOCUS_27040 <1226 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087142.1:CoA transferase >Feature sequence320 162 1019 gene locus_tag LOCUS_27050 162 1019 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096985.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence321 >Feature sequence322 >Feature sequence323 >Feature sequence324 49 912 gene locus_tag LOCUS_27060 49 912 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence325 >Feature sequence326 921 430 gene locus_tag LOCUS_27070 gene lspA 921 430 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU46 protein_id gnl|my_center|LOCUS_27070 >Feature sequence327 78 467 gene locus_tag LOCUS_27080 78 467 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084495.1 protein_id gnl|my_center|LOCUS_27080 491 835 gene locus_tag LOCUS_27090 491 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27090 >Feature sequence328 >Feature sequence329 >Feature sequence330 <1 665 gene locus_tag LOCUS_27100 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8E4:DNA mismatch repair protein MutL >Feature sequence331 >Feature sequence332 <1026 422 gene locus_tag LOCUS_27110 <1026 422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073578.1:sterol desaturase >Feature sequence333