>Feature sequence001 1417 788 gene locus_tag LOCUS_00010 1417 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1892 2290 gene locus_tag LOCUS_00020 1892 2290 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62L95 protein_id gnl|my_center|LOCUS_00020 2315 2686 gene locus_tag LOCUS_00030 2315 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2752 3987 gene locus_tag LOCUS_00040 2752 3987 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_00040 4061 5497 gene locus_tag LOCUS_00050 4061 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 protein_id gnl|my_center|LOCUS_00050 5494 8634 gene locus_tag LOCUS_00060 5494 8634 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189156.1 protein_id gnl|my_center|LOCUS_00060 10295 9342 gene locus_tag LOCUS_00070 gene pphA 10295 9342 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930070.1 protein_id gnl|my_center|LOCUS_00070 11055 10297 gene locus_tag LOCUS_00080 11055 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_00080 11562 11059 gene locus_tag LOCUS_00090 11562 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13255 11837 gene locus_tag LOCUS_00100 gene oprN 13255 11837 CDS product multidrug efflux outer membrane protein OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_00100 16406 13248 gene locus_tag LOCUS_00110 16406 13248 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_00110 17618 16410 gene locus_tag LOCUS_00120 17618 16410 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038815.1 protein_id gnl|my_center|LOCUS_00120 18980 17955 gene locus_tag LOCUS_00130 18980 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 19507 18977 gene locus_tag LOCUS_00140 19507 18977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20581 19514 gene locus_tag LOCUS_00150 20581 19514 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_00150 20672 20905 gene locus_tag LOCUS_00160 20672 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082903.1 protein_id gnl|my_center|LOCUS_00160 20902 21123 gene locus_tag LOCUS_00170 20902 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21130 21420 gene locus_tag LOCUS_00180 21130 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21451 21813 gene locus_tag LOCUS_00190 21451 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21826 23208 gene locus_tag LOCUS_00200 21826 23208 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 protein_id gnl|my_center|LOCUS_00200 23258 23761 gene locus_tag LOCUS_00210 23258 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_00210 23935 23789 gene locus_tag LOCUS_00220 23935 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25315 23996 gene locus_tag LOCUS_00230 25315 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25842 25312 gene locus_tag LOCUS_00240 25842 25312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26308 25835 gene locus_tag LOCUS_00250 26308 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26384 26611 gene locus_tag LOCUS_00260 26384 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29025 27892 gene locus_tag LOCUS_00270 29025 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29143 29424 gene locus_tag LOCUS_00280 29143 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 >Feature sequence002 1868 1254 gene locus_tag LOCUS_00290 1868 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 2105 3313 gene locus_tag LOCUS_00300 2105 3313 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_00300 3398 5533 gene locus_tag LOCUS_00310 3398 5533 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_00310 5526 6683 gene locus_tag LOCUS_00320 5526 6683 CDS product putative acyl CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702816.1 protein_id gnl|my_center|LOCUS_00320 6744 8999 gene locus_tag LOCUS_00330 gene fadE 6744 8999 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_00330 9061 10209 gene locus_tag LOCUS_00340 9061 10209 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_00340 10792 10280 gene locus_tag LOCUS_00350 10792 10280 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_00350 11244 10819 gene locus_tag LOCUS_00360 11244 10819 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_00360 12079 11474 gene locus_tag LOCUS_00370 12079 11474 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 protein_id gnl|my_center|LOCUS_00370 13200 12076 gene locus_tag LOCUS_00380 13200 12076 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 protein_id gnl|my_center|LOCUS_00380 13328 13693 gene locus_tag LOCUS_00390 13328 13693 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265884.1 protein_id gnl|my_center|LOCUS_00390 13696 13962 gene locus_tag LOCUS_00400 13696 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 14045 14830 gene locus_tag LOCUS_00410 14045 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 14929 15939 gene locus_tag LOCUS_00420 14929 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701235.1 protein_id gnl|my_center|LOCUS_00420 >Feature sequence003 2221 635 gene locus_tag LOCUS_00430 2221 635 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG14 protein_id gnl|my_center|LOCUS_00430 2845 2363 gene locus_tag LOCUS_00440 2845 2363 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SX7 protein_id gnl|my_center|LOCUS_00440 3366 2854 gene locus_tag LOCUS_00450 gene dsbB 3366 2854 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC32 protein_id gnl|my_center|LOCUS_00450 4935 3382 gene locus_tag LOCUS_00460 4935 3382 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAC6 protein_id gnl|my_center|LOCUS_00460 6401 4980 gene locus_tag LOCUS_00470 gene fumC 6401 4980 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 protein_id gnl|my_center|LOCUS_00470 6549 6370 gene locus_tag LOCUS_00480 6549 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 6515 7882 gene locus_tag LOCUS_00490 gene purB 6515 7882 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K9 protein_id gnl|my_center|LOCUS_00490 7891 8397 gene locus_tag LOCUS_00500 7891 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 8849 8403 gene locus_tag LOCUS_00510 8849 8403 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404884.1 protein_id gnl|my_center|LOCUS_00510 9061 8846 gene locus_tag LOCUS_00520 9061 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 10336 9134 gene locus_tag LOCUS_00530 10336 9134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_00530 11423 10416 gene locus_tag LOCUS_00540 gene pyrD 11423 10416 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62K45 protein_id gnl|my_center|LOCUS_00540 13438 11447 gene locus_tag LOCUS_00550 13438 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 14061 13447 gene locus_tag LOCUS_00560 gene ribA 14061 13447 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q3 protein_id gnl|my_center|LOCUS_00560 >Feature sequence004 1526 606 gene locus_tag LOCUS_00570 gene araC 1526 606 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_00570 1743 3155 gene locus_tag LOCUS_00580 1743 3155 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_00580 3152 3322 gene locus_tag LOCUS_00590 gene rubA 3152 3322 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_00590 3851 3351 gene locus_tag LOCUS_00600 3851 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 4150 5979 gene locus_tag LOCUS_00610 4150 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 6017 7018 gene locus_tag LOCUS_00620 6017 7018 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_00620 7149 8258 gene locus_tag LOCUS_00630 7149 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 8270 9421 gene locus_tag LOCUS_00640 8270 9421 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_00640 9520 10311 gene locus_tag LOCUS_00650 9520 10311 CDS product putative Short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704905.1 protein_id gnl|my_center|LOCUS_00650 10327 11031 gene locus_tag LOCUS_00660 10327 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_00660 12112 11054 gene locus_tag LOCUS_00670 12112 11054 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_00670 14018 12117 gene locus_tag LOCUS_00680 gene gbt 14018 12117 CDS product glycine/betaine transmethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 <1 1115 gene locus_tag LOCUS_00690 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8P5:30S ribosomal protein S1 1243 1578 gene locus_tag LOCUS_00700 gene ihfB 1243 1578 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 protein_id gnl|my_center|LOCUS_00700 1590 1904 gene locus_tag LOCUS_00710 1590 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 1913 3079 gene locus_tag LOCUS_00720 gene lapB 1913 3079 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_00720 3141 4127 gene locus_tag LOCUS_00730 gene dfrA 3141 4127 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_00730 5633 4164 gene locus_tag LOCUS_00740 5633 4164 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_00740 6626 5727 gene locus_tag LOCUS_00750 6626 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7056 6628 gene locus_tag LOCUS_00760 7056 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7685 7053 gene locus_tag LOCUS_00770 7685 7053 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 protein_id gnl|my_center|LOCUS_00770 7778 8683 gene locus_tag LOCUS_00780 gene prmB 7778 8683 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_00780 8693 9793 gene locus_tag LOCUS_00790 gene aroC 8693 9793 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRQ8 protein_id gnl|my_center|LOCUS_00790 9798 10964 gene locus_tag LOCUS_00800 9798 10964 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_00800 11901 11020 gene locus_tag LOCUS_00810 11901 11020 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103885.1 protein_id gnl|my_center|LOCUS_00810 12015 12638 gene locus_tag LOCUS_00820 12015 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 >Feature sequence006 961 1236 gene locus_tag LOCUS_00830 961 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082658.1 protein_id gnl|my_center|LOCUS_00830 1907 1356 gene locus_tag LOCUS_00840 1907 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 2893 1937 gene locus_tag LOCUS_00850 2893 1937 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_00850 3463 3014 gene locus_tag LOCUS_00860 3463 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3810 3460 gene locus_tag LOCUS_00870 3810 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 6980 3807 gene locus_tag LOCUS_00880 6980 3807 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_00880 8017 6992 gene locus_tag LOCUS_00890 8017 6992 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_00890 9282 8029 gene locus_tag LOCUS_00900 gene czcC 9282 8029 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_00900 10378 9731 gene locus_tag LOCUS_00910 10378 9731 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_00910 10446 10910 gene locus_tag LOCUS_00920 10446 10910 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_00920 11887 12255 gene locus_tag LOCUS_00930 11887 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence007 676 194 gene locus_tag LOCUS_00940 gene ssb 676 194 CDS product single-stranded DNA-binding protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2F7 protein_id gnl|my_center|LOCUS_00940 895 2274 gene locus_tag LOCUS_00950 895 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_00950 3411 2278 gene locus_tag LOCUS_00960 3411 2278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_00960 5247 3538 gene locus_tag LOCUS_00970 5247 3538 CDS product phosphoethanolamine--lipid A transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 protein_id gnl|my_center|LOCUS_00970 7286 5283 gene locus_tag LOCUS_00980 7286 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 7521 7297 gene locus_tag LOCUS_00990 7521 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 8215 7715 gene locus_tag LOCUS_01000 8215 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 9300 8215 gene locus_tag LOCUS_01010 9300 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence008 317 625 gene locus_tag LOCUS_01020 gene fdx 317 625 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383628.1 protein_id gnl|my_center|LOCUS_01020 651 1049 gene locus_tag LOCUS_01030 651 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1046 1471 gene locus_tag LOCUS_01040 1046 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1889 4501 gene locus_tag LOCUS_01050 gene fyuA 1889 4501 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_01050 4498 4656 gene locus_tag LOCUS_01060 4498 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4653 5426 gene locus_tag LOCUS_01070 4653 5426 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_01070 5436 6848 gene locus_tag LOCUS_01080 5436 6848 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_01080 6868 7413 gene locus_tag LOCUS_01090 gene exbB 6868 7413 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_01090 7410 7811 gene locus_tag LOCUS_01100 7410 7811 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_01100 7833 8237 gene locus_tag LOCUS_01110 7833 8237 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_01110 8241 8894 gene locus_tag LOCUS_01120 8241 8894 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TA7 protein_id gnl|my_center|LOCUS_01120 8891 10366 gene locus_tag LOCUS_01130 8891 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence009 2312 1365 gene locus_tag LOCUS_01140 gene ribF 2312 1365 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_01140 3856 2312 gene locus_tag LOCUS_01150 gene mviN 3856 2312 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG8 protein_id gnl|my_center|LOCUS_01150 4010 4273 gene locus_tag LOCUS_01160 gene rpsT 4010 4273 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_01160 4639 7266 gene locus_tag LOCUS_01170 4639 7266 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 protein_id gnl|my_center|LOCUS_01170 7558 8319 gene locus_tag LOCUS_01180 7558 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8430 9161 gene locus_tag LOCUS_01190 8430 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence010 2264 1899 gene locus_tag LOCUS_01200 gene cheY 2264 1899 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_01200 2572 2261 gene locus_tag LOCUS_01210 2572 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3215 2736 gene locus_tag LOCUS_01220 gene cheW 3215 2736 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_01220 4195 3212 gene locus_tag LOCUS_01230 gene motB 4195 3212 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_01230 4943 4203 gene locus_tag LOCUS_01240 gene motC 4943 4203 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_01240 6744 4936 gene locus_tag LOCUS_01250 6744 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7470 6748 gene locus_tag LOCUS_01260 gene cheZ 7470 6748 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3R9 protein_id gnl|my_center|LOCUS_01260 7865 7473 gene locus_tag LOCUS_01270 7865 7473 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316827.1 protein_id gnl|my_center|LOCUS_01270 8625 7888 gene locus_tag LOCUS_01280 gene fliA 8625 7888 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI20 protein_id gnl|my_center|LOCUS_01280 9521 8622 gene locus_tag LOCUS_01290 gene flhG 9521 8622 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD2 protein_id gnl|my_center|LOCUS_01290 10521 9511 gene locus_tag LOCUS_01300 10521 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence011 1051 122 gene locus_tag LOCUS_01310 1051 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_01310 2295 1051 gene locus_tag LOCUS_01320 gene kynU 2295 1051 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 protein_id gnl|my_center|LOCUS_01320 5825 2412 gene locus_tag LOCUS_01330 5825 2412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_01330 6076 6582 gene locus_tag LOCUS_01340 6076 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_01340 7649 6597 gene locus_tag LOCUS_01350 7649 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7701 8381 gene locus_tag LOCUS_01360 7701 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8861 8385 gene locus_tag LOCUS_01370 8861 8385 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 protein_id gnl|my_center|LOCUS_01370 8963 9439 gene locus_tag LOCUS_01380 8963 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence012 <1 1125 gene locus_tag LOCUS_01390 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114736.1:geranyl-CoA carboxylase subunit alpha 2999 1218 gene locus_tag LOCUS_01400 2999 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4263 3106 gene locus_tag LOCUS_01410 4263 3106 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_01410 4374 6077 gene locus_tag LOCUS_01420 4374 6077 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_01420 6952 6095 gene locus_tag LOCUS_01430 gene folD 6952 6095 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJD4 protein_id gnl|my_center|LOCUS_01430 7065 7661 gene locus_tag LOCUS_01440 gene ccmA 7065 7661 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE30 protein_id gnl|my_center|LOCUS_01440 7727 8323 gene locus_tag LOCUS_01450 gene ccmB 7727 8323 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_01450 8320 9081 gene locus_tag LOCUS_01460 8320 9081 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266113.1 protein_id gnl|my_center|LOCUS_01460 9211 9684 gene locus_tag LOCUS_01470 gene ccmE 9211 9684 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_01470 >Feature sequence013 890 435 gene locus_tag LOCUS_01480 890 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 2254 887 gene locus_tag LOCUS_01490 2254 887 CDS product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_01490 3258 2251 gene locus_tag LOCUS_01500 3258 2251 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_01500 5104 3350 gene locus_tag LOCUS_01510 5104 3350 CDS product type I restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_01510 5443 6456 gene locus_tag LOCUS_01520 gene intD 5443 6456 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_01520 6534 6458 gene locus_tag LOCUS_t00010 6534 6458 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7794 6700 gene locus_tag LOCUS_01530 gene ychF 7794 6700 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_01530 8425 7844 gene locus_tag LOCUS_01540 gene pth 8425 7844 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K029 protein_id gnl|my_center|LOCUS_01540 9246 8560 gene locus_tag LOCUS_01550 gene rplY 9246 8560 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_01550 <10276 9395 gene locus_tag LOCUS_01560 <10276 9395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921099.1:RNA polymerase sigma factor SigJ >Feature sequence014 68 220 gene locus_tag LOCUS_01570 68 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 225 1397 gene locus_tag LOCUS_01580 225 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 1448 1693 gene locus_tag LOCUS_01590 1448 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 1707 2954 gene locus_tag LOCUS_01600 gene lysA 1707 2954 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_01600 2951 3868 gene locus_tag LOCUS_01610 2951 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3879 5420 gene locus_tag LOCUS_01620 gene fadD 3879 5420 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_01620 5547 6401 gene locus_tag LOCUS_01630 5547 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7560 6457 gene locus_tag LOCUS_01640 gene exoZ 7560 6457 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085156.1 protein_id gnl|my_center|LOCUS_01640 7721 8431 gene locus_tag LOCUS_01650 7721 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8616 9350 gene locus_tag LOCUS_01660 8616 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 <10026 9453 gene locus_tag LOCUS_01670 <10026 9453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence015 <1 562 gene locus_tag LOCUS_01680 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405490.1:TetR family transcriptional regulator 559 1959 gene locus_tag LOCUS_01690 gene oprN 559 1959 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037484.1 protein_id gnl|my_center|LOCUS_01690 1966 3024 gene locus_tag LOCUS_01700 1966 3024 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_01700 3046 6123 gene locus_tag LOCUS_01710 gene acrB5 3046 6123 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_01710 6292 9672 gene locus_tag LOCUS_01720 6292 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence016 212 667 gene locus_tag LOCUS_01730 212 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 818 1153 gene locus_tag LOCUS_01740 818 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1259 3295 gene locus_tag LOCUS_01750 1259 3295 CDS product dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_01750 4393 3428 gene locus_tag LOCUS_01760 4393 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5580 4393 gene locus_tag LOCUS_01770 5580 4393 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_01770 5742 7262 gene locus_tag LOCUS_01780 5742 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_01780 7268 7498 gene locus_tag LOCUS_01790 7268 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7499 8653 gene locus_tag LOCUS_01800 7499 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142974.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence017 <1 605 gene locus_tag LOCUS_01810 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114132.1:alpha/beta hydrolase 655 1227 gene locus_tag LOCUS_01820 655 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 1224 1718 gene locus_tag LOCUS_01830 1224 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1715 2731 gene locus_tag LOCUS_01840 1715 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2905 5475 gene locus_tag LOCUS_01850 2905 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 5711 7054 gene locus_tag LOCUS_01860 5711 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7086 7877 gene locus_tag LOCUS_01870 7086 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8109 8669 gene locus_tag LOCUS_01880 8109 8669 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 protein_id gnl|my_center|LOCUS_01880 8982 8695 gene locus_tag LOCUS_01890 8982 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence018 2517 343 gene locus_tag LOCUS_01900 2517 343 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_01900 3391 6333 gene locus_tag LOCUS_01910 gene nrdA 3391 6333 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL9 protein_id gnl|my_center|LOCUS_01910 7189 6401 gene locus_tag LOCUS_01920 7189 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 7837 7397 gene locus_tag LOCUS_01930 7837 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036511.1 protein_id gnl|my_center|LOCUS_01930 8096 9469 gene locus_tag LOCUS_01940 8096 9469 CDS product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence019 3514 3104 gene locus_tag LOCUS_01950 3514 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3744 4376 gene locus_tag LOCUS_01960 gene crp 3744 4376 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 protein_id gnl|my_center|LOCUS_01960 6157 4397 gene locus_tag LOCUS_01970 6157 4397 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 protein_id gnl|my_center|LOCUS_01970 8523 6163 gene locus_tag LOCUS_01980 8523 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence020 398 889 gene locus_tag LOCUS_01990 398 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 1186 911 gene locus_tag LOCUS_02000 1186 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2803 1307 gene locus_tag LOCUS_02010 gene fleQ 2803 1307 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 protein_id gnl|my_center|LOCUS_02010 3179 2796 gene locus_tag LOCUS_02020 3179 2796 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997154.1 protein_id gnl|my_center|LOCUS_02020 4684 3230 gene locus_tag LOCUS_02030 gene rpoN 4684 3230 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D0 protein_id gnl|my_center|LOCUS_02030 5535 4897 gene locus_tag LOCUS_02040 5535 4897 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 protein_id gnl|my_center|LOCUS_02040 6148 5570 gene locus_tag LOCUS_02050 6148 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6525 6145 gene locus_tag LOCUS_02060 gene fliS 6525 6145 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C6 protein_id gnl|my_center|LOCUS_02060 7892 6720 gene locus_tag LOCUS_02070 gene fliD 7892 6720 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9C5 protein_id gnl|my_center|LOCUS_02070 8439 8068 gene locus_tag LOCUS_02080 8439 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 <9085 8518 gene locus_tag LOCUS_02090 <9085 8518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVV0:flagellin >Feature sequence021 78 923 gene locus_tag LOCUS_02100 gene sseA 78 923 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 protein_id gnl|my_center|LOCUS_02100 920 1159 gene locus_tag LOCUS_02110 920 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1249 1749 gene locus_tag LOCUS_02120 1249 1749 CDS product transcription initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 protein_id gnl|my_center|LOCUS_02120 1775 2146 gene locus_tag LOCUS_02130 1775 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_02130 2217 3419 gene locus_tag LOCUS_02140 2217 3419 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_02140 3481 3834 gene locus_tag LOCUS_02150 3481 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 protein_id gnl|my_center|LOCUS_02150 4024 4668 gene locus_tag LOCUS_02160 4024 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_02160 4758 5126 gene locus_tag LOCUS_02170 4758 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5113 5550 gene locus_tag LOCUS_02180 5113 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6169 5552 gene locus_tag LOCUS_02190 6169 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6320 7039 gene locus_tag LOCUS_02200 6320 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7103 7768 gene locus_tag LOCUS_02210 7103 7768 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_02210 7776 8624 gene locus_tag LOCUS_02220 7776 8624 CDS product 5'-3' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44176 protein_id gnl|my_center|LOCUS_02220 >Feature sequence022 1303 419 gene locus_tag LOCUS_02230 1303 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 1842 1345 gene locus_tag LOCUS_02240 1842 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 2501 1839 gene locus_tag LOCUS_02250 gene algU 2501 1839 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_02250 2643 3350 gene locus_tag LOCUS_02260 2643 3350 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_02260 3366 4205 gene locus_tag LOCUS_02270 3366 4205 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_02270 4208 4777 gene locus_tag LOCUS_02280 4208 4777 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_02280 4777 5424 gene locus_tag LOCUS_02290 4777 5424 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_02290 6397 5543 gene locus_tag LOCUS_02300 6397 5543 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_02300 7177 6500 gene locus_tag LOCUS_02310 7177 6500 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_02310 7544 7453 gene locus_tag LOCUS_t00020 7544 7453 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7911 7597 gene locus_tag LOCUS_02320 7911 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8789 7911 gene locus_tag LOCUS_02330 gene dapA 8789 7911 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y56 protein_id gnl|my_center|LOCUS_02330 >Feature sequence023 4400 2268 gene locus_tag LOCUS_02340 gene hyuA 4400 2268 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975280.1 protein_id gnl|my_center|LOCUS_02340 4804 4397 gene locus_tag LOCUS_02350 4804 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7682 4923 gene locus_tag LOCUS_02360 7682 4923 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 protein_id gnl|my_center|LOCUS_02360 8793 7774 gene locus_tag LOCUS_02370 8793 7774 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence024 448 1638 gene locus_tag LOCUS_02380 gene hemY 448 1638 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_02380 2934 1717 gene locus_tag LOCUS_02390 gene sat 2934 1717 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_02390 3770 2970 gene locus_tag LOCUS_02400 3770 2970 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_02400 3834 5753 gene locus_tag LOCUS_02410 3834 5753 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_02410 5764 7008 gene locus_tag LOCUS_02420 gene cca 5764 7008 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW2 protein_id gnl|my_center|LOCUS_02420 7770 6979 gene locus_tag LOCUS_02430 gene uppP 7770 6979 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ9 protein_id gnl|my_center|LOCUS_02430 7816 8553 gene locus_tag LOCUS_02440 gene ptr1 7816 8553 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence025 2351 201 gene locus_tag LOCUS_02450 2351 201 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_02450 2350 2664 gene locus_tag LOCUS_02460 2350 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2703 3116 gene locus_tag LOCUS_02470 2703 3116 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_02470 4512 3229 gene locus_tag LOCUS_02480 4512 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4976 4548 gene locus_tag LOCUS_02490 4976 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5356 5048 gene locus_tag LOCUS_02500 5356 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6036 5515 gene locus_tag LOCUS_02510 6036 5515 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_02510 7381 6293 gene locus_tag LOCUS_02520 7381 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 <8839 7402 gene locus_tag LOCUS_02530 <8839 7402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538040.1:exported copper oxidase >Feature sequence026 1719 316 gene locus_tag LOCUS_02540 1719 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 4270 1856 gene locus_tag LOCUS_02550 4270 1856 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_02550 5018 6958 gene locus_tag LOCUS_02560 5018 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_02560 6982 8337 gene locus_tag LOCUS_02570 6982 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence027 870 1445 gene locus_tag LOCUS_02580 870 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2946 1471 gene locus_tag LOCUS_02590 2946 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3079 5757 gene locus_tag LOCUS_02600 3079 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5747 7381 gene locus_tag LOCUS_02610 5747 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879694.1 protein_id gnl|my_center|LOCUS_02610 8082 7378 gene locus_tag LOCUS_02620 8082 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_02620 <8787 8046 gene locus_tag LOCUS_02630 <8787 8046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P64302:haloalkane dehalogenase 1 >Feature sequence028 1624 2529 gene locus_tag LOCUS_02640 1624 2529 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_02640 3058 2546 gene locus_tag LOCUS_02650 3058 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3517 3068 gene locus_tag LOCUS_02660 3517 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4176 3556 gene locus_tag LOCUS_02670 4176 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5135 4203 gene locus_tag LOCUS_02680 5135 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6605 5319 gene locus_tag LOCUS_02690 6605 5319 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_02690 6702 7412 gene locus_tag LOCUS_02700 6702 7412 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_02700 7475 8578 gene locus_tag LOCUS_02710 7475 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence029 <1 1751 gene locus_tag LOCUS_02720 <1 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:RND transporter 1926 1744 gene locus_tag LOCUS_02730 1926 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1913 3247 gene locus_tag LOCUS_02740 1913 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_02740 3343 5832 gene locus_tag LOCUS_02750 3343 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5878 6939 gene locus_tag LOCUS_02760 5878 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7536 7027 gene locus_tag LOCUS_02770 7536 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 8401 7529 gene locus_tag LOCUS_02780 8401 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence030 <1 858 gene locus_tag LOCUS_02790 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_636480.2:alanyl dipeptidyl peptidase 877 2598 gene locus_tag LOCUS_02800 877 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_02800 3449 2616 gene locus_tag LOCUS_02810 3449 2616 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_02810 5473 3563 gene locus_tag LOCUS_02820 5473 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 protein_id gnl|my_center|LOCUS_02820 6397 5570 gene locus_tag LOCUS_02830 6397 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_02830 6792 6454 gene locus_tag LOCUS_02840 6792 6454 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_02840 6873 7424 gene locus_tag LOCUS_02850 6873 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090472.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence031 399 887 gene locus_tag LOCUS_02860 399 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 protein_id gnl|my_center|LOCUS_02860 877 1467 gene locus_tag LOCUS_02870 877 1467 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9W5 protein_id gnl|my_center|LOCUS_02870 2117 1464 gene locus_tag LOCUS_02880 gene lexA 2117 1464 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVP9 protein_id gnl|my_center|LOCUS_02880 2199 2453 gene locus_tag LOCUS_02890 2199 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2457 2873 gene locus_tag LOCUS_02900 2457 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02900 2961 3641 gene locus_tag LOCUS_02910 2961 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02910 3685 4116 gene locus_tag LOCUS_02920 gene recX 3685 4116 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_02920 4601 4122 gene locus_tag LOCUS_02930 4601 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 5140 4598 gene locus_tag LOCUS_02940 5140 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6745 5627 gene locus_tag LOCUS_02950 6745 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 7091 7390 gene locus_tag LOCUS_02960 7091 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02960 >Feature sequence032 4961 4263 gene locus_tag LOCUS_02970 4961 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_02970 6152 4998 gene locus_tag LOCUS_02980 6152 4998 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT92 protein_id gnl|my_center|LOCUS_02980 7259 6165 gene locus_tag LOCUS_02990 gene aroB 7259 6165 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_02990 7852 7319 gene locus_tag LOCUS_03000 gene aroK 7852 7319 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43880 protein_id gnl|my_center|LOCUS_03000 8524 7943 gene locus_tag LOCUS_03010 8524 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence033 609 1172 gene locus_tag LOCUS_03020 gene dcd 609 1172 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDP4 protein_id gnl|my_center|LOCUS_03020 2070 1189 gene locus_tag LOCUS_03030 2070 1189 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706261.1 protein_id gnl|my_center|LOCUS_03030 2202 2957 gene locus_tag LOCUS_03040 2202 2957 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113019.1 protein_id gnl|my_center|LOCUS_03040 2954 3460 gene locus_tag LOCUS_03050 2954 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3465 4073 gene locus_tag LOCUS_03060 gene msrA 3465 4073 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_03060 4879 4166 gene locus_tag LOCUS_03070 4879 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5902 4964 gene locus_tag LOCUS_03080 5902 4964 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_03080 7233 5911 gene locus_tag LOCUS_03090 7233 5911 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 protein_id gnl|my_center|LOCUS_03090 <8502 7282 gene locus_tag LOCUS_03100 <8502 7282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZG0:ribosomal RNA large subunit methyltransferase K/L >Feature sequence034 <1 1222 gene locus_tag LOCUS_03110 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104717.1:membrane protein 1264 2613 gene locus_tag LOCUS_03120 1264 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_03120 2861 3130 gene locus_tag LOCUS_03130 2861 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3143 3820 gene locus_tag LOCUS_03140 gene phoP 3143 3820 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_03140 3848 5236 gene locus_tag LOCUS_03150 gene phoQ 3848 5236 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_03150 5809 5237 gene locus_tag LOCUS_03160 gene orn 5809 5237 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_03160 5901 7268 gene locus_tag LOCUS_03170 gene cysB 5901 7268 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_03170 7301 8152 gene locus_tag LOCUS_03180 7301 8152 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence035 258 1184 gene locus_tag LOCUS_03190 258 1184 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 protein_id gnl|my_center|LOCUS_03190 1830 1192 gene locus_tag LOCUS_03200 1830 1192 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_03200 1894 3081 gene locus_tag LOCUS_03210 1894 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_03210 3135 4922 gene locus_tag LOCUS_03220 3135 4922 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_03220 4960 5361 gene locus_tag LOCUS_03230 4960 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085846.1 protein_id gnl|my_center|LOCUS_03230 5394 6035 gene locus_tag LOCUS_03240 5394 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 7900 6098 gene locus_tag LOCUS_03250 7900 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence036 1502 72 gene locus_tag LOCUS_03260 1502 72 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525215.1 protein_id gnl|my_center|LOCUS_03260 2777 1503 gene locus_tag LOCUS_03270 2777 1503 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 protein_id gnl|my_center|LOCUS_03270 3569 2823 gene locus_tag LOCUS_03280 3569 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5314 3608 gene locus_tag LOCUS_03290 5314 3608 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974754.1 protein_id gnl|my_center|LOCUS_03290 5580 6470 gene locus_tag LOCUS_03300 5580 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7245 6517 gene locus_tag LOCUS_03310 7245 6517 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence037 <1 500 gene locus_tag LOCUS_03320 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121265.1:glycosyl transferase family 1 497 1786 gene locus_tag LOCUS_03330 497 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1783 2829 gene locus_tag LOCUS_03340 gene galE 1783 2829 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55180 protein_id gnl|my_center|LOCUS_03340 3044 4036 gene locus_tag LOCUS_03350 3044 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5134 4076 gene locus_tag LOCUS_03360 5134 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6153 5266 gene locus_tag LOCUS_03370 6153 5266 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_03370 6704 6150 gene locus_tag LOCUS_03380 gene rfbC 6704 6150 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37780 protein_id gnl|my_center|LOCUS_03380 7601 6714 gene locus_tag LOCUS_03390 gene rmlA 7601 6714 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_03390 >Feature sequence038 249 1910 gene locus_tag LOCUS_03400 249 1910 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 protein_id gnl|my_center|LOCUS_03400 1950 2735 gene locus_tag LOCUS_03410 1950 2735 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_03410 2749 4314 gene locus_tag LOCUS_03420 gene fadD3 2749 4314 CDS product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 protein_id gnl|my_center|LOCUS_03420 4338 5201 gene locus_tag LOCUS_03430 4338 5201 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_03430 6528 5215 gene locus_tag LOCUS_03440 6528 5215 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098203.1 protein_id gnl|my_center|LOCUS_03440 <8063 6578 gene locus_tag LOCUS_03450 <8063 6578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388620.1:TonB-dependent receptor >Feature sequence039 905 138 gene locus_tag LOCUS_03460 905 138 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258271.1 protein_id gnl|my_center|LOCUS_03460 1750 989 gene locus_tag LOCUS_03470 1750 989 CDS product putative short-chain type dehydrogenase/reductase y4lA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55541 protein_id gnl|my_center|LOCUS_03470 2702 1881 gene locus_tag LOCUS_03480 2702 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 3794 2814 gene locus_tag LOCUS_03490 3794 2814 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_03490 4792 3791 gene locus_tag LOCUS_03500 4792 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 6798 4789 gene locus_tag LOCUS_03510 6798 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_03510 <7856 6872 gene locus_tag LOCUS_03520 <7856 6872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114217.1:hydrolase >Feature sequence040 <1 731 gene locus_tag LOCUS_03530 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329291.1:NADH dehydrogenase 812 2890 gene locus_tag LOCUS_03540 gene ppk 812 2890 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_03540 4401 2887 gene locus_tag LOCUS_03550 gene ppx 4401 2887 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_03550 4529 5008 gene locus_tag LOCUS_03560 4529 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5016 5357 gene locus_tag LOCUS_03570 5016 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5535 6149 gene locus_tag LOCUS_03580 5535 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6337 6933 gene locus_tag LOCUS_03590 6337 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 <7708 7003 gene locus_tag LOCUS_03600 <7708 7003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P26480:RNA polymerase sigma factor RpoD >Feature sequence041 <1 616 gene locus_tag LOCUS_03610 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZK7:Na(+)-translocating NADH-quinone reductase subunit B 628 1425 gene locus_tag LOCUS_03620 gene nqrC 628 1425 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_03620 1438 2112 gene locus_tag LOCUS_03630 gene nqrD 1438 2112 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_03630 2122 2730 gene locus_tag LOCUS_03640 gene nqrE 2122 2730 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_03640 2755 3978 gene locus_tag LOCUS_03650 gene nqrF 2755 3978 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M8 protein_id gnl|my_center|LOCUS_03650 4023 4214 gene locus_tag LOCUS_03660 4023 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 4241 4651 gene locus_tag LOCUS_03670 4241 4651 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880837.1 protein_id gnl|my_center|LOCUS_03670 4748 5605 gene locus_tag LOCUS_03680 4748 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5618 6565 gene locus_tag LOCUS_03690 5618 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6643 7140 gene locus_tag LOCUS_03700 6643 7140 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence042 356 949 gene locus_tag LOCUS_03710 gene hisB 356 949 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_03710 1010 1645 gene locus_tag LOCUS_03720 gene hisH1 1010 1645 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_03720 1787 2512 gene locus_tag LOCUS_03730 gene hisA 1787 2512 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q91 protein_id gnl|my_center|LOCUS_03730 2561 3340 gene locus_tag LOCUS_03740 gene hisF1 2561 3340 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_03740 3385 3711 gene locus_tag LOCUS_03750 gene hisE 3385 3711 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA47 protein_id gnl|my_center|LOCUS_03750 3725 3955 gene locus_tag LOCUS_03760 gene tatA 3725 3955 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSY2 protein_id gnl|my_center|LOCUS_03760 3979 4353 gene locus_tag LOCUS_03770 3979 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4364 5125 gene locus_tag LOCUS_03780 gene tatC 4364 5125 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG1 protein_id gnl|my_center|LOCUS_03780 5182 6000 gene locus_tag LOCUS_03790 5182 6000 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_03790 6816 6010 gene locus_tag LOCUS_03800 gene aroE 6816 6010 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUS1 protein_id gnl|my_center|LOCUS_03800 <7618 6832 gene locus_tag LOCUS_03810 <7618 6832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEG3:delta-aminolevulinic acid dehydratase >Feature sequence043 1825 596 gene locus_tag LOCUS_03820 gene ftsA 1825 596 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 protein_id gnl|my_center|LOCUS_03820 2610 1828 gene locus_tag LOCUS_03830 2610 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3569 2607 gene locus_tag LOCUS_03840 gene ddlB 3569 2607 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_03840 4438 3566 gene locus_tag LOCUS_03850 gene murB 4438 3566 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_03850 5868 4435 gene locus_tag LOCUS_03860 gene murC 5868 4435 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_03860 6926 5868 gene locus_tag LOCUS_03870 gene murG 6926 5868 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 protein_id gnl|my_center|LOCUS_03870 <7458 6932 gene locus_tag LOCUS_03880 <7458 6932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZSA4:putative lipid II flippase FtsW >Feature sequence044 3423 1879 gene locus_tag LOCUS_03890 gene glpA 3423 1879 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_03890 4141 3437 gene locus_tag LOCUS_03900 4141 3437 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_03900 4315 5538 gene locus_tag LOCUS_03910 gene acrE 4315 5538 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_03910 5622 6314 gene locus_tag LOCUS_03920 gene tptC 5622 6314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence045 4009 2192 gene locus_tag LOCUS_03930 4009 2192 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084324.1 protein_id gnl|my_center|LOCUS_03930 4144 5025 gene locus_tag LOCUS_03940 4144 5025 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_03940 6573 5083 gene locus_tag LOCUS_03950 6573 5083 CDS product flavin-binding family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_03950 <7300 6781 gene locus_tag LOCUS_03960 <7300 6781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087142.1:CoA transferase >Feature sequence046 357 1712 gene locus_tag LOCUS_03970 gene yaeL 357 1712 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83MD2 protein_id gnl|my_center|LOCUS_03970 1737 4040 gene locus_tag LOCUS_03980 gene oma 1737 4040 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW1 protein_id gnl|my_center|LOCUS_03980 4093 4617 gene locus_tag LOCUS_03990 4093 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4707 5768 gene locus_tag LOCUS_04000 gene lpxD 4707 5768 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW3 protein_id gnl|my_center|LOCUS_04000 5749 6222 gene locus_tag LOCUS_04010 gene fabZ 5749 6222 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH57 protein_id gnl|my_center|LOCUS_04010 6230 7009 gene locus_tag LOCUS_04020 gene lpxA 6230 7009 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5W3 protein_id gnl|my_center|LOCUS_04020 >Feature sequence047 355 197 gene locus_tag LOCUS_04030 355 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 385 582 gene locus_tag LOCUS_04040 385 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 605 1072 gene locus_tag LOCUS_04050 605 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1076 1579 gene locus_tag LOCUS_04060 1076 1579 CDS product pilus assembly protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268993.1 protein_id gnl|my_center|LOCUS_04060 1619 2512 gene locus_tag LOCUS_04070 gene rcpC 1619 2512 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114980.1 protein_id gnl|my_center|LOCUS_04070 2525 3859 gene locus_tag LOCUS_04080 2525 3859 CDS product exported fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 protein_id gnl|my_center|LOCUS_04080 3891 5081 gene locus_tag LOCUS_04090 gene tadZ 3891 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093855.1 protein_id gnl|my_center|LOCUS_04090 5086 6315 gene locus_tag LOCUS_04100 gene tadA 5086 6315 CDS product ATPase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103953.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence048 755 1339 gene locus_tag LOCUS_04110 755 1339 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_04110 1336 2550 gene locus_tag LOCUS_04120 gene nasF 1336 2550 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207015.1 protein_id gnl|my_center|LOCUS_04120 2557 4269 gene locus_tag LOCUS_04130 2557 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4266 7097 gene locus_tag LOCUS_04140 4266 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence049 164 1465 gene locus_tag LOCUS_04150 164 1465 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_04150 1462 2220 gene locus_tag LOCUS_04160 1462 2220 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_04160 2279 3595 gene locus_tag LOCUS_04170 2279 3595 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919303.1 protein_id gnl|my_center|LOCUS_04170 3595 3942 gene locus_tag LOCUS_04180 3595 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942958.1 protein_id gnl|my_center|LOCUS_04180 3939 4433 gene locus_tag LOCUS_04190 3939 4433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009543.1 protein_id gnl|my_center|LOCUS_04190 4775 4425 gene locus_tag LOCUS_04200 gene arsC 4775 4425 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_04200 4859 5734 gene locus_tag LOCUS_04210 4859 5734 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_04210 5713 6252 gene locus_tag LOCUS_04220 5713 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6379 7104 gene locus_tag LOCUS_04230 6379 7104 CDS product putative fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703751.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence050 1714 2457 gene locus_tag LOCUS_04240 1714 2457 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_04240 2483 3169 gene locus_tag LOCUS_04250 2483 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3166 4122 gene locus_tag LOCUS_04260 3166 4122 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528105.1 protein_id gnl|my_center|LOCUS_04260 4206 5609 gene locus_tag LOCUS_04270 4206 5609 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102965.1 protein_id gnl|my_center|LOCUS_04270 5690 6607 gene locus_tag LOCUS_04280 5690 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence051 1514 405 gene locus_tag LOCUS_04290 gene mnmA 1514 405 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A1 protein_id gnl|my_center|LOCUS_04290 1987 1544 gene locus_tag LOCUS_04300 1987 1544 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_04300 2763 1984 gene locus_tag LOCUS_04310 2763 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3259 2765 gene locus_tag LOCUS_04320 gene gspM 3259 2765 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC0 protein_id gnl|my_center|LOCUS_04320 4455 3256 gene locus_tag LOCUS_04330 4455 3256 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TC9 protein_id gnl|my_center|LOCUS_04330 5395 4457 gene locus_tag LOCUS_04340 gene gspK 5395 4457 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT3 protein_id gnl|my_center|LOCUS_04340 5946 5395 gene locus_tag LOCUS_04350 5946 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04350 6476 6096 gene locus_tag LOCUS_04360 6476 6096 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918067.1 protein_id gnl|my_center|LOCUS_04360 <7026 6473 gene locus_tag LOCUS_04370 <7026 6473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204728.1:type II secretion system protein GspH >Feature sequence052 <1 693 gene locus_tag LOCUS_04380 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087110.1:cysteine desulfurase 690 1850 gene locus_tag LOCUS_04390 gene iscS 690 1850 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0D4 protein_id gnl|my_center|LOCUS_04390 1847 2230 gene locus_tag LOCUS_04400 1847 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2227 2550 gene locus_tag LOCUS_04410 gene iscA 2227 2550 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E782 protein_id gnl|my_center|LOCUS_04410 2708 3139 gene locus_tag LOCUS_04420 gene ndk 2708 3139 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_04420 3172 4338 gene locus_tag LOCUS_04430 gene rlmN 3172 4338 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ42 protein_id gnl|my_center|LOCUS_04430 4335 5078 gene locus_tag LOCUS_04440 gene pilF 4335 5078 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 protein_id gnl|my_center|LOCUS_04440 5075 5989 gene locus_tag LOCUS_04450 5075 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence053 1103 837 gene locus_tag LOCUS_04460 gene fdx1 1103 837 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_04460 1780 1187 gene locus_tag LOCUS_04470 1780 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2858 2448 gene locus_tag LOCUS_04480 2858 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3666 2914 gene locus_tag LOCUS_04490 3666 2914 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_04490 4001 3855 gene locus_tag LOCUS_04500 4001 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4466 4071 gene locus_tag LOCUS_04510 4466 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5094 4609 gene locus_tag LOCUS_04520 gene coaD 5094 4609 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB8 protein_id gnl|my_center|LOCUS_04520 5678 5106 gene locus_tag LOCUS_04530 gene rsmD 5678 5106 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMM5 protein_id gnl|my_center|LOCUS_04530 6254 5787 gene locus_tag LOCUS_04540 6254 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence054 570 1649 gene locus_tag LOCUS_04550 570 1649 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_04550 1862 2023 gene locus_tag LOCUS_04560 1862 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2219 3073 gene locus_tag LOCUS_04570 2219 3073 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_04570 3252 3629 gene locus_tag LOCUS_04580 3252 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3692 4705 gene locus_tag LOCUS_04590 gene dusA 3692 4705 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEM0 protein_id gnl|my_center|LOCUS_04590 4720 5313 gene locus_tag LOCUS_04600 gene ppiA 4720 5313 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SS6 protein_id gnl|my_center|LOCUS_04600 5327 6049 gene locus_tag LOCUS_04610 gene lpxH 5327 6049 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N978 protein_id gnl|my_center|LOCUS_04610 6813 6046 gene locus_tag LOCUS_04620 6813 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence055 736 47 gene locus_tag LOCUS_04630 gene mtnC 736 47 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_04630 1284 733 gene locus_tag LOCUS_04640 gene mtnD 1284 733 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN79 protein_id gnl|my_center|LOCUS_04640 1910 1281 gene locus_tag LOCUS_04650 gene mtnB 1910 1281 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I342 protein_id gnl|my_center|LOCUS_04650 3431 1959 gene locus_tag LOCUS_04660 gene mgtE 3431 1959 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I7 protein_id gnl|my_center|LOCUS_04660 3753 3583 gene locus_tag LOCUS_04670 gene rpmG 3753 3583 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57187 protein_id gnl|my_center|LOCUS_04670 3995 3759 gene locus_tag LOCUS_04680 gene rpmB 3995 3759 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM9 protein_id gnl|my_center|LOCUS_04680 4204 4719 gene locus_tag LOCUS_04690 4204 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4716 5270 gene locus_tag LOCUS_04700 4716 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5939 5265 gene locus_tag LOCUS_04710 5939 5265 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_04710 >Feature sequence056 1630 281 gene locus_tag LOCUS_04720 gene tolC 1630 281 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_04720 2336 1611 gene locus_tag LOCUS_04730 2336 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2754 3908 gene locus_tag LOCUS_04740 gene prpC 2754 3908 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_04740 3972 6566 gene locus_tag LOCUS_04750 gene acnM 3972 6566 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence057 3 629 gene locus_tag LOCUS_04760 3 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 791 2704 gene locus_tag LOCUS_04770 791 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3518 4909 gene locus_tag LOCUS_04780 3518 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4992 5315 gene locus_tag LOCUS_04790 4992 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 5363 5581 gene locus_tag LOCUS_04800 5363 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6001 5813 gene locus_tag LOCUS_04810 6001 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6142 6564 gene locus_tag LOCUS_04820 6142 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence058 <1 506 gene locus_tag LOCUS_04830 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199340.1:glutathione S-transferase 547 996 gene locus_tag LOCUS_04840 547 996 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_04840 1011 2198 gene locus_tag LOCUS_04850 1011 2198 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_04850 3356 2223 gene locus_tag LOCUS_04860 3356 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 3937 3362 gene locus_tag LOCUS_04870 3937 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 4110 4595 gene locus_tag LOCUS_04880 4110 4595 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_04880 4660 5721 gene locus_tag LOCUS_04890 4660 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6044 6733 gene locus_tag LOCUS_04900 6044 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence059 565 2016 gene locus_tag LOCUS_04910 gene putA 565 2016 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_04910 2191 4620 gene locus_tag LOCUS_04920 2191 4620 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_04920 5009 4632 gene locus_tag LOCUS_04930 5009 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5153 5536 gene locus_tag LOCUS_04940 5153 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5588 6259 gene locus_tag LOCUS_04950 5588 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6272 6628 gene locus_tag LOCUS_04960 6272 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence060 1672 56 gene locus_tag LOCUS_04970 1672 56 CDS product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_04970 2154 1750 gene locus_tag LOCUS_04980 2154 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2791 2195 gene locus_tag LOCUS_04990 gene tag 2791 2195 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_04990 4127 2796 gene locus_tag LOCUS_05000 4127 2796 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_05000 4705 4172 gene locus_tag LOCUS_05010 4705 4172 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_05010 5465 4734 gene locus_tag LOCUS_05020 5465 4734 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR8 protein_id gnl|my_center|LOCUS_05020 5558 6040 gene locus_tag LOCUS_05030 5558 6040 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410960.1 protein_id gnl|my_center|LOCUS_05030 6136 6591 gene locus_tag LOCUS_05040 gene ysnE 6136 6591 CDS product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 protein_id gnl|my_center|LOCUS_05040 >Feature sequence061 <1 3066 gene locus_tag LOCUS_05050 <1 3066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104171.1:translocation/assembly module TamB 3753 3055 gene locus_tag LOCUS_05060 3753 3055 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_05060 3710 4048 gene locus_tag LOCUS_05070 3710 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4050 5300 gene locus_tag LOCUS_05080 gene lysA 4050 5300 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_05080 5325 6086 gene locus_tag LOCUS_05090 5325 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence062 716 264 gene locus_tag LOCUS_05100 716 264 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_05100 801 1253 gene locus_tag LOCUS_05110 801 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_05110 1250 1543 gene locus_tag LOCUS_05120 1250 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529114.1 protein_id gnl|my_center|LOCUS_05120 1975 1532 gene locus_tag LOCUS_05130 1975 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2478 1972 gene locus_tag LOCUS_05140 2478 1972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 protein_id gnl|my_center|LOCUS_05140 2507 2833 gene locus_tag LOCUS_05150 2507 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2830 3123 gene locus_tag LOCUS_05160 2830 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3164 4573 gene locus_tag LOCUS_05170 3164 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4617 5747 gene locus_tag LOCUS_05180 4617 5747 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104870.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence063 827 1441 gene locus_tag LOCUS_05190 827 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2370 1741 gene locus_tag LOCUS_05200 2370 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5474 2367 gene locus_tag LOCUS_05210 5474 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence064 1325 357 gene locus_tag LOCUS_05220 gene epmA 1325 357 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z197 protein_id gnl|my_center|LOCUS_05220 1915 1346 gene locus_tag LOCUS_05230 gene efp 1915 1346 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_05230 1977 2990 gene locus_tag LOCUS_05240 1977 2990 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_05240 2984 5086 gene locus_tag LOCUS_05250 2984 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6013 5159 gene locus_tag LOCUS_05260 gene htpX 6013 5159 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8F0 protein_id gnl|my_center|LOCUS_05260 6673 6071 gene locus_tag LOCUS_05270 6673 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 >Feature sequence065 200 2023 gene locus_tag LOCUS_05280 gene atuH 200 2023 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_05280 2173 2643 gene locus_tag LOCUS_05290 2173 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2685 3977 gene locus_tag LOCUS_05300 2685 3977 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_05300 4023 5231 gene locus_tag LOCUS_05310 gene acd 4023 5231 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_05310 6047 5244 gene locus_tag LOCUS_05320 6047 5244 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence066 1230 22 gene locus_tag LOCUS_05330 1230 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1307 2122 gene locus_tag LOCUS_05340 gene proC 1307 2122 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_05340 2122 2679 gene locus_tag LOCUS_05350 2122 2679 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087263.1 protein_id gnl|my_center|LOCUS_05350 2687 3835 gene locus_tag LOCUS_05360 gene metX 2687 3835 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_05360 3832 4452 gene locus_tag LOCUS_05370 3832 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_05370 4449 4883 gene locus_tag LOCUS_05380 4449 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_05380 5809 4871 gene locus_tag LOCUS_05390 5809 4871 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269195.1 protein_id gnl|my_center|LOCUS_05390 6391 5900 gene locus_tag LOCUS_05400 6391 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence067 1585 1660 gene locus_tag LOCUS_t00030 1585 1660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2475 1726 gene locus_tag LOCUS_05410 2475 1726 CDS product amino acid ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706607.1 protein_id gnl|my_center|LOCUS_05410 3412 2468 gene locus_tag LOCUS_05420 3412 2468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706606.1 protein_id gnl|my_center|LOCUS_05420 4206 3412 gene locus_tag LOCUS_05430 4206 3412 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706605.1 protein_id gnl|my_center|LOCUS_05430 4275 5489 gene locus_tag LOCUS_05440 4275 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_05440 5480 6334 gene locus_tag LOCUS_05450 5480 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence068 993 175 gene locus_tag LOCUS_05460 gene mutM 993 175 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_05460 1970 1059 gene locus_tag LOCUS_05470 1970 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3338 1974 gene locus_tag LOCUS_05480 3338 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4092 3343 gene locus_tag LOCUS_05490 4092 3343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_05490 5137 4193 gene locus_tag LOCUS_05500 5137 4193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05500 6131 5268 gene locus_tag LOCUS_05510 6131 5268 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence069 740 24 gene locus_tag LOCUS_05520 gene phoU 740 24 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_05520 1696 851 gene locus_tag LOCUS_05530 gene pstB 1696 851 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_05530 3455 1740 gene locus_tag LOCUS_05540 gene pstA 3455 1740 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_05540 5753 3483 gene locus_tag LOCUS_05550 5753 3483 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_05550 <6485 5907 gene locus_tag LOCUS_05560 <6485 5907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119574.1:porin >Feature sequence070 3895 2405 gene locus_tag LOCUS_05570 gene nusA 3895 2405 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 protein_id gnl|my_center|LOCUS_05570 4366 3902 gene locus_tag LOCUS_05580 gene rimP 4366 3902 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95578 protein_id gnl|my_center|LOCUS_05580 4504 4428 gene locus_tag LOCUS_t00040 4504 4428 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4698 4614 gene locus_tag LOCUS_t00050 4698 4614 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5093 4755 gene locus_tag LOCUS_05590 5093 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5871 5101 gene locus_tag LOCUS_05600 gene tpiA 5871 5101 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 protein_id gnl|my_center|LOCUS_05600 <6479 5896 gene locus_tag LOCUS_05610 <6479 5896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8XF81:phosphoglucosamine mutase >Feature sequence071 492 1670 gene locus_tag LOCUS_05620 492 1670 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940949.1 protein_id gnl|my_center|LOCUS_05620 1939 4905 gene locus_tag LOCUS_05630 1939 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence072 2688 3116 gene locus_tag LOCUS_05640 gene pilE 2688 3116 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_05640 3445 3906 gene locus_tag LOCUS_05650 gene pilE 3445 3906 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_05650 4053 6095 gene locus_tag LOCUS_05660 4053 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence073 307 798 gene locus_tag LOCUS_05670 307 798 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_05670 2544 829 gene locus_tag LOCUS_05680 2544 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2429 2734 gene locus_tag LOCUS_05690 2429 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2770 3717 gene locus_tag LOCUS_05700 2770 3717 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_05700 4226 3759 gene locus_tag LOCUS_05710 4226 3759 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640520.1 protein_id gnl|my_center|LOCUS_05710 4360 5217 gene locus_tag LOCUS_05720 4360 5217 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_05720 5238 6311 gene locus_tag LOCUS_05730 5238 6311 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence074 1107 1745 gene locus_tag LOCUS_05740 1107 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 1816 2658 gene locus_tag LOCUS_05750 1816 2658 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_05750 2911 2705 gene locus_tag LOCUS_05760 2911 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3828 3007 gene locus_tag LOCUS_05770 3828 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3999 4601 gene locus_tag LOCUS_05780 3999 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4598 5359 gene locus_tag LOCUS_05790 4598 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918001.1 protein_id gnl|my_center|LOCUS_05790 <6371 5363 gene locus_tag LOCUS_05800 <6371 5363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0ML37:acetyl-coenzyme A synthetase >Feature sequence075 <1 535 gene locus_tag LOCUS_05810 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082447.1:acyl-CoA dehydrogenase 756 3227 gene locus_tag LOCUS_05820 756 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 3315 4052 gene locus_tag LOCUS_05830 3315 4052 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_05830 4889 4080 gene locus_tag LOCUS_05840 4889 4080 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence076 979 182 gene locus_tag LOCUS_05850 979 182 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_05850 1187 1486 gene locus_tag LOCUS_05860 1187 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2036 1542 gene locus_tag LOCUS_05870 2036 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2204 2677 gene locus_tag LOCUS_05880 2204 2677 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_05880 3004 2928 gene locus_tag LOCUS_t00060 3004 2928 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3491 3081 gene locus_tag LOCUS_05890 3491 3081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_05890 5545 3488 gene locus_tag LOCUS_05900 gene uvrB 5545 3488 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_05900 >Feature sequence077 1370 1047 gene locus_tag LOCUS_05910 1370 1047 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_05910 2067 1471 gene locus_tag LOCUS_05920 2067 1471 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_05920 2223 3305 gene locus_tag LOCUS_05930 2223 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3503 3417 gene locus_tag LOCUS_t00070 3503 3417 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3539 4609 gene locus_tag LOCUS_05940 gene queA 3539 4609 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P867 protein_id gnl|my_center|LOCUS_05940 5117 4602 gene locus_tag LOCUS_05950 5117 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707268.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence078 2358 1138 gene locus_tag LOCUS_05960 2358 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2985 2605 gene locus_tag LOCUS_05970 2985 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3119 5143 gene locus_tag LOCUS_05980 gene metG 3119 5143 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_05980 5245 5820 gene locus_tag LOCUS_05990 gene rnfA 5245 5820 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_05990 >Feature sequence079 835 56 gene locus_tag LOCUS_06000 835 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2248 890 gene locus_tag LOCUS_06010 2248 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4694 2424 gene locus_tag LOCUS_06020 4694 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4859 5632 gene locus_tag LOCUS_06030 4859 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence080 1628 627 gene locus_tag LOCUS_06040 1628 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2137 1625 gene locus_tag LOCUS_06050 2137 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2628 2134 gene locus_tag LOCUS_06060 2628 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3260 2628 gene locus_tag LOCUS_06070 3260 2628 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_06070 3667 3326 gene locus_tag LOCUS_06080 3667 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4311 3664 gene locus_tag LOCUS_06090 4311 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence081 657 202 gene locus_tag LOCUS_06100 657 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2846 957 gene locus_tag LOCUS_06110 2846 957 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103381.1 protein_id gnl|my_center|LOCUS_06110 3717 2953 gene locus_tag LOCUS_06120 3717 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5702 3714 gene locus_tag LOCUS_06130 5702 3714 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975430.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence082 2 715 gene locus_tag LOCUS_06140 gene argF 2 715 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XL4 protein_id gnl|my_center|LOCUS_06140 793 1398 gene locus_tag LOCUS_06150 793 1398 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244525.1 protein_id gnl|my_center|LOCUS_06150 1398 1871 gene locus_tag LOCUS_06160 1398 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3743 1884 gene locus_tag LOCUS_06170 gene htpG 3743 1884 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAZ2 protein_id gnl|my_center|LOCUS_06170 4923 3847 gene locus_tag LOCUS_06180 4923 3847 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_06180 5930 5007 gene locus_tag LOCUS_06190 5930 5007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence083 6 884 gene locus_tag LOCUS_06200 gene fadA 6 884 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEL0 protein_id gnl|my_center|LOCUS_06200 1588 1052 gene locus_tag LOCUS_06210 1588 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919164.1 protein_id gnl|my_center|LOCUS_06210 1750 2175 gene locus_tag LOCUS_06220 1750 2175 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_06220 3247 2216 gene locus_tag LOCUS_06230 gene icd 3247 2216 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_06230 3575 4777 gene locus_tag LOCUS_06240 3575 4777 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_06240 4802 5221 gene locus_tag LOCUS_06250 4802 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence084 1230 61 gene locus_tag LOCUS_06260 1230 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1676 1332 gene locus_tag LOCUS_06270 1676 1332 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719746.1 protein_id gnl|my_center|LOCUS_06270 1886 2281 gene locus_tag LOCUS_06280 1886 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2292 2717 gene locus_tag LOCUS_06290 2292 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3197 2718 gene locus_tag LOCUS_06300 3197 2718 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037892.1 protein_id gnl|my_center|LOCUS_06300 3385 3771 gene locus_tag LOCUS_06310 3385 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3774 4748 gene locus_tag LOCUS_06320 3774 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_06320 5200 4742 gene locus_tag LOCUS_06330 5200 4742 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908387.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence085 226 1023 gene locus_tag LOCUS_06340 226 1023 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_06340 1031 1936 gene locus_tag LOCUS_06350 1031 1936 CDS product acetaldehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH39 protein_id gnl|my_center|LOCUS_06350 1946 2275 gene locus_tag LOCUS_06360 1946 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2307 3362 gene locus_tag LOCUS_06370 gene mhpE 2307 3362 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51020 protein_id gnl|my_center|LOCUS_06370 3377 3835 gene locus_tag LOCUS_06380 3377 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence086 177 1295 gene locus_tag LOCUS_06390 177 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1572 2015 gene locus_tag LOCUS_06400 1572 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_06400 2037 4238 gene locus_tag LOCUS_06410 2037 4238 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_06410 4258 4815 gene locus_tag LOCUS_06420 4258 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence087 2322 94 gene locus_tag LOCUS_06430 2322 94 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 protein_id gnl|my_center|LOCUS_06430 3647 2364 gene locus_tag LOCUS_06440 gene wbpO 3647 2364 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_06440 4709 3657 gene locus_tag LOCUS_06450 4709 3657 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 protein_id gnl|my_center|LOCUS_06450 5961 4831 gene locus_tag LOCUS_06460 5961 4831 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808448.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence088 153 647 gene locus_tag LOCUS_06470 153 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 723 2033 gene locus_tag LOCUS_06480 gene czcC 723 2033 CDS product cobalt-zinc-cadmium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205515.1 protein_id gnl|my_center|LOCUS_06480 2042 3280 gene locus_tag LOCUS_06490 2042 3280 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence089 415 1428 gene locus_tag LOCUS_06500 415 1428 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_06500 1517 1840 gene locus_tag LOCUS_06510 gene fdx 1517 1840 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383628.1 protein_id gnl|my_center|LOCUS_06510 2671 1868 gene locus_tag LOCUS_06520 2671 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2909 3793 gene locus_tag LOCUS_06530 2909 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_06530 4275 3823 gene locus_tag LOCUS_06540 4275 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence090 463 705 gene locus_tag LOCUS_06550 463 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 849 1205 gene locus_tag LOCUS_06560 849 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1602 1883 gene locus_tag LOCUS_06570 1602 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1971 2780 gene locus_tag LOCUS_06580 1971 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2791 3252 gene locus_tag LOCUS_06590 2791 3252 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_06590 3283 3681 gene locus_tag LOCUS_06600 3283 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3706 4209 gene locus_tag LOCUS_06610 3706 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 <5834 4245 gene locus_tag LOCUS_06620 <5834 4245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528611.1:adenylate cyclase >Feature sequence091 <1 2036 gene locus_tag LOCUS_06630 <1 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037274.1:DNA internalization-related competence protein ComEC/Rec2 2558 2082 gene locus_tag LOCUS_06640 gene hisI 2558 2082 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 protein_id gnl|my_center|LOCUS_06640 3306 2674 gene locus_tag LOCUS_06650 3306 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4193 3351 gene locus_tag LOCUS_06660 gene queD 4193 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_06660 4287 5708 gene locus_tag LOCUS_06670 gene gltX 4287 5708 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNT0 protein_id gnl|my_center|LOCUS_06670 >Feature sequence092 1399 719 gene locus_tag LOCUS_06680 gene cmk 1399 719 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z1 protein_id gnl|my_center|LOCUS_06680 2720 1404 gene locus_tag LOCUS_06690 gene aroA 2720 1404 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA95 protein_id gnl|my_center|LOCUS_06690 3666 2797 gene locus_tag LOCUS_06700 3666 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4800 3667 gene locus_tag LOCUS_06710 gene hisC2 4800 3667 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_06710 <5702 4828 gene locus_tag LOCUS_06720 <5702 4828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404232.1:chorismate mutase >Feature sequence093 <1 603 gene locus_tag LOCUS_06730 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WGE3:succinyl-CoA--D-citramalate CoA-transferase 745 1671 gene locus_tag LOCUS_06740 gene lpqP 745 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_06740 1826 3511 gene locus_tag LOCUS_06750 1826 3511 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812216.1 protein_id gnl|my_center|LOCUS_06750 3508 4437 gene locus_tag LOCUS_06760 3508 4437 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539164.1 protein_id gnl|my_center|LOCUS_06760 4607 4434 gene locus_tag LOCUS_06770 4607 4434 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528379.1 protein_id gnl|my_center|LOCUS_06770 4789 5550 gene locus_tag LOCUS_06780 4789 5550 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence094 329 571 gene locus_tag LOCUS_06790 329 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1760 1059 gene locus_tag LOCUS_06800 1760 1059 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_06800 2579 2064 gene locus_tag LOCUS_06810 2579 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2690 3631 gene locus_tag LOCUS_06820 2690 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3852 3628 gene locus_tag LOCUS_06830 3852 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3851 4810 gene locus_tag LOCUS_06840 3851 4810 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974799.1 protein_id gnl|my_center|LOCUS_06840 4879 5178 gene locus_tag LOCUS_06850 4879 5178 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_06850 5455 5381 gene locus_tag LOCUS_t00080 5455 5381 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence095 17 2836 gene locus_tag LOCUS_06860 17 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2978 3562 gene locus_tag LOCUS_06870 2978 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_06870 3589 5466 gene locus_tag LOCUS_06880 3589 5466 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence096 <1 868 gene locus_tag LOCUS_06890 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q885J6:N-succinylarginine dihydrolase 890 1399 gene locus_tag LOCUS_06900 890 1399 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_06900 1454 3172 gene locus_tag LOCUS_06910 gene gspA 1454 3172 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_06910 3174 3998 gene locus_tag LOCUS_06920 3174 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5218 4010 gene locus_tag LOCUS_06930 gene argD 5218 4010 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L20 protein_id gnl|my_center|LOCUS_06930 5384 5309 gene locus_tag LOCUS_t00090 5384 5309 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 325 1734 gene locus_tag LOCUS_06940 325 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_06940 2173 1742 gene locus_tag LOCUS_06950 2173 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_06950 2901 2161 gene locus_tag LOCUS_06960 2901 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3200 2901 gene locus_tag LOCUS_06970 3200 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4433 3252 gene locus_tag LOCUS_06980 gene mgtE 4433 3252 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F430 protein_id gnl|my_center|LOCUS_06980 4533 5138 gene locus_tag LOCUS_06990 4533 5138 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336778.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence098 3124 1586 gene locus_tag LOCUS_07000 gene mdoG 3124 1586 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67558 protein_id gnl|my_center|LOCUS_07000 4300 3155 gene locus_tag LOCUS_07010 4300 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5080 4313 gene locus_tag LOCUS_07020 gene rnt 5080 4313 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_07020 >Feature sequence099 <1 1490 gene locus_tag LOCUS_07030 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207250.1:acyl-CoA dehydrogenase 3644 1554 gene locus_tag LOCUS_07040 3644 1554 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 protein_id gnl|my_center|LOCUS_07040 3806 5005 gene locus_tag LOCUS_07050 3806 5005 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence100 999 343 gene locus_tag LOCUS_07060 gene nth 999 343 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAF2 protein_id gnl|my_center|LOCUS_07060 1670 996 gene locus_tag LOCUS_07070 1670 996 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_07070 2308 1667 gene locus_tag LOCUS_07080 2308 1667 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT90 protein_id gnl|my_center|LOCUS_07080 3228 2305 gene locus_tag LOCUS_07090 3228 2305 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_07090 5390 3282 gene locus_tag LOCUS_07100 5390 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence101 914 57 gene locus_tag LOCUS_07110 gene folE2 914 57 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_07110 1051 1659 gene locus_tag LOCUS_07120 1051 1659 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 protein_id gnl|my_center|LOCUS_07120 1749 2159 gene locus_tag LOCUS_07130 1749 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3573 2164 gene locus_tag LOCUS_07140 gene argH 3573 2164 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 protein_id gnl|my_center|LOCUS_07140 3667 4779 gene locus_tag LOCUS_07150 gene algZ 3667 4779 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence102 436 1290 gene locus_tag LOCUS_07160 436 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4475 1383 gene locus_tag LOCUS_07170 4475 1383 CDS product MexW/MexI family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 protein_id gnl|my_center|LOCUS_07170 <5406 4499 gene locus_tag LOCUS_07180 <5406 4499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958004.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence103 1241 237 gene locus_tag LOCUS_07190 1241 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1353 1835 gene locus_tag LOCUS_07200 1353 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_07200 1997 2962 gene locus_tag LOCUS_07210 1997 2962 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_07210 3168 3458 gene locus_tag LOCUS_07220 gene groS 3168 3458 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_07220 3489 5153 gene locus_tag LOCUS_07230 gene groL 3489 5153 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_07230 >Feature sequence104 893 351 gene locus_tag LOCUS_07240 gene hslV 893 351 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_07240 1395 1024 gene locus_tag LOCUS_07250 1395 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2477 1518 gene locus_tag LOCUS_07260 gene xerC 2477 1518 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI3 protein_id gnl|my_center|LOCUS_07260 3197 2490 gene locus_tag LOCUS_07270 3197 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_07270 4024 3185 gene locus_tag LOCUS_07280 gene dapF 4024 3185 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AD4 protein_id gnl|my_center|LOCUS_07280 4077 4475 gene locus_tag LOCUS_07290 4077 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4475 4864 gene locus_tag LOCUS_07300 4475 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence105 616 191 gene locus_tag LOCUS_07310 616 191 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_07310 690 1835 gene locus_tag LOCUS_07320 690 1835 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_07320 1915 3252 gene locus_tag LOCUS_07330 1915 3252 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_07330 3299 4165 gene locus_tag LOCUS_07340 3299 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096069.1 protein_id gnl|my_center|LOCUS_07340 <5332 4124 gene locus_tag LOCUS_07350 <5332 4124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEF8:putative protein kinase UbiB >Feature sequence106 197 1807 gene locus_tag LOCUS_07360 gene fadD-2 197 1807 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225041.1 protein_id gnl|my_center|LOCUS_07360 1841 3286 gene locus_tag LOCUS_07370 gene putA 1841 3286 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_07370 <5310 3331 gene locus_tag LOCUS_07380 <5310 3331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120314.1:helix-turn-helix transcriptional regulator >Feature sequence107 <1 1101 gene locus_tag LOCUS_07390 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097325.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1446 1228 gene locus_tag LOCUS_07400 gene infA 1446 1228 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM3 protein_id gnl|my_center|LOCUS_07400 2220 1501 gene locus_tag LOCUS_07410 gene ate 2220 1501 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH8 protein_id gnl|my_center|LOCUS_07410 2957 2217 gene locus_tag LOCUS_07420 gene aat 2957 2217 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMD2 protein_id gnl|my_center|LOCUS_07420 3349 3020 gene locus_tag LOCUS_07430 3349 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence108 1082 1603 gene locus_tag LOCUS_07440 1082 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1620 2387 gene locus_tag LOCUS_07450 1620 2387 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_07450 2431 3903 gene locus_tag LOCUS_07460 gene rpoN 2431 3903 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_07460 3932 4255 gene locus_tag LOCUS_07470 3932 4255 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555091.1 protein_id gnl|my_center|LOCUS_07470 4326 4787 gene locus_tag LOCUS_07480 gene ptsN 4326 4787 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence109 144 1229 gene locus_tag LOCUS_07490 144 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090184.1 protein_id gnl|my_center|LOCUS_07490 1233 2255 gene locus_tag LOCUS_07500 gene ddlA 1233 2255 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_07500 2349 3584 gene locus_tag LOCUS_07510 2349 3584 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_07510 3682 4614 gene locus_tag LOCUS_07520 3682 4614 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence110 448 1644 gene locus_tag LOCUS_07530 448 1644 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207959.1 protein_id gnl|my_center|LOCUS_07530 1656 3107 gene locus_tag LOCUS_07540 1656 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3582 3506 gene locus_tag LOCUS_t00100 3582 3506 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4737 3733 gene locus_tag LOCUS_07550 4737 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence111 1456 125 gene locus_tag LOCUS_07560 1456 125 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_07560 2566 1466 gene locus_tag LOCUS_07570 2566 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2795 2571 gene locus_tag LOCUS_07580 2795 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 <5262 2831 gene locus_tag LOCUS_07590 <5262 2831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87ND6:DNA gyrase subunit A >Feature sequence112 139 5106 gene locus_tag LOCUS_07600 139 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence113 679 1074 gene locus_tag LOCUS_07610 679 1074 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 protein_id gnl|my_center|LOCUS_07610 1136 2362 gene locus_tag LOCUS_07620 1136 2362 CDS product teichoic acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876004.1 protein_id gnl|my_center|LOCUS_07620 3480 2413 gene locus_tag LOCUS_07630 3480 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4593 3625 gene locus_tag LOCUS_07640 4593 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence114 833 84 gene locus_tag LOCUS_07650 833 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1645 824 gene locus_tag LOCUS_07660 gene stp 1645 824 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_07660 4322 1653 gene locus_tag LOCUS_07670 4322 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence115 382 221 gene locus_tag LOCUS_07680 382 221 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878381.1 protein_id gnl|my_center|LOCUS_07680 565 2772 gene locus_tag LOCUS_07690 gene yncD 565 2772 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035356.1 protein_id gnl|my_center|LOCUS_07690 2914 3357 gene locus_tag LOCUS_07700 2914 3357 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085743.1 protein_id gnl|my_center|LOCUS_07700 3367 4536 gene locus_tag LOCUS_07710 3367 4536 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence116 1868 957 gene locus_tag LOCUS_07720 1868 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_07720 2041 3537 gene locus_tag LOCUS_07730 2041 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_07730 <5164 3620 gene locus_tag LOCUS_07740 <5164 3620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZXI0:valine--tRNA ligase >Feature sequence117 1436 645 gene locus_tag LOCUS_07750 1436 645 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_07750 2071 1433 gene locus_tag LOCUS_07760 gene rsmG 2071 1433 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3N0 protein_id gnl|my_center|LOCUS_07760 3541 2090 gene locus_tag LOCUS_07770 gene prpD 3541 2090 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188028.1 protein_id gnl|my_center|LOCUS_07770 3902 4561 gene locus_tag LOCUS_07780 3902 4561 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061805.1 protein_id gnl|my_center|LOCUS_07780 4763 5035 gene locus_tag LOCUS_07790 4763 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence118 832 2145 gene locus_tag LOCUS_07800 832 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3907 2291 gene locus_tag LOCUS_07810 3907 2291 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_07810 5002 3932 gene locus_tag LOCUS_07820 5002 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence119 <1 672 gene locus_tag LOCUS_07830 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226447.1:glycosyl transferase 677 1447 gene locus_tag LOCUS_07840 677 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1533 2714 gene locus_tag LOCUS_07850 1533 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2711 3940 gene locus_tag LOCUS_07860 2711 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence120 309 384 gene locus_tag LOCUS_t00110 309 384 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 400 474 gene locus_tag LOCUS_t00120 400 474 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1174 557 gene locus_tag LOCUS_07870 1174 557 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_07870 3549 1174 gene locus_tag LOCUS_07880 gene ppsA 3549 1174 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLP8 protein_id gnl|my_center|LOCUS_07880 3622 4446 gene locus_tag LOCUS_07890 3622 4446 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_07890 >Feature sequence121 767 851 gene locus_tag LOCUS_t00130 767 851 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2272 980 gene locus_tag LOCUS_07900 gene purA 2272 980 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_07900 3429 2443 gene locus_tag LOCUS_07910 gene hisZ 3429 2443 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_07910 3629 3438 gene locus_tag LOCUS_07920 3629 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4495 3626 gene locus_tag LOCUS_07930 4495 3626 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_07930 <5062 4498 gene locus_tag LOCUS_07940 <5062 4498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266497.1:protease modulator HflK >Feature sequence122 676 212 gene locus_tag LOCUS_07950 gene mraZ 676 212 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK88 protein_id gnl|my_center|LOCUS_07950 1466 1891 gene locus_tag LOCUS_07960 1466 1891 CDS product MxaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228136.1 protein_id gnl|my_center|LOCUS_07960 1898 2659 gene locus_tag LOCUS_07970 1898 2659 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_07970 2766 3521 gene locus_tag LOCUS_07980 2766 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3412 4443 gene locus_tag LOCUS_07990 3412 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 <5053 4494 gene locus_tag LOCUS_08000 <5053 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87WV5:histidinol dehydrogenase >Feature sequence123 1453 1962 gene locus_tag LOCUS_08010 1453 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2654 1959 gene locus_tag LOCUS_08020 2654 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3950 2664 gene locus_tag LOCUS_08030 gene amt 3950 2664 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_08030 >Feature sequence124 3 233 gene locus_tag LOCUS_08040 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 230 1147 gene locus_tag LOCUS_08050 230 1147 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226340.1 protein_id gnl|my_center|LOCUS_08050 2261 1356 gene locus_tag LOCUS_08060 2261 1356 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921015.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08060 2888 2406 gene locus_tag LOCUS_08070 2888 2406 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_08070 3431 2973 gene locus_tag LOCUS_08080 3431 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4395 3496 gene locus_tag LOCUS_08090 gene rdgC 4395 3496 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1R9 protein_id gnl|my_center|LOCUS_08090 <5017 4514 gene locus_tag LOCUS_08100 <5017 4514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937731.1:cardiolipin synthase >Feature sequence125 733 140 gene locus_tag LOCUS_08110 gene paiB 733 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 protein_id gnl|my_center|LOCUS_08110 1531 746 gene locus_tag LOCUS_08120 gene thiG 1531 746 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_08120 1652 1579 gene locus_tag LOCUS_t00140 1652 1579 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1703 1909 gene locus_tag LOCUS_08130 1703 1909 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_08130 1982 4246 gene locus_tag LOCUS_08140 1982 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence126 <1 709 gene locus_tag LOCUS_08150 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5U3:chaperone SurA 712 1743 gene locus_tag LOCUS_08160 gene pdxA1 712 1743 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58715 protein_id gnl|my_center|LOCUS_08160 1740 2513 gene locus_tag LOCUS_08170 gene rsmA 1740 2513 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_08170 2590 3021 gene locus_tag LOCUS_08180 2590 3021 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR97 protein_id gnl|my_center|LOCUS_08180 <5009 3046 gene locus_tag LOCUS_08190 <5009 3046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:GGDEF domain-containing protein >Feature sequence127 2278 1391 gene locus_tag LOCUS_08200 2278 1391 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_08200 3482 2442 gene locus_tag LOCUS_08210 3482 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4781 3561 gene locus_tag LOCUS_08220 gene sucB 4781 3561 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 protein_id gnl|my_center|LOCUS_08220 >Feature sequence128 <1 860 gene locus_tag LOCUS_08230 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268628.1:short chain dehydrogenase 2278 926 gene locus_tag LOCUS_08240 2278 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_08240 2810 2355 gene locus_tag LOCUS_08250 2810 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4225 2807 gene locus_tag LOCUS_08260 4225 2807 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_08260 4438 4938 gene locus_tag LOCUS_08270 4438 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence129 1738 320 gene locus_tag LOCUS_08280 gene dld 1738 320 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_08280 2307 1735 gene locus_tag LOCUS_08290 gene gmhA 2307 1735 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_08290 2428 3294 gene locus_tag LOCUS_08300 2428 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3641 3300 gene locus_tag LOCUS_08310 3641 3300 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX8 protein_id gnl|my_center|LOCUS_08310 4888 3638 gene locus_tag LOCUS_08320 4888 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence130 2104 1601 gene locus_tag LOCUS_08330 gene pilP 2104 1601 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_08330 2760 2101 gene locus_tag LOCUS_08340 gene pilO 2760 2101 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_08340 3368 2757 gene locus_tag LOCUS_08350 gene pilN 3368 2757 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_08350 4453 3365 gene locus_tag LOCUS_08360 4453 3365 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence131 283 900 gene locus_tag LOCUS_08370 283 900 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_08370 2405 1989 gene locus_tag LOCUS_08380 2405 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 protein_id gnl|my_center|LOCUS_08380 2517 4148 gene locus_tag LOCUS_08390 2517 4148 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532697.1 protein_id gnl|my_center|LOCUS_08390 <4975 4176 gene locus_tag LOCUS_08400 <4975 4176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140509.1:universal stress protein UspA >Feature sequence132 1409 129 gene locus_tag LOCUS_08410 gene clpX 1409 129 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_08410 2135 1515 gene locus_tag LOCUS_08420 gene clpP 2135 1515 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHI5 protein_id gnl|my_center|LOCUS_08420 3567 2239 gene locus_tag LOCUS_08430 gene tig 3567 2239 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_08430 3699 3615 gene locus_tag LOCUS_t00150 3699 3615 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3854 4033 gene locus_tag LOCUS_08440 3854 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence133 1070 585 gene locus_tag LOCUS_08450 1070 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1268 1104 gene locus_tag LOCUS_08460 gene rubA2 1268 1104 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_08460 2563 1283 gene locus_tag LOCUS_08470 gene pksS 2563 1283 CDS product polyketide biosynthesis cytochrome P450 PksS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31785 protein_id gnl|my_center|LOCUS_08470 3314 2622 gene locus_tag LOCUS_08480 3314 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3507 4073 gene locus_tag LOCUS_08490 3507 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704609.1 protein_id gnl|my_center|LOCUS_08490 4559 4083 gene locus_tag LOCUS_08500 4559 4083 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence134 116 364 gene locus_tag LOCUS_08510 116 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 370 1374 gene locus_tag LOCUS_08520 370 1374 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202848.1 protein_id gnl|my_center|LOCUS_08520 2093 1401 gene locus_tag LOCUS_08530 2093 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3744 2194 gene locus_tag LOCUS_08540 3744 2194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence135 1 696 gene locus_tag LOCUS_08550 1 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 696 1193 gene locus_tag LOCUS_08560 696 1193 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_08560 1190 1666 gene locus_tag LOCUS_08570 1190 1666 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_08570 1650 2630 gene locus_tag LOCUS_08580 gene nagZ 1650 2630 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P75949 protein_id gnl|my_center|LOCUS_08580 2713 3270 gene locus_tag LOCUS_08590 gene hpt 2713 3270 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768820.1 protein_id gnl|my_center|LOCUS_08590 3267 4025 gene locus_tag LOCUS_08600 3267 4025 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 protein_id gnl|my_center|LOCUS_08600 4784 4029 gene locus_tag LOCUS_08610 gene phbB 4784 4029 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence136 <1 784 gene locus_tag LOCUS_08620 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5F6:bifunctional protein PutA 845 1552 gene locus_tag LOCUS_08630 845 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1835 1557 gene locus_tag LOCUS_08640 1835 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2025 3422 gene locus_tag LOCUS_08650 2025 3422 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_08650 3687 4115 gene locus_tag LOCUS_08660 3687 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08660 4659 4009 gene locus_tag LOCUS_08670 4659 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence137 953 2152 gene locus_tag LOCUS_08680 953 2152 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897437.1 protein_id gnl|my_center|LOCUS_08680 2218 3864 gene locus_tag LOCUS_08690 gene kstD 2218 3864 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71864 protein_id gnl|my_center|LOCUS_08690 4086 4823 gene locus_tag LOCUS_08700 4086 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence138 1103 489 gene locus_tag LOCUS_08710 1103 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1155 1316 gene locus_tag LOCUS_08720 1155 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2778 1354 gene locus_tag LOCUS_08730 2778 1354 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_08730 3049 3870 gene locus_tag LOCUS_08740 3049 3870 CDS product macrocin O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444381.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence139 2456 1692 gene locus_tag LOCUS_08750 gene map 2456 1692 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_08750 2632 3453 gene locus_tag LOCUS_08760 gene rpsB 2632 3453 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JC4 protein_id gnl|my_center|LOCUS_08760 3556 4602 gene locus_tag LOCUS_08770 gene tsf 3556 4602 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CDR5 protein_id gnl|my_center|LOCUS_08770 >Feature sequence140 1 441 gene locus_tag LOCUS_08780 1 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 422 1597 gene locus_tag LOCUS_08790 gene fabF 422 1597 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_08790 1594 2385 gene locus_tag LOCUS_08800 1594 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2382 2834 gene locus_tag LOCUS_08810 2382 2834 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_08810 2868 3587 gene locus_tag LOCUS_08820 2868 3587 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105316.1 protein_id gnl|my_center|LOCUS_08820 <4844 3617 gene locus_tag LOCUS_08830 <4844 3617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63WB9:dihydroxy-acid dehydratase >Feature sequence141 <1 1626 gene locus_tag LOCUS_08840 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KNY1:ribonuclease R 1623 2318 gene locus_tag LOCUS_08850 1623 2318 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918090.1 protein_id gnl|my_center|LOCUS_08850 2414 3169 gene locus_tag LOCUS_08860 gene rlmB 2414 3169 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_08860 3326 3775 gene locus_tag LOCUS_08870 gene rpsF 3326 3775 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P02358 protein_id gnl|my_center|LOCUS_08870 3779 4009 gene locus_tag LOCUS_08880 gene rpsR 3779 4009 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC1 protein_id gnl|my_center|LOCUS_08880 4022 4480 gene locus_tag LOCUS_08890 gene rplI 4022 4480 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC0 protein_id gnl|my_center|LOCUS_08890 >Feature sequence142 <1 861 gene locus_tag LOCUS_08900 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706388.1:alcohol dehydrogenase 861 1715 gene locus_tag LOCUS_08910 861 1715 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_08910 1919 2341 gene locus_tag LOCUS_08920 1919 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2331 3074 gene locus_tag LOCUS_08930 2331 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3161 3793 gene locus_tag LOCUS_08940 3161 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3790 4374 gene locus_tag LOCUS_08950 3790 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence143 <1 667 gene locus_tag LOCUS_08960 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3Q3:flagellar biosynthetic protein FliR 664 1794 gene locus_tag LOCUS_08970 gene flhB 664 1794 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_08970 2221 1799 gene locus_tag LOCUS_08980 2221 1799 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926524.1 protein_id gnl|my_center|LOCUS_08980 2829 2233 gene locus_tag LOCUS_08990 gene cynT 2829 2233 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_08990 4431 3100 gene locus_tag LOCUS_09000 4431 3100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence144 1750 431 gene locus_tag LOCUS_09010 1750 431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_09010 1820 2671 gene locus_tag LOCUS_09020 1820 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2681 3484 gene locus_tag LOCUS_09030 2681 3484 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933431.1 protein_id gnl|my_center|LOCUS_09030 3491 4321 gene locus_tag LOCUS_09040 3491 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence145 448 1791 gene locus_tag LOCUS_09050 gene miaB 448 1791 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2L3 protein_id gnl|my_center|LOCUS_09050 1788 2795 gene locus_tag LOCUS_09060 1788 2795 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_09060 2792 3214 gene locus_tag LOCUS_09070 gene ybeY 2792 3214 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_09070 3214 4080 gene locus_tag LOCUS_09080 3214 4080 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence146 709 83 gene locus_tag LOCUS_09090 709 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1122 706 gene locus_tag LOCUS_09100 1122 706 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208353.1 protein_id gnl|my_center|LOCUS_09100 1868 1119 gene locus_tag LOCUS_09110 1868 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2208 1861 gene locus_tag LOCUS_09120 2208 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2466 2218 gene locus_tag LOCUS_09130 gene acpP 2466 2218 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNN3 protein_id gnl|my_center|LOCUS_09130 3310 2501 gene locus_tag LOCUS_09140 3310 2501 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 protein_id gnl|my_center|LOCUS_09140 4290 3307 gene locus_tag LOCUS_09150 gene rapK 4290 3307 CDS product pteridine-dependent deoxygenase like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639353.2 protein_id gnl|my_center|LOCUS_09150 4475 4729 gene locus_tag LOCUS_09160 gene acpC 4475 4729 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639351.2 protein_id gnl|my_center|LOCUS_09160 >Feature sequence147 <1 1072 gene locus_tag LOCUS_09170 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JT87:tRNA modification GTPase MnmE 1193 1651 gene locus_tag LOCUS_09180 1193 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3814 1652 gene locus_tag LOCUS_09190 3814 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4761 3850 gene locus_tag LOCUS_09200 4761 3850 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence148 1559 2698 gene locus_tag LOCUS_09210 1559 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1693 1618 gene locus_tag LOCUS_t00160 1693 1618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2883 2695 gene locus_tag LOCUS_09220 2883 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3048 3920 gene locus_tag LOCUS_09230 gene tesB 3048 3920 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence149 1403 453 gene locus_tag LOCUS_09240 gene gshB 1403 453 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX7 protein_id gnl|my_center|LOCUS_09240 2864 1524 gene locus_tag LOCUS_09250 2864 1524 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_09250 2976 3362 gene locus_tag LOCUS_09260 gene pilG 2976 3362 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_09260 3375 3923 gene locus_tag LOCUS_09270 gene pilI 3375 3923 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_09270 >Feature sequence150 1933 302 gene locus_tag LOCUS_09280 gene aceF 1933 302 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGE2 protein_id gnl|my_center|LOCUS_09280 4612 1937 gene locus_tag LOCUS_09290 gene aceE 4612 1937 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_09290 >Feature sequence151 338 2911 gene locus_tag LOCUS_09300 338 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3184 4548 gene locus_tag LOCUS_09310 3184 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence152 28 909 gene locus_tag LOCUS_09320 28 909 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_09320 915 1355 gene locus_tag LOCUS_09330 915 1355 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_09330 1561 3909 gene locus_tag LOCUS_09340 1561 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence153 <1 1500 gene locus_tag LOCUS_09350 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P479:cytochrome c oxidase subunit 1 1662 2201 gene locus_tag LOCUS_09360 gene coxG 1662 2201 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948581.1 protein_id gnl|my_center|LOCUS_09360 2225 3103 gene locus_tag LOCUS_09370 gene cox3 2225 3103 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_09370 3398 3156 gene locus_tag LOCUS_09380 3398 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3499 4209 gene locus_tag LOCUS_09390 3499 4209 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT19 protein_id gnl|my_center|LOCUS_09390 >Feature sequence154 126 659 gene locus_tag LOCUS_09400 126 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09400 660 2315 gene locus_tag LOCUS_09410 660 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09410 2329 3186 gene locus_tag LOCUS_09420 2329 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3183 4373 gene locus_tag LOCUS_09430 3183 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence155 606 2222 gene locus_tag LOCUS_09440 606 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2320 2646 gene locus_tag LOCUS_09450 2320 2646 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPM9 protein_id gnl|my_center|LOCUS_09450 3008 2935 gene locus_tag LOCUS_t00170 3008 2935 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3491 3093 gene locus_tag LOCUS_09460 gene rpsI 3491 3093 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_09460 3935 3507 gene locus_tag LOCUS_09470 gene rplM 3935 3507 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SI5 protein_id gnl|my_center|LOCUS_09470 <4628 4058 gene locus_tag LOCUS_09480 <4628 4058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400837.1:twitching motility protein PilT >Feature sequence156 976 125 gene locus_tag LOCUS_09490 976 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2713 1016 gene locus_tag LOCUS_09500 gene leuA 2713 1016 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPL1 protein_id gnl|my_center|LOCUS_09500 3773 2976 gene locus_tag LOCUS_09510 gene pssA 3773 2976 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_09510 <4598 3827 gene locus_tag LOCUS_09520 <4598 3827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FLM4:2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase >Feature sequence157 <1 1072 gene locus_tag LOCUS_09530 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266151.1:cystathionine gamma-synthase 2152 3948 gene locus_tag LOCUS_09540 2152 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4232 4549 gene locus_tag LOCUS_09550 4232 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence158 589 59 gene locus_tag LOCUS_09560 589 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3761 678 gene locus_tag LOCUS_09570 3761 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 <4593 4001 gene locus_tag LOCUS_09580 <4593 4001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WKA7:putative diacyglycerol O-acyltransferase >Feature sequence159 2981 2634 gene locus_tag LOCUS_09590 2981 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4234 2993 gene locus_tag LOCUS_09600 4234 2993 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence160 57 530 gene locus_tag LOCUS_09610 57 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 653 2008 gene locus_tag LOCUS_09620 653 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_09620 2101 2589 gene locus_tag LOCUS_09630 2101 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2623 2859 gene locus_tag LOCUS_09640 2623 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 <4548 2934 gene locus_tag LOCUS_09650 <4548 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBB5:DNA mismatch repair protein MutS >Feature sequence161 <1 1143 gene locus_tag LOCUS_09660 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P0B3:alanine--tRNA ligase 1225 2454 gene locus_tag LOCUS_09670 gene lysC 1225 2454 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_09670 2553 2747 gene locus_tag LOCUS_09680 gene csrA 2553 2747 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK11 protein_id gnl|my_center|LOCUS_09680 2819 2895 gene locus_tag LOCUS_t00180 2819 2895 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2939 3030 gene locus_tag LOCUS_t00190 2939 3030 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3088 3164 gene locus_tag LOCUS_t00200 3088 3164 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <4518 3290 gene locus_tag LOCUS_09690 <4518 3290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539668.1:long-chain-fatty-acid--CoA ligase >Feature sequence162 681 1082 gene locus_tag LOCUS_09700 681 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200901.1 protein_id gnl|my_center|LOCUS_09700 1098 1472 gene locus_tag LOCUS_09710 1098 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2944 1490 gene locus_tag LOCUS_09720 gene dbpA 2944 1490 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_09720 3718 3002 gene locus_tag LOCUS_09730 3718 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence163 1047 1499 gene locus_tag LOCUS_09740 1047 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1874 2887 gene locus_tag LOCUS_09750 1874 2887 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_09750 4149 2884 gene locus_tag LOCUS_09760 4149 2884 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035424.1 protein_id gnl|my_center|LOCUS_09760 4483 4256 gene locus_tag LOCUS_09770 4483 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence164 1731 490 gene locus_tag LOCUS_09780 1731 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2453 1728 gene locus_tag LOCUS_09790 gene ompR 2453 1728 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_09790 2621 3514 gene locus_tag LOCUS_09800 2621 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3688 4416 gene locus_tag LOCUS_09810 3688 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence165 3575 858 gene locus_tag LOCUS_09820 3575 858 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_09820 4376 3618 gene locus_tag LOCUS_09830 4376 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence166 1179 559 gene locus_tag LOCUS_09840 1179 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_09840 2043 1192 gene locus_tag LOCUS_09850 2043 1192 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 protein_id gnl|my_center|LOCUS_09850 2141 2692 gene locus_tag LOCUS_09860 2141 2692 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB9 protein_id gnl|my_center|LOCUS_09860 2746 3231 gene locus_tag LOCUS_09870 2746 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3342 3917 gene locus_tag LOCUS_09880 3342 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence167 <1 1179 gene locus_tag LOCUS_09890 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P5Z6:pyruvate kinase 1269 1973 gene locus_tag LOCUS_09900 1269 1973 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 protein_id gnl|my_center|LOCUS_09900 2444 2001 gene locus_tag LOCUS_09910 2444 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038901.1 protein_id gnl|my_center|LOCUS_09910 3181 2567 gene locus_tag LOCUS_09920 3181 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 4171 3320 gene locus_tag LOCUS_09930 4171 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112358.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence168 <1 711 gene locus_tag LOCUS_09940 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113970.1:transcriptional regulator 852 2228 gene locus_tag LOCUS_09950 gene trkA 852 2228 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_09950 2228 3730 gene locus_tag LOCUS_09960 gene trkH 2228 3730 CDS product trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3C8 protein_id gnl|my_center|LOCUS_09960 >Feature sequence169 109 270 gene locus_tag LOCUS_09970 109 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 263 1114 gene locus_tag LOCUS_09980 gene cheR 263 1114 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J5 protein_id gnl|my_center|LOCUS_09980 1111 1746 gene locus_tag LOCUS_09990 gene cheD1 1111 1746 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_09990 1746 2783 gene locus_tag LOCUS_10000 gene cheB1 1746 2783 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 protein_id gnl|my_center|LOCUS_10000 2857 4038 gene locus_tag LOCUS_10010 gene mcp 2857 4038 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence170 1241 1789 gene locus_tag LOCUS_10020 1241 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2203 2913 gene locus_tag LOCUS_10030 2203 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3442 3320 gene locus_tag LOCUS_10040 3442 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 <4446 3638 gene locus_tag LOCUS_10050 <4446 3638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUL8:ribonucleoside-diphosphate reductase subunit beta >Feature sequence171 <1 940 gene locus_tag LOCUS_10060 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036316.1:peptidase M20 1642 1043 gene locus_tag LOCUS_10070 1642 1043 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_10070 3590 1734 gene locus_tag LOCUS_10080 3590 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence172 <1 658 gene locus_tag LOCUS_10090 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VT06:S-(hydroxymethyl)glutathione dehydrogenase 658 1509 gene locus_tag LOCUS_10100 658 1509 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML36 protein_id gnl|my_center|LOCUS_10100 1561 1637 gene locus_tag LOCUS_t00210 1561 1637 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1841 3322 gene locus_tag LOCUS_10110 1841 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence173 490 1755 gene locus_tag LOCUS_10120 gene ycaD 490 1755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_10120 2365 1745 gene locus_tag LOCUS_10130 gene cysC 2365 1745 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E828 protein_id gnl|my_center|LOCUS_10130 3094 2438 gene locus_tag LOCUS_10140 3094 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence174 153 548 gene locus_tag LOCUS_10150 gene rpsH 153 548 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL9 protein_id gnl|my_center|LOCUS_10150 562 1092 gene locus_tag LOCUS_10160 gene rplF 562 1092 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_10160 1162 1515 gene locus_tag LOCUS_10170 gene rplR 1162 1515 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSK2 protein_id gnl|my_center|LOCUS_10170 1519 2028 gene locus_tag LOCUS_10180 gene rpsE 1519 2028 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B48 protein_id gnl|my_center|LOCUS_10180 2032 2223 gene locus_tag LOCUS_10190 gene rpmD 2032 2223 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44366 protein_id gnl|my_center|LOCUS_10190 2243 2677 gene locus_tag LOCUS_10200 gene rplO 2243 2677 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTB2 protein_id gnl|my_center|LOCUS_10200 2688 4037 gene locus_tag LOCUS_10210 gene secY 2688 4037 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MQR0 protein_id gnl|my_center|LOCUS_10210 >Feature sequence175 152 228 gene locus_tag LOCUS_t00220 152 228 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3602 453 gene locus_tag LOCUS_10220 3602 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3787 4299 gene locus_tag LOCUS_10230 3787 4299 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence176 1374 1129 gene locus_tag LOCUS_10240 gene acpP1 1374 1129 CDS product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 protein_id gnl|my_center|LOCUS_10240 2244 1501 gene locus_tag LOCUS_10250 gene fabG 2244 1501 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389704.1 protein_id gnl|my_center|LOCUS_10250 3239 2316 gene locus_tag LOCUS_10260 3239 2316 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLP3 protein_id gnl|my_center|LOCUS_10260 3841 3236 gene locus_tag LOCUS_10270 3841 3236 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 protein_id gnl|my_center|LOCUS_10270 3931 4377 gene locus_tag LOCUS_10280 gene xcpT 3931 4377 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_10280 >Feature sequence177 1507 485 gene locus_tag LOCUS_10290 1507 485 CDS product sugar dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_10290 2166 1507 gene locus_tag LOCUS_10300 2166 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2831 2262 gene locus_tag LOCUS_10310 2831 2262 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_10310 >Feature sequence178 843 523 gene locus_tag LOCUS_10320 843 523 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013722.1 protein_id gnl|my_center|LOCUS_10320 2103 853 gene locus_tag LOCUS_10330 2103 853 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_10330 3272 2226 gene locus_tag LOCUS_10340 3272 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3785 3360 gene locus_tag LOCUS_10350 3785 3360 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEA7 protein_id gnl|my_center|LOCUS_10350 <4387 3775 gene locus_tag LOCUS_10360 <4387 3775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893580.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence179 4 372 gene locus_tag LOCUS_10370 4 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 369 1454 gene locus_tag LOCUS_10380 369 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3118 1628 gene locus_tag LOCUS_10390 gene ntrC 3118 1628 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_10390 4268 3198 gene locus_tag LOCUS_10400 gene ntrB 4268 3198 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence180 1275 343 gene locus_tag LOCUS_10410 gene etfA 1275 343 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_10410 2021 1275 gene locus_tag LOCUS_10420 gene etfB 2021 1275 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_10420 3725 2064 gene locus_tag LOCUS_10430 3725 2064 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_10430 >Feature sequence181 2395 1781 gene locus_tag LOCUS_10440 2395 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3612 2368 gene locus_tag LOCUS_10450 3612 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence182 165 1502 gene locus_tag LOCUS_10460 gene trpE 165 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_10460 1499 2320 gene locus_tag LOCUS_10470 gene pabC 1499 2320 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_10470 2320 3324 gene locus_tag LOCUS_10480 2320 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_10480 3332 3955 gene locus_tag LOCUS_10490 gene tmk 3332 3955 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence183 >Feature sequence184 2312 1398 gene locus_tag LOCUS_10500 2312 1398 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 protein_id gnl|my_center|LOCUS_10500 3220 2309 gene locus_tag LOCUS_10510 3220 2309 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537829.1 protein_id gnl|my_center|LOCUS_10510 4034 3354 gene locus_tag LOCUS_10520 4034 3354 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence185 2620 848 gene locus_tag LOCUS_10530 gene msbA 2620 848 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLY2 protein_id gnl|my_center|LOCUS_10530 2696 3037 gene locus_tag LOCUS_10540 2696 3037 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_10540 3854 3054 gene locus_tag LOCUS_10550 3854 3054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123045.1 protein_id gnl|my_center|LOCUS_10550 4273 3875 gene locus_tag LOCUS_10560 4273 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930254.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence186 999 562 gene locus_tag LOCUS_10570 999 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1354 1073 gene locus_tag LOCUS_10580 1354 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1852 1421 gene locus_tag LOCUS_10590 1852 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2322 1870 gene locus_tag LOCUS_10600 2322 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3172 2801 gene locus_tag LOCUS_10610 3172 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3604 3191 gene locus_tag LOCUS_10620 3604 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3964 3671 gene locus_tag LOCUS_10630 3964 3671 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_10630 4149 3964 gene locus_tag LOCUS_10640 4149 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence187 >Feature sequence188 1109 693 gene locus_tag LOCUS_10650 1109 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1541 1179 gene locus_tag LOCUS_10660 gene tfoX 1541 1179 CDS product DNA transformation protein tfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_10660 1776 2477 gene locus_tag LOCUS_10670 1776 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence189 1167 166 gene locus_tag LOCUS_10680 1167 166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_10680 1520 1164 gene locus_tag LOCUS_10690 1520 1164 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_10690 2743 1544 gene locus_tag LOCUS_10700 2743 1544 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_10700 3328 4125 gene locus_tag LOCUS_10710 3328 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence190 1089 424 gene locus_tag LOCUS_10720 gene trpF 1089 424 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7R6 protein_id gnl|my_center|LOCUS_10720 1879 1091 gene locus_tag LOCUS_10730 gene truA 1879 1091 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN7 protein_id gnl|my_center|LOCUS_10730 2529 1876 gene locus_tag LOCUS_10740 2529 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 <4243 2563 gene locus_tag LOCUS_10750 <4243 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003163304.1:motility protein FimV >Feature sequence191 1413 235 gene locus_tag LOCUS_10760 1413 235 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_10760 1905 1486 gene locus_tag LOCUS_10770 1905 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_10770 2533 1928 gene locus_tag LOCUS_10780 2533 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence192 1112 117 gene locus_tag LOCUS_10790 1112 117 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_10790 1820 1278 gene locus_tag LOCUS_10800 gene folE1 1820 1278 CDS product GTP cyclohydrolase 1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYG8 protein_id gnl|my_center|LOCUS_10800 1888 2688 gene locus_tag LOCUS_10810 gene parB 1888 2688 CDS product putative chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AH2 protein_id gnl|my_center|LOCUS_10810 2893 3648 gene locus_tag LOCUS_10820 2893 3648 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537954.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence193 418 975 gene locus_tag LOCUS_10830 gene nuoE 418 975 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347513.1 protein_id gnl|my_center|LOCUS_10830 972 2276 gene locus_tag LOCUS_10840 972 2276 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789502.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence194 1367 267 gene locus_tag LOCUS_10850 gene dnaN 1367 267 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_10850 2957 1608 gene locus_tag LOCUS_10860 gene dnaA 2957 1608 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2N6 protein_id gnl|my_center|LOCUS_10860 3368 3730 gene locus_tag LOCUS_10870 gene rnpA 3368 3730 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_10870 3742 3957 gene locus_tag LOCUS_10880 3742 3957 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I270 protein_id gnl|my_center|LOCUS_10880 >Feature sequence195 903 424 gene locus_tag LOCUS_10890 903 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1156 2874 gene locus_tag LOCUS_10900 gene gatAX 1156 2874 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036138.1 protein_id gnl|my_center|LOCUS_10900 2967 3593 gene locus_tag LOCUS_10910 gene ycgM 2967 3593 CDS product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence196 737 1498 gene locus_tag LOCUS_10920 737 1498 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_10920 1500 2861 gene locus_tag LOCUS_10930 gene ttpC 1500 2861 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_10930 2848 3369 gene locus_tag LOCUS_10940 gene exbB 2848 3369 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_10940 3379 3792 gene locus_tag LOCUS_10950 3379 3792 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence197 <1 857 gene locus_tag LOCUS_10960 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN61:succinyl-diaminopimelate desuccinylase 854 1846 gene locus_tag LOCUS_10970 854 1846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_10970 2817 1873 gene locus_tag LOCUS_10980 gene qor 2817 1873 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223329.1 protein_id gnl|my_center|LOCUS_10980 3900 2887 gene locus_tag LOCUS_10990 3900 2887 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_10990 4014 4101 gene locus_tag LOCUS_t00230 4014 4101 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence198 <1 800 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctgtgcggcagtgaac 1496 930 gene locus_tag LOCUS_11000 1496 930 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_11000 2530 1502 gene locus_tag LOCUS_11010 2530 1502 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_11010 3556 2558 gene locus_tag LOCUS_11020 3556 2558 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_11020 <4172 3553 gene locus_tag LOCUS_11030 <4172 3553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415806.1:type I-F CRISPR-associated protein Csy1 >Feature sequence199 2 1024 gene locus_tag LOCUS_11040 gene proA 2 1024 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_11040 1021 1683 gene locus_tag LOCUS_11050 gene nadD 1021 1683 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_11050 1667 2338 gene locus_tag LOCUS_11060 1667 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2350 2820 gene locus_tag LOCUS_11070 gene rlmH 2350 2820 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_11070 <4165 2831 gene locus_tag LOCUS_11080 <4165 2831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091605.1:MFS transporter >Feature sequence200 1446 1649 gene locus_tag LOCUS_11090 1446 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2956 1724 gene locus_tag LOCUS_11100 2956 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3300 2953 gene locus_tag LOCUS_11110 gene nirD 3300 2953 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 protein_id gnl|my_center|LOCUS_11110 <4155 3297 gene locus_tag LOCUS_11120 <4155 3297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205570.1:nitrite reductase large subunit >Feature sequence201 <1 1288 gene locus_tag LOCUS_11130 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066164.1:catalase-peroxidase 1371 1799 gene locus_tag LOCUS_11140 gene ohr 1371 1799 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 protein_id gnl|my_center|LOCUS_11140 1822 2709 gene locus_tag LOCUS_11150 1822 2709 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_11150 3375 2746 gene locus_tag LOCUS_11160 3375 2746 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_11160 <4145 3375 gene locus_tag LOCUS_11170 <4145 3375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EKS5:glycine--tRNA ligase alpha subunit >Feature sequence202 5 1006 gene locus_tag LOCUS_11180 5 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1012 1764 gene locus_tag LOCUS_11190 gene gpmA 1012 1764 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 protein_id gnl|my_center|LOCUS_11190 2324 1788 gene locus_tag LOCUS_11200 2324 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_11200 2421 3320 gene locus_tag LOCUS_11210 2421 3320 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_11210 3317 3832 gene locus_tag LOCUS_11220 3317 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4075 3836 gene locus_tag LOCUS_11230 4075 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence203 196 639 gene locus_tag LOCUS_11240 196 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 636 1268 gene locus_tag LOCUS_11250 636 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2059 1295 gene locus_tag LOCUS_11260 2059 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3544 2075 gene locus_tag LOCUS_11270 3544 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4131 3550 gene locus_tag LOCUS_11280 4131 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence204 150 1340 gene locus_tag LOCUS_11290 150 1340 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_11290 2522 1344 gene locus_tag LOCUS_11300 2522 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2654 3592 gene locus_tag LOCUS_11310 2654 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence205 1768 203 gene locus_tag LOCUS_11320 1768 203 CDS product putative phosphate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26024 protein_id gnl|my_center|LOCUS_11320 3076 1889 gene locus_tag LOCUS_11330 3076 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence206 539 3232 gene locus_tag LOCUS_11340 539 3232 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 protein_id gnl|my_center|LOCUS_11340 3384 3575 gene locus_tag LOCUS_11350 3384 3575 CDS product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence207 650 1528 gene locus_tag LOCUS_11360 650 1528 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_11360 1654 2706 gene locus_tag LOCUS_11370 1654 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3948 2740 gene locus_tag LOCUS_11380 3948 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence208 <1 637 gene locus_tag LOCUS_11390 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114325.1:acyl-CoA dehydrogenase 1516 644 gene locus_tag LOCUS_11400 gene pecR 1516 644 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_11400 2692 1520 gene locus_tag LOCUS_11410 gene ivd 2692 1520 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence209 1350 427 gene locus_tag LOCUS_11420 1350 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1906 1436 gene locus_tag LOCUS_11430 1906 1436 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 protein_id gnl|my_center|LOCUS_11430 <4002 1906 gene locus_tag LOCUS_11440 <4002 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein >Feature sequence210 223 74 gene locus_tag LOCUS_11450 223 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1006 233 gene locus_tag LOCUS_11460 1006 233 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11460 1089 2135 gene locus_tag LOCUS_11470 1089 2135 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_11470 3099 2056 gene locus_tag LOCUS_11480 gene adiY 3099 2056 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence211 170 697 gene locus_tag LOCUS_11490 170 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2970 679 gene locus_tag LOCUS_11500 2970 679 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence212 469 62 gene locus_tag LOCUS_11510 469 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 773 543 gene locus_tag LOCUS_11520 773 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1260 868 gene locus_tag LOCUS_11530 1260 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_11530 1656 1282 gene locus_tag LOCUS_11540 1656 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2498 1881 gene locus_tag LOCUS_11550 2498 1881 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 protein_id gnl|my_center|LOCUS_11550 2674 3972 gene locus_tag LOCUS_11560 2674 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence213 324 1652 gene locus_tag LOCUS_11570 324 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1763 2407 gene locus_tag LOCUS_11580 1763 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2475 3014 gene locus_tag LOCUS_11590 2475 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence214 1663 1439 gene locus_tag LOCUS_11600 1663 1439 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXL5 protein_id gnl|my_center|LOCUS_11600 2360 1743 gene locus_tag LOCUS_11610 2360 1743 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928612.1 protein_id gnl|my_center|LOCUS_11610 3958 2357 gene locus_tag LOCUS_11620 gene lpw206-207 3958 2357 CDS product paraquat-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205234.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence215 634 416 gene locus_tag LOCUS_11630 634 416 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_11630 1406 639 gene locus_tag LOCUS_11640 1406 639 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG20 protein_id gnl|my_center|LOCUS_11640 2317 1403 gene locus_tag LOCUS_11650 2317 1403 CDS product ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205265.1 protein_id gnl|my_center|LOCUS_11650 2362 3813 gene locus_tag LOCUS_11660 gene phr 2362 3813 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence216 302 27 gene locus_tag LOCUS_11670 302 27 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403102.1 protein_id gnl|my_center|LOCUS_11670 733 311 gene locus_tag LOCUS_11680 733 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1520 819 gene locus_tag LOCUS_11690 1520 819 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_11690 1826 2161 gene locus_tag LOCUS_11700 1826 2161 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_11700 2951 2211 gene locus_tag LOCUS_11710 2951 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106512.1 protein_id gnl|my_center|LOCUS_11710 3334 2948 gene locus_tag LOCUS_11720 3334 2948 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 protein_id gnl|my_center|LOCUS_11720 <3947 3426 gene locus_tag LOCUS_11730 <3947 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530092.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence217 1 1158 gene locus_tag LOCUS_11740 1 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1293 3620 gene locus_tag LOCUS_11750 gene mrcB 1293 3620 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_11750 >Feature sequence218 2234 1194 gene locus_tag LOCUS_11760 2234 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3731 2241 gene locus_tag LOCUS_11770 3731 2241 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence219 805 2946 gene locus_tag LOCUS_11780 805 2946 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_11780 2931 3740 gene locus_tag LOCUS_11790 2931 3740 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence220 1400 240 gene locus_tag LOCUS_11800 1400 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932751.1 protein_id gnl|my_center|LOCUS_11800 1687 1472 gene locus_tag LOCUS_11810 1687 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2205 1684 gene locus_tag LOCUS_11820 2205 1684 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence221 950 276 gene locus_tag LOCUS_11830 950 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1045 1650 gene locus_tag LOCUS_11840 1045 1650 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC76 protein_id gnl|my_center|LOCUS_11840 1659 2009 gene locus_tag LOCUS_11850 1659 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2622 1930 gene locus_tag LOCUS_11860 2622 1930 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 protein_id gnl|my_center|LOCUS_11860 3746 2619 gene locus_tag LOCUS_11870 gene perM 3746 2619 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence222 525 1406 gene locus_tag LOCUS_11880 gene prk 525 1406 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS95 protein_id gnl|my_center|LOCUS_11880 1411 2442 gene locus_tag LOCUS_11890 1411 2442 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_11890 2558 2863 gene locus_tag LOCUS_11900 2558 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2878 3513 gene locus_tag LOCUS_11910 2878 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence223 439 1695 gene locus_tag LOCUS_11920 439 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3491 1770 gene locus_tag LOCUS_11930 3491 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence224 136 828 gene locus_tag LOCUS_11940 136 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 849 1436 gene locus_tag LOCUS_11950 849 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2160 1387 gene locus_tag LOCUS_11960 2160 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3541 2246 gene locus_tag LOCUS_11970 gene gltA 3541 2246 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5V0 protein_id gnl|my_center|LOCUS_11970 >Feature sequence225 287 12 gene locus_tag LOCUS_11980 287 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1270 374 gene locus_tag LOCUS_11990 1270 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1934 1272 gene locus_tag LOCUS_12000 1934 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2404 1934 gene locus_tag LOCUS_12010 2404 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3449 2451 gene locus_tag LOCUS_12020 3449 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence226 <1 1298 gene locus_tag LOCUS_12030 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetyl-CoA synthetase 1540 2508 gene locus_tag LOCUS_12040 1540 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence227 880 329 gene locus_tag LOCUS_12050 880 329 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MII1 protein_id gnl|my_center|LOCUS_12050 1281 985 gene locus_tag LOCUS_12060 1281 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2117 1329 gene locus_tag LOCUS_12070 2117 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2294 3859 gene locus_tag LOCUS_12080 2294 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence228 641 1297 gene locus_tag LOCUS_12090 641 1297 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230170.1 protein_id gnl|my_center|LOCUS_12090 1294 2265 gene locus_tag LOCUS_12100 1294 2265 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705110.1 protein_id gnl|my_center|LOCUS_12100 2368 3735 gene locus_tag LOCUS_12110 2368 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WL81 protein_id gnl|my_center|LOCUS_12110 >Feature sequence229 <1 541 gene locus_tag LOCUS_12120 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035935.1:3,4-dihydroxy-2-butanone-4-phosphate synthase 559 1074 gene locus_tag LOCUS_12130 gene ribH 559 1074 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 protein_id gnl|my_center|LOCUS_12130 1071 1535 gene locus_tag LOCUS_12140 gene nusB 1071 1535 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_12140 1542 2486 gene locus_tag LOCUS_12150 gene thiL 1542 2486 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX7 protein_id gnl|my_center|LOCUS_12150 2486 3019 gene locus_tag LOCUS_12160 gene pgpA 2486 3019 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNR9 protein_id gnl|my_center|LOCUS_12160 >Feature sequence230 895 1575 gene locus_tag LOCUS_12170 895 1575 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088254.1 protein_id gnl|my_center|LOCUS_12170 1652 2470 gene locus_tag LOCUS_12180 1652 2470 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_12180 2571 2885 gene locus_tag LOCUS_12190 2571 2885 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 protein_id gnl|my_center|LOCUS_12190 2895 3617 gene locus_tag LOCUS_12200 2895 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence231 633 3116 gene locus_tag LOCUS_12210 633 3116 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_12210 3223 3308 gene locus_tag LOCUS_t00240 3223 3308 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3343 3416 gene locus_tag LOCUS_t00250 3343 3416 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3456 3531 gene locus_tag LOCUS_t00260 3456 3531 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence232 1676 1302 gene locus_tag LOCUS_12220 1676 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3178 2822 gene locus_tag LOCUS_tm00010 3178 2822 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence233 354 950 gene locus_tag LOCUS_12230 354 950 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_12230 950 1816 gene locus_tag LOCUS_12240 950 1816 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 protein_id gnl|my_center|LOCUS_12240 1908 3107 gene locus_tag LOCUS_12250 1908 3107 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence234 639 283 gene locus_tag LOCUS_12260 gene mmcQ 639 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614659.1 protein_id gnl|my_center|LOCUS_12260 977 645 gene locus_tag LOCUS_12270 977 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2449 1007 gene locus_tag LOCUS_12280 2449 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_12280 3203 2739 gene locus_tag LOCUS_12290 3203 2739 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence235 >Feature sequence236 >Feature sequence237 834 367 gene locus_tag LOCUS_12300 gene smg 834 367 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_12300 2011 896 gene locus_tag LOCUS_12310 gene smf 2011 896 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_12310 3215 2040 gene locus_tag LOCUS_12320 3215 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence238 2343 718 gene locus_tag LOCUS_12330 gene atuC 2343 718 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_12330 2454 3104 gene locus_tag LOCUS_12340 2454 3104 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035502.1 protein_id gnl|my_center|LOCUS_12340 <3720 3186 gene locus_tag LOCUS_12350 <3720 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetyl-CoA synthetase >Feature sequence239 2664 2272 gene locus_tag LOCUS_12360 2664 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12360 <3715 2716 gene locus_tag LOCUS_12370 <3715 2716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037293.1:transporter note possible pseudo, internal stop codon >Feature sequence240 192 809 gene locus_tag LOCUS_12380 gene msrA 192 809 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EN0 protein_id gnl|my_center|LOCUS_12380 888 2447 gene locus_tag LOCUS_12390 888 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2761 2444 gene locus_tag LOCUS_12400 2761 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3157 2834 gene locus_tag LOCUS_12410 3157 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3422 3634 gene locus_tag LOCUS_12420 3422 3634 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence241 <1 1050 gene locus_tag LOCUS_12430 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222012.1:penicillin acylase 1081 1488 gene locus_tag LOCUS_12440 1081 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1509 1934 gene locus_tag LOCUS_12450 1509 1934 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 protein_id gnl|my_center|LOCUS_12450 3331 1931 gene locus_tag LOCUS_12460 gene engA 3331 1931 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_12460 3705 3406 gene locus_tag LOCUS_12470 3705 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence242 517 1284 gene locus_tag LOCUS_12480 517 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1390 1314 gene locus_tag LOCUS_t00270 1390 1314 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2367 1399 gene locus_tag LOCUS_12490 2367 1399 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_12490 2552 2866 gene locus_tag LOCUS_12500 gene rplU 2552 2866 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E873 protein_id gnl|my_center|LOCUS_12500 2879 3136 gene locus_tag LOCUS_12510 gene rpmA 2879 3136 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU3 protein_id gnl|my_center|LOCUS_12510 >Feature sequence243 333 911 gene locus_tag LOCUS_12520 333 911 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 protein_id gnl|my_center|LOCUS_12520 1905 919 gene locus_tag LOCUS_12530 1905 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031039.1 protein_id gnl|my_center|LOCUS_12530 <3699 2019 gene locus_tag LOCUS_12540 <3699 2019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:GGDEF domain-containing protein >Feature sequence244 176 1405 gene locus_tag LOCUS_12550 176 1405 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205478.1 protein_id gnl|my_center|LOCUS_12550 2503 1541 gene locus_tag LOCUS_12560 2503 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 <3695 2947 gene locus_tag LOCUS_12570 <3695 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I693:adenosylmethionine-8-amino-7-oxononanoate aminotransferase >Feature sequence245 1450 254 gene locus_tag LOCUS_12580 1450 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2006 1512 gene locus_tag LOCUS_12590 2006 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2862 2032 gene locus_tag LOCUS_12600 2862 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3286 2864 gene locus_tag LOCUS_12610 3286 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3482 3288 gene locus_tag LOCUS_12620 3482 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3667 3479 gene locus_tag LOCUS_12630 3667 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence246 <1 1357 gene locus_tag LOCUS_12640 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072668.1:peptidase M61 1351 2004 gene locus_tag LOCUS_12650 gene plsY 1351 2004 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66905 protein_id gnl|my_center|LOCUS_12650 1989 2957 gene locus_tag LOCUS_12660 gene birA 1989 2957 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS61 protein_id gnl|my_center|LOCUS_12660 2954 3688 gene locus_tag LOCUS_12670 gene coaX 2954 3688 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence247 1110 919 gene locus_tag LOCUS_12680 1110 919 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902305.1 protein_id gnl|my_center|LOCUS_12680 1520 1107 gene locus_tag LOCUS_12690 1520 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3269 1830 gene locus_tag LOCUS_12700 gene cysG 3269 1830 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_12700 3683 3285 gene locus_tag LOCUS_12710 3683 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence248 <1 1156 gene locus_tag LOCUS_12720 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490371.1:ammonium transporter 1239 1628 gene locus_tag LOCUS_12730 1239 1628 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340730.1 protein_id gnl|my_center|LOCUS_12730 1711 3003 gene locus_tag LOCUS_12740 1711 3003 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_12740 3303 3043 gene locus_tag LOCUS_12750 3303 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence249 1081 119 gene locus_tag LOCUS_12760 1081 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2180 1164 gene locus_tag LOCUS_12770 2180 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2977 2177 gene locus_tag LOCUS_12780 2977 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence250 655 2454 gene locus_tag LOCUS_12790 655 2454 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_12790 2472 3413 gene locus_tag LOCUS_12800 2472 3413 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence251 1502 858 gene locus_tag LOCUS_12810 gene fliH 1502 858 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930338.1 protein_id gnl|my_center|LOCUS_12810 2518 1502 gene locus_tag LOCUS_12820 gene fliG 2518 1502 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E0 protein_id gnl|my_center|LOCUS_12820 <3671 2519 gene locus_tag LOCUS_12830 <3671 2519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9D9:flagellar M-ring protein >Feature sequence252 337 2160 gene locus_tag LOCUS_12840 gene typA 337 2160 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_12840 3225 2209 gene locus_tag LOCUS_12850 3225 2209 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence253 896 81 gene locus_tag LOCUS_12860 896 81 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_12860 1168 1860 gene locus_tag LOCUS_12870 gene gpmA 1168 1860 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_12870 1873 2619 gene locus_tag LOCUS_12880 1873 2619 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence254 2869 128 gene locus_tag LOCUS_12890 2869 128 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920434.1 protein_id gnl|my_center|LOCUS_12890 2868 3509 gene locus_tag LOCUS_12900 2868 3509 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence255 1269 1664 gene locus_tag LOCUS_12910 1269 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1696 2931 gene locus_tag LOCUS_12920 1696 2931 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_12920 <3645 2897 gene locus_tag LOCUS_12930 <3645 2897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886781.1:lipase >Feature sequence256 671 829 gene locus_tag LOCUS_12940 671 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1735 1112 gene locus_tag LOCUS_12950 gene dcd 1735 1112 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYK8 protein_id gnl|my_center|LOCUS_12950 3042 1732 gene locus_tag LOCUS_12960 3042 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3485 3039 gene locus_tag LOCUS_12970 3485 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence257 >Feature sequence258 <1 805 gene locus_tag LOCUS_12980 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921202.1:ABC transporter ATP-binding protein 802 1563 gene locus_tag LOCUS_12990 gene yadH 802 1563 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4P8 protein_id gnl|my_center|LOCUS_12990 1583 1831 gene locus_tag LOCUS_13000 1583 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815955.1 protein_id gnl|my_center|LOCUS_13000 2759 1797 gene locus_tag LOCUS_13010 2759 1797 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_13010 2880 3482 gene locus_tag LOCUS_13020 gene azoR 2880 3482 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG7 protein_id gnl|my_center|LOCUS_13020 >Feature sequence259 2833 1373 gene locus_tag LOCUS_13030 gene cafA 2833 1373 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_13030 3504 2908 gene locus_tag LOCUS_13040 3504 2908 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_13040 >Feature sequence260 3 158 gene locus_tag LOCUS_13050 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 151 1080 gene locus_tag LOCUS_13060 151 1080 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_13060 1145 1780 gene locus_tag LOCUS_13070 gene gmk 1145 1780 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNB1 protein_id gnl|my_center|LOCUS_13070 1834 2097 gene locus_tag LOCUS_13080 1834 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence261 1228 524 gene locus_tag LOCUS_13090 gene rpe 1228 524 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 protein_id gnl|my_center|LOCUS_13090 1312 2196 gene locus_tag LOCUS_13100 gene purC 1312 2196 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIW9 protein_id gnl|my_center|LOCUS_13100 2234 2827 gene locus_tag LOCUS_13110 2234 2827 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH1 protein_id gnl|my_center|LOCUS_13110 2880 3260 gene locus_tag LOCUS_13120 2880 3260 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225309.1 protein_id gnl|my_center|LOCUS_13120 3277 3618 gene locus_tag LOCUS_13130 3277 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence262 3363 2209 gene locus_tag LOCUS_13140 3363 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence263 <1 711 gene locus_tag LOCUS_13150 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207012.1:nitrate reductase 837 2189 gene locus_tag LOCUS_13160 gene crnA 837 2189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_13160 2194 2757 gene locus_tag LOCUS_13170 gene mobA 2194 2757 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMS8 protein_id gnl|my_center|LOCUS_13170 >Feature sequence264 2207 702 gene locus_tag LOCUS_13180 2207 702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_13180 2755 2279 gene locus_tag LOCUS_13190 2755 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence265 2045 159 gene locus_tag LOCUS_13200 2045 159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_13200 3261 2059 gene locus_tag LOCUS_13210 3261 2059 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039039.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence266 1179 382 gene locus_tag LOCUS_13220 gene pmtA 1179 382 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_13220 1172 2467 gene locus_tag LOCUS_13230 gene adcK4 1172 2467 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_13230 3370 2483 gene locus_tag LOCUS_13240 3370 2483 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence267 1649 168 gene locus_tag LOCUS_13250 1649 168 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731449.1 protein_id gnl|my_center|LOCUS_13250 1904 2659 gene locus_tag LOCUS_13260 1904 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2681 3421 gene locus_tag LOCUS_13270 2681 3421 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFQ6 protein_id gnl|my_center|LOCUS_13270 >Feature sequence268 1518 328 gene locus_tag LOCUS_13280 1518 328 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_13280 1604 2542 gene locus_tag LOCUS_13290 gene hmgCl 1604 2542 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_13290 3511 2582 gene locus_tag LOCUS_13300 3511 2582 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence269 <1 1063 gene locus_tag LOCUS_13310 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229602.1:methylhydantoinase 1078 3342 gene locus_tag LOCUS_13320 1078 3342 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence270 686 423 gene locus_tag LOCUS_13330 686 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1933 1040 gene locus_tag LOCUS_13340 gene prmA 1933 1040 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_13340 3325 1967 gene locus_tag LOCUS_13350 gene xseA 3325 1967 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 protein_id gnl|my_center|LOCUS_13350 >Feature sequence271 1631 186 gene locus_tag LOCUS_13360 gene gtfA 1631 186 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_13360 1796 2533 gene locus_tag LOCUS_13370 1796 2533 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence272 <1 846 gene locus_tag LOCUS_13380 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P67207:putative diacyglycerol O-acyltransferase 912 1559 gene locus_tag LOCUS_13390 912 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13390 1569 2684 gene locus_tag LOCUS_13400 1569 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13400 >Feature sequence273 1324 890 gene locus_tag LOCUS_13410 1324 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3345 1342 gene locus_tag LOCUS_13420 3345 1342 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence274 1409 603 gene locus_tag LOCUS_13430 1409 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3007 1406 gene locus_tag LOCUS_13440 3007 1406 CDS product nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence275 911 96 gene locus_tag LOCUS_13450 911 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1954 1088 gene locus_tag LOCUS_13460 gene nadC 1954 1088 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_13460 2914 1958 gene locus_tag LOCUS_13470 gene trxB1 2914 1958 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_13470 >Feature sequence276 <1 662 gene locus_tag LOCUS_13480 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975608.1:sulfotransferase 700 1797 gene locus_tag LOCUS_13490 gene wbtI 700 1797 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 protein_id gnl|my_center|LOCUS_13490 1794 2513 gene locus_tag LOCUS_13500 gene wbqC 1794 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073072.1 protein_id gnl|my_center|LOCUS_13500 2503 3477 gene locus_tag LOCUS_13510 2503 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence277 1690 788 gene locus_tag LOCUS_13520 gene accD 1690 788 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN6 protein_id gnl|my_center|LOCUS_13520 2567 1761 gene locus_tag LOCUS_13530 gene trpA 2567 1761 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_13530 <3487 2574 gene locus_tag LOCUS_13540 <3487 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2W9Z8:tryptophan synthase beta chain >Feature sequence278 379 53 gene locus_tag LOCUS_13550 379 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 536 360 gene locus_tag LOCUS_13560 536 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1033 533 gene locus_tag LOCUS_13570 1033 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1593 1030 gene locus_tag LOCUS_13580 1593 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1766 1590 gene locus_tag LOCUS_13590 1766 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1975 1763 gene locus_tag LOCUS_13600 1975 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2292 1978 gene locus_tag LOCUS_13610 2292 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2671 2285 gene locus_tag LOCUS_13620 2671 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence279 3330 2227 gene locus_tag LOCUS_13630 3330 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence280 1604 267 gene locus_tag LOCUS_13640 1604 267 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_13640 3026 1740 gene locus_tag LOCUS_13650 3026 1740 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence281 620 1411 gene locus_tag LOCUS_13660 620 1411 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_13660 1420 2334 gene locus_tag LOCUS_13670 1420 2334 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704587.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence282 2438 1122 gene locus_tag LOCUS_13680 2438 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_13680 2649 3116 gene locus_tag LOCUS_13690 2649 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence283 3 203 gene locus_tag LOCUS_13700 3 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 339 2126 gene locus_tag LOCUS_13710 339 2126 CDS product acyl-CoA dehydrogenase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_13710 2619 2197 gene locus_tag LOCUS_13720 2619 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2753 3193 gene locus_tag LOCUS_13730 2753 3193 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence284 1710 769 gene locus_tag LOCUS_13740 1710 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence285 <3421 1915 gene locus_tag LOCUS_13750 <3421 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031533.1:serine/threonine protein kinase >Feature sequence286 614 1036 gene locus_tag LOCUS_13760 614 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_13760 1158 1973 gene locus_tag LOCUS_13770 gene speD 1158 1973 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4I6 protein_id gnl|my_center|LOCUS_13770 2684 2043 gene locus_tag LOCUS_13780 gene coq7 2684 2043 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD67 protein_id gnl|my_center|LOCUS_13780 >Feature sequence287 <1 742 gene locus_tag LOCUS_13790 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000644706.1:lytic transglycosylase 3198 799 gene locus_tag LOCUS_13800 gene lon 3198 799 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V39 protein_id gnl|my_center|LOCUS_13800 >Feature sequence288 108 1457 gene locus_tag LOCUS_13810 gene tilS 108 1457 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7L3 protein_id gnl|my_center|LOCUS_13810 1530 3221 gene locus_tag LOCUS_13820 gene pyrG 1530 3221 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_13820 3218 3376 gene locus_tag LOCUS_13830 3218 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence289 <1 520 gene locus_tag LOCUS_13840 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705198.1:patatin 613 1614 gene locus_tag LOCUS_13850 613 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121034.1 protein_id gnl|my_center|LOCUS_13850 1841 2338 gene locus_tag LOCUS_13860 1841 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3246 2425 gene locus_tag LOCUS_13870 3246 2425 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence290 1726 401 gene locus_tag LOCUS_13880 1726 401 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_13880 1783 2796 gene locus_tag LOCUS_13890 gene mtnA 1783 2796 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_13890 2831 3202 gene locus_tag LOCUS_13900 2831 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence291 1763 1927 gene locus_tag LOCUS_13910 1763 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence292 1287 310 gene locus_tag LOCUS_13920 1287 310 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE7 protein_id gnl|my_center|LOCUS_13920 1325 2419 gene locus_tag LOCUS_13930 1325 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 <3394 2465 gene locus_tag LOCUS_13940 <3394 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204936.1:NAD+ synthase >Feature sequence293 2327 3355 gene locus_tag LOCUS_13950 gene rr07 2327 3355 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence294 1491 757 gene locus_tag LOCUS_13960 1491 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13960 2363 1383 gene locus_tag LOCUS_13970 2363 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13970 2866 2360 gene locus_tag LOCUS_13980 2866 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence295 853 3003 gene locus_tag LOCUS_13990 gene fadB 853 3003 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_13990 >Feature sequence296 977 327 gene locus_tag LOCUS_14000 977 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence297 118 1347 gene locus_tag LOCUS_14010 gene bioF 118 1347 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 protein_id gnl|my_center|LOCUS_14010 1344 2159 gene locus_tag LOCUS_14020 1344 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence298 310 1650 gene locus_tag LOCUS_14030 310 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 2229 2606 gene locus_tag LOCUS_14040 2229 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 <3353 2643 gene locus_tag LOCUS_14050 <3353 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113270.1:acyltransferase >Feature sequence299 682 1338 gene locus_tag LOCUS_14060 682 1338 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_14060 1374 2105 gene locus_tag LOCUS_14070 1374 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2123 2557 gene locus_tag LOCUS_14080 2123 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2627 3274 gene locus_tag LOCUS_14090 2627 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence300 2274 1108 gene locus_tag LOCUS_14100 2274 1108 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_14100 3183 2419 gene locus_tag LOCUS_14110 3183 2419 CDS product putative enoyl-CoA hydratase EchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701358.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence301 738 475 gene locus_tag LOCUS_14120 738 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 923 1978 gene locus_tag LOCUS_14130 923 1978 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_14130 <3340 1975 gene locus_tag LOCUS_14140 <3340 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071991.1:multidrug transporter >Feature sequence302 2926 134 gene locus_tag LOCUS_14150 2926 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence303 1144 584 gene locus_tag LOCUS_14160 gene tsaC 1144 584 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ3 protein_id gnl|my_center|LOCUS_14160 <3334 1144 gene locus_tag LOCUS_14170 <3334 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P4F3:DNA topoisomerase 1 >Feature sequence304 397 1662 gene locus_tag LOCUS_14180 397 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1734 1955 gene locus_tag LOCUS_14190 1734 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2140 2481 gene locus_tag LOCUS_14200 2140 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947249.1 protein_id gnl|my_center|LOCUS_14200 2478 3242 gene locus_tag LOCUS_14210 2478 3242 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence305 2216 456 gene locus_tag LOCUS_14220 2216 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2494 2228 gene locus_tag LOCUS_14230 2494 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3177 2491 gene locus_tag LOCUS_14240 3177 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence306 2 2407 gene locus_tag LOCUS_14250 2 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence307 1716 1372 gene locus_tag LOCUS_14260 1716 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2729 1785 gene locus_tag LOCUS_14270 2729 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence308 408 563 gene locus_tag LOCUS_14280 408 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 639 1400 gene locus_tag LOCUS_14290 639 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2524 1397 gene locus_tag LOCUS_14300 2524 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence309 76 570 gene locus_tag LOCUS_14310 76 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 563 1228 gene locus_tag LOCUS_14320 gene purN 563 1228 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_14320 1228 1938 gene locus_tag LOCUS_14330 1228 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 <3307 1955 gene locus_tag LOCUS_14340 <3307 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAB6:hydroxyacylglutathione hydrolase >Feature sequence310 961 2100 gene locus_tag LOCUS_14350 961 2100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822415.1 protein_id gnl|my_center|LOCUS_14350 2788 2114 gene locus_tag LOCUS_14360 2788 2114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence311 >Feature sequence312 733 1197 gene locus_tag LOCUS_14370 733 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence313 1588 1193 gene locus_tag LOCUS_14380 1588 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_14380 2741 1662 gene locus_tag LOCUS_14390 2741 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence314 >Feature sequence315 966 259 gene locus_tag LOCUS_14400 966 259 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_14400 2918 963 gene locus_tag LOCUS_14410 gene yoaA 2918 963 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence316 276 953 gene locus_tag LOCUS_14420 276 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1141 2139 gene locus_tag LOCUS_14430 1141 2139 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_14430 2885 2145 gene locus_tag LOCUS_14440 2885 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence317 154 1488 gene locus_tag LOCUS_14450 154 1488 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537616.1 protein_id gnl|my_center|LOCUS_14450 1761 2261 gene locus_tag LOCUS_14460 gene rpoE 1761 2261 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_14460 2261 2623 gene locus_tag LOCUS_14470 2261 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2646 3212 gene locus_tag LOCUS_14480 2646 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence318 1243 506 gene locus_tag LOCUS_14490 1243 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2113 1349 gene locus_tag LOCUS_14500 2113 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence319 1625 414 gene locus_tag LOCUS_14510 gene ubiH 1625 414 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_14510 2965 1640 gene locus_tag LOCUS_14520 gene pepP 2965 1640 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence320 735 1520 gene locus_tag LOCUS_14530 735 1520 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_14530 1608 2888 gene locus_tag LOCUS_14540 1608 2888 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence321 <1 1697 gene locus_tag LOCUS_14550 <1 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205643.1:cellulose biosynthesis protein <3228 1711 gene locus_tag LOCUS_14560 <3228 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005174899.1:membrane protein >Feature sequence322 443 51 gene locus_tag LOCUS_14570 443 51 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQU5 protein_id gnl|my_center|LOCUS_14570 787 440 gene locus_tag LOCUS_14580 gene fliN 787 440 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E7 protein_id gnl|my_center|LOCUS_14580 1851 784 gene locus_tag LOCUS_14590 gene fliM 1851 784 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9E6 protein_id gnl|my_center|LOCUS_14590 2422 1862 gene locus_tag LOCUS_14600 gene fliL 2422 1862 CDS product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037086.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence323 228 1085 gene locus_tag LOCUS_14610 228 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1900 1121 gene locus_tag LOCUS_14620 1900 1121 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 protein_id gnl|my_center|LOCUS_14620 2882 2025 gene locus_tag LOCUS_14630 gene ttcA 2882 2025 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H2 protein_id gnl|my_center|LOCUS_14630 >Feature sequence324 678 1619 gene locus_tag LOCUS_14640 678 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_14640 2420 1653 gene locus_tag LOCUS_14650 2420 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_14650 2558 3157 gene locus_tag LOCUS_14660 2558 3157 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence325 2472 643 gene locus_tag LOCUS_14670 2472 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2981 2652 gene locus_tag LOCUS_14680 2981 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence326 250 2079 gene locus_tag LOCUS_14690 gene glmS 250 2079 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU94 protein_id gnl|my_center|LOCUS_14690 2088 2987 gene locus_tag LOCUS_14700 2088 2987 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence327 184 2286 gene locus_tag LOCUS_14710 184 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919289.1 protein_id gnl|my_center|LOCUS_14710 2329 2718 gene locus_tag LOCUS_14720 2329 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence328 660 1688 gene locus_tag LOCUS_14730 gene sohB 660 1688 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_14730 1714 2349 gene locus_tag LOCUS_14740 1714 2349 CDS product phosphatidylethanolamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence329 557 1003 gene locus_tag LOCUS_14750 gene hspA 557 1003 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_14750 1096 1998 gene locus_tag LOCUS_14760 gene cbpA 1096 1998 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036248.1 protein_id gnl|my_center|LOCUS_14760 3060 2056 gene locus_tag LOCUS_14770 gene fbp 3060 2056 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE85 protein_id gnl|my_center|LOCUS_14770 >Feature sequence330 812 1051 gene locus_tag LOCUS_14780 812 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1048 1944 gene locus_tag LOCUS_14790 gene ispA 1048 1944 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence331 895 1194 gene locus_tag LOCUS_14800 895 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1226 2068 gene locus_tag LOCUS_14810 1226 2068 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence332 1332 91 gene locus_tag LOCUS_14820 1332 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2040 1426 gene locus_tag LOCUS_14830 2040 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence333 <1 708 gene locus_tag LOCUS_14840 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036035.1:2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase 1801 713 gene locus_tag LOCUS_14850 1801 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2557 1802 gene locus_tag LOCUS_14860 2557 1802 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence334 1199 51 gene locus_tag LOCUS_14870 1199 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2608 1208 gene locus_tag LOCUS_14880 2608 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 >Feature sequence335 <1 633 gene locus_tag LOCUS_14890 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208248.1:magnesium transporter 2160 652 gene locus_tag LOCUS_14900 gene hapE 2160 652 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence336 <1 612 gene locus_tag LOCUS_14910 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726881.1:TetR family transcriptional regulator 678 1949 gene locus_tag LOCUS_14920 gene yfeW 678 1949 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_14920 2830 1994 gene locus_tag LOCUS_14930 2830 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence337 3 1076 gene locus_tag LOCUS_14940 gene dacC 3 1076 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_14940 1092 1727 gene locus_tag LOCUS_14950 gene lipB 1092 1727 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_14950 1822 2616 gene locus_tag LOCUS_14960 gene mlaF 1822 2616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence338 1762 1226 gene locus_tag LOCUS_14970 1762 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2912 1875 gene locus_tag LOCUS_14980 gene hrcA 2912 1875 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence339 389 1057 gene locus_tag LOCUS_14990 gene queE 389 1057 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_14990 1060 1743 gene locus_tag LOCUS_15000 gene queC 1060 1743 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F6 protein_id gnl|my_center|LOCUS_15000 1791 1866 gene locus_tag LOCUS_t00280 1791 1866 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2028 2104 gene locus_tag LOCUS_t00290 2028 2104 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2908 2111 gene locus_tag LOCUS_15010 gene hutD 2908 2111 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGW0 protein_id gnl|my_center|LOCUS_15010 >Feature sequence340 1001 1924 gene locus_tag LOCUS_15020 gene lpxL 1001 1924 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_15020 1982 2980 gene locus_tag LOCUS_15030 1982 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence341 <1 1550 gene locus_tag LOCUS_15040 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EG15:peptidylprolyl isomerase 1635 2885 gene locus_tag LOCUS_15050 gene gltP 1635 2885 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence342 1673 213 gene locus_tag LOCUS_15060 1673 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <3135 1808 gene locus_tag LOCUS_15070 <3135 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087254.1:alcohol dehydrogenase >Feature sequence343 847 242 gene locus_tag LOCUS_15080 gene rplD 847 242 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF22 protein_id gnl|my_center|LOCUS_15080 1511 870 gene locus_tag LOCUS_15090 gene rplC 1511 870 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF21 protein_id gnl|my_center|LOCUS_15090 1841 1524 gene locus_tag LOCUS_15100 gene rpsJ 1841 1524 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP3 protein_id gnl|my_center|LOCUS_15100 <3133 1937 gene locus_tag LOCUS_15110 <3133 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NID9:elongation factor Tu >Feature sequence344 1406 603 gene locus_tag LOCUS_15120 1406 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2464 1619 gene locus_tag LOCUS_15130 2464 1619 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072510.1 protein_id gnl|my_center|LOCUS_15130 2774 2562 gene locus_tag LOCUS_15140 2774 2562 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813568.1 protein_id gnl|my_center|LOCUS_15140 2896 2771 gene locus_tag LOCUS_15150 2896 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence345 484 1254 gene locus_tag LOCUS_15160 484 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230389.1 protein_id gnl|my_center|LOCUS_15160 1258 2343 gene locus_tag LOCUS_15170 1258 2343 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_15170 2423 2950 gene locus_tag LOCUS_15180 2423 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence346 1371 1446 gene locus_tag LOCUS_t00300 1371 1446 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1900 1406 gene locus_tag LOCUS_15190 1900 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2016 2675 gene locus_tag LOCUS_15200 2016 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence347 2229 1159 gene locus_tag LOCUS_15210 2229 1159 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence348 2167 644 gene locus_tag LOCUS_15220 gene mltF 2167 644 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_15220 2303 2392 gene locus_tag LOCUS_t00310 2303 2392 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <3076 2472 gene locus_tag LOCUS_15230 <3076 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730456.1:sodium:proline symporter >Feature sequence349 1692 2540 gene locus_tag LOCUS_15240 1692 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence350 <1 1303 gene locus_tag LOCUS_15250 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8Q5:inosine-5'-monophosphate dehydrogenase 1312 2919 gene locus_tag LOCUS_15260 gene guaA 1312 2919 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X5 protein_id gnl|my_center|LOCUS_15260 >Feature sequence351 >Feature sequence352 <1 736 gene locus_tag LOCUS_15270 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266256.1:bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase 779 1165 gene locus_tag LOCUS_15280 779 1165 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence353 349 1971 gene locus_tag LOCUS_15290 349 1971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15290 2855 1992 gene locus_tag LOCUS_15300 2855 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence354 <1 2974 gene locus_tag LOCUS_15310 <1 2974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028707.1:NAD-glutamate dehydrogenase >Feature sequence355 686 1015 gene locus_tag LOCUS_15320 686 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2030 1107 gene locus_tag LOCUS_15330 gene lpxC 2030 1107 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCJ5 protein_id gnl|my_center|LOCUS_15330 <3041 2217 gene locus_tag LOCUS_15340 <3041 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q32JZ7:cell division protein FtsZ >Feature sequence356 1744 842 gene locus_tag LOCUS_15350 gene galU 1744 842 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G7 protein_id gnl|my_center|LOCUS_15350 2630 1776 gene locus_tag LOCUS_15360 2630 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence357 3 653 gene locus_tag LOCUS_15370 3 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 763 838 gene locus_tag LOCUS_t00320 763 838 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1550 1861 gene locus_tag LOCUS_15380 1550 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence358 219 52 gene locus_tag LOCUS_15390 219 52 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT88 protein_id gnl|my_center|LOCUS_15390 1922 408 gene locus_tag LOCUS_15400 gene pepA 1922 408 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_15400 >Feature sequence359 98 700 gene locus_tag LOCUS_15410 98 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence360 <1 1664 gene locus_tag LOCUS_15420 <1 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037508.1:glutamate dehydrogenase <3024 1934 gene locus_tag LOCUS_15430 <3024 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPZ4:cell division protein ZapE >Feature sequence361 696 917 gene locus_tag LOCUS_15440 696 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 964 1365 gene locus_tag LOCUS_15450 gene sdhC 964 1365 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382963.1 protein_id gnl|my_center|LOCUS_15450 1376 1762 gene locus_tag LOCUS_15460 1376 1762 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence362 197 1492 gene locus_tag LOCUS_15470 gene hisS 197 1492 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ11 protein_id gnl|my_center|LOCUS_15470 1511 2152 gene locus_tag LOCUS_15480 1511 2152 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence363 <1 875 gene locus_tag LOCUS_15490 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E1JGJ8:peptide chain release factor 2 907 2430 gene locus_tag LOCUS_15500 gene lysS 907 2430 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L3G6 protein_id gnl|my_center|LOCUS_15500 >Feature sequence364 2300 957 gene locus_tag LOCUS_15510 2300 957 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228966.1 protein_id gnl|my_center|LOCUS_15510 2810 2364 gene locus_tag LOCUS_15520 2810 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence365 1435 743 gene locus_tag LOCUS_15530 1435 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2274 1432 gene locus_tag LOCUS_15540 2274 1432 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UN7 protein_id gnl|my_center|LOCUS_15540 2554 2279 gene locus_tag LOCUS_15550 2554 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence366 1164 631 gene locus_tag LOCUS_15560 1164 631 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933067.1 protein_id gnl|my_center|LOCUS_15560 1480 1217 gene locus_tag LOCUS_15570 1480 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1680 2270 gene locus_tag LOCUS_15580 1680 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 <2983 2297 gene locus_tag LOCUS_15590 <2983 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531331.1:alpha/beta hydrolase >Feature sequence367 <1 1210 gene locus_tag LOCUS_15600 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268402.1:c-type cytochrome biogenesis protein CcmF 1210 1731 gene locus_tag LOCUS_15610 gene dsbE 1210 1731 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_15610 1728 2198 gene locus_tag LOCUS_15620 1728 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence368 2731 1781 gene locus_tag LOCUS_15630 2731 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence369 484 305 gene locus_tag LOCUS_15640 484 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1000 587 gene locus_tag LOCUS_15650 1000 587 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_15650 1673 1032 gene locus_tag LOCUS_15660 gene sspA 1673 1032 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 protein_id gnl|my_center|LOCUS_15660 2542 1775 gene locus_tag LOCUS_15670 gene petC 2542 1775 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037465.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence370 492 1019 gene locus_tag LOCUS_15680 492 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637650.2 protein_id gnl|my_center|LOCUS_15680 <2941 1433 gene locus_tag LOCUS_15690 <2941 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KND9:polyribonucleotide nucleotidyltransferase >Feature sequence371 >Feature sequence372 3 1121 gene locus_tag LOCUS_15700 3 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1127 1957 gene locus_tag LOCUS_15710 1127 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_15710 2258 1992 gene locus_tag LOCUS_15720 2258 1992 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence373 >Feature sequence374 134 418 gene locus_tag LOCUS_15730 134 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 569 2668 gene locus_tag LOCUS_15740 gene bfrI 569 2668 CDS product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence375 2844 1105 gene locus_tag LOCUS_15750 gene pilB 2844 1105 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence376 <1 830 gene locus_tag LOCUS_15760 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_208542.1:phospholipase 1352 963 gene locus_tag LOCUS_15770 gene rplQ 1352 963 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_15770 2359 1379 gene locus_tag LOCUS_15780 gene rpoA 2359 1379 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_15780 >Feature sequence377 <1 1054 gene locus_tag LOCUS_15790 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51551:dihydroorotase-like protein 1149 1514 gene locus_tag LOCUS_15800 gene pilH 1149 1514 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_15800 >Feature sequence378 2495 1863 gene locus_tag LOCUS_15810 gene engB 2495 1863 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT0 protein_id gnl|my_center|LOCUS_15810 >Feature sequence379 33 2618 gene locus_tag LOCUS_15820 33 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence380 225 1268 gene locus_tag LOCUS_15830 gene pilT 225 1268 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_15830 1282 2451 gene locus_tag LOCUS_15840 gene pilU 1282 2451 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence381 964 254 gene locus_tag LOCUS_15850 gene ftsE 964 254 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_15850 1898 969 gene locus_tag LOCUS_15860 1898 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 <2890 1948 gene locus_tag LOCUS_15870 <2890 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038389.1:membrane protein >Feature sequence382 1492 1872 gene locus_tag LOCUS_15880 1492 1872 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_15880 2088 2357 gene locus_tag LOCUS_15890 2088 2357 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 protein_id gnl|my_center|LOCUS_15890 2486 2659 gene locus_tag LOCUS_15900 2486 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence383 547 236 gene locus_tag LOCUS_15910 547 236 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204343.1 protein_id gnl|my_center|LOCUS_15910 960 544 gene locus_tag LOCUS_15920 960 544 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 protein_id gnl|my_center|LOCUS_15920 1377 1000 gene locus_tag LOCUS_15930 1377 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2034 1420 gene locus_tag LOCUS_15940 2034 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2528 2172 gene locus_tag LOCUS_15950 2528 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089897.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence384 1429 104 gene locus_tag LOCUS_15960 1429 104 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_15960 2041 1451 gene locus_tag LOCUS_15970 gene lolA 2041 1451 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW06 protein_id gnl|my_center|LOCUS_15970 2867 2211 gene locus_tag LOCUS_15980 2867 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence385 641 2407 gene locus_tag LOCUS_15990 641 2407 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258747.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence386 2323 968 gene locus_tag LOCUS_16000 2323 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 <2864 2353 gene locus_tag LOCUS_16010 <2864 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWL5:aspartate--tRNA(Asp/Asn) ligase >Feature sequence387 241 885 gene locus_tag LOCUS_16020 gene dsbA 241 885 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_16020 1001 1813 gene locus_tag LOCUS_16030 1001 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence388 153 971 gene locus_tag LOCUS_16040 153 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence389 <1 1182 gene locus_tag LOCUS_16050 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNS7:glutamyl-tRNA(Gln) amidotransferase subunit A 1192 2649 gene locus_tag LOCUS_16060 gene gatB 1192 2649 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_16060 >Feature sequence390 <2838 840 gene locus_tag LOCUS_16070 <2838 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9K3:aconitate hydratase >Feature sequence391 794 75 gene locus_tag LOCUS_16080 gene rph 794 75 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_16080 854 1276 gene locus_tag LOCUS_16090 854 1276 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_16090 1322 1849 gene locus_tag LOCUS_16100 1322 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence392 <1 882 gene locus_tag LOCUS_16110 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P80358:arginine N-succinyltransferase subunit beta 879 1400 gene locus_tag LOCUS_16120 879 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16120 1419 2345 gene locus_tag LOCUS_16130 1419 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16130 >Feature sequence393 234 749 gene locus_tag LOCUS_16140 234 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265501.1 protein_id gnl|my_center|LOCUS_16140 1954 824 gene locus_tag LOCUS_16150 gene proB 1954 824 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_16150 2826 1963 gene locus_tag LOCUS_16160 2826 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence394 90 752 gene locus_tag LOCUS_16170 90 752 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110067.1 protein_id gnl|my_center|LOCUS_16170 781 1668 gene locus_tag LOCUS_16180 781 1668 CDS product polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_16180 2324 1677 gene locus_tag LOCUS_16190 2324 1677 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_16190 2364 2795 gene locus_tag LOCUS_16200 2364 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence395 490 966 gene locus_tag LOCUS_16210 490 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 976 1947 gene locus_tag LOCUS_16220 976 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence396 <1 2139 gene locus_tag LOCUS_16230 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUP3:chaperone protein ClpB >Feature sequence397 1582 1310 gene locus_tag LOCUS_16240 1582 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <2814 1579 gene locus_tag LOCUS_16250 <2814 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118365.1:cation:proton antiporter >Feature sequence398 <1 761 gene locus_tag LOCUS_16260 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3B1:histidine kinase 1116 775 gene locus_tag LOCUS_16270 gene acpS 1116 775 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W3 protein_id gnl|my_center|LOCUS_16270 1994 1239 gene locus_tag LOCUS_16280 gene pdxJ 1994 1239 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6F2 protein_id gnl|my_center|LOCUS_16280 2726 2031 gene locus_tag LOCUS_16290 gene recO 2726 2031 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51838 protein_id gnl|my_center|LOCUS_16290 >Feature sequence399 779 258 gene locus_tag LOCUS_16300 779 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_16300 1641 772 gene locus_tag LOCUS_16310 1641 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199880.1 protein_id gnl|my_center|LOCUS_16310 1718 2161 gene locus_tag LOCUS_16320 1718 2161 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence400 1631 1272 gene locus_tag LOCUS_16330 1631 1272 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_16330 2632 1628 gene locus_tag LOCUS_16340 2632 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence401 161 1033 gene locus_tag LOCUS_16350 gene prpB 161 1033 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_16350 1046 1915 gene locus_tag LOCUS_16360 1046 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence402 >Feature sequence403 733 948 gene locus_tag LOCUS_16370 733 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1395 967 gene locus_tag LOCUS_16380 1395 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2202 1405 gene locus_tag LOCUS_16390 2202 1405 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089969.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence404 975 514 gene locus_tag LOCUS_16400 975 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1410 1030 gene locus_tag LOCUS_16410 1410 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1717 2319 gene locus_tag LOCUS_16420 1717 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence405 2040 397 gene locus_tag LOCUS_16430 2040 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence406 1106 2386 gene locus_tag LOCUS_16440 gene dhs1 1106 2386 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC31 protein_id gnl|my_center|LOCUS_16440 >Feature sequence407 1707 76 gene locus_tag LOCUS_16450 1707 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2375 1704 gene locus_tag LOCUS_16460 2375 1704 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039473.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence408 1814 1047 gene locus_tag LOCUS_16470 1814 1047 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_16470 2575 1862 gene locus_tag LOCUS_16480 2575 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence409 1452 1075 gene locus_tag LOCUS_16490 gene rplL 1452 1075 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_16490 2040 1507 gene locus_tag LOCUS_16500 gene rplJ 2040 1507 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ2 protein_id gnl|my_center|LOCUS_16500 >Feature sequence410 <1 1070 gene locus_tag LOCUS_16510 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932902.1:geranylgeranyl hydrogenase BchP 1122 1739 gene locus_tag LOCUS_16520 1122 1739 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence411 <1 525 gene locus_tag LOCUS_16530 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104994.1:glycine/betaine transmethylase 538 1899 gene locus_tag LOCUS_16540 538 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence412 1249 701 gene locus_tag LOCUS_16550 1249 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 protein_id gnl|my_center|LOCUS_16550 1953 1246 gene locus_tag LOCUS_16560 1953 1246 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063813.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence413 728 129 gene locus_tag LOCUS_16570 728 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1183 1608 gene locus_tag LOCUS_16580 1183 1608 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388697.1 protein_id gnl|my_center|LOCUS_16580 <2723 1688 gene locus_tag LOCUS_16590 <2723 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNF7:putative FAD-containing monooxygenase MymA >Feature sequence414 304 783 gene locus_tag LOCUS_16600 304 783 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH0 protein_id gnl|my_center|LOCUS_16600 >Feature sequence415 1615 1121 gene locus_tag LOCUS_16610 1615 1121 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_16610 <2717 1612 gene locus_tag LOCUS_16620 <2717 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83CM5:bifunctional NAD(P)H-hydrate repair enzyme Nnr >Feature sequence416 109 669 gene locus_tag LOCUS_16630 gene pgsA 109 669 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_16630 780 855 gene locus_tag LOCUS_t00330 780 855 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 948 1021 gene locus_tag LOCUS_t00340 948 1021 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1234 2325 gene locus_tag LOCUS_16640 1234 2325 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_16640 2522 2608 gene locus_tag LOCUS_t00350 2522 2608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence417 <2698 205 gene locus_tag LOCUS_16650 <2698 205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P4N7:pyruvate carboxylase >Feature sequence418 375 1058 gene locus_tag LOCUS_16660 375 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1092 1610 gene locus_tag LOCUS_16670 gene ymdB 1092 1610 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence419 494 141 gene locus_tag LOCUS_16680 494 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1339 527 gene locus_tag LOCUS_16690 1339 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1697 2629 gene locus_tag LOCUS_16700 gene secF 1697 2629 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI2 protein_id gnl|my_center|LOCUS_16700 >Feature sequence420 2052 529 gene locus_tag LOCUS_16710 2052 529 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_16710 >Feature sequence421 <1 949 gene locus_tag LOCUS_16720 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056097.1:glycosyl transferase 2028 946 gene locus_tag LOCUS_16730 2028 946 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_16730 2537 2025 gene locus_tag LOCUS_16740 2537 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence422 605 1516 gene locus_tag LOCUS_16750 gene sulA 605 1516 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 protein_id gnl|my_center|LOCUS_16750 <2664 1603 gene locus_tag LOCUS_16760 <2664 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113173.1:ATPase >Feature sequence423 802 1497 gene locus_tag LOCUS_16770 802 1497 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201020.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence424 1363 473 gene locus_tag LOCUS_16780 1363 473 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765926.1 protein_id gnl|my_center|LOCUS_16780 1822 1376 gene locus_tag LOCUS_16790 1822 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2150 1932 gene locus_tag LOCUS_16800 2150 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2344 2168 gene locus_tag LOCUS_16810 2344 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence425 <1 2554 gene locus_tag LOCUS_16820 <1 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:diguanylate cyclase >Feature sequence426 <2651 1658 gene locus_tag LOCUS_16830 <2651 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940951.1:RND transporter >Feature sequence427 1384 371 gene locus_tag LOCUS_16840 gene plsX 1384 371 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_16840 1658 1455 gene locus_tag LOCUS_16850 gene rpmF 1658 1455 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_16850 2245 1694 gene locus_tag LOCUS_16860 2245 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence428 809 3 gene locus_tag LOCUS_16870 gene cysQ 809 3 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_16870 881 1522 gene locus_tag LOCUS_16880 881 1522 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_16880 2477 1503 gene locus_tag LOCUS_16890 2477 1503 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195933.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence429 336 713 gene locus_tag LOCUS_16900 gene rbfA 336 713 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7F4 protein_id gnl|my_center|LOCUS_16900 722 1636 gene locus_tag LOCUS_16910 gene truB 722 1636 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KL1 protein_id gnl|my_center|LOCUS_16910 1735 2004 gene locus_tag LOCUS_16920 gene rpsO 1735 2004 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF33 protein_id gnl|my_center|LOCUS_16920 >Feature sequence430 1440 163 gene locus_tag LOCUS_16930 gene vieA 1440 163 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_16930 1692 2612 gene locus_tag LOCUS_16940 1692 2612 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence431 1034 675 gene locus_tag LOCUS_16950 1034 675 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312731.1 protein_id gnl|my_center|LOCUS_16950 1532 1092 gene locus_tag LOCUS_16960 1532 1092 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228997.1 protein_id gnl|my_center|LOCUS_16960 <2633 1536 gene locus_tag LOCUS_16970 <2633 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119637.1:GGDEF domain-containing protein >Feature sequence432 <1 1277 gene locus_tag LOCUS_16980 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VY59:phosphoenolpyruvate-protein phosphotransferase >Feature sequence433 586 1713 gene locus_tag LOCUS_16990 gene ompA 586 1713 CDS product outer membrane protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7S0 protein_id gnl|my_center|LOCUS_16990 2350 1871 gene locus_tag LOCUS_17000 2350 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence434 648 1532 gene locus_tag LOCUS_17010 648 1532 CDS product isocitrate lyase-family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_17010 2471 1548 gene locus_tag LOCUS_17020 2471 1548 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence435 182 2053 gene locus_tag LOCUS_17030 182 2053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_17030 <2618 2103 gene locus_tag LOCUS_17040 <2618 2103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206171.1:short-chain dehydrogenase >Feature sequence436 >Feature sequence437 276 518 gene locus_tag LOCUS_17050 276 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 505 927 gene locus_tag LOCUS_17060 gene pspC 505 927 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_17060 1016 1651 gene locus_tag LOCUS_17070 1016 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence438 <1 1016 gene locus_tag LOCUS_17080 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVM4:isoleucine--tRNA ligase 1017 1511 gene locus_tag LOCUS_17090 gene lspA 1017 1511 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_17090 1511 2476 gene locus_tag LOCUS_17100 gene ispH 1511 2476 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence439 <1 1911 gene locus_tag LOCUS_17110 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704810.1:ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent >Feature sequence440 1341 595 gene locus_tag LOCUS_17120 gene ynhD 1341 595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_17120 2490 1393 gene locus_tag LOCUS_17130 2490 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence441 <2589 154 gene locus_tag LOCUS_17140 <2589 154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGG0:DNA-directed DNA polymerase >Feature sequence442 821 1372 gene locus_tag LOCUS_17150 821 1372 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_17150 1386 1772 gene locus_tag LOCUS_17160 gene apaG 1386 1772 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU61 protein_id gnl|my_center|LOCUS_17160 <2589 1812 gene locus_tag LOCUS_17170 <2589 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262931.1:NADH oxidase >Feature sequence443 711 82 gene locus_tag LOCUS_17180 711 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 <2588 729 gene locus_tag LOCUS_17190 <2588 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P7B3:transcription-repair-coupling factor >Feature sequence444 164 796 gene locus_tag LOCUS_17200 164 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 887 1489 gene locus_tag LOCUS_17210 887 1489 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024227.1 protein_id gnl|my_center|LOCUS_17210 1598 2083 gene locus_tag LOCUS_17220 1598 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence445 24 788 gene locus_tag LOCUS_17230 24 788 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 protein_id gnl|my_center|LOCUS_17230 816 1961 gene locus_tag LOCUS_17240 816 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence446 278 1207 gene locus_tag LOCUS_17250 278 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703674.1 protein_id gnl|my_center|LOCUS_17250 2357 1191 gene locus_tag LOCUS_17260 2357 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence447 1717 1448 gene locus_tag LOCUS_17270 1717 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1976 2314 gene locus_tag LOCUS_17280 gene glnK 1976 2314 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence448 710 384 gene locus_tag LOCUS_17290 gene fliE 710 384 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D8 protein_id gnl|my_center|LOCUS_17290 1029 1844 gene locus_tag LOCUS_17300 1029 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_17300 2073 2348 gene locus_tag LOCUS_17310 2073 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence449 1261 644 gene locus_tag LOCUS_17320 1261 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1677 1312 gene locus_tag LOCUS_17330 1677 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2309 2536 gene locus_tag LOCUS_17340 2309 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189709.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence450 >Feature sequence451 792 1967 gene locus_tag LOCUS_17350 792 1967 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence452 436 687 gene locus_tag LOCUS_17360 436 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 684 1082 gene locus_tag LOCUS_17370 684 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1127 2209 gene locus_tag LOCUS_17380 gene serC 1127 2209 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ94 protein_id gnl|my_center|LOCUS_17380 >Feature sequence453 985 1257 gene locus_tag LOCUS_17390 985 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1729 1274 gene locus_tag LOCUS_17400 1729 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence454 1190 285 gene locus_tag LOCUS_17410 gene rimK 1190 285 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_17410 1621 1187 gene locus_tag LOCUS_17420 1621 1187 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_17420 1739 2047 gene locus_tag LOCUS_17430 1739 2047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071772.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence455 440 1261 gene locus_tag LOCUS_17440 440 1261 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_17440 1888 1301 gene locus_tag LOCUS_17450 1888 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence456 405 617 gene locus_tag LOCUS_17460 405 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 674 1378 gene locus_tag LOCUS_17470 674 1378 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_17470 1390 1977 gene locus_tag LOCUS_17480 1390 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence457 517 215 gene locus_tag LOCUS_17490 517 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_17490 1468 521 gene locus_tag LOCUS_17500 1468 521 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_17500 <2526 1505 gene locus_tag LOCUS_17510 <2526 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63QW0:dihydroorotase >Feature sequence458 1712 1350 gene locus_tag LOCUS_17520 1712 1350 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205685.1 protein_id gnl|my_center|LOCUS_17520 2210 1716 gene locus_tag LOCUS_17530 2210 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence459 >Feature sequence460 525 1388 gene locus_tag LOCUS_17540 gene gspC 525 1388 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262834.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence461 <1 1831 gene locus_tag LOCUS_17550 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62KI2:threonine--tRNA ligase >Feature sequence462 <1 812 gene locus_tag LOCUS_17560 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947465.1:adenylate/guanylate cyclase domain-containing protein 952 1272 gene locus_tag LOCUS_17570 gene clpS 952 1272 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 protein_id gnl|my_center|LOCUS_17570 >Feature sequence463 <1 677 gene locus_tag LOCUS_17580 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C9G0:aldehyde dehydrogenase 743 1972 gene locus_tag LOCUS_17590 gene yjiB 743 1972 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_17590 >Feature sequence464 >Feature sequence465 156 749 gene locus_tag LOCUS_17600 156 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 769 1494 gene locus_tag LOCUS_17610 769 1494 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E3 protein_id gnl|my_center|LOCUS_17610 1491 2018 gene locus_tag LOCUS_17620 gene ruvC 1491 2018 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E4 protein_id gnl|my_center|LOCUS_17620 >Feature sequence466 1585 575 gene locus_tag LOCUS_17630 1585 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 <2486 1582 gene locus_tag LOCUS_17640 <2486 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403762.1:colanic acid biosynthesis glycosyltransferase WcaL >Feature sequence467 615 1790 gene locus_tag LOCUS_17650 615 1790 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence468 299 634 gene locus_tag LOCUS_17660 299 634 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_17660 1270 662 gene locus_tag LOCUS_17670 gene recR 1270 662 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF8 protein_id gnl|my_center|LOCUS_17670 2475 1318 gene locus_tag LOCUS_17680 2475 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence469 >Feature sequence470 584 1063 gene locus_tag LOCUS_17690 gene ispF 584 1063 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L7 protein_id gnl|my_center|LOCUS_17690 1179 1823 gene locus_tag LOCUS_17700 1179 1823 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_17700 2376 1837 gene locus_tag LOCUS_17710 2376 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence471 732 1517 gene locus_tag LOCUS_17720 732 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1612 2172 gene locus_tag LOCUS_17730 1612 2172 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339016.1 protein_id gnl|my_center|LOCUS_17730 2235 2453 gene locus_tag LOCUS_17740 2235 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence472 1267 365 gene locus_tag LOCUS_17750 1267 365 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 protein_id gnl|my_center|LOCUS_17750 2155 1286 gene locus_tag LOCUS_17760 2155 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_17760 2461 2207 gene locus_tag LOCUS_17770 2461 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence473 <2436 1457 gene locus_tag LOCUS_17780 <2436 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037292.1:transporter >Feature sequence474 1544 1699 gene locus_tag LOCUS_17790 1544 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence475 148 1644 gene locus_tag LOCUS_17800 gene putA 148 1644 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_17800 >Feature sequence476 865 284 gene locus_tag LOCUS_17810 865 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <2413 936 gene locus_tag LOCUS_17820 <2413 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63QM5:proline--tRNA ligase >Feature sequence477 <1 853 gene locus_tag LOCUS_17830 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WAP8:histidine kinase 850 1494 gene locus_tag LOCUS_17840 850 1494 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_17840 1681 2280 gene locus_tag LOCUS_17850 gene petA 1681 2280 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD50 protein_id gnl|my_center|LOCUS_17850 >Feature sequence478 1178 6 gene locus_tag LOCUS_17860 1178 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920725.1 protein_id gnl|my_center|LOCUS_17860 1348 2076 gene locus_tag LOCUS_17870 gene yccA 1348 2076 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence479 16 1386 gene locus_tag LOCUS_17880 16 1386 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089062.1 protein_id gnl|my_center|LOCUS_17880 1383 2195 gene locus_tag LOCUS_17890 1383 2195 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104038.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence480 306 695 gene locus_tag LOCUS_17900 gene panD 306 695 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_17900 700 1323 gene locus_tag LOCUS_17910 700 1323 CDS product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence481 128 613 gene locus_tag LOCUS_17920 gene infC 128 613 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6I3 protein_id gnl|my_center|LOCUS_17920 755 952 gene locus_tag LOCUS_17930 gene rpmI 755 952 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHL2 protein_id gnl|my_center|LOCUS_17930 978 1337 gene locus_tag LOCUS_17940 gene rplT 978 1337 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_17940 >Feature sequence482 499 810 gene locus_tag LOCUS_17950 499 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence483 >Feature sequence484 <1 723 gene locus_tag LOCUS_17960 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036061.1:histidine kinase 720 1556 gene locus_tag LOCUS_17970 720 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1712 2029 gene locus_tag LOCUS_17980 1712 2029 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_17980 2107 2280 gene locus_tag LOCUS_17990 2107 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence485 1327 998 gene locus_tag LOCUS_18000 gene yajC 1327 998 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_18000 <2366 1400 gene locus_tag LOCUS_18010 <2366 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932849.1:UDP-glucose 6-dehydrogenase >Feature sequence486 <1 574 gene locus_tag LOCUS_18020 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0J6:NADH-quinone oxidoreductase subunit G 578 1582 gene locus_tag LOCUS_18030 gene nuoH 578 1582 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J5 protein_id gnl|my_center|LOCUS_18030 1585 2130 gene locus_tag LOCUS_18040 gene nuoI 1585 2130 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J4 protein_id gnl|my_center|LOCUS_18040 >Feature sequence487 667 380 gene locus_tag LOCUS_18050 gene gatC 667 380 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_18050 862 1899 gene locus_tag LOCUS_18060 gene mreB 862 1899 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence488 >Feature sequence489 871 548 gene locus_tag LOCUS_18070 871 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1563 955 gene locus_tag LOCUS_18080 1563 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_18080 <2355 1668 gene locus_tag LOCUS_18090 <2355 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34311:signaling protein YkoW >Feature sequence490 1478 1927 gene locus_tag LOCUS_18100 1478 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2005 2256 gene locus_tag LOCUS_18110 gene yeaQ 2005 2256 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence491 <1 737 gene locus_tag LOCUS_18120 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37965:glycerophosphoryl diester phosphodiesterase <2351 864 gene locus_tag LOCUS_18130 <2351 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036069.1:alkyl hydroperoxide reductase subunit F >Feature sequence492 <1 977 gene locus_tag LOCUS_18140 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039500.1:inner membrane transport permease 1077 2060 gene locus_tag LOCUS_18150 gene mdh 1077 2060 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_18150 >Feature sequence493 167 247 gene locus_tag LOCUS_t00360 167 247 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence494 1348 689 gene locus_tag LOCUS_18160 gene flgD 1348 689 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW69 protein_id gnl|my_center|LOCUS_18160 1765 1361 gene locus_tag LOCUS_18170 gene flgC 1765 1361 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B4 protein_id gnl|my_center|LOCUS_18170 2133 1777 gene locus_tag LOCUS_18180 gene flgB 2133 1777 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B3 protein_id gnl|my_center|LOCUS_18180 >Feature sequence495 <1 543 gene locus_tag LOCUS_18190 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000600052.1:3-oxoacyl-ACP reductase >Feature sequence496 481 47 gene locus_tag LOCUS_18200 481 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1588 503 gene locus_tag LOCUS_18210 1588 503 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence497 >Feature sequence498 >Feature sequence499 1594 812 gene locus_tag LOCUS_18220 1594 812 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence500 892 1371 gene locus_tag LOCUS_18230 gene smpB 892 1371 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A832 protein_id gnl|my_center|LOCUS_18230 >Feature sequence501 >Feature sequence502 2288 1848 gene locus_tag LOCUS_18240 2288 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence503 847 233 gene locus_tag LOCUS_18250 847 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18250 <2287 1087 gene locus_tag LOCUS_18260 <2287 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404038.1:amino acid transporter >Feature sequence504 3 545 gene locus_tag LOCUS_18270 3 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 545 1570 gene locus_tag LOCUS_18280 gene cioB 545 1570 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 protein_id gnl|my_center|LOCUS_18280 2025 1687 gene locus_tag LOCUS_18290 2025 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2281 2105 gene locus_tag LOCUS_18300 2281 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence505 1975 653 gene locus_tag LOCUS_18310 gene argA 1975 653 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SJ5 protein_id gnl|my_center|LOCUS_18310 >Feature sequence506 >Feature sequence507 3 644 gene locus_tag LOCUS_18320 3 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence508 774 1895 gene locus_tag LOCUS_18330 774 1895 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence509 1299 220 gene locus_tag LOCUS_18340 gene alr 1299 220 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D71 protein_id gnl|my_center|LOCUS_18340 <2263 1296 gene locus_tag LOCUS_18350 <2263 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZXJ3:replicative DNA helicase >Feature sequence510 <1 618 gene locus_tag LOCUS_18360 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005467801.1:ABC transporter ATP-binding protein 1506 631 gene locus_tag LOCUS_18370 gene ephC 1506 631 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_18370 <2248 1537 gene locus_tag LOCUS_18380 <2248 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZPK0:argininosuccinate synthase >Feature sequence511 >Feature sequence512 >Feature sequence513 406 239 gene locus_tag LOCUS_18390 406 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 906 1415 gene locus_tag LOCUS_18400 gene def 906 1415 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P934 protein_id gnl|my_center|LOCUS_18400 >Feature sequence514 24 1394 gene locus_tag LOCUS_18410 24 1394 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence515 178 1620 gene locus_tag LOCUS_18420 gene purF 178 1620 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_18420 >Feature sequence516 109 33 gene locus_tag LOCUS_t00370 109 33 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 204 129 gene locus_tag LOCUS_t00380 204 129 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 535 263 gene locus_tag LOCUS_18430 gene hupB 535 263 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_18430 949 1515 gene locus_tag LOCUS_18440 949 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence517 279 1325 gene locus_tag LOCUS_18450 279 1325 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942955.1 protein_id gnl|my_center|LOCUS_18450 1386 2132 gene locus_tag LOCUS_18460 1386 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence518 <1 509 gene locus_tag LOCUS_18470 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVZ7:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 509 1594 gene locus_tag LOCUS_18480 gene mraY 509 1594 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_18480 >Feature sequence519 236 1864 gene locus_tag LOCUS_18490 236 1864 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence520 <1 696 gene locus_tag LOCUS_18500 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092150.1:Bcr/CflA family drug resistance efflux transporter 1687 722 gene locus_tag LOCUS_18510 1687 722 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence521 121 465 gene locus_tag LOCUS_18520 121 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 514 589 gene locus_tag LOCUS_t00390 514 589 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence522 1587 742 gene locus_tag LOCUS_18530 gene folP 1587 742 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE9 protein_id gnl|my_center|LOCUS_18530 <2194 1633 gene locus_tag LOCUS_18540 <2194 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83BY5:ATP-dependent zinc metalloprotease FtsH >Feature sequence523 1134 193 gene locus_tag LOCUS_18550 gene lpqC 1134 193 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_18550 1866 1258 gene locus_tag LOCUS_18560 1866 1258 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918109.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence524 1603 617 gene locus_tag LOCUS_18570 gene cysB 1603 617 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence525 1449 1063 gene locus_tag LOCUS_18580 gene gcvH 1449 1063 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ70 protein_id gnl|my_center|LOCUS_18580 <2182 1527 gene locus_tag LOCUS_18590 <2182 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88AS0:aminomethyltransferase >Feature sequence526 1562 540 gene locus_tag LOCUS_18600 1562 540 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709492.1 protein_id gnl|my_center|LOCUS_18600 <2176 1580 gene locus_tag LOCUS_18610 <2176 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KSB4:putative dioxygenase >Feature sequence527 522 734 gene locus_tag LOCUS_18620 522 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18620 1683 907 gene locus_tag LOCUS_18630 gene zapD 1683 907 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QL1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence528 684 1100 gene locus_tag LOCUS_18640 684 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1699 1097 gene locus_tag LOCUS_18650 1699 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence529 <1 1877 gene locus_tag LOCUS_18660 <1 1877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921329.1:TonB-dependent receptor >Feature sequence530 462 1655 gene locus_tag LOCUS_18670 gene flgL 462 1655 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence531 <2153 177 gene locus_tag LOCUS_18680 <2153 177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037075.1:flagellar biosynthesis protein FlhA >Feature sequence532 <1 742 gene locus_tag LOCUS_18690 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072067.1:peptidase M14 1074 832 gene locus_tag LOCUS_18700 1074 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2151 1204 gene locus_tag LOCUS_18710 2151 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence533 <1 993 gene locus_tag LOCUS_18720 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114183.1:serine protease MucD 986 1228 gene locus_tag LOCUS_18730 986 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence534 <1 691 gene locus_tag LOCUS_18740 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC46:50S ribosomal protein L2 704 976 gene locus_tag LOCUS_18750 gene rpsS 704 976 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T09 protein_id gnl|my_center|LOCUS_18750 987 1319 gene locus_tag LOCUS_18760 gene rplV 987 1319 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T08 protein_id gnl|my_center|LOCUS_18760 1330 2019 gene locus_tag LOCUS_18770 gene rpsC 1330 2019 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_18770 >Feature sequence535 1357 539 gene locus_tag LOCUS_18780 gene dapD 1357 539 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG0 protein_id gnl|my_center|LOCUS_18780 <2143 1382 gene locus_tag LOCUS_18790 <2143 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886P5:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence536 508 1479 gene locus_tag LOCUS_18800 gene pstS 508 1479 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_18800 >Feature sequence537 >Feature sequence538 453 770 gene locus_tag LOCUS_18810 453 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence539 751 323 gene locus_tag LOCUS_18820 751 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence540 <1 550 gene locus_tag LOCUS_18830 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZJF2:tryptophan--tRNA ligase 576 1436 gene locus_tag LOCUS_18840 576 1436 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_18840 >Feature sequence541 672 962 gene locus_tag LOCUS_18850 672 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18850 >Feature sequence542 <1 591 gene locus_tag LOCUS_18860 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDH6:FAD:protein FMN transferase 685 1185 gene locus_tag LOCUS_18870 685 1185 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065038.1 protein_id gnl|my_center|LOCUS_18870 1640 1182 gene locus_tag LOCUS_18880 gene soxR 1640 1182 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51506 protein_id gnl|my_center|LOCUS_18880 >Feature sequence543 1376 24 gene locus_tag LOCUS_18890 1376 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence544 302 835 gene locus_tag LOCUS_18900 gene rimM 302 835 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC2 protein_id gnl|my_center|LOCUS_18900 825 1589 gene locus_tag LOCUS_18910 gene trmD 825 1589 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ1 protein_id gnl|my_center|LOCUS_18910 1576 1938 gene locus_tag LOCUS_18920 gene rplS 1576 1938 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886U9 protein_id gnl|my_center|LOCUS_18920 >Feature sequence545 1409 726 gene locus_tag LOCUS_18930 gene rnc 1409 726 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB52 protein_id gnl|my_center|LOCUS_18930 1809 1429 gene locus_tag LOCUS_18940 1809 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2119 1838 gene locus_tag LOCUS_18950 2119 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence546 7 720 gene locus_tag LOCUS_18960 7 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 720 1238 gene locus_tag LOCUS_18970 gene kdsC 720 1238 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_18970 1238 1795 gene locus_tag LOCUS_18980 1238 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence547 590 1468 gene locus_tag LOCUS_18990 590 1468 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204207.1 protein_id gnl|my_center|LOCUS_18990 1472 1930 gene locus_tag LOCUS_19000 1472 1930 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098177.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence548 217 453 gene locus_tag LOCUS_19010 217 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 572 1057 gene locus_tag LOCUS_19020 gene bfrB 572 1057 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_19020 1535 1119 gene locus_tag LOCUS_19030 1535 1119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence549 >Feature sequence550 1010 297 gene locus_tag LOCUS_19040 gene lolD 1010 297 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SP4 protein_id gnl|my_center|LOCUS_19040 <2100 1003 gene locus_tag LOCUS_19050 <2100 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191984.1:lipoprotein releasing system protein >Feature sequence551 340 1449 gene locus_tag LOCUS_19060 340 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence552 <1 541 gene locus_tag LOCUS_19070 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186297.1:1-acyl-sn-glycerol-3-phosphate acyltransferase 531 1895 gene locus_tag LOCUS_19080 531 1895 CDS product L-gulonolactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence553 280 1509 gene locus_tag LOCUS_19090 280 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_19090 <2089 1554 gene locus_tag LOCUS_19100 <2089 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66520:putative transaldolase >Feature sequence554 1014 145 gene locus_tag LOCUS_19110 gene APA2 1014 145 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_19110 <2089 1097 gene locus_tag LOCUS_19120 <2089 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I1M0:lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex >Feature sequence555 3 227 gene locus_tag LOCUS_19130 3 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 980 279 gene locus_tag LOCUS_19140 980 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1265 1005 gene locus_tag LOCUS_19150 1265 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1905 1273 gene locus_tag LOCUS_19160 1905 1273 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence556 <1 599 gene locus_tag LOCUS_19170 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920248.1:cation transporter 625 873 gene locus_tag LOCUS_19180 625 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 870 1583 gene locus_tag LOCUS_19190 870 1583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence557 362 781 gene locus_tag LOCUS_19200 gene atpC 362 781 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR4 protein_id gnl|my_center|LOCUS_19200 >Feature sequence558 <1 739 gene locus_tag LOCUS_19210 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EP44:transketolase 824 1831 gene locus_tag LOCUS_19220 gene gap 824 1831 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK56 protein_id gnl|my_center|LOCUS_19220 >Feature sequence559 2078 1494 gene locus_tag LOCUS_19230 2078 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence560 1371 598 gene locus_tag LOCUS_19240 1371 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_19240 1529 1927 gene locus_tag LOCUS_19250 1529 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence561 <1 1885 gene locus_tag LOCUS_19260 <1 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZX3:protein-glutamine gamma-glutamyltransferase >Feature sequence562 1358 69 gene locus_tag LOCUS_19270 1358 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence563 317 1105 gene locus_tag LOCUS_19280 317 1105 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_19280 1139 1705 gene locus_tag LOCUS_19290 1139 1705 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence564 1299 1952 gene locus_tag LOCUS_19300 gene lexA 1299 1952 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37452 protein_id gnl|my_center|LOCUS_19300 >Feature sequence565 <2059 63 gene locus_tag LOCUS_19310 <2059 63 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543968.1:fimbriae usher protein >Feature sequence566 >Feature sequence567 <1 1654 gene locus_tag LOCUS_19320 <1 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039298.1:Oar protein >Feature sequence568 <1 844 gene locus_tag LOCUS_19330 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E8Z0:DNA replication and repair protein RecF >Feature sequence569 326 84 gene locus_tag LOCUS_19340 326 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1285 368 gene locus_tag LOCUS_19350 gene bioH 1285 368 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_19350 <2049 1308 gene locus_tag LOCUS_19360 <2049 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185593.1:NAD(P)-dependent oxidoreductase >Feature sequence570 >Feature sequence571 175 975 gene locus_tag LOCUS_19370 gene paaG 175 975 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence572 200 811 gene locus_tag LOCUS_19380 200 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19380 836 1999 gene locus_tag LOCUS_19390 836 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19390 >Feature sequence573 >Feature sequence574 <1 830 gene locus_tag LOCUS_19400 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703124.1:putative fumarate reductase/succinate dehydrogenase 842 1231 gene locus_tag LOCUS_19410 842 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence575 1566 760 gene locus_tag LOCUS_19420 gene atuE 1566 760 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence576 >Feature sequence577 817 254 gene locus_tag LOCUS_19430 gene ahpC 817 254 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036070.1 protein_id gnl|my_center|LOCUS_19430 1798 1037 gene locus_tag LOCUS_19440 gene murI 1798 1037 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_19440 >Feature sequence578 789 10 gene locus_tag LOCUS_19450 789 10 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_19450 1761 871 gene locus_tag LOCUS_19460 gene cysM 1761 871 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_19460 >Feature sequence579 1180 269 gene locus_tag LOCUS_19470 gene hmgL 1180 269 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_19470 <2015 1186 gene locus_tag LOCUS_19480 <2015 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810799.1:CoA transferase >Feature sequence580 502 861 gene locus_tag LOCUS_19490 gene dgkA 502 861 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44424 protein_id gnl|my_center|LOCUS_19490 883 1815 gene locus_tag LOCUS_19500 883 1815 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence581 221 1126 gene locus_tag LOCUS_19510 221 1126 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_19510 1123 1941 gene locus_tag LOCUS_19520 1123 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence582 700 92 gene locus_tag LOCUS_19530 700 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence583 574 1533 gene locus_tag LOCUS_19540 574 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence584 225 962 gene locus_tag LOCUS_19550 225 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19550 959 1405 gene locus_tag LOCUS_19560 959 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 <1999 1416 gene locus_tag LOCUS_19570 <1999 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090991.1:citronellol catabolism dehydrogenase >Feature sequence585 1582 980 gene locus_tag LOCUS_19580 gene argA 1582 980 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence586 1 198 gene locus_tag LOCUS_19590 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1124 195 gene locus_tag LOCUS_19600 1124 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 <1992 1283 gene locus_tag LOCUS_19610 <1992 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702891.1:putative peptidase >Feature sequence587 72 1268 gene locus_tag LOCUS_19620 gene hemA 72 1268 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW8 protein_id gnl|my_center|LOCUS_19620 >Feature sequence588 1364 12 gene locus_tag LOCUS_19630 1364 12 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198976.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence589 343 621 gene locus_tag LOCUS_19640 343 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence590 >Feature sequence591 >Feature sequence592 791 1564 gene locus_tag LOCUS_19650 791 1564 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence593 612 854 gene locus_tag LOCUS_19660 612 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 841 1695 gene locus_tag LOCUS_19670 841 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence594 1116 295 gene locus_tag LOCUS_19680 1116 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1694 1113 gene locus_tag LOCUS_19690 1694 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence595 >Feature sequence596 <1 556 gene locus_tag LOCUS_19700 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88AG1:cell division protein FtsX 660 1535 gene locus_tag LOCUS_19710 gene rpoH 660 1535 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF81 protein_id gnl|my_center|LOCUS_19710 >Feature sequence597 329 1408 gene locus_tag LOCUS_19720 gene queG 329 1408 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_19720 <1957 1412 gene locus_tag LOCUS_19730 <1957 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDQ7:glucose-6-phosphate isomerase >Feature sequence598 828 1271 gene locus_tag LOCUS_19740 828 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 <1956 1272 gene locus_tag LOCUS_19750 <1956 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZTY4:chaperone protein DnaJ >Feature sequence599 <1 627 gene locus_tag LOCUS_19760 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388348.1:peptide ABC transporter permease 624 1589 gene locus_tag LOCUS_19770 gene oppD 624 1589 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889269.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence600 <1954 720 gene locus_tag LOCUS_19780 <1954 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87YY4:chromosome partition protein Smc >Feature sequence601 <1951 966 gene locus_tag LOCUS_19790 <1951 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123295.1:alkyl sulfatase >Feature sequence602 159 234 gene locus_tag LOCUS_t00400 159 234 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 268 657 gene locus_tag LOCUS_19800 gene secE 268 657 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET6 protein_id gnl|my_center|LOCUS_19800 668 1195 gene locus_tag LOCUS_19810 gene nusG 668 1195 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_19810 1306 1737 gene locus_tag LOCUS_19820 gene rplK 1306 1737 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 protein_id gnl|my_center|LOCUS_19820 >Feature sequence603 <1 706 gene locus_tag LOCUS_19830 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189844.1:hydrolase >Feature sequence604 <1 930 gene locus_tag LOCUS_19840 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204290.1:carboxylesterase 927 1463 gene locus_tag LOCUS_19850 gene yrdA 927 1463 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946314.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence605 >Feature sequence606 <1 1229 gene locus_tag LOCUS_19860 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093191.1:penicillin-binding protein 2 >Feature sequence607 1 795 gene locus_tag LOCUS_19870 1 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19870 >Feature sequence608 998 279 gene locus_tag LOCUS_19880 gene uppS 998 279 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG7 protein_id gnl|my_center|LOCUS_19880 1571 1014 gene locus_tag LOCUS_19890 gene frr 1571 1014 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence609 1567 791 gene locus_tag LOCUS_19900 gene exoA 1567 791 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence610 >Feature sequence611 1015 869 gene locus_tag LOCUS_19910 1015 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1155 1015 gene locus_tag LOCUS_19920 1155 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1394 1152 gene locus_tag LOCUS_19930 1394 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1527 1727 gene locus_tag LOCUS_19940 1527 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence612 1264 758 gene locus_tag LOCUS_19950 1264 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence613 >Feature sequence614 >Feature sequence615 613 1428 gene locus_tag LOCUS_19960 613 1428 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141901.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence616 >Feature sequence617 >Feature sequence618 976 176 gene locus_tag LOCUS_19970 gene gloB 976 176 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T1 protein_id gnl|my_center|LOCUS_19970 1018 1785 gene locus_tag LOCUS_19980 1018 1785 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772769.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence619 >Feature sequence620 556 1056 gene locus_tag LOCUS_19990 gene greB 556 1056 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089959.1 protein_id gnl|my_center|LOCUS_19990 1292 1053 gene locus_tag LOCUS_20000 1292 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence621 >Feature sequence622 <1 1417 gene locus_tag LOCUS_20010 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224638.1:two-component sensor histidine kinase >Feature sequence623 442 47 gene locus_tag LOCUS_20020 gene gloA 442 47 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PC83 protein_id gnl|my_center|LOCUS_20020 >Feature sequence624 1644 481 gene locus_tag LOCUS_20030 gene sucC 1644 481 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80886 protein_id gnl|my_center|LOCUS_20030 >Feature sequence625 585 1556 gene locus_tag LOCUS_20040 585 1556 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence626 996 85 gene locus_tag LOCUS_20050 996 85 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530005.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence627 1298 1534 gene locus_tag LOCUS_20060 1298 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence628 >Feature sequence629 378 860 gene locus_tag LOCUS_20070 378 860 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035831.1 protein_id gnl|my_center|LOCUS_20070 1517 864 gene locus_tag LOCUS_20080 1517 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence630 >Feature sequence631 455 1324 gene locus_tag LOCUS_20090 gene ispE 455 1324 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C5 protein_id gnl|my_center|LOCUS_20090 1396 1470 gene locus_tag LOCUS_t00410 1396 1470 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence632 1204 227 gene locus_tag LOCUS_20100 1204 227 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence633 585 124 gene locus_tag LOCUS_20110 585 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1778 600 gene locus_tag LOCUS_20120 1778 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence634 1698 469 gene locus_tag LOCUS_20130 1698 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence635 168 635 gene locus_tag LOCUS_20140 168 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 632 811 gene locus_tag LOCUS_20150 632 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 840 1313 gene locus_tag LOCUS_20160 840 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence636 >Feature sequence637 <1 798 gene locus_tag LOCUS_20170 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038953.1:acyl-CoA desaturase 1220 795 gene locus_tag LOCUS_20180 1220 795 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence638 159 1775 gene locus_tag LOCUS_20190 159 1775 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence639 >Feature sequence640 414 49 gene locus_tag LOCUS_20200 414 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 990 529 gene locus_tag LOCUS_20210 990 529 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_20210 1818 1021 gene locus_tag LOCUS_20220 gene fabG 1818 1021 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence641 <1 753 gene locus_tag LOCUS_20230 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87YK2:NAD kinase >Feature sequence642 820 155 gene locus_tag LOCUS_20240 820 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence643 1810 335 gene locus_tag LOCUS_20250 1810 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence644 <1 510 gene locus_tag LOCUS_20260 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207008.1:molybdenum cofactor biosynthesis protein MoaE 517 1443 gene locus_tag LOCUS_20270 gene moaCB 517 1443 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_20270 1440 1604 gene locus_tag LOCUS_20280 1440 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence645 <1803 943 gene locus_tag LOCUS_20290 <1803 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028993.1:methyltransferase >Feature sequence646 >Feature sequence647 1191 154 gene locus_tag LOCUS_20300 gene ygjD 1191 154 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 protein_id gnl|my_center|LOCUS_20300 1315 1530 gene locus_tag LOCUS_20310 gene rpsU 1315 1530 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF3 protein_id gnl|my_center|LOCUS_20310 >Feature sequence648 <1 1344 gene locus_tag LOCUS_20320 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083191.1:adenylate cyclase >Feature sequence649 393 1181 gene locus_tag LOCUS_20330 gene suhB 393 1181 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence650 <1 579 gene locus_tag LOCUS_20340 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003393654.1:SAM-dependent methyltransferase 629 1411 gene locus_tag LOCUS_20350 gene lgt 629 1411 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_20350 >Feature sequence651 >Feature sequence652 400 1278 gene locus_tag LOCUS_20360 400 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence653 127 504 gene locus_tag LOCUS_20370 127 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114197.1 protein_id gnl|my_center|LOCUS_20370 512 1489 gene locus_tag LOCUS_20380 gene rsgA 512 1489 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5H9 protein_id gnl|my_center|LOCUS_20380 >Feature sequence654 <1 568 gene locus_tag LOCUS_20390 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UDC3:molybdenum import ATP-binding protein ModC 559 1749 gene locus_tag LOCUS_20400 gene moeA 559 1749 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932999.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence655 801 1685 gene locus_tag LOCUS_20410 801 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120857.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence656 <1 883 gene locus_tag LOCUS_20420 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074037.1:beta-ketoacyl-ACP synthase II 1002 1427 gene locus_tag LOCUS_20430 1002 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence657 >Feature sequence658 715 272 gene locus_tag LOCUS_20440 715 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_20440 <1777 772 gene locus_tag LOCUS_20450 <1777 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KNQ7:ATP-dependent protease ATPase subunit HslU >Feature sequence659 208 588 gene locus_tag LOCUS_20460 208 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701948.1 protein_id gnl|my_center|LOCUS_20460 1744 659 gene locus_tag LOCUS_20470 gene kshA 1744 659 CDS product 3-ketosteroid-9-alpha-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4R3 protein_id gnl|my_center|LOCUS_20470 >Feature sequence660 332 961 gene locus_tag LOCUS_20480 332 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1332 979 gene locus_tag LOCUS_20490 1332 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_20490 1774 1466 gene locus_tag LOCUS_20500 1774 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence661 506 303 gene locus_tag LOCUS_20510 506 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 936 526 gene locus_tag LOCUS_20520 936 526 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence662 <1 1247 gene locus_tag LOCUS_20530 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538040.1:exported copper oxidase >Feature sequence663 935 120 gene locus_tag LOCUS_20540 935 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1459 935 gene locus_tag LOCUS_20550 1459 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence664 429 1448 gene locus_tag LOCUS_20560 gene mltB-1 429 1448 CDS product murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705439.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence665 1327 254 gene locus_tag LOCUS_20570 gene aroG 1327 254 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_20570 >Feature sequence666 <1 759 gene locus_tag LOCUS_20580 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPX7:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence667 >Feature sequence668 434 694 gene locus_tag LOCUS_20590 434 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 819 1289 gene locus_tag LOCUS_20600 819 1289 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776247.1 protein_id gnl|my_center|LOCUS_20600 1322 1723 gene locus_tag LOCUS_20610 1322 1723 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708433.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence669 313 1584 gene locus_tag LOCUS_20620 313 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383481.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence670 <1 840 gene locus_tag LOCUS_20630 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113524.1:dipeptidase 864 1052 gene locus_tag LOCUS_20640 864 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721784.1 protein_id gnl|my_center|LOCUS_20640 <1732 1217 gene locus_tag LOCUS_20650 <1732 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89Y21:2-dehydropantoate 2-reductase >Feature sequence671 >Feature sequence672 <1 745 gene locus_tag LOCUS_20660 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CCQ9:succinate dehydrogenase flavoprotein subunit 764 1549 gene locus_tag LOCUS_20670 gene sdhB 764 1549 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ72 protein_id gnl|my_center|LOCUS_20670 >Feature sequence673 127 669 gene locus_tag LOCUS_20680 127 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 753 1643 gene locus_tag LOCUS_20690 753 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence674 <1729 78 gene locus_tag LOCUS_20700 <1729 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120311.1:histidine kinase >Feature sequence675 >Feature sequence676 >Feature sequence677 215 42 gene locus_tag LOCUS_20710 215 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 648 178 gene locus_tag LOCUS_20720 648 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 908 645 gene locus_tag LOCUS_20730 908 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1122 940 gene locus_tag LOCUS_20740 1122 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1493 1119 gene locus_tag LOCUS_20750 1493 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence678 1558 626 gene locus_tag LOCUS_20760 1558 626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence679 584 42 gene locus_tag LOCUS_20770 584 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_20770 986 597 gene locus_tag LOCUS_20780 986 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence680 <1 831 gene locus_tag LOCUS_20790 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070558.1:aminobenzoyl-glutamate transporter >Feature sequence681 <1 1607 gene locus_tag LOCUS_20800 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031493.1:peptidase >Feature sequence682 >Feature sequence683 <1718 197 gene locus_tag LOCUS_20810 <1718 197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZYP6:elongation factor G >Feature sequence684 841 1275 gene locus_tag LOCUS_20820 841 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1368 1580 gene locus_tag LOCUS_20830 1368 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence685 715 32 gene locus_tag LOCUS_20840 715 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence686 3 248 gene locus_tag LOCUS_20850 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 626 255 gene locus_tag LOCUS_20860 626 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 713 1570 gene locus_tag LOCUS_20870 713 1570 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence687 188 1429 gene locus_tag LOCUS_20880 188 1429 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence688 1519 134 gene locus_tag LOCUS_20890 1519 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142415.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence689 487 1086 gene locus_tag LOCUS_20900 487 1086 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence690 1629 730 gene locus_tag LOCUS_20910 1629 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence691 >Feature sequence692 <1 1550 gene locus_tag LOCUS_20920 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705768.1:long-chain acyl-CoA synthetase >Feature sequence693 1573 1106 gene locus_tag LOCUS_20930 1573 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence694 173 853 gene locus_tag LOCUS_20940 173 853 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P741 protein_id gnl|my_center|LOCUS_20940 906 1550 gene locus_tag LOCUS_20950 906 1550 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920895.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence695 1080 19 gene locus_tag LOCUS_20960 1080 19 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence696 >Feature sequence697 1598 1188 gene locus_tag LOCUS_20970 1598 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence698 >Feature sequence699 >Feature sequence700 <1 589 gene locus_tag LOCUS_20980 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887149.1:methyltransferase type 11 >Feature sequence701 <1 874 gene locus_tag LOCUS_20990 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PA84:3-oxoacyl-[acyl-carrier-protein] synthase 3 1564 878 gene locus_tag LOCUS_21000 1564 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence702 999 394 gene locus_tag LOCUS_21010 999 394 CDS product paraquat-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194239.1 protein_id gnl|my_center|LOCUS_21010 <1662 1107 gene locus_tag LOCUS_21020 <1662 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226475.1:peptidyl-dipeptidase Dcp >Feature sequence703 >Feature sequence704 >Feature sequence705 229 1311 gene locus_tag LOCUS_21030 gene ctaA 229 1311 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence706 287 1204 gene locus_tag LOCUS_21040 287 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence707 524 1405 gene locus_tag LOCUS_21050 524 1405 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_21050 1641 1417 gene locus_tag LOCUS_21060 1641 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence708 >Feature sequence709 >Feature sequence710 <1 597 gene locus_tag LOCUS_21070 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140683.1:prolyl endopeptidase 671 1327 gene locus_tag LOCUS_21080 671 1327 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence711 471 1013 gene locus_tag LOCUS_21090 471 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 <1628 1077 gene locus_tag LOCUS_21100 <1628 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116803.1:acyl-CoA dehydrogenase >Feature sequence712 >Feature sequence713 1431 787 gene locus_tag LOCUS_21110 gene thiE 1431 787 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_21110 >Feature sequence714 >Feature sequence715 <1 1450 gene locus_tag LOCUS_21120 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094139.1:penicillin-binding protein 3 >Feature sequence716 74 406 gene locus_tag LOCUS_21130 74 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 473 1510 gene locus_tag LOCUS_21140 gene aguA 473 1510 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence717 1320 313 gene locus_tag LOCUS_21150 gene pyrB 1320 313 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_21150 >Feature sequence718 627 37 gene locus_tag LOCUS_21160 627 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1101 679 gene locus_tag LOCUS_21170 1101 679 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425271.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence719 >Feature sequence720 <1612 344 gene locus_tag LOCUS_21180 <1612 344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87VH3:DNA topoisomerase 4 subunit B >Feature sequence721 601 83 gene locus_tag LOCUS_21190 601 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 <1612 608 gene locus_tag LOCUS_21200 <1612 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HX25:lipoyl synthase >Feature sequence722 <1 661 gene locus_tag LOCUS_21210 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037434.1:membrane protein 1534 650 gene locus_tag LOCUS_21220 1534 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence723 451 840 gene locus_tag LOCUS_21230 451 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence724 1166 324 gene locus_tag LOCUS_21240 gene hemK 1166 324 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C0 protein_id gnl|my_center|LOCUS_21240 >Feature sequence725 <1 1382 gene locus_tag LOCUS_21250 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708494.1:acyltransferase >Feature sequence726 237 875 gene locus_tag LOCUS_21260 gene hisG 237 875 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q85 protein_id gnl|my_center|LOCUS_21260 >Feature sequence727 478 173 gene locus_tag LOCUS_21270 478 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 879 475 gene locus_tag LOCUS_21280 879 475 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_21280 1415 876 gene locus_tag LOCUS_21290 1415 876 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_21290 1581 1408 gene locus_tag LOCUS_21300 1581 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence728 >Feature sequence729 <1581 1044 gene locus_tag LOCUS_21310 <1581 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072508.1:Crp/Fnr family transcriptional regulator >Feature sequence730 >Feature sequence731 1490 186 gene locus_tag LOCUS_21320 1490 186 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence732 <1 853 gene locus_tag LOCUS_21330 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533438.1:hydrolase <1571 884 gene locus_tag LOCUS_21340 <1571 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388092.1:short-chain dehydrogenase >Feature sequence733 1139 438 gene locus_tag LOCUS_21350 1139 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888523.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence734 559 1086 gene locus_tag LOCUS_21360 559 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence735 1015 95 gene locus_tag LOCUS_21370 gene oppB 1015 95 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence736 >Feature sequence737 <1552 51 gene locus_tag LOCUS_21380 <1552 51 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037005.1:ferrous iron transporter B >Feature sequence738 <1550 1023 gene locus_tag LOCUS_21390 <1550 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104739.1:aspartate-semialdehyde dehydrogenase >Feature sequence739 682 332 gene locus_tag LOCUS_21400 682 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence740 1030 335 gene locus_tag LOCUS_21410 1030 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence741 1447 1028 gene locus_tag LOCUS_21420 1447 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence742 >Feature sequence743 306 1325 gene locus_tag LOCUS_21430 306 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence744 >Feature sequence745 821 318 gene locus_tag LOCUS_21440 821 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229248.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence746 >Feature sequence747 1243 308 gene locus_tag LOCUS_21450 gene yyaM 1243 308 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206550.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence748 1016 165 gene locus_tag LOCUS_21460 gene speE 1016 165 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_21460 >Feature sequence749 <1 573 gene locus_tag LOCUS_21470 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000705149.1:rhamnosyltransferase 1423 596 gene locus_tag LOCUS_21480 1423 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence750 >Feature sequence751 <1 586 gene locus_tag LOCUS_21490 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNA0:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence752 1081 176 gene locus_tag LOCUS_21500 1081 176 CDS product putative 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701337.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence753 <1 914 gene locus_tag LOCUS_21510 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEG2:protease >Feature sequence754 <1 552 gene locus_tag LOCUS_21520 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PAL2:DNA repair protein RecN 985 563 gene locus_tag LOCUS_21530 gene fur 985 563 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_21530