>Feature sequence001 154 1719 gene locus_tag LOCUS_00010 154 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1750 2697 gene locus_tag LOCUS_00020 1750 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7872 2941 gene locus_tag LOCUS_00030 7872 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8170 9309 gene locus_tag LOCUS_00040 8170 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 10123 9752 gene locus_tag LOCUS_00050 gene crcB 10123 9752 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZS8 protein_id gnl|my_center|LOCUS_00050 10223 10936 gene locus_tag LOCUS_00060 10223 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_00060 12619 11081 gene locus_tag LOCUS_00070 gene gldJ 12619 11081 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_00070 13705 12683 gene locus_tag LOCUS_00080 13705 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13985 17917 gene locus_tag LOCUS_00090 gene porU 13985 17917 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_00090 18190 19452 gene locus_tag LOCUS_00100 gene porV 18190 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_00100 19539 20039 gene locus_tag LOCUS_00110 19539 20039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 21978 20122 gene locus_tag LOCUS_00120 21978 20122 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306686.1 protein_id gnl|my_center|LOCUS_00120 22514 21978 gene locus_tag LOCUS_00130 22514 21978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_00130 22815 22733 gene locus_tag LOCUS_t00010 22815 22733 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 24072 22903 gene locus_tag LOCUS_00140 gene putA 24072 22903 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_00140 26348 24348 gene locus_tag LOCUS_00150 gene bfmBA 26348 24348 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_00150 26636 27064 gene locus_tag LOCUS_00160 26636 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 27216 31562 gene locus_tag LOCUS_00170 27216 31562 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_00170 31596 32882 gene locus_tag LOCUS_00180 31596 32882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 33190 34884 gene locus_tag LOCUS_00190 gene hsdM 33190 34884 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_00190 34885 36750 gene locus_tag LOCUS_00200 34885 36750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 36722 38569 gene locus_tag LOCUS_00210 36722 38569 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 protein_id gnl|my_center|LOCUS_00210 38635 39609 gene locus_tag LOCUS_00220 38635 39609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123253.1 protein_id gnl|my_center|LOCUS_00220 39663 40652 gene locus_tag LOCUS_00230 39663 40652 CDS product HrgA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851346.1 protein_id gnl|my_center|LOCUS_00230 40748 41914 gene locus_tag LOCUS_00240 gene holB 40748 41914 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_00240 42610 44061 gene locus_tag LOCUS_00250 42610 44061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766922.1 protein_id gnl|my_center|LOCUS_00250 44108 44533 gene locus_tag LOCUS_00260 44108 44533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 44547 45554 gene locus_tag LOCUS_00270 44547 45554 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_00270 45646 47265 gene locus_tag LOCUS_00280 45646 47265 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_00280 47435 47938 gene locus_tag LOCUS_00290 47435 47938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 48633 48160 gene locus_tag LOCUS_00300 48633 48160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 48975 48730 gene locus_tag LOCUS_00310 48975 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 49800 49438 gene locus_tag LOCUS_00320 49800 49438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 50938 49829 gene locus_tag LOCUS_00330 gene mtnA 50938 49829 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TI2 protein_id gnl|my_center|LOCUS_00330 51676 50987 gene locus_tag LOCUS_00340 gene mtnC 51676 50987 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_00340 51907 53337 gene locus_tag LOCUS_00350 51907 53337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 54882 53437 gene locus_tag LOCUS_00360 54882 53437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 55134 56606 gene locus_tag LOCUS_00370 55134 56606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 57700 56663 gene locus_tag LOCUS_00380 57700 56663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 57804 59210 gene locus_tag LOCUS_00390 57804 59210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 61295 59301 gene locus_tag LOCUS_00400 61295 59301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 61617 65339 gene locus_tag LOCUS_00410 gene metH 61617 65339 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_00410 65773 66240 gene locus_tag LOCUS_00420 gene guaD 65773 66240 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_00420 66521 67561 gene locus_tag LOCUS_00430 66521 67561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 67620 69530 gene locus_tag LOCUS_00440 67620 69530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 69701 71818 gene locus_tag LOCUS_00450 69701 71818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 71879 72136 gene locus_tag LOCUS_00460 71879 72136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 72475 72966 gene locus_tag LOCUS_00470 72475 72966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 72987 74099 gene locus_tag LOCUS_00480 72987 74099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 74152 75645 gene locus_tag LOCUS_00490 74152 75645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 75753 76205 gene locus_tag LOCUS_00500 75753 76205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 76372 78045 gene locus_tag LOCUS_00510 76372 78045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 78064 78756 gene locus_tag LOCUS_00520 78064 78756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 78761 78946 gene locus_tag LOCUS_00530 78761 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 78988 80832 gene locus_tag LOCUS_00540 78988 80832 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_00540 80935 81237 gene locus_tag LOCUS_00550 80935 81237 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387049.1 protein_id gnl|my_center|LOCUS_00550 81279 81695 gene locus_tag LOCUS_00560 81279 81695 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_00560 81745 85512 gene locus_tag LOCUS_00570 81745 85512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 85669 86508 gene locus_tag LOCUS_00580 85669 86508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 87370 86702 gene locus_tag LOCUS_00590 87370 86702 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_00590 87525 88709 gene locus_tag LOCUS_00600 87525 88709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 88731 89513 gene locus_tag LOCUS_00610 88731 89513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 89523 90002 gene locus_tag LOCUS_00620 89523 90002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 90196 90609 gene locus_tag LOCUS_00630 90196 90609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 90798 91085 gene locus_tag LOCUS_00640 90798 91085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 91579 92061 gene locus_tag LOCUS_00650 gene mraZ 91579 92061 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_00650 92033 92953 gene locus_tag LOCUS_00660 gene rsmH 92033 92953 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_00660 93249 93632 gene locus_tag LOCUS_00670 93249 93632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 93766 95874 gene locus_tag LOCUS_00680 gene ftsI 93766 95874 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_00680 95900 97357 gene locus_tag LOCUS_00690 gene murE 95900 97357 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_00690 97518 98801 gene locus_tag LOCUS_00700 gene mraY 97518 98801 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_00700 98855 100261 gene locus_tag LOCUS_00710 gene murD 98855 100261 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_00710 100525 101661 gene locus_tag LOCUS_00720 gene ftsW 100525 101661 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_00720 101831 102922 gene locus_tag LOCUS_00730 gene murG 101831 102922 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_00730 103021 104388 gene locus_tag LOCUS_00740 gene murC 103021 104388 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_00740 104570 105346 gene locus_tag LOCUS_00750 104570 105346 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_00750 105458 106774 gene locus_tag LOCUS_00760 gene ftsA 105458 106774 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_00760 107006 108451 gene locus_tag LOCUS_00770 107006 108451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 109101 108628 gene locus_tag LOCUS_00780 109101 108628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 109919 109191 gene locus_tag LOCUS_00790 109919 109191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 111515 110130 gene locus_tag LOCUS_00800 111515 110130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 111569 112261 gene locus_tag LOCUS_00810 111569 112261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 protein_id gnl|my_center|LOCUS_00810 112475 113248 gene locus_tag LOCUS_00820 112475 113248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 113400 114182 gene locus_tag LOCUS_00830 113400 114182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 114187 115164 gene locus_tag LOCUS_00840 114187 115164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00840 115761 117395 gene locus_tag LOCUS_00850 115761 117395 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_00850 117409 118125 gene locus_tag LOCUS_00860 gene fkpA 117409 118125 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_00860 118169 119140 gene locus_tag LOCUS_00870 118169 119140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 119238 120140 gene locus_tag LOCUS_00880 119238 120140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 120160 120870 gene locus_tag LOCUS_00890 120160 120870 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_00890 120908 121585 gene locus_tag LOCUS_00900 120908 121585 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_00900 121654 122241 gene locus_tag LOCUS_00910 121654 122241 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_00910 122434 122820 gene locus_tag LOCUS_00920 122434 122820 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_00920 122909 123571 gene locus_tag LOCUS_00930 122909 123571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 123957 125393 gene locus_tag LOCUS_00940 123957 125393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 125512 126789 gene locus_tag LOCUS_00950 125512 126789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 126838 127521 gene locus_tag LOCUS_00960 126838 127521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 128705 127731 gene locus_tag LOCUS_00970 128705 127731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 130730 128886 gene locus_tag LOCUS_00980 130730 128886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 133389 130999 gene locus_tag LOCUS_00990 133389 130999 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_00990 134633 133791 gene locus_tag LOCUS_01000 134633 133791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 136502 134742 gene locus_tag LOCUS_01010 136502 134742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 137512 136520 gene locus_tag LOCUS_01020 137512 136520 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_01020 138139 137576 gene locus_tag LOCUS_01030 138139 137576 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_01030 138634 138191 gene locus_tag LOCUS_01040 gene tadA 138634 138191 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_01040 139009 140391 gene locus_tag LOCUS_01050 139009 140391 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_01050 140465 141847 gene locus_tag LOCUS_01060 140465 141847 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_01060 141993 144182 gene locus_tag LOCUS_01070 141993 144182 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_01070 145322 144393 gene locus_tag LOCUS_01080 gene mvaK 145322 144393 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_01080 146078 147602 gene locus_tag LOCUS_r00010 146078 147602 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 147725 147799 gene locus_tag LOCUS_t00020 147725 147799 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 147840 147914 gene locus_tag LOCUS_t00030 147840 147914 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 148123 150937 gene locus_tag LOCUS_r00020 148123 150937 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 151196 151298 gene locus_tag LOCUS_r00030 151196 151298 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence002 397 2694 gene locus_tag LOCUS_01090 397 2694 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_01090 2863 3756 gene locus_tag LOCUS_01100 2863 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 4143 5051 gene locus_tag LOCUS_01110 4143 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 5221 6039 gene locus_tag LOCUS_01120 5221 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 6128 8230 gene locus_tag LOCUS_01130 6128 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8327 10483 gene locus_tag LOCUS_01140 8327 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10596 13943 gene locus_tag LOCUS_01150 10596 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 16165 14003 gene locus_tag LOCUS_01160 16165 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 17425 16196 gene locus_tag LOCUS_01170 17425 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_01170 18239 17460 gene locus_tag LOCUS_01180 gene scpA 18239 17460 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_01180 18360 19124 gene locus_tag LOCUS_01190 18360 19124 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z22 protein_id gnl|my_center|LOCUS_01190 19605 22058 gene locus_tag LOCUS_01200 19605 22058 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_01200 22301 23062 gene locus_tag LOCUS_01210 22301 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 23647 24003 gene locus_tag LOCUS_01220 23647 24003 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_01220 24003 24263 gene locus_tag LOCUS_01230 24003 24263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 24333 24668 gene locus_tag LOCUS_01240 24333 24668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 24707 25180 gene locus_tag LOCUS_01250 gene pycA 24707 25180 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_01250 25678 25268 gene locus_tag LOCUS_01260 25678 25268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 27203 26181 gene locus_tag LOCUS_01270 gene hemH 27203 26181 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_01270 28898 27996 gene locus_tag LOCUS_01280 28898 27996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 29509 29018 gene locus_tag LOCUS_01290 29509 29018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 29844 31637 gene locus_tag LOCUS_01300 29844 31637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 31738 32442 gene locus_tag LOCUS_01310 gene truB 31738 32442 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_01310 32526 33212 gene locus_tag LOCUS_01320 32526 33212 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_01320 35112 33541 gene locus_tag LOCUS_01330 35112 33541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 35593 36408 gene locus_tag LOCUS_01340 35593 36408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01340 36363 36917 gene locus_tag LOCUS_01350 36363 36917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01350 37038 39362 gene locus_tag LOCUS_01360 37038 39362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 39485 40036 gene locus_tag LOCUS_01370 39485 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 40854 40222 gene locus_tag LOCUS_01380 40854 40222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 41269 42453 gene locus_tag LOCUS_01390 41269 42453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 42490 43746 gene locus_tag LOCUS_01400 42490 43746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 43757 44485 gene locus_tag LOCUS_01410 43757 44485 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8E6 protein_id gnl|my_center|LOCUS_01410 44817 45947 gene locus_tag LOCUS_01420 gene capI 44817 45947 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_01420 46068 47225 gene locus_tag LOCUS_01430 46068 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 47357 47776 gene locus_tag LOCUS_01440 47357 47776 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_01440 48298 47879 gene locus_tag LOCUS_01450 48298 47879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 48788 51202 gene locus_tag LOCUS_01460 48788 51202 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765755.1 protein_id gnl|my_center|LOCUS_01460 52133 51279 gene locus_tag LOCUS_01470 52133 51279 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_01470 52411 53424 gene locus_tag LOCUS_01480 52411 53424 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_01480 53491 54024 gene locus_tag LOCUS_01490 gene hscB 53491 54024 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYX6 protein_id gnl|my_center|LOCUS_01490 54151 54235 gene locus_tag LOCUS_t00040 54151 54235 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54429 55367 gene locus_tag LOCUS_01500 gene rsgA 54429 55367 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_01500 55380 56606 gene locus_tag LOCUS_01510 55380 56606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_01510 56785 57360 gene locus_tag LOCUS_01520 gene pnuC 56785 57360 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621371.1 protein_id gnl|my_center|LOCUS_01520 57800 57357 gene locus_tag LOCUS_01530 57800 57357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 57967 58476 gene locus_tag LOCUS_01540 gene kptA 57967 58476 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_01540 58507 60213 gene locus_tag LOCUS_01550 58507 60213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 61264 60254 gene locus_tag LOCUS_01560 61264 60254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 61402 62247 gene locus_tag LOCUS_01570 gene folP 61402 62247 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_01570 62362 62964 gene locus_tag LOCUS_01580 gene miaE 62362 62964 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_01580 63160 66030 gene locus_tag LOCUS_01590 63160 66030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 66239 67303 gene locus_tag LOCUS_01600 66239 67303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 67360 67821 gene locus_tag LOCUS_01610 67360 67821 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_01610 68678 67818 gene locus_tag LOCUS_01620 68678 67818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 68801 69778 gene locus_tag LOCUS_01630 68801 69778 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_01630 70217 69855 gene locus_tag LOCUS_01640 70217 69855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_01640 71178 70426 gene locus_tag LOCUS_01650 gene pcrB 71178 70426 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_01650 71349 72152 gene locus_tag LOCUS_01660 71349 72152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 72169 73377 gene locus_tag LOCUS_01670 gene mauG 72169 73377 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_01670 73487 74689 gene locus_tag LOCUS_01680 gene mauG 73487 74689 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_01680 74677 74886 gene locus_tag LOCUS_01690 74677 74886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 75002 76717 gene locus_tag LOCUS_01700 75002 76717 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 protein_id gnl|my_center|LOCUS_01700 76913 77470 gene locus_tag LOCUS_01710 76913 77470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 78568 77573 gene locus_tag LOCUS_01720 78568 77573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 79562 78570 gene locus_tag LOCUS_01730 79562 78570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 80168 79701 gene locus_tag LOCUS_01740 80168 79701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 81442 80315 gene locus_tag LOCUS_01750 81442 80315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 82679 81468 gene locus_tag LOCUS_01760 82679 81468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 83691 82762 gene locus_tag LOCUS_01770 83691 82762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 85254 83836 gene locus_tag LOCUS_01780 gene rodA 85254 83836 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_01780 85410 85586 gene locus_tag LOCUS_01790 85410 85586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 86144 85581 gene locus_tag LOCUS_01800 86144 85581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 86359 88341 gene locus_tag LOCUS_01810 86359 88341 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_01810 88545 89942 gene locus_tag LOCUS_01820 88545 89942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_01820 90087 90614 gene locus_tag LOCUS_01830 90087 90614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_01830 91093 90611 gene locus_tag LOCUS_01840 91093 90611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 91259 95683 gene locus_tag LOCUS_01850 91259 95683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 95708 97687 gene locus_tag LOCUS_01860 95708 97687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 101324 97794 gene locus_tag LOCUS_01870 gene dnaE 101324 97794 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_01870 101689 102597 gene locus_tag LOCUS_01880 101689 102597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 102590 103465 gene locus_tag LOCUS_01890 102590 103465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 103507 104205 gene locus_tag LOCUS_01900 103507 104205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 105532 104324 gene locus_tag LOCUS_01910 105532 104324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 106172 105810 gene locus_tag LOCUS_01920 106172 105810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 106748 106296 gene locus_tag LOCUS_01930 106748 106296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 107065 107550 gene locus_tag LOCUS_01940 107065 107550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 107598 108041 gene locus_tag LOCUS_01950 107598 108041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 108104 108616 gene locus_tag LOCUS_01960 108104 108616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 108771 109532 gene locus_tag LOCUS_01970 gene yaaA 108771 109532 CDS product UPF0246 protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R5 protein_id gnl|my_center|LOCUS_01970 109779 110990 gene locus_tag LOCUS_01980 109779 110990 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_01980 111083 112228 gene locus_tag LOCUS_01990 111083 112228 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_01990 112194 113435 gene locus_tag LOCUS_02000 gene ribBA 112194 113435 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_02000 116353 113756 gene locus_tag LOCUS_02010 116353 113756 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_02010 116795 117676 gene locus_tag LOCUS_02020 116795 117676 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920217.1 protein_id gnl|my_center|LOCUS_02020 117974 122683 gene locus_tag LOCUS_02030 117974 122683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 123323 123943 gene locus_tag LOCUS_02040 123323 123943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 124833 123955 gene locus_tag LOCUS_02050 124833 123955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 125138 126592 gene locus_tag LOCUS_02060 125138 126592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 126827 127258 gene locus_tag LOCUS_02070 126827 127258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362012.1 protein_id gnl|my_center|LOCUS_02070 128027 127371 gene locus_tag LOCUS_02080 128027 127371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 129386 128043 gene locus_tag LOCUS_02090 129386 128043 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_02090 129773 130132 gene locus_tag LOCUS_02100 129773 130132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_02100 130188 133148 gene locus_tag LOCUS_02110 130188 133148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 133148 133945 gene locus_tag LOCUS_02120 133148 133945 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_02120 134101 135573 gene locus_tag LOCUS_02130 134101 135573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080595.1 protein_id gnl|my_center|LOCUS_02130 135991 135641 gene locus_tag LOCUS_02140 135991 135641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence003 4144 3473 gene locus_tag LOCUS_02150 4144 3473 CDS product HAD superfamily hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920786.1 protein_id gnl|my_center|LOCUS_02150 5679 4135 gene locus_tag LOCUS_02160 5679 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6563 5685 gene locus_tag LOCUS_02170 6563 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7744 6587 gene locus_tag LOCUS_02180 7744 6587 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_02180 9019 8072 gene locus_tag LOCUS_02190 gene pseB 9019 8072 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_02190 9395 10681 gene locus_tag LOCUS_02200 9395 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_02200 10824 11231 gene locus_tag LOCUS_02210 10824 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_02210 11913 11362 gene locus_tag LOCUS_02220 11913 11362 CDS product 30S ribosomal protein S5 alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459628.1 protein_id gnl|my_center|LOCUS_02220 12116 11916 gene locus_tag LOCUS_02230 12116 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 12570 13493 gene locus_tag LOCUS_02240 12570 13493 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_02240 16537 13622 gene locus_tag LOCUS_02250 16537 13622 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_02250 17373 16915 gene locus_tag LOCUS_02260 17373 16915 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_02260 18972 17527 gene locus_tag LOCUS_02270 gene sdaA 18972 17527 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_02270 19804 19088 gene locus_tag LOCUS_02280 19804 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 20320 19880 gene locus_tag LOCUS_02290 20320 19880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 20767 20354 gene locus_tag LOCUS_02300 20767 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 21198 20809 gene locus_tag LOCUS_02310 21198 20809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 21763 21263 gene locus_tag LOCUS_02320 21763 21263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 22129 22698 gene locus_tag LOCUS_02330 gene yfhC 22129 22698 CDS product putative NAD(P)H nitroreductase YfhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31571 protein_id gnl|my_center|LOCUS_02330 22846 24108 gene locus_tag LOCUS_02340 22846 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 24560 28234 gene locus_tag LOCUS_02350 gene ileS 24560 28234 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_02350 28291 29247 gene locus_tag LOCUS_02360 gene metF 28291 29247 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_02360 29951 29340 gene locus_tag LOCUS_02370 29951 29340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 30217 31371 gene locus_tag LOCUS_02380 30217 31371 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_02380 31466 32107 gene locus_tag LOCUS_02390 31466 32107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 32173 33021 gene locus_tag LOCUS_02400 32173 33021 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_02400 33271 34209 gene locus_tag LOCUS_02410 33271 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 34416 35378 gene locus_tag LOCUS_02420 gene prsA 34416 35378 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_02420 37096 35453 gene locus_tag LOCUS_02430 37096 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 37804 37385 gene locus_tag LOCUS_02440 37804 37385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 38709 38290 gene locus_tag LOCUS_02450 38709 38290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 39578 39147 gene locus_tag LOCUS_02460 39578 39147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 39891 40592 gene locus_tag LOCUS_02470 gene ftsE 39891 40592 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_02470 41127 40681 gene locus_tag LOCUS_02480 41127 40681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 41465 42043 gene locus_tag LOCUS_02490 41465 42043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 42177 42617 gene locus_tag LOCUS_02500 gene rpiB 42177 42617 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_02500 42714 43478 gene locus_tag LOCUS_02510 42714 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_02510 46286 43581 gene locus_tag LOCUS_02520 46286 43581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_02520 47193 46408 gene locus_tag LOCUS_02530 47193 46408 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_02530 49054 47321 gene locus_tag LOCUS_02540 49054 47321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 49382 51298 gene locus_tag LOCUS_02550 49382 51298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 52197 51388 gene locus_tag LOCUS_02560 52197 51388 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_02560 52997 52341 gene locus_tag LOCUS_02570 52997 52341 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_02570 53597 53103 gene locus_tag LOCUS_02580 53597 53103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 53810 55672 gene locus_tag LOCUS_02590 gene parE 53810 55672 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_02590 57036 55786 gene locus_tag LOCUS_02600 57036 55786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_02600 58516 57161 gene locus_tag LOCUS_02610 58516 57161 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_02610 59382 58675 gene locus_tag LOCUS_02620 59382 58675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 59913 59416 gene locus_tag LOCUS_02630 gene ogt 59913 59416 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJW5 protein_id gnl|my_center|LOCUS_02630 60253 59972 gene locus_tag LOCUS_02640 60253 59972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 60754 60308 gene locus_tag LOCUS_02650 60754 60308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 61060 61854 gene locus_tag LOCUS_02660 61060 61854 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398469.1 protein_id gnl|my_center|LOCUS_02660 61857 63050 gene locus_tag LOCUS_02670 61857 63050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 63050 64177 gene locus_tag LOCUS_02680 63050 64177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 64210 65418 gene locus_tag LOCUS_02690 64210 65418 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405138.1 protein_id gnl|my_center|LOCUS_02690 65497 65943 gene locus_tag LOCUS_02700 65497 65943 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_02700 67260 66019 gene locus_tag LOCUS_02710 gene hom 67260 66019 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831S8 protein_id gnl|my_center|LOCUS_02710 68886 67957 gene locus_tag LOCUS_02720 68886 67957 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 70043 69081 gene locus_tag LOCUS_02730 70043 69081 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_02730 71634 70237 gene locus_tag LOCUS_02740 71634 70237 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_02740 72592 71756 gene locus_tag LOCUS_02750 72592 71756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 73654 72746 gene locus_tag LOCUS_02760 gene gldA 73654 72746 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_02760 74063 73809 gene locus_tag LOCUS_02770 74063 73809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 75935 74106 gene locus_tag LOCUS_02780 75935 74106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 80916 76018 gene locus_tag LOCUS_02790 80916 76018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 81393 81019 gene locus_tag LOCUS_02800 81393 81019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_02800 81646 83742 gene locus_tag LOCUS_02810 81646 83742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 83849 84958 gene locus_tag LOCUS_02820 83849 84958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 84961 85659 gene locus_tag LOCUS_02830 84961 85659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 87284 85671 gene locus_tag LOCUS_02840 87284 85671 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_02840 87458 88384 gene locus_tag LOCUS_02850 87458 88384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_02850 88557 92588 gene locus_tag LOCUS_02860 88557 92588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 93626 93081 gene locus_tag LOCUS_02870 93626 93081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 94349 93714 gene locus_tag LOCUS_02880 94349 93714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 96631 94427 gene locus_tag LOCUS_02890 96631 94427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 97241 96873 gene locus_tag LOCUS_02900 97241 96873 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_02900 99414 97480 gene locus_tag LOCUS_02910 99414 97480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 99949 99428 gene locus_tag LOCUS_02920 99949 99428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 101478 100264 gene locus_tag LOCUS_02930 101478 100264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 107418 101491 gene locus_tag LOCUS_02940 107418 101491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 110318 107439 gene locus_tag LOCUS_02950 110318 107439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 111670 110396 gene locus_tag LOCUS_02960 111670 110396 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_02960 112371 111811 gene locus_tag LOCUS_02970 112371 111811 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_02970 112756 113064 gene locus_tag LOCUS_02980 112756 113064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_02980 113214 113288 gene locus_tag LOCUS_t00050 113214 113288 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 113313 113397 gene locus_tag LOCUS_t00060 113313 113397 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 113409 113482 gene locus_tag LOCUS_t00070 113409 113482 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 113542 113614 gene locus_tag LOCUS_t00080 113542 113614 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 113727 114914 gene locus_tag LOCUS_02990 gene tuf 113727 114914 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_02990 114997 115070 gene locus_tag LOCUS_t00090 114997 115070 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 115145 115327 gene locus_tag LOCUS_03000 115145 115327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 115376 115921 gene locus_tag LOCUS_03010 gene nusG 115376 115921 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_03010 115936 116388 gene locus_tag LOCUS_03020 gene rplK 115936 116388 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_03020 116485 117177 gene locus_tag LOCUS_03030 gene rplA 116485 117177 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_03030 117215 117748 gene locus_tag LOCUS_03040 gene rplJ 117215 117748 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_03040 117822 118199 gene locus_tag LOCUS_03050 gene rplL 117822 118199 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ6 protein_id gnl|my_center|LOCUS_03050 118384 122211 gene locus_tag LOCUS_03060 gene rpoB 118384 122211 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_03060 122348 126625 gene locus_tag LOCUS_03070 gene rpoC 122348 126625 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_03070 127225 126911 gene locus_tag LOCUS_03080 127225 126911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_03080 127692 127826 gene locus_tag LOCUS_03090 127692 127826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence004 230 1084 gene locus_tag LOCUS_03100 230 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3375 1207 gene locus_tag LOCUS_03110 3375 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3901 3464 gene locus_tag LOCUS_03120 3901 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5720 4275 gene locus_tag LOCUS_03130 5720 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 6034 8220 gene locus_tag LOCUS_03140 6034 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 8536 11193 gene locus_tag LOCUS_03150 8536 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 11591 11391 gene locus_tag LOCUS_03160 11591 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 13135 11744 gene locus_tag LOCUS_03170 13135 11744 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_03170 13754 13305 gene locus_tag LOCUS_03180 13754 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 15004 14123 gene locus_tag LOCUS_03190 gene sucD 15004 14123 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_03190 15516 15196 gene locus_tag LOCUS_03200 15516 15196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 17035 15596 gene locus_tag LOCUS_03210 17035 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 19451 17280 gene locus_tag LOCUS_03220 19451 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 20260 19631 gene locus_tag LOCUS_03230 20260 19631 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_03230 21782 20343 gene locus_tag LOCUS_03240 21782 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 22785 22072 gene locus_tag LOCUS_03250 22785 22072 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_03250 24294 22852 gene locus_tag LOCUS_03260 24294 22852 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_03260 24489 25223 gene locus_tag LOCUS_03270 24489 25223 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_03270 25266 29384 gene locus_tag LOCUS_03280 25266 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 29535 31124 gene locus_tag LOCUS_03290 29535 31124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 31284 32387 gene locus_tag LOCUS_03300 31284 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 32426 33739 gene locus_tag LOCUS_03310 32426 33739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 34045 35115 gene locus_tag LOCUS_03320 34045 35115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 35151 36530 gene locus_tag LOCUS_03330 35151 36530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 36521 36712 gene locus_tag LOCUS_03340 36521 36712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 38424 36721 gene locus_tag LOCUS_03350 38424 36721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 38653 39432 gene locus_tag LOCUS_03360 38653 39432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 41190 39538 gene locus_tag LOCUS_03370 41190 39538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 45193 41219 gene locus_tag LOCUS_03380 45193 41219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 45968 45408 gene locus_tag LOCUS_03390 45968 45408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 46961 46014 gene locus_tag LOCUS_03400 46961 46014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 48087 47017 gene locus_tag LOCUS_03410 48087 47017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 48879 48262 gene locus_tag LOCUS_03420 48879 48262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 49676 49029 gene locus_tag LOCUS_03430 gene citB 49676 49029 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_03430 51637 49688 gene locus_tag LOCUS_03440 51637 49688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 51804 53984 gene locus_tag LOCUS_03450 51804 53984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 53995 54309 gene locus_tag LOCUS_03460 53995 54309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 54343 55170 gene locus_tag LOCUS_03470 54343 55170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 55224 56150 gene locus_tag LOCUS_03480 55224 56150 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992754.1 protein_id gnl|my_center|LOCUS_03480 56269 57429 gene locus_tag LOCUS_03490 56269 57429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 57582 58370 gene locus_tag LOCUS_03500 57582 58370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 58351 59169 gene locus_tag LOCUS_03510 58351 59169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_03510 59239 60552 gene locus_tag LOCUS_03520 59239 60552 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058547.1 protein_id gnl|my_center|LOCUS_03520 60564 61130 gene locus_tag LOCUS_03530 60564 61130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 61139 61798 gene locus_tag LOCUS_03540 61139 61798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 61983 62822 gene locus_tag LOCUS_03550 61983 62822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 64139 62904 gene locus_tag LOCUS_03560 64139 62904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 64486 65736 gene locus_tag LOCUS_03570 64486 65736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 65986 66168 gene locus_tag LOCUS_03580 65986 66168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 66765 67412 gene locus_tag LOCUS_03590 66765 67412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 68716 67559 gene locus_tag LOCUS_03600 68716 67559 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_03600 69927 68851 gene locus_tag LOCUS_03610 69927 68851 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_03610 70052 70597 gene locus_tag LOCUS_03620 70052 70597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 71651 70692 gene locus_tag LOCUS_03630 gene serA 71651 70692 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_03630 73444 71747 gene locus_tag LOCUS_03640 73444 71747 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_03640 74390 73581 gene locus_tag LOCUS_03650 74390 73581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 74581 75054 gene locus_tag LOCUS_03660 74581 75054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 75205 76164 gene locus_tag LOCUS_03670 gene accA 75205 76164 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_03670 76235 76771 gene locus_tag LOCUS_03680 76235 76771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 76803 77690 gene locus_tag LOCUS_03690 gene dapA 76803 77690 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_03690 77963 78298 gene locus_tag LOCUS_03700 77963 78298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 78313 78807 gene locus_tag LOCUS_03710 78313 78807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 80224 78863 gene locus_tag LOCUS_03720 gene gltP 80224 78863 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_03720 80568 81131 gene locus_tag LOCUS_03730 80568 81131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 81100 82050 gene locus_tag LOCUS_03740 81100 82050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 82480 83058 gene locus_tag LOCUS_03750 82480 83058 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_03750 83139 84749 gene locus_tag LOCUS_03760 83139 84749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 85572 86150 gene locus_tag LOCUS_03770 85572 86150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 86202 86753 gene locus_tag LOCUS_03780 86202 86753 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_03780 86737 88749 gene locus_tag LOCUS_03790 86737 88749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 89843 88980 gene locus_tag LOCUS_03800 gene lgt 89843 88980 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_03800 90000 90869 gene locus_tag LOCUS_03810 90000 90869 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_03810 91243 90866 gene locus_tag LOCUS_03820 91243 90866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 91770 94238 gene locus_tag LOCUS_03830 91770 94238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 94429 94836 gene locus_tag LOCUS_03840 94429 94836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 94858 95454 gene locus_tag LOCUS_03850 94858 95454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_03850 95473 96228 gene locus_tag LOCUS_03860 gene yjfH 95473 96228 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_03860 96324 97076 gene locus_tag LOCUS_03870 96324 97076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 97246 98298 gene locus_tag LOCUS_03880 97246 98298 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_03880 98309 98566 gene locus_tag LOCUS_03890 98309 98566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 98674 99345 gene locus_tag LOCUS_03900 98674 99345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 100320 99517 gene locus_tag LOCUS_03910 100320 99517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 100826 100365 gene locus_tag LOCUS_03920 gene ybeY 100826 100365 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_03920 101320 100913 gene locus_tag LOCUS_03930 101320 100913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 104914 101519 gene locus_tag LOCUS_03940 104914 101519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 105649 105197 gene locus_tag LOCUS_03950 105649 105197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 106244 105804 gene locus_tag LOCUS_03960 106244 105804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 109390 106388 gene locus_tag LOCUS_03970 109390 106388 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_03970 109397 109576 gene locus_tag LOCUS_03980 109397 109576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 110194 110766 gene locus_tag LOCUS_03990 110194 110766 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_03990 110884 112365 gene locus_tag LOCUS_04000 110884 112365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 113731 112454 gene locus_tag LOCUS_04010 113731 112454 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804038.1 protein_id gnl|my_center|LOCUS_04010 114142 115668 gene locus_tag LOCUS_04020 114142 115668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011244.1 protein_id gnl|my_center|LOCUS_04020 116703 117230 gene locus_tag LOCUS_04030 gene yneN 116703 117230 CDS product thioredoxin-like protein YneN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31820 protein_id gnl|my_center|LOCUS_04030 117643 117245 gene locus_tag LOCUS_04040 117643 117245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 118483 117686 gene locus_tag LOCUS_04050 118483 117686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 119356 118619 gene locus_tag LOCUS_04060 119356 118619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 119554 120147 gene locus_tag LOCUS_04070 119554 120147 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_04070 120180 121097 gene locus_tag LOCUS_04080 120180 121097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence005 4859 141 gene locus_tag LOCUS_04090 4859 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5837 5130 gene locus_tag LOCUS_04100 5837 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6099 7520 gene locus_tag LOCUS_04110 6099 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8038 7499 gene locus_tag LOCUS_04120 8038 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8051 8980 gene locus_tag LOCUS_04130 8051 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9469 9068 gene locus_tag LOCUS_04140 9469 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11849 9783 gene locus_tag LOCUS_04150 gene feoB 11849 9783 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_04150 12094 11840 gene locus_tag LOCUS_04160 12094 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 12823 12329 gene locus_tag LOCUS_04170 12823 12329 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_04170 13883 12852 gene locus_tag LOCUS_04180 13883 12852 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249793.1 protein_id gnl|my_center|LOCUS_04180 14520 13867 gene locus_tag LOCUS_04190 gene arsC 14520 13867 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_04190 14910 14569 gene locus_tag LOCUS_04200 14910 14569 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_04200 15323 14913 gene locus_tag LOCUS_04210 15323 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 16089 15565 gene locus_tag LOCUS_04220 16089 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 17488 16253 gene locus_tag LOCUS_04230 17488 16253 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_04230 19222 17564 gene locus_tag LOCUS_04240 19222 17564 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_04240 19702 19280 gene locus_tag LOCUS_04250 19702 19280 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_04250 20576 19770 gene locus_tag LOCUS_04260 20576 19770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 22337 20907 gene locus_tag LOCUS_04270 22337 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 24644 22401 gene locus_tag LOCUS_04280 24644 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 25993 24968 gene locus_tag LOCUS_04290 25993 24968 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_04290 27097 26006 gene locus_tag LOCUS_04300 27097 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 27211 27942 gene locus_tag LOCUS_04310 27211 27942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 27950 31378 gene locus_tag LOCUS_04320 27950 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 31649 32107 gene locus_tag LOCUS_04330 31649 32107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 34582 32192 gene locus_tag LOCUS_04340 34582 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 34928 36460 gene locus_tag LOCUS_04350 gene atpD 34928 36460 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_04350 36579 36848 gene locus_tag LOCUS_04360 36579 36848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_04360 37281 37667 gene locus_tag LOCUS_04370 37281 37667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 37907 38593 gene locus_tag LOCUS_04380 37907 38593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 39693 38590 gene locus_tag LOCUS_04390 gene fjo29 39693 38590 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_04390 40570 42357 gene locus_tag LOCUS_04400 40570 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 42438 42818 gene locus_tag LOCUS_04410 42438 42818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 42839 43936 gene locus_tag LOCUS_04420 42839 43936 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_04420 43940 44731 gene locus_tag LOCUS_04430 43940 44731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_04430 45293 44976 gene locus_tag LOCUS_04440 45293 44976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 45979 45296 gene locus_tag LOCUS_04450 45979 45296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 46288 48081 gene locus_tag LOCUS_04460 46288 48081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 50567 48153 gene locus_tag LOCUS_04470 50567 48153 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_04470 51252 50695 gene locus_tag LOCUS_04480 51252 50695 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693800.1 protein_id gnl|my_center|LOCUS_04480 51722 51351 gene locus_tag LOCUS_04490 51722 51351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 52377 51997 gene locus_tag LOCUS_04500 52377 51997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 52819 52463 gene locus_tag LOCUS_04510 52819 52463 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_04510 53826 53110 gene locus_tag LOCUS_04520 gene radC 53826 53110 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_04520 54197 56608 gene locus_tag LOCUS_04530 54197 56608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 56701 57162 gene locus_tag LOCUS_04540 56701 57162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 60477 57253 gene locus_tag LOCUS_04550 60477 57253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 65524 61724 gene locus_tag LOCUS_04560 65524 61724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 66102 67532 gene locus_tag LOCUS_04570 66102 67532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 69336 67537 gene locus_tag LOCUS_04580 69336 67537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 69537 70964 gene locus_tag LOCUS_04590 69537 70964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 70990 72147 gene locus_tag LOCUS_04600 70990 72147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 72353 72790 gene locus_tag LOCUS_04610 72353 72790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 73122 73496 gene locus_tag LOCUS_04620 73122 73496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 76837 73916 gene locus_tag LOCUS_04630 76837 73916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 77117 77887 gene locus_tag LOCUS_04640 gene lgtF 77117 77887 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_04640 78626 77895 gene locus_tag LOCUS_04650 78626 77895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 78867 79892 gene locus_tag LOCUS_04660 gene ruvB 78867 79892 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M0 protein_id gnl|my_center|LOCUS_04660 80008 80664 gene locus_tag LOCUS_04670 80008 80664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 80698 81321 gene locus_tag LOCUS_04680 80698 81321 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_04680 82424 81723 gene locus_tag LOCUS_04690 82424 81723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 83696 82680 gene locus_tag LOCUS_04700 gene yedA 83696 82680 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212270.1 protein_id gnl|my_center|LOCUS_04700 85864 83906 gene locus_tag LOCUS_04710 gene dnaG 85864 83906 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_04710 86789 87856 gene locus_tag LOCUS_04720 86789 87856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_04720 87843 88424 gene locus_tag LOCUS_04730 87843 88424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 89928 88855 gene locus_tag LOCUS_04740 89928 88855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 90923 90102 gene locus_tag LOCUS_04750 gene dapD 90923 90102 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_04750 91905 90997 gene locus_tag LOCUS_04760 91905 90997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 92254 93201 gene locus_tag LOCUS_04770 gene kpsF 92254 93201 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_04770 94803 93319 gene locus_tag LOCUS_04780 gene rtcB 94803 93319 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X178 protein_id gnl|my_center|LOCUS_04780 95339 96199 gene locus_tag LOCUS_04790 95339 96199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_04790 98573 96228 gene locus_tag LOCUS_04800 98573 96228 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_04800 99565 98687 gene locus_tag LOCUS_04810 99565 98687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 100591 99704 gene locus_tag LOCUS_04820 100591 99704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 101683 100718 gene locus_tag LOCUS_04830 101683 100718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 102699 102010 gene locus_tag LOCUS_04840 102699 102010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 103316 102723 gene locus_tag LOCUS_04850 103316 102723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 103665 104477 gene locus_tag LOCUS_04860 gene kdsA 103665 104477 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE91 protein_id gnl|my_center|LOCUS_04860 104704 105330 gene locus_tag LOCUS_04870 104704 105330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 106299 105661 gene locus_tag LOCUS_04880 106299 105661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 106826 106572 gene locus_tag LOCUS_04890 106826 106572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 106744 108585 gene locus_tag LOCUS_04900 106744 108585 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_04900 108621 110348 gene locus_tag LOCUS_04910 108621 110348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 110459 111643 gene locus_tag LOCUS_04920 gene trzA 110459 111643 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_04920 111810 112793 gene locus_tag LOCUS_04930 111810 112793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 113914 112877 gene locus_tag LOCUS_04940 113914 112877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_04940 115147 114044 gene locus_tag LOCUS_04950 115147 114044 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAA2 protein_id gnl|my_center|LOCUS_04950 115943 115206 gene locus_tag LOCUS_04960 115943 115206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 116942 116019 gene locus_tag LOCUS_04970 116942 116019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 118039 117050 gene locus_tag LOCUS_04980 118039 117050 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence006 578 102 gene locus_tag LOCUS_04990 578 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4606 707 gene locus_tag LOCUS_05000 4606 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5302 7773 gene locus_tag LOCUS_05010 5302 7773 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_05010 9090 8086 gene locus_tag LOCUS_05020 9090 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 10885 9218 gene locus_tag LOCUS_05030 gene fhs 10885 9218 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J047 protein_id gnl|my_center|LOCUS_05030 12258 11014 gene locus_tag LOCUS_05040 12258 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_05040 12520 14112 gene locus_tag LOCUS_05050 12520 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 14266 14916 gene locus_tag LOCUS_05060 14266 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 15160 15738 gene locus_tag LOCUS_05070 15160 15738 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_05070 16054 15725 gene locus_tag LOCUS_05080 16054 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 16246 16662 gene locus_tag LOCUS_05090 16246 16662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 16780 18165 gene locus_tag LOCUS_05100 16780 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 18252 19793 gene locus_tag LOCUS_05110 gene pccB 18252 19793 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_05110 20454 19939 gene locus_tag LOCUS_05120 20454 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 20987 20475 gene locus_tag LOCUS_05130 20987 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 21238 22071 gene locus_tag LOCUS_05140 21238 22071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 22173 23228 gene locus_tag LOCUS_05150 22173 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795935.1 protein_id gnl|my_center|LOCUS_05150 24890 23430 gene locus_tag LOCUS_05160 gene rtcB 24890 23430 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7R9 protein_id gnl|my_center|LOCUS_05160 27334 24944 gene locus_tag LOCUS_05170 27334 24944 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_05170 30188 27573 gene locus_tag LOCUS_05180 30188 27573 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108893.1 protein_id gnl|my_center|LOCUS_05180 32332 30434 gene locus_tag LOCUS_05190 32332 30434 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_05190 32450 36160 gene locus_tag LOCUS_05200 32450 36160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 36624 36157 gene locus_tag LOCUS_05210 36624 36157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 36856 37896 gene locus_tag LOCUS_05220 36856 37896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 38042 39973 gene locus_tag LOCUS_05230 38042 39973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 41289 40126 gene locus_tag LOCUS_05240 41289 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 42624 41386 gene locus_tag LOCUS_05250 42624 41386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 44543 42882 gene locus_tag LOCUS_05260 44543 42882 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_05260 44608 46077 gene locus_tag LOCUS_05270 44608 46077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 48352 46184 gene locus_tag LOCUS_05280 48352 46184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 48669 50519 gene locus_tag LOCUS_05290 48669 50519 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203287.1 protein_id gnl|my_center|LOCUS_05290 51062 50541 gene locus_tag LOCUS_05300 51062 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 53189 51186 gene locus_tag LOCUS_05310 53189 51186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 53752 55401 gene locus_tag LOCUS_05320 53752 55401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 57165 55492 gene locus_tag LOCUS_05330 57165 55492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 57647 57255 gene locus_tag LOCUS_05340 57647 57255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 58022 58939 gene locus_tag LOCUS_05350 58022 58939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 59251 59658 gene locus_tag LOCUS_05360 59251 59658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 60660 59740 gene locus_tag LOCUS_05370 gene phuW 60660 59740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_05370 61543 60785 gene locus_tag LOCUS_05380 61543 60785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 61889 64552 gene locus_tag LOCUS_05390 gene gyrA 61889 64552 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_05390 64784 66145 gene locus_tag LOCUS_05400 64784 66145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 66709 66401 gene locus_tag LOCUS_05410 66709 66401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 68182 66716 gene locus_tag LOCUS_05420 68182 66716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 68847 68539 gene locus_tag LOCUS_05430 68847 68539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 69760 68888 gene locus_tag LOCUS_05440 gene dhaA 69760 68888 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_05440 69858 71099 gene locus_tag LOCUS_05450 69858 71099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 72485 71100 gene locus_tag LOCUS_05460 72485 71100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 73576 72647 gene locus_tag LOCUS_05470 73576 72647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_05470 74265 73672 gene locus_tag LOCUS_05480 74265 73672 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963700.1 protein_id gnl|my_center|LOCUS_05480 76194 74593 gene locus_tag LOCUS_05490 76194 74593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 76920 76216 gene locus_tag LOCUS_05500 gene yoxD 76920 76216 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_05500 77798 77037 gene locus_tag LOCUS_05510 77798 77037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 80205 77878 gene locus_tag LOCUS_05520 80205 77878 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_05520 82163 80355 gene locus_tag LOCUS_05530 82163 80355 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_05530 82851 82405 gene locus_tag LOCUS_05540 82851 82405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 83017 83580 gene locus_tag LOCUS_05550 83017 83580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 84884 83889 gene locus_tag LOCUS_05560 84884 83889 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_05560 85351 87600 gene locus_tag LOCUS_05570 85351 87600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 88809 87796 gene locus_tag LOCUS_05580 88809 87796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 90050 88824 gene locus_tag LOCUS_05590 90050 88824 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_05590 90542 90081 gene locus_tag LOCUS_05600 90542 90081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 93290 90693 gene locus_tag LOCUS_05610 gene mutS 93290 90693 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_05610 93979 93545 gene locus_tag LOCUS_05620 93979 93545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 94434 94075 gene locus_tag LOCUS_05630 94434 94075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 94661 95647 gene locus_tag LOCUS_05640 94661 95647 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_05640 96441 95740 gene locus_tag LOCUS_05650 gene dapB 96441 95740 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_05650 97548 96613 gene locus_tag LOCUS_05660 97548 96613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 98338 97562 gene locus_tag LOCUS_05670 98338 97562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 100102 98471 gene locus_tag LOCUS_05680 gene pruA 100102 98471 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_05680 100243 100494 gene locus_tag LOCUS_05690 100243 100494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 100720 101259 gene locus_tag LOCUS_05700 100720 101259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 101450 102709 gene locus_tag LOCUS_05710 101450 102709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 103504 102701 gene locus_tag LOCUS_05720 103504 102701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 104374 103631 gene locus_tag LOCUS_05730 104374 103631 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_05730 105100 104498 gene locus_tag LOCUS_05740 105100 104498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 105615 105133 gene locus_tag LOCUS_05750 105615 105133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 106019 107134 gene locus_tag LOCUS_05760 106019 107134 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_05760 107487 108842 gene locus_tag LOCUS_05770 107487 108842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 108953 109465 gene locus_tag LOCUS_05780 108953 109465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 109472 110014 gene locus_tag LOCUS_05790 109472 110014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 110016 110468 gene locus_tag LOCUS_05800 110016 110468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 110506 111414 gene locus_tag LOCUS_05810 110506 111414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 111463 111993 gene locus_tag LOCUS_05820 111463 111993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 112054 112635 gene locus_tag LOCUS_05830 112054 112635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 112651 113838 gene locus_tag LOCUS_05840 112651 113838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 114550 113804 gene locus_tag LOCUS_05850 114550 113804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 114743 114669 gene locus_tag LOCUS_t00100 114743 114669 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 117150 115153 gene locus_tag LOCUS_05860 gene yidC 117150 115153 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_05860 >Feature sequence007 244 666 gene locus_tag LOCUS_05870 244 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 953 1726 gene locus_tag LOCUS_05880 953 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1928 3055 gene locus_tag LOCUS_05890 1928 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3669 3163 gene locus_tag LOCUS_05900 3669 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3911 3699 gene locus_tag LOCUS_05910 3911 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5245 4211 gene locus_tag LOCUS_05920 5245 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6279 5242 gene locus_tag LOCUS_05930 6279 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7200 6382 gene locus_tag LOCUS_05940 7200 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 8273 7311 gene locus_tag LOCUS_05950 8273 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9313 8306 gene locus_tag LOCUS_05960 gene fjo19 9313 8306 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_05960 9820 9410 gene locus_tag LOCUS_05970 9820 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 10111 11316 gene locus_tag LOCUS_05980 gene fadA 10111 11316 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_05980 11450 13615 gene locus_tag LOCUS_05990 11450 13615 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_05990 14923 13850 gene locus_tag LOCUS_06000 gene aroC 14923 13850 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PP7 protein_id gnl|my_center|LOCUS_06000 15095 15823 gene locus_tag LOCUS_06010 gene mapB 15095 15823 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_06010 15841 16284 gene locus_tag LOCUS_06020 15841 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 17328 16348 gene locus_tag LOCUS_06030 17328 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 18786 17365 gene locus_tag LOCUS_06040 18786 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 19354 18818 gene locus_tag LOCUS_06050 19354 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895507.1 protein_id gnl|my_center|LOCUS_06050 19845 20870 gene locus_tag LOCUS_06060 gene ltaE 19845 20870 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_06060 20875 21786 gene locus_tag LOCUS_06070 20875 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 21798 22445 gene locus_tag LOCUS_06080 21798 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 22464 22949 gene locus_tag LOCUS_06090 22464 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 23090 24238 gene locus_tag LOCUS_06100 23090 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 25619 24318 gene locus_tag LOCUS_06110 25619 24318 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_06110 25819 27327 gene locus_tag LOCUS_06120 gene cysS 25819 27327 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_06120 27556 28893 gene locus_tag LOCUS_06130 gene argH 27556 28893 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_06130 28968 29936 gene locus_tag LOCUS_06140 28968 29936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 30151 30879 gene locus_tag LOCUS_06150 30151 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 31280 31936 gene locus_tag LOCUS_06160 31280 31936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 31938 32987 gene locus_tag LOCUS_06170 31938 32987 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072682.1 protein_id gnl|my_center|LOCUS_06170 33305 33979 gene locus_tag LOCUS_06180 33305 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 37796 34479 gene locus_tag LOCUS_06190 37796 34479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 38267 37911 gene locus_tag LOCUS_06200 38267 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 38536 39618 gene locus_tag LOCUS_06210 38536 39618 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_06210 39754 40884 gene locus_tag LOCUS_06220 39754 40884 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_06220 40897 41172 gene locus_tag LOCUS_06230 40897 41172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 46834 41603 gene locus_tag LOCUS_06240 46834 41603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 47819 46977 gene locus_tag LOCUS_06250 gene prmA 47819 46977 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_06250 48100 49698 gene locus_tag LOCUS_06260 48100 49698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 49740 50384 gene locus_tag LOCUS_06270 49740 50384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 50437 51378 gene locus_tag LOCUS_06280 50437 51378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 51443 52378 gene locus_tag LOCUS_06290 51443 52378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 52378 53058 gene locus_tag LOCUS_06300 52378 53058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_06300 53536 59904 gene locus_tag LOCUS_06310 53536 59904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 60515 64666 gene locus_tag LOCUS_06320 60515 64666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 65424 70322 gene locus_tag LOCUS_06330 65424 70322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 72250 70448 gene locus_tag LOCUS_06340 72250 70448 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_06340 72527 75313 gene locus_tag LOCUS_06350 72527 75313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_06350 75350 75790 gene locus_tag LOCUS_06360 75350 75790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 77050 76352 gene locus_tag LOCUS_06370 gene nth 77050 76352 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_06370 78049 77177 gene locus_tag LOCUS_06380 78049 77177 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_06380 78524 78898 gene locus_tag LOCUS_06390 78524 78898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 79111 80160 gene locus_tag LOCUS_06400 79111 80160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 80390 80659 gene locus_tag LOCUS_06410 80390 80659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 80649 80954 gene locus_tag LOCUS_06420 80649 80954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 81312 80983 gene locus_tag LOCUS_06430 81312 80983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 81800 81333 gene locus_tag LOCUS_06440 81800 81333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 84390 81934 gene locus_tag LOCUS_06450 84390 81934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 84791 86269 gene locus_tag LOCUS_06460 gene glpK2 84791 86269 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_06460 86295 86768 gene locus_tag LOCUS_06470 86295 86768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 87206 87571 gene locus_tag LOCUS_06480 87206 87571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 88320 87568 gene locus_tag LOCUS_06490 88320 87568 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969328.1 protein_id gnl|my_center|LOCUS_06490 89045 89596 gene locus_tag LOCUS_06500 89045 89596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 90057 89521 gene locus_tag LOCUS_06510 90057 89521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 90238 91206 gene locus_tag LOCUS_06520 90238 91206 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_06520 92292 91318 gene locus_tag LOCUS_06530 92292 91318 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_06530 93337 92387 gene locus_tag LOCUS_06540 93337 92387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 94195 93344 gene locus_tag LOCUS_06550 94195 93344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_06550 94365 96398 gene locus_tag LOCUS_06560 94365 96398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 96741 96448 gene locus_tag LOCUS_06570 96741 96448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 97633 96743 gene locus_tag LOCUS_06580 97633 96743 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_06580 98043 97741 gene locus_tag LOCUS_06590 98043 97741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 98097 98246 gene locus_tag LOCUS_06600 98097 98246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 101763 98323 gene locus_tag LOCUS_06610 101763 98323 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_06610 103015 101834 gene locus_tag LOCUS_06620 103015 101834 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_06620 104460 103069 gene locus_tag LOCUS_06630 104460 103069 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_06630 105097 104474 gene locus_tag LOCUS_06640 105097 104474 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_06640 105624 106187 gene locus_tag LOCUS_06650 105624 106187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 106391 107149 gene locus_tag LOCUS_06660 106391 107149 CDS product N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003782.1 protein_id gnl|my_center|LOCUS_06660 107384 107851 gene locus_tag LOCUS_06670 107384 107851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 107992 108954 gene locus_tag LOCUS_06680 107992 108954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 108980 109435 gene locus_tag LOCUS_06690 108980 109435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 111228 109627 gene locus_tag LOCUS_06700 111228 109627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 112250 111432 gene locus_tag LOCUS_06710 112250 111432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 113561 112344 gene locus_tag LOCUS_06720 113561 112344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 114003 113587 gene locus_tag LOCUS_06730 114003 113587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 115476 114010 gene locus_tag LOCUS_06740 115476 114010 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_06740 116455 115742 gene locus_tag LOCUS_06750 gene pdxJ 116455 115742 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_06750 >Feature sequence008 605 1930 gene locus_tag LOCUS_06760 605 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3399 2017 gene locus_tag LOCUS_06770 gene radA 3399 2017 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_06770 3660 4331 gene locus_tag LOCUS_06780 3660 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4859 4356 gene locus_tag LOCUS_06790 4859 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6838 4949 gene locus_tag LOCUS_06800 6838 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 7652 6930 gene locus_tag LOCUS_06810 7652 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 7927 9276 gene locus_tag LOCUS_06820 7927 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 11636 9360 gene locus_tag LOCUS_06830 gene acn 11636 9360 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_06830 12042 11734 gene locus_tag LOCUS_06840 12042 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 12640 12227 gene locus_tag LOCUS_06850 12640 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 13114 12683 gene locus_tag LOCUS_06860 13114 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 13505 13134 gene locus_tag LOCUS_06870 13505 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 13898 13518 gene locus_tag LOCUS_06880 13898 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 14149 15165 gene locus_tag LOCUS_06890 gene speB 14149 15165 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_06890 15748 15227 gene locus_tag LOCUS_06900 15748 15227 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_06900 15920 16390 gene locus_tag LOCUS_06910 15920 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 16686 17333 gene locus_tag LOCUS_06920 16686 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 17419 17492 gene locus_tag LOCUS_t00110 17419 17492 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17637 19745 gene locus_tag LOCUS_06930 17637 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 19972 20340 gene locus_tag LOCUS_06940 19972 20340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 20394 21875 gene locus_tag LOCUS_06950 gene hsdM 20394 21875 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_06950 21875 23686 gene locus_tag LOCUS_06960 21875 23686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705006.1 protein_id gnl|my_center|LOCUS_06960 23689 25152 gene locus_tag LOCUS_06970 23689 25152 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_06970 25145 26356 gene locus_tag LOCUS_06980 25145 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 26512 28527 gene locus_tag LOCUS_06990 26512 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 29160 28606 gene locus_tag LOCUS_07000 29160 28606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 29343 30218 gene locus_tag LOCUS_07010 29343 30218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 30222 30638 gene locus_tag LOCUS_07020 30222 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 30663 33635 gene locus_tag LOCUS_07030 30663 33635 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_07030 34291 33638 gene locus_tag LOCUS_07040 34291 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 34920 34309 gene locus_tag LOCUS_07050 34920 34309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 35108 36271 gene locus_tag LOCUS_07060 35108 36271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108579.1 protein_id gnl|my_center|LOCUS_07060 36438 37553 gene locus_tag LOCUS_07070 36438 37553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109847.1 protein_id gnl|my_center|LOCUS_07070 37822 41061 gene locus_tag LOCUS_07080 37822 41061 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_07080 41214 41663 gene locus_tag LOCUS_07090 41214 41663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 42515 41721 gene locus_tag LOCUS_07100 gene proC 42515 41721 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_07100 42835 45165 gene locus_tag LOCUS_07110 42835 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 45363 46457 gene locus_tag LOCUS_07120 45363 46457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 46587 47273 gene locus_tag LOCUS_07130 46587 47273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 47360 48733 gene locus_tag LOCUS_07140 gene cry 47360 48733 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_07140 49745 48813 gene locus_tag LOCUS_07150 gene mdh 49745 48813 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_07150 50161 51669 gene locus_tag LOCUS_07160 50161 51669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 51669 53228 gene locus_tag LOCUS_07170 51669 53228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 53374 54939 gene locus_tag LOCUS_07180 53374 54939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 55131 56705 gene locus_tag LOCUS_07190 55131 56705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 56856 57275 gene locus_tag LOCUS_07200 gene ndk 56856 57275 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_07200 59388 57349 gene locus_tag LOCUS_07210 59388 57349 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_07210 60971 59496 gene locus_tag LOCUS_07220 60971 59496 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_07220 61195 61713 gene locus_tag LOCUS_07230 61195 61713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_07230 63019 61769 gene locus_tag LOCUS_07240 gene mnmA 63019 61769 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_07240 63768 63160 gene locus_tag LOCUS_07250 63768 63160 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_07250 63955 64515 gene locus_tag LOCUS_07260 63955 64515 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_07260 64717 65718 gene locus_tag LOCUS_07270 gene fbp 64717 65718 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT2 protein_id gnl|my_center|LOCUS_07270 65729 66292 gene locus_tag LOCUS_07280 65729 66292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 66344 67552 gene locus_tag LOCUS_07290 66344 67552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 69247 67613 gene locus_tag LOCUS_07300 gene lepB 69247 67613 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_07300 70038 69289 gene locus_tag LOCUS_07310 70038 69289 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_07310 70790 70218 gene locus_tag LOCUS_07320 70790 70218 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021421.1 protein_id gnl|my_center|LOCUS_07320 72018 70804 gene locus_tag LOCUS_07330 gene rsmB 72018 70804 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_07330 72808 72071 gene locus_tag LOCUS_07340 72808 72071 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_07340 73587 72910 gene locus_tag LOCUS_07350 73587 72910 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_07350 73635 74888 gene locus_tag LOCUS_07360 gene rocD 73635 74888 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_07360 74961 75677 gene locus_tag LOCUS_07370 74961 75677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 76563 75694 gene locus_tag LOCUS_07380 76563 75694 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_07380 77757 76723 gene locus_tag LOCUS_07390 77757 76723 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_07390 77977 77905 gene locus_tag LOCUS_t00120 77977 77905 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78248 78835 gene locus_tag LOCUS_07400 78248 78835 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_07400 79011 79634 gene locus_tag LOCUS_07410 79011 79634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 79808 80350 gene locus_tag LOCUS_07420 79808 80350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 81963 80473 gene locus_tag LOCUS_07430 gene gapA2 81963 80473 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_07430 82600 82103 gene locus_tag LOCUS_07440 82600 82103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 82715 86467 gene locus_tag LOCUS_07450 82715 86467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 86651 87667 gene locus_tag LOCUS_07460 86651 87667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 87770 88372 gene locus_tag LOCUS_07470 87770 88372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_07470 88479 89069 gene locus_tag LOCUS_07480 88479 89069 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_07480 91026 89152 gene locus_tag LOCUS_07490 91026 89152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 92191 91247 gene locus_tag LOCUS_07500 92191 91247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 92651 92214 gene locus_tag LOCUS_07510 92651 92214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 93491 92835 gene locus_tag LOCUS_07520 93491 92835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 96208 93623 gene locus_tag LOCUS_07530 96208 93623 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_07530 97232 96219 gene locus_tag LOCUS_07540 97232 96219 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_07540 98435 97308 gene locus_tag LOCUS_07550 98435 97308 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_07550 100122 98578 gene locus_tag LOCUS_07560 100122 98578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 101319 100135 gene locus_tag LOCUS_07570 101319 100135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 102308 101643 gene locus_tag LOCUS_07580 102308 101643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 103983 103471 gene locus_tag LOCUS_07590 103983 103471 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_07590 104781 104041 gene locus_tag LOCUS_07600 104781 104041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 105938 104835 gene locus_tag LOCUS_07610 105938 104835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_07610 107074 106031 gene locus_tag LOCUS_07620 gene pepL 107074 106031 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FHS3 protein_id gnl|my_center|LOCUS_07620 107313 107238 gene locus_tag LOCUS_t00130 107313 107238 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 107452 107375 gene locus_tag LOCUS_t00140 107452 107375 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 107707 110415 gene locus_tag LOCUS_07630 107707 110415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence009 399 1352 gene locus_tag LOCUS_07640 399 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2020 1406 gene locus_tag LOCUS_07650 2020 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 5036 2097 gene locus_tag LOCUS_07660 5036 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5186 6577 gene locus_tag LOCUS_07670 5186 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6677 7174 gene locus_tag LOCUS_07680 6677 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7760 7353 gene locus_tag LOCUS_07690 7760 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_07690 9058 7835 gene locus_tag LOCUS_07700 9058 7835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_07700 9986 9117 gene locus_tag LOCUS_07710 9986 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 13000 10064 gene locus_tag LOCUS_07720 13000 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 14524 13232 gene locus_tag LOCUS_07730 gene nusA 14524 13232 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_07730 15039 14551 gene locus_tag LOCUS_07740 gene rimP 15039 14551 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJX5 protein_id gnl|my_center|LOCUS_07740 15403 15882 gene locus_tag LOCUS_07750 gene recX 15403 15882 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_07750 16041 17048 gene locus_tag LOCUS_07760 gene nadA 16041 17048 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_07760 17210 18589 gene locus_tag LOCUS_07770 17210 18589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257660.1 protein_id gnl|my_center|LOCUS_07770 20294 18759 gene locus_tag LOCUS_07780 20294 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435136.1 protein_id gnl|my_center|LOCUS_07780 21853 20459 gene locus_tag LOCUS_07790 21853 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 22057 23112 gene locus_tag LOCUS_07800 22057 23112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 23128 23931 gene locus_tag LOCUS_07810 23128 23931 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_07810 25413 24019 gene locus_tag LOCUS_07820 25413 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 26470 25439 gene locus_tag LOCUS_07830 26470 25439 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_07830 27141 26467 gene locus_tag LOCUS_07840 27141 26467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 30919 27362 gene locus_tag LOCUS_07850 30919 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 31484 31140 gene locus_tag LOCUS_07860 31484 31140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 31573 32814 gene locus_tag LOCUS_07870 31573 32814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097166.1 protein_id gnl|my_center|LOCUS_07870 33737 32862 gene locus_tag LOCUS_07880 33737 32862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 33988 34758 gene locus_tag LOCUS_07890 33988 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_07890 34980 35435 gene locus_tag LOCUS_07900 34980 35435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 36325 35612 gene locus_tag LOCUS_07910 36325 35612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 38979 36418 gene locus_tag LOCUS_07920 38979 36418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 40180 38993 gene locus_tag LOCUS_07930 40180 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 41062 40217 gene locus_tag LOCUS_07940 41062 40217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 41481 41143 gene locus_tag LOCUS_07950 41481 41143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 41789 41580 gene locus_tag LOCUS_07960 41789 41580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 42370 41792 gene locus_tag LOCUS_07970 gene carQ 42370 41792 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083848.1 protein_id gnl|my_center|LOCUS_07970 43382 42540 gene locus_tag LOCUS_07980 gene mscS-2 43382 42540 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_07980 44152 43394 gene locus_tag LOCUS_07990 44152 43394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 44815 44312 gene locus_tag LOCUS_08000 44815 44312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 45105 47492 gene locus_tag LOCUS_08010 45105 47492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 47615 48259 gene locus_tag LOCUS_08020 47615 48259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 48312 49619 gene locus_tag LOCUS_08030 48312 49619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 49780 50448 gene locus_tag LOCUS_08040 49780 50448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 50451 51554 gene locus_tag LOCUS_08050 50451 51554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_08050 51661 52173 gene locus_tag LOCUS_08060 51661 52173 CDS product sugar translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_08060 53059 52262 gene locus_tag LOCUS_08070 53059 52262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 54136 53180 gene locus_tag LOCUS_08080 gene tktC 54136 53180 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_08080 55042 54194 gene locus_tag LOCUS_08090 gene tktA 55042 54194 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_08090 55874 55191 gene locus_tag LOCUS_08100 55874 55191 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_08100 57215 58324 gene locus_tag LOCUS_08110 gene ctaA 57215 58324 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_08110 60540 58471 gene locus_tag LOCUS_08120 gene fusA 60540 58471 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK6 protein_id gnl|my_center|LOCUS_08120 61109 61702 gene locus_tag LOCUS_08130 61109 61702 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_08130 61802 62443 gene locus_tag LOCUS_08140 61802 62443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 63106 62480 gene locus_tag LOCUS_08150 63106 62480 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888318.1 protein_id gnl|my_center|LOCUS_08150 65541 63277 gene locus_tag LOCUS_08160 gene pepN 65541 63277 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_08160 66215 65601 gene locus_tag LOCUS_08170 66215 65601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_08170 66329 66808 gene locus_tag LOCUS_08180 66329 66808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 67874 66918 gene locus_tag LOCUS_08190 gene thrB 67874 66918 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66132 protein_id gnl|my_center|LOCUS_08190 67961 69163 gene locus_tag LOCUS_08200 gene argD 67961 69163 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_08200 69180 70094 gene locus_tag LOCUS_08210 69180 70094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 70334 70083 gene locus_tag LOCUS_08220 70334 70083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 70333 71004 gene locus_tag LOCUS_08230 70333 71004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08230 70998 71630 gene locus_tag LOCUS_08240 gene mtnB 70998 71630 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N3 protein_id gnl|my_center|LOCUS_08240 72682 71705 gene locus_tag LOCUS_08250 72682 71705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 72799 73830 gene locus_tag LOCUS_08260 72799 73830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 73834 74850 gene locus_tag LOCUS_08270 73834 74850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 75531 75983 gene locus_tag LOCUS_08280 75531 75983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 79461 76138 gene locus_tag LOCUS_08290 gene secA 79461 76138 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XF8 protein_id gnl|my_center|LOCUS_08290 80089 80859 gene locus_tag LOCUS_08300 80089 80859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 80905 81315 gene locus_tag LOCUS_08310 gene ygcM 80905 81315 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_08310 81455 82408 gene locus_tag LOCUS_08320 81455 82408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 83817 82426 gene locus_tag LOCUS_08330 83817 82426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 83979 84497 gene locus_tag LOCUS_08340 83979 84497 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_08340 84512 85489 gene locus_tag LOCUS_08350 84512 85489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 85493 85858 gene locus_tag LOCUS_08360 85493 85858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 85860 87896 gene locus_tag LOCUS_08370 85860 87896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 87900 88343 gene locus_tag LOCUS_08380 87900 88343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 89346 88399 gene locus_tag LOCUS_08390 89346 88399 CDS product GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 protein_id gnl|my_center|LOCUS_08390 90415 89618 gene locus_tag LOCUS_08400 90415 89618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 91072 90476 gene locus_tag LOCUS_08410 91072 90476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 91314 94292 gene locus_tag LOCUS_08420 91314 94292 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_08420 94394 94879 gene locus_tag LOCUS_08430 gene bsaA 94394 94879 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_08430 96491 94965 gene locus_tag LOCUS_08440 96491 94965 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_08440 97786 96620 gene locus_tag LOCUS_08450 97786 96620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 98006 99481 gene locus_tag LOCUS_08460 gene proS 98006 99481 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_08460 99746 100990 gene locus_tag LOCUS_08470 99746 100990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 101242 102129 gene locus_tag LOCUS_08480 101242 102129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 102162 103268 gene locus_tag LOCUS_08490 102162 103268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 103275 103589 gene locus_tag LOCUS_08500 103275 103589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 104190 105194 gene locus_tag LOCUS_08510 104190 105194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 105224 106063 gene locus_tag LOCUS_08520 105224 106063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 106248 108974 gene locus_tag LOCUS_08530 106248 108974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 109606 110496 gene locus_tag LOCUS_08540 109606 110496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence010 414 1514 gene locus_tag LOCUS_08550 gene rlmG 414 1514 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ELR4 protein_id gnl|my_center|LOCUS_08550 2238 1636 gene locus_tag LOCUS_08560 2238 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3501 2452 gene locus_tag LOCUS_08570 3501 2452 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_08570 5815 3503 gene locus_tag LOCUS_08580 5815 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6747 5815 gene locus_tag LOCUS_08590 6747 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_08590 6979 7452 gene locus_tag LOCUS_08600 gene rlmH 6979 7452 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_08600 7899 8318 gene locus_tag LOCUS_08610 7899 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8511 10232 gene locus_tag LOCUS_08620 8511 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12303 10390 gene locus_tag LOCUS_08630 12303 10390 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_08630 12497 13924 gene locus_tag LOCUS_08640 12497 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 16628 14013 gene locus_tag LOCUS_08650 16628 14013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 17684 16758 gene locus_tag LOCUS_08660 17684 16758 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_08660 30917 17772 gene locus_tag LOCUS_08670 30917 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 34284 31021 gene locus_tag LOCUS_08680 34284 31021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 35083 34331 gene locus_tag LOCUS_08690 35083 34331 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_08690 35874 35095 gene locus_tag LOCUS_08700 35874 35095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 37320 36247 gene locus_tag LOCUS_08710 37320 36247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 37745 38095 gene locus_tag LOCUS_08720 37745 38095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 38373 38951 gene locus_tag LOCUS_08730 38373 38951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 39019 39966 gene locus_tag LOCUS_08740 gene ribF 39019 39966 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_08740 39970 41109 gene locus_tag LOCUS_08750 39970 41109 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_08750 41122 41463 gene locus_tag LOCUS_08760 41122 41463 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_08760 42071 41481 gene locus_tag LOCUS_08770 42071 41481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 42860 42276 gene locus_tag LOCUS_08780 42860 42276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 43133 43711 gene locus_tag LOCUS_08790 43133 43711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 43918 44418 gene locus_tag LOCUS_08800 43918 44418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 44569 46131 gene locus_tag LOCUS_08810 44569 46131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 49358 46239 gene locus_tag LOCUS_08820 49358 46239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 49781 50737 gene locus_tag LOCUS_08830 49781 50737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 51656 50742 gene locus_tag LOCUS_08840 51656 50742 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_08840 52184 51660 gene locus_tag LOCUS_08850 gene kdsC 52184 51660 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_08850 53336 52209 gene locus_tag LOCUS_08860 53336 52209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 54538 53357 gene locus_tag LOCUS_08870 54538 53357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 60358 54767 gene locus_tag LOCUS_08880 60358 54767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 60971 60408 gene locus_tag LOCUS_08890 60971 60408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 61324 62238 gene locus_tag LOCUS_08900 gene hemF 61324 62238 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_08900 62250 63302 gene locus_tag LOCUS_08910 62250 63302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 63299 63943 gene locus_tag LOCUS_08920 63299 63943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_08920 64447 63956 gene locus_tag LOCUS_08930 64447 63956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 65129 64461 gene locus_tag LOCUS_08940 65129 64461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 66194 65433 gene locus_tag LOCUS_08950 66194 65433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 66456 67181 gene locus_tag LOCUS_08960 66456 67181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 67325 68809 gene locus_tag LOCUS_08970 67325 68809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 69294 70334 gene locus_tag LOCUS_08980 gene asnA 69294 70334 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM4 protein_id gnl|my_center|LOCUS_08980 73317 70441 gene locus_tag LOCUS_08990 73317 70441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 75669 74200 gene locus_tag LOCUS_09000 75669 74200 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_09000 77300 76134 gene locus_tag LOCUS_09010 77300 76134 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_09010 77602 78258 gene locus_tag LOCUS_09020 gene pcm 77602 78258 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_09020 78356 79696 gene locus_tag LOCUS_09030 78356 79696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 81112 79703 gene locus_tag LOCUS_09040 81112 79703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 82027 81257 gene locus_tag LOCUS_09050 82027 81257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 83237 82353 gene locus_tag LOCUS_09060 gene nadK 83237 82353 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_09060 84547 83237 gene locus_tag LOCUS_09070 84547 83237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 85238 84813 gene locus_tag LOCUS_09080 85238 84813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 85711 85280 gene locus_tag LOCUS_09090 85711 85280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 87650 85851 gene locus_tag LOCUS_09100 87650 85851 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_09100 89048 88620 gene locus_tag LOCUS_09110 89048 88620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 90418 89066 gene locus_tag LOCUS_09120 gene murF 90418 89066 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_09120 90629 91396 gene locus_tag LOCUS_09130 gene pcbD 90629 91396 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_09130 91612 94149 gene locus_tag LOCUS_09140 91612 94149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 95414 94260 gene locus_tag LOCUS_09150 gene hmgA 95414 94260 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_09150 96696 95716 gene locus_tag LOCUS_09160 96696 95716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 97026 97472 gene locus_tag LOCUS_09170 97026 97472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 97923 100325 gene locus_tag LOCUS_09180 gene mutS2 97923 100325 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 protein_id gnl|my_center|LOCUS_09180 100346 101026 gene locus_tag LOCUS_09190 100346 101026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 101045 101728 gene locus_tag LOCUS_09200 101045 101728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 102990 101809 gene locus_tag LOCUS_09210 102990 101809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 103219 103752 gene locus_tag LOCUS_09220 103219 103752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_09220 104161 103820 gene locus_tag LOCUS_09230 104161 103820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence011 1112 339 gene locus_tag LOCUS_09240 1112 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1408 1941 gene locus_tag LOCUS_09250 1408 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2015 2710 gene locus_tag LOCUS_09260 2015 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122826.1 protein_id gnl|my_center|LOCUS_09260 4197 2683 gene locus_tag LOCUS_09270 4197 2683 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_09270 4306 6153 gene locus_tag LOCUS_09280 gene mscS1 4306 6153 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_09280 6972 6178 gene locus_tag LOCUS_09290 6972 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 9746 6987 gene locus_tag LOCUS_09300 9746 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 11518 10055 gene locus_tag LOCUS_09310 11518 10055 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107966.1 protein_id gnl|my_center|LOCUS_09310 12223 13317 gene locus_tag LOCUS_09320 12223 13317 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_09320 13545 13472 gene locus_tag LOCUS_t00150 13545 13472 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13863 13772 gene locus_tag LOCUS_t00160 13863 13772 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14079 14005 gene locus_tag LOCUS_t00170 14079 14005 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14229 14155 gene locus_tag LOCUS_t00180 14229 14155 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14733 14647 gene locus_tag LOCUS_t00190 14733 14647 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15167 15091 gene locus_tag LOCUS_t00200 15167 15091 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15332 15259 gene locus_tag LOCUS_t00210 15332 15259 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15524 15449 gene locus_tag LOCUS_t00220 15524 15449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16071 15997 gene locus_tag LOCUS_t00230 16071 15997 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 17034 16819 gene locus_tag LOCUS_09330 17034 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 17474 17400 gene locus_tag LOCUS_t00240 17474 17400 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19990 18215 gene locus_tag LOCUS_09340 19990 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 21498 20101 gene locus_tag LOCUS_09350 21498 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 21989 21519 gene locus_tag LOCUS_09360 21989 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 25389 22540 gene locus_tag LOCUS_09370 25389 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 26592 25642 gene locus_tag LOCUS_09380 26592 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 29029 26594 gene locus_tag LOCUS_09390 29029 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 30209 29079 gene locus_tag LOCUS_09400 30209 29079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 31223 30219 gene locus_tag LOCUS_09410 gene tsaD 31223 30219 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_09410 31574 36460 gene locus_tag LOCUS_09420 31574 36460 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202866.1 protein_id gnl|my_center|LOCUS_09420 36612 38678 gene locus_tag LOCUS_09430 gene ppk 36612 38678 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S51 protein_id gnl|my_center|LOCUS_09430 38725 39756 gene locus_tag LOCUS_09440 gene hemE 38725 39756 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_09440 39967 40494 gene locus_tag LOCUS_09450 39967 40494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 40651 41100 gene locus_tag LOCUS_09460 40651 41100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 41166 42005 gene locus_tag LOCUS_09470 41166 42005 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_09470 42064 42615 gene locus_tag LOCUS_09480 42064 42615 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 protein_id gnl|my_center|LOCUS_09480 42656 43249 gene locus_tag LOCUS_09490 42656 43249 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_09490 43350 44423 gene locus_tag LOCUS_09500 43350 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 44600 47299 gene locus_tag LOCUS_09510 44600 47299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 47417 47707 gene locus_tag LOCUS_09520 47417 47707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 47727 48797 gene locus_tag LOCUS_09530 47727 48797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 48927 49961 gene locus_tag LOCUS_09540 gene mvaD 48927 49961 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_09540 50867 50049 gene locus_tag LOCUS_09550 50867 50049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 51518 50958 gene locus_tag LOCUS_09560 gene scpB 51518 50958 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFR3 protein_id gnl|my_center|LOCUS_09560 51863 52255 gene locus_tag LOCUS_09570 51863 52255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 52336 53124 gene locus_tag LOCUS_09580 52336 53124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_09580 54719 53241 gene locus_tag LOCUS_09590 54719 53241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 54837 56231 gene locus_tag LOCUS_09600 54837 56231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_09600 57557 56421 gene locus_tag LOCUS_09610 57557 56421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 58382 57696 gene locus_tag LOCUS_09620 58382 57696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 59743 58493 gene locus_tag LOCUS_09630 59743 58493 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_09630 59945 60439 gene locus_tag LOCUS_09640 59945 60439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 60636 61778 gene locus_tag LOCUS_09650 60636 61778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 61996 63435 gene locus_tag LOCUS_09660 61996 63435 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_09660 63571 64605 gene locus_tag LOCUS_09670 63571 64605 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_09670 64602 65306 gene locus_tag LOCUS_09680 gene algR 64602 65306 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_09680 65718 65314 gene locus_tag LOCUS_09690 gene msrB 65718 65314 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_09690 66201 65806 gene locus_tag LOCUS_09700 66201 65806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 67290 66382 gene locus_tag LOCUS_09710 67290 66382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 67501 67277 gene locus_tag LOCUS_09720 67501 67277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 67709 67431 gene locus_tag LOCUS_09730 67709 67431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 69032 67731 gene locus_tag LOCUS_09740 69032 67731 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_09740 70722 69094 gene locus_tag LOCUS_09750 70722 69094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 71353 70805 gene locus_tag LOCUS_09760 71353 70805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 72432 71350 gene locus_tag LOCUS_09770 72432 71350 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_09770 74044 72548 gene locus_tag LOCUS_09780 gene miaB 74044 72548 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_09780 74241 76196 gene locus_tag LOCUS_09790 74241 76196 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_09790 76469 78367 gene locus_tag LOCUS_09800 76469 78367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 78963 79541 gene locus_tag LOCUS_09810 78963 79541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 80016 79666 gene locus_tag LOCUS_09820 80016 79666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 80305 81693 gene locus_tag LOCUS_09830 80305 81693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 82442 81720 gene locus_tag LOCUS_09840 82442 81720 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_09840 83508 83912 gene locus_tag LOCUS_09850 83508 83912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 84080 86110 gene locus_tag LOCUS_09860 gene uvrB 84080 86110 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_09860 86234 86890 gene locus_tag LOCUS_09870 86234 86890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 86907 87662 gene locus_tag LOCUS_09880 gene gldF 86907 87662 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_09880 87656 89416 gene locus_tag LOCUS_09890 gene gldG 87656 89416 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_09890 89988 89413 gene locus_tag LOCUS_09900 gene nadD 89988 89413 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_09900 91102 90131 gene locus_tag LOCUS_09910 91102 90131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 91570 91184 gene locus_tag LOCUS_09920 91570 91184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 91922 91542 gene locus_tag LOCUS_09930 gene gcvH 91922 91542 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N36 protein_id gnl|my_center|LOCUS_09930 93076 92159 gene locus_tag LOCUS_09940 93076 92159 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_09940 93635 94249 gene locus_tag LOCUS_09950 gene sodA 93635 94249 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_09950 94455 95219 gene locus_tag LOCUS_09960 94455 95219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 96588 95290 gene locus_tag LOCUS_09970 96588 95290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001976156.1 protein_id gnl|my_center|LOCUS_09970 98329 96632 gene locus_tag LOCUS_09980 98329 96632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 98700 98404 gene locus_tag LOCUS_09990 98700 98404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 99032 98697 gene locus_tag LOCUS_10000 99032 98697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 99366 99046 gene locus_tag LOCUS_10010 99366 99046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 101597 99489 gene locus_tag LOCUS_10020 gene recG 101597 99489 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_10020 101807 102511 gene locus_tag LOCUS_10030 101807 102511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence012 679 224 gene locus_tag LOCUS_10040 679 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2213 780 gene locus_tag LOCUS_10050 2213 780 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_10050 3141 2260 gene locus_tag LOCUS_10060 3141 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4235 3255 gene locus_tag LOCUS_10070 4235 3255 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_10070 4543 6177 gene locus_tag LOCUS_10080 4543 6177 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_10080 6346 7224 gene locus_tag LOCUS_10090 6346 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 7321 8214 gene locus_tag LOCUS_10100 gene udp 7321 8214 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_10100 8398 10347 gene locus_tag LOCUS_10110 8398 10347 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_10110 11467 10478 gene locus_tag LOCUS_10120 gene bioB 11467 10478 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_10120 12282 11782 gene locus_tag LOCUS_10130 12282 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 13101 12349 gene locus_tag LOCUS_10140 13101 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 13616 13104 gene locus_tag LOCUS_10150 13616 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 14150 13842 gene locus_tag LOCUS_10160 14150 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 15286 14162 gene locus_tag LOCUS_10170 15286 14162 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_10170 15541 15999 gene locus_tag LOCUS_10180 15541 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 16754 16047 gene locus_tag LOCUS_10190 16754 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 18249 17041 gene locus_tag LOCUS_10200 18249 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 18963 18334 gene locus_tag LOCUS_10210 18963 18334 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_10210 19659 19057 gene locus_tag LOCUS_10220 19659 19057 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_10220 21224 19794 gene locus_tag LOCUS_10230 21224 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140023.1 protein_id gnl|my_center|LOCUS_10230 22475 21246 gene locus_tag LOCUS_10240 22475 21246 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_10240 24446 22641 gene locus_tag LOCUS_10250 24446 22641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_10250 24536 25201 gene locus_tag LOCUS_10260 24536 25201 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_10260 25564 25286 gene locus_tag LOCUS_10270 25564 25286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 27358 25598 gene locus_tag LOCUS_10280 27358 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 28227 27370 gene locus_tag LOCUS_10290 28227 27370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_10290 29477 28239 gene locus_tag LOCUS_10300 29477 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 33154 29474 gene locus_tag LOCUS_10310 33154 29474 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_10310 33423 33184 gene locus_tag LOCUS_10320 33423 33184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 36036 33625 gene locus_tag LOCUS_10330 36036 33625 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_10330 36714 36154 gene locus_tag LOCUS_10340 36714 36154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 37708 40044 gene locus_tag LOCUS_10350 37708 40044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 40257 41675 gene locus_tag LOCUS_10360 40257 41675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 41689 42453 gene locus_tag LOCUS_10370 41689 42453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 42463 43914 gene locus_tag LOCUS_10380 42463 43914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 44102 44701 gene locus_tag LOCUS_10390 44102 44701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 45401 44826 gene locus_tag LOCUS_10400 45401 44826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_10400 46409 45513 gene locus_tag LOCUS_10410 46409 45513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_10410 46636 49029 gene locus_tag LOCUS_10420 46636 49029 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_10420 49102 49545 gene locus_tag LOCUS_10430 49102 49545 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_10430 49585 50865 gene locus_tag LOCUS_10440 49585 50865 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_10440 50915 51175 gene locus_tag LOCUS_10450 50915 51175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 51172 51756 gene locus_tag LOCUS_10460 51172 51756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 55367 51837 gene locus_tag LOCUS_10470 gene smc 55367 51837 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_10470 55590 56648 gene locus_tag LOCUS_10480 gene fabH2 55590 56648 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_10480 56852 58420 gene locus_tag LOCUS_10490 56852 58420 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_10490 58860 60008 gene locus_tag LOCUS_10500 58860 60008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 61079 60012 gene locus_tag LOCUS_10510 gene phoR 61079 60012 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_10510 61826 61089 gene locus_tag LOCUS_10520 gene phoP 61826 61089 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_10520 63342 61948 gene locus_tag LOCUS_10530 63342 61948 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_10530 63947 63342 gene locus_tag LOCUS_10540 63947 63342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 64369 66330 gene locus_tag LOCUS_10550 64369 66330 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_10550 66686 66426 gene locus_tag LOCUS_10560 66686 66426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 67915 66827 gene locus_tag LOCUS_10570 67915 66827 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_10570 69056 67926 gene locus_tag LOCUS_10580 gene tgt 69056 67926 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_10580 69239 70237 gene locus_tag LOCUS_10590 69239 70237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 70228 70839 gene locus_tag LOCUS_10600 70228 70839 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_10600 70975 71964 gene locus_tag LOCUS_10610 70975 71964 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_10610 72112 74391 gene locus_tag LOCUS_10620 72112 74391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 74933 74478 gene locus_tag LOCUS_10630 74933 74478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 75398 77191 gene locus_tag LOCUS_10640 gene aspS 75398 77191 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCT7 protein_id gnl|my_center|LOCUS_10640 77346 78026 gene locus_tag LOCUS_10650 77346 78026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 78081 79637 gene locus_tag LOCUS_10660 78081 79637 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_10660 79973 80794 gene locus_tag LOCUS_10670 79973 80794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 81612 81043 gene locus_tag LOCUS_10680 81612 81043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 82690 81812 gene locus_tag LOCUS_10690 82690 81812 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_10690 84015 82915 gene locus_tag LOCUS_10700 84015 82915 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P46 protein_id gnl|my_center|LOCUS_10700 84588 84049 gene locus_tag LOCUS_10710 84588 84049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 84811 85914 gene locus_tag LOCUS_10720 84811 85914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 85922 87184 gene locus_tag LOCUS_10730 85922 87184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 87188 88351 gene locus_tag LOCUS_10740 87188 88351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 89036 88353 gene locus_tag LOCUS_10750 89036 88353 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_10750 89330 90145 gene locus_tag LOCUS_10760 89330 90145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140126.1 protein_id gnl|my_center|LOCUS_10760 90932 90231 gene locus_tag LOCUS_10770 gene folE1 90932 90231 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB6 protein_id gnl|my_center|LOCUS_10770 91155 92639 gene locus_tag LOCUS_10780 91155 92639 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_10780 93181 92654 gene locus_tag LOCUS_10790 93181 92654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 95264 93327 gene locus_tag LOCUS_10800 95264 93327 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_10800 95603 97393 gene locus_tag LOCUS_10810 95603 97393 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_10810 97508 97975 gene locus_tag LOCUS_10820 97508 97975 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_10820 97985 98776 gene locus_tag LOCUS_10830 97985 98776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 99826 98897 gene locus_tag LOCUS_10840 99826 98897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 102415 99980 gene locus_tag LOCUS_10850 102415 99980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence013 1 153 gene locus_tag LOCUS_10860 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1209 214 gene locus_tag LOCUS_10870 1209 214 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_10870 2083 1283 gene locus_tag LOCUS_10880 2083 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2256 4403 gene locus_tag LOCUS_10890 2256 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4447 5508 gene locus_tag LOCUS_10900 4447 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7988 5505 gene locus_tag LOCUS_10910 gene fecA 7988 5505 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_10910 8579 8160 gene locus_tag LOCUS_10920 8579 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9710 10633 gene locus_tag LOCUS_10930 9710 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 11017 11985 gene locus_tag LOCUS_10940 11017 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 12927 12232 gene locus_tag LOCUS_10950 gene hddC 12927 12232 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_10950 13609 13037 gene locus_tag LOCUS_10960 gene gmhA 13609 13037 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ4 protein_id gnl|my_center|LOCUS_10960 13806 14525 gene locus_tag LOCUS_10970 13806 14525 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_10970 14712 15671 gene locus_tag LOCUS_10980 14712 15671 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_10980 16865 15726 gene locus_tag LOCUS_10990 16865 15726 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_10990 18078 16963 gene locus_tag LOCUS_11000 18078 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_11000 18347 19255 gene locus_tag LOCUS_11010 18347 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 19335 19838 gene locus_tag LOCUS_11020 19335 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 20424 21194 gene locus_tag LOCUS_11030 20424 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 22808 21321 gene locus_tag LOCUS_11040 gene hutH1 22808 21321 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_11040 23037 24653 gene locus_tag LOCUS_11050 gene sulP 23037 24653 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_11050 24888 25538 gene locus_tag LOCUS_11060 gene cynT 24888 25538 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_11060 25745 26170 gene locus_tag LOCUS_11070 25745 26170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 26349 27971 gene locus_tag LOCUS_11080 26349 27971 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122718.1 protein_id gnl|my_center|LOCUS_11080 28108 30591 gene locus_tag LOCUS_11090 28108 30591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 30656 32539 gene locus_tag LOCUS_11100 30656 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 32622 33197 gene locus_tag LOCUS_11110 32622 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 33609 33367 gene locus_tag LOCUS_11120 33609 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 33770 34423 gene locus_tag LOCUS_11130 33770 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 34852 34451 gene locus_tag LOCUS_11140 gene yuxK 34852 34451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_11140 36516 35047 gene locus_tag LOCUS_11150 36516 35047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_11150 36959 37480 gene locus_tag LOCUS_11160 36959 37480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 37865 39073 gene locus_tag LOCUS_11170 37865 39073 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_11170 39282 40145 gene locus_tag LOCUS_11180 39282 40145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 40193 41884 gene locus_tag LOCUS_11190 gene ggt 40193 41884 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_11190 42438 42827 gene locus_tag LOCUS_11200 gene ytxJ 42438 42827 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_11200 44175 42904 gene locus_tag LOCUS_11210 gene nqrF 44175 42904 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_11210 44878 44270 gene locus_tag LOCUS_11220 gene nqrE 44878 44270 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHJ7 protein_id gnl|my_center|LOCUS_11220 45579 44917 gene locus_tag LOCUS_11230 gene nqrD 45579 44917 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_11230 46401 45613 gene locus_tag LOCUS_11240 gene nqrC 46401 45613 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_11240 47680 46385 gene locus_tag LOCUS_11250 gene nqrB 47680 46385 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M4 protein_id gnl|my_center|LOCUS_11250 49372 47735 gene locus_tag LOCUS_11260 gene nqrA 49372 47735 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_11260 51765 49651 gene locus_tag LOCUS_11270 51765 49651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 53972 51852 gene locus_tag LOCUS_11280 gene pepX1 53972 51852 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_11280 54410 54820 gene locus_tag LOCUS_11290 54410 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 54991 56634 gene locus_tag LOCUS_11300 54991 56634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_11300 56769 59840 gene locus_tag LOCUS_11310 56769 59840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 60219 62558 gene locus_tag LOCUS_11320 60219 62558 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962187.1 protein_id gnl|my_center|LOCUS_11320 63236 65356 gene locus_tag LOCUS_11330 63236 65356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 65505 67238 gene locus_tag LOCUS_11340 65505 67238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 67242 67637 gene locus_tag LOCUS_11350 67242 67637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 68045 68353 gene locus_tag LOCUS_11360 gene yqjZ 68045 68353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_11360 68858 68445 gene locus_tag LOCUS_11370 68858 68445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 69115 70548 gene locus_tag LOCUS_11380 gene pykA 69115 70548 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_11380 70607 71275 gene locus_tag LOCUS_11390 70607 71275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 72096 71311 gene locus_tag LOCUS_11400 72096 71311 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_11400 73228 72107 gene locus_tag LOCUS_11410 73228 72107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_11410 73812 73282 gene locus_tag LOCUS_11420 gene mtnD 73812 73282 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN79 protein_id gnl|my_center|LOCUS_11420 74229 73927 gene locus_tag LOCUS_11430 74229 73927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_11430 74601 76721 gene locus_tag LOCUS_11440 74601 76721 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_11440 78003 76777 gene locus_tag LOCUS_11450 78003 76777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 78239 79615 gene locus_tag LOCUS_11460 78239 79615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 79790 79987 gene locus_tag LOCUS_11470 79790 79987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 80100 83504 gene locus_tag LOCUS_11480 80100 83504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 83869 85665 gene locus_tag LOCUS_11490 83869 85665 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_11490 85890 88928 gene locus_tag LOCUS_11500 85890 88928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_11500 89129 89260 gene locus_tag LOCUS_11510 89129 89260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 90876 89509 gene locus_tag LOCUS_11520 90876 89509 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_11520 91909 91160 gene locus_tag LOCUS_11530 91909 91160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 93264 92113 gene locus_tag LOCUS_11540 93264 92113 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_11540 93429 94793 gene locus_tag LOCUS_11550 93429 94793 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551092.1 protein_id gnl|my_center|LOCUS_11550 94780 96138 gene locus_tag LOCUS_11560 94780 96138 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_11560 96824 96135 gene locus_tag LOCUS_11570 96824 96135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence014 2683 140 gene locus_tag LOCUS_11580 gene clpC 2683 140 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_11580 3146 3541 gene locus_tag LOCUS_11590 3146 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4049 3633 gene locus_tag LOCUS_11600 4049 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4555 15837 gene locus_tag LOCUS_11610 4555 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 15985 16764 gene locus_tag LOCUS_11620 gene map 15985 16764 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_11620 17329 16910 gene locus_tag LOCUS_11630 gene rplS 17329 16910 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_11630 17604 18935 gene locus_tag LOCUS_11640 gene rmuC 17604 18935 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_11640 21545 19002 gene locus_tag LOCUS_11650 21545 19002 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765755.1 protein_id gnl|my_center|LOCUS_11650 22043 22468 gene locus_tag LOCUS_11660 22043 22468 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_11660 22587 24761 gene locus_tag LOCUS_11670 22587 24761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 24857 25813 gene locus_tag LOCUS_11680 24857 25813 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_11680 26072 26581 gene locus_tag LOCUS_11690 26072 26581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_11690 26704 27240 gene locus_tag LOCUS_11700 26704 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 27291 27797 gene locus_tag LOCUS_11710 27291 27797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_11710 30494 27969 gene locus_tag LOCUS_11720 30494 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 30831 32255 gene locus_tag LOCUS_11730 30831 32255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_11730 32647 33939 gene locus_tag LOCUS_11740 32647 33939 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_11740 36253 34670 gene locus_tag LOCUS_11750 36253 34670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 37242 36739 gene locus_tag LOCUS_11760 37242 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 38114 37242 gene locus_tag LOCUS_11770 38114 37242 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_11770 38802 38128 gene locus_tag LOCUS_11780 38802 38128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 38982 39782 gene locus_tag LOCUS_11790 38982 39782 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933727.1 protein_id gnl|my_center|LOCUS_11790 40728 39952 gene locus_tag LOCUS_11800 40728 39952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 41714 40986 gene locus_tag LOCUS_11810 41714 40986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 42871 42065 gene locus_tag LOCUS_11820 42871 42065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 43656 42898 gene locus_tag LOCUS_11830 43656 42898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 43877 45967 gene locus_tag LOCUS_11840 43877 45967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 47506 46358 gene locus_tag LOCUS_11850 47506 46358 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_11850 47861 48568 gene locus_tag LOCUS_11860 47861 48568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 51234 49096 gene locus_tag LOCUS_11870 51234 49096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 51412 52899 gene locus_tag LOCUS_11880 51412 52899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 54557 53034 gene locus_tag LOCUS_11890 54557 53034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 54688 55479 gene locus_tag LOCUS_11900 54688 55479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 55507 56052 gene locus_tag LOCUS_11910 gene rmlC 55507 56052 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_11910 56059 56952 gene locus_tag LOCUS_11920 56059 56952 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_11920 57241 59880 gene locus_tag LOCUS_11930 57241 59880 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476570.1 protein_id gnl|my_center|LOCUS_11930 60104 60481 gene locus_tag LOCUS_11940 60104 60481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 60554 60772 gene locus_tag LOCUS_11950 60554 60772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 60886 61314 gene locus_tag LOCUS_11960 60886 61314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 61323 61895 gene locus_tag LOCUS_11970 61323 61895 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_11970 62595 61900 gene locus_tag LOCUS_11980 62595 61900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 63515 62670 gene locus_tag LOCUS_11990 63515 62670 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_11990 64264 63602 gene locus_tag LOCUS_12000 64264 63602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 64347 64898 gene locus_tag LOCUS_12010 64347 64898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 66561 65155 gene locus_tag LOCUS_12020 66561 65155 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272619.1 protein_id gnl|my_center|LOCUS_12020 67693 66797 gene locus_tag LOCUS_12030 67693 66797 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272620.1 protein_id gnl|my_center|LOCUS_12030 68865 67744 gene locus_tag LOCUS_12040 68865 67744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 69355 68936 gene locus_tag LOCUS_12050 69355 68936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_12050 69732 70949 gene locus_tag LOCUS_12060 69732 70949 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_12060 71666 70953 gene locus_tag LOCUS_12070 71666 70953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 72386 71706 gene locus_tag LOCUS_12080 72386 71706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 73245 72391 gene locus_tag LOCUS_12090 73245 72391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258571.1 protein_id gnl|my_center|LOCUS_12090 73943 73287 gene locus_tag LOCUS_12100 73943 73287 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964844.1 protein_id gnl|my_center|LOCUS_12100 75127 74171 gene locus_tag LOCUS_12110 75127 74171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 75403 75164 gene locus_tag LOCUS_12120 75403 75164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 76382 75381 gene locus_tag LOCUS_12130 76382 75381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 77134 76388 gene locus_tag LOCUS_12140 77134 76388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 78611 77145 gene locus_tag LOCUS_12150 78611 77145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 79936 78941 gene locus_tag LOCUS_12160 79936 78941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 80939 80043 gene locus_tag LOCUS_12170 80939 80043 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807005.1 protein_id gnl|my_center|LOCUS_12170 83819 81324 gene locus_tag LOCUS_12180 83819 81324 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107156.1 protein_id gnl|my_center|LOCUS_12180 85537 84284 gene locus_tag LOCUS_12190 85537 84284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 86185 85568 gene locus_tag LOCUS_12200 gene ychE 86185 85568 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_12200 86951 86193 gene locus_tag LOCUS_12210 86951 86193 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_12210 87832 87059 gene locus_tag LOCUS_12220 87832 87059 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_12220 88541 88026 gene locus_tag LOCUS_12230 88541 88026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 88718 89767 gene locus_tag LOCUS_12240 88718 89767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 89896 91149 gene locus_tag LOCUS_12250 89896 91149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 91149 92027 gene locus_tag LOCUS_12260 91149 92027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_12260 92139 94949 gene locus_tag LOCUS_12270 92139 94949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence015 69 1166 gene locus_tag LOCUS_12280 69 1166 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_12280 1254 1724 gene locus_tag LOCUS_12290 1254 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2767 2108 gene locus_tag LOCUS_12300 2767 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3274 2780 gene locus_tag LOCUS_12310 3274 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 11415 3397 gene locus_tag LOCUS_12320 11415 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11980 13320 gene locus_tag LOCUS_12330 11980 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081499.1 protein_id gnl|my_center|LOCUS_12330 13391 13678 gene locus_tag LOCUS_12340 13391 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 13713 15140 gene locus_tag LOCUS_12350 13713 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 15260 15913 gene locus_tag LOCUS_12360 15260 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 16097 16669 gene locus_tag LOCUS_12370 16097 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 18268 16937 gene locus_tag LOCUS_12380 gene bfmBB 18268 16937 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_12380 19680 18427 gene locus_tag LOCUS_12390 19680 18427 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_12390 20132 21124 gene locus_tag LOCUS_12400 20132 21124 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_12400 21243 22571 gene locus_tag LOCUS_12410 21243 22571 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_12410 22624 23805 gene locus_tag LOCUS_12420 22624 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_12420 23881 24582 gene locus_tag LOCUS_12430 23881 24582 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_12430 25826 24831 gene locus_tag LOCUS_12440 25826 24831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 26467 25916 gene locus_tag LOCUS_12450 26467 25916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 26911 26633 gene locus_tag LOCUS_12460 26911 26633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 27481 26921 gene locus_tag LOCUS_12470 27481 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 28126 27611 gene locus_tag LOCUS_12480 28126 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 28616 28119 gene locus_tag LOCUS_12490 28616 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 33138 28864 gene locus_tag LOCUS_12500 33138 28864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 34625 33192 gene locus_tag LOCUS_12510 gene glcD 34625 33192 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_12510 35059 34784 gene locus_tag LOCUS_12520 35059 34784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 37479 35149 gene locus_tag LOCUS_12530 37479 35149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 38847 37756 gene locus_tag LOCUS_12540 38847 37756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 39407 40087 gene locus_tag LOCUS_12550 39407 40087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 protein_id gnl|my_center|LOCUS_12550 40383 53246 gene locus_tag LOCUS_12560 40383 53246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 53578 54441 gene locus_tag LOCUS_12570 53578 54441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67109 protein_id gnl|my_center|LOCUS_12570 54552 55346 gene locus_tag LOCUS_12580 54552 55346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 55456 56085 gene locus_tag LOCUS_12590 55456 56085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_12590 56367 57197 gene locus_tag LOCUS_12600 56367 57197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 58089 57232 gene locus_tag LOCUS_12610 58089 57232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 59941 58730 gene locus_tag LOCUS_12620 59941 58730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 60920 60123 gene locus_tag LOCUS_12630 60920 60123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 62690 61092 gene locus_tag LOCUS_12640 62690 61092 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 protein_id gnl|my_center|LOCUS_12640 63072 62701 gene locus_tag LOCUS_12650 63072 62701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 64572 63283 gene locus_tag LOCUS_12660 64572 63283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730816.1 protein_id gnl|my_center|LOCUS_12660 65206 64565 gene locus_tag LOCUS_12670 65206 64565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 66205 65267 gene locus_tag LOCUS_12680 66205 65267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 66379 67371 gene locus_tag LOCUS_12690 66379 67371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 67361 67978 gene locus_tag LOCUS_12700 67361 67978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 69536 68088 gene locus_tag LOCUS_12710 gene mloB 69536 68088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_12710 69849 71717 gene locus_tag LOCUS_12720 gene hscA 69849 71717 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51382 protein_id gnl|my_center|LOCUS_12720 72361 71810 gene locus_tag LOCUS_12730 72361 71810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 73511 72516 gene locus_tag LOCUS_12740 gene yogA 73511 72516 CDS product putative zinc-type alcohol dehydrogenase-like protein YogA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35017 protein_id gnl|my_center|LOCUS_12740 74156 73581 gene locus_tag LOCUS_12750 74156 73581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 74615 77011 gene locus_tag LOCUS_12760 74615 77011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 77221 77607 gene locus_tag LOCUS_12770 77221 77607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 77827 79731 gene locus_tag LOCUS_12780 gene acsA 77827 79731 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_12780 79724 80233 gene locus_tag LOCUS_12790 79724 80233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 80768 80289 gene locus_tag LOCUS_12800 80768 80289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 82028 81015 gene locus_tag LOCUS_12810 gene add 82028 81015 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_12810 82142 83245 gene locus_tag LOCUS_12820 82142 83245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 84015 83242 gene locus_tag LOCUS_12830 84015 83242 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_12830 84690 84097 gene locus_tag LOCUS_12840 84690 84097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784111.1 protein_id gnl|my_center|LOCUS_12840 85310 84702 gene locus_tag LOCUS_12850 85310 84702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 86202 85450 gene locus_tag LOCUS_12860 86202 85450 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660378.1 protein_id gnl|my_center|LOCUS_12860 86553 86230 gene locus_tag LOCUS_12870 86553 86230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 87256 86747 gene locus_tag LOCUS_12880 87256 86747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 89129 87357 gene locus_tag LOCUS_12890 89129 87357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_12890 90644 89277 gene locus_tag LOCUS_12900 90644 89277 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_12900 92138 91071 gene locus_tag LOCUS_12910 92138 91071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence016 674 147 gene locus_tag LOCUS_12920 674 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1342 821 gene locus_tag LOCUS_12930 1342 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1769 1320 gene locus_tag LOCUS_12940 1769 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2008 3603 gene locus_tag LOCUS_12950 2008 3603 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_12950 4646 3669 gene locus_tag LOCUS_12960 4646 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5664 4849 gene locus_tag LOCUS_12970 5664 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 5871 8090 gene locus_tag LOCUS_12980 5871 8090 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_12980 8659 8147 gene locus_tag LOCUS_12990 gene rimM 8659 8147 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_12990 8701 9558 gene locus_tag LOCUS_13000 8701 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 11016 9544 gene locus_tag LOCUS_13010 11016 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 11677 11249 gene locus_tag LOCUS_13020 11677 11249 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 protein_id gnl|my_center|LOCUS_13020 11869 12555 gene locus_tag LOCUS_13030 11869 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 12611 13342 gene locus_tag LOCUS_13040 12611 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 13413 13721 gene locus_tag LOCUS_13050 13413 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 13765 15927 gene locus_tag LOCUS_13060 13765 15927 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_13060 16022 17053 gene locus_tag LOCUS_13070 16022 17053 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_13070 17092 22098 gene locus_tag LOCUS_13080 17092 22098 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_13080 23626 22709 gene locus_tag LOCUS_13090 23626 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 24443 23844 gene locus_tag LOCUS_13100 24443 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 27007 24506 gene locus_tag LOCUS_13110 27007 24506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_13110 27731 27111 gene locus_tag LOCUS_13120 27731 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_13120 28672 27866 gene locus_tag LOCUS_13130 gene mqnD 28672 27866 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_13130 30026 28728 gene locus_tag LOCUS_13140 30026 28728 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_13140 30340 30993 gene locus_tag LOCUS_13150 30340 30993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 31100 34039 gene locus_tag LOCUS_13160 31100 34039 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_13160 34167 34589 gene locus_tag LOCUS_13170 34167 34589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 34959 35798 gene locus_tag LOCUS_13180 34959 35798 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_13180 35902 36810 gene locus_tag LOCUS_13190 35902 36810 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_13190 38752 36872 gene locus_tag LOCUS_13200 38752 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 40711 38819 gene locus_tag LOCUS_13210 40711 38819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 40858 41559 gene locus_tag LOCUS_13220 40858 41559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 42342 41560 gene locus_tag LOCUS_13230 42342 41560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 43458 42400 gene locus_tag LOCUS_13240 43458 42400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 43894 45165 gene locus_tag LOCUS_13250 43894 45165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122297.1 protein_id gnl|my_center|LOCUS_13250 46102 45287 gene locus_tag LOCUS_13260 46102 45287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 46976 46215 gene locus_tag LOCUS_13270 46976 46215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 47245 48630 gene locus_tag LOCUS_13280 47245 48630 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_13280 48645 49784 gene locus_tag LOCUS_13290 48645 49784 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_13290 50013 52652 gene locus_tag LOCUS_13300 50013 52652 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_13300 52886 52662 gene locus_tag LOCUS_13310 52886 52662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 53424 55832 gene locus_tag LOCUS_13320 53424 55832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 56359 56036 gene locus_tag LOCUS_13330 56359 56036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 56764 56465 gene locus_tag LOCUS_13340 56764 56465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 59446 57155 gene locus_tag LOCUS_13350 59446 57155 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_13350 59653 60366 gene locus_tag LOCUS_13360 gene rsmI 59653 60366 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_13360 60514 60867 gene locus_tag LOCUS_13370 60514 60867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 60897 61388 gene locus_tag LOCUS_13380 60897 61388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 62704 61454 gene locus_tag LOCUS_13390 gene erg3 62704 61454 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_13390 63213 62821 gene locus_tag LOCUS_13400 63213 62821 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_13400 63850 63227 gene locus_tag LOCUS_13410 63850 63227 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_13410 64738 64154 gene locus_tag LOCUS_13420 64738 64154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 66327 65122 gene locus_tag LOCUS_13430 66327 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_13430 67991 66597 gene locus_tag LOCUS_13440 67991 66597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_13440 68971 68177 gene locus_tag LOCUS_13450 68971 68177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 72200 69093 gene locus_tag LOCUS_13460 72200 69093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 72398 72213 gene locus_tag LOCUS_13470 72398 72213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 73323 72472 gene locus_tag LOCUS_13480 gene accD 73323 72472 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_13480 74772 73456 gene locus_tag LOCUS_13490 gene rimO 74772 73456 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_13490 74888 75100 gene locus_tag LOCUS_13500 74888 75100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 75042 75908 gene locus_tag LOCUS_13510 75042 75908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 78104 76059 gene locus_tag LOCUS_13520 78104 76059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 79182 78238 gene locus_tag LOCUS_13530 79182 78238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964401.1 protein_id gnl|my_center|LOCUS_13530 79715 79179 gene locus_tag LOCUS_13540 79715 79179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 79952 80356 gene locus_tag LOCUS_13550 gene gspG 79952 80356 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_13550 80357 80857 gene locus_tag LOCUS_13560 80357 80857 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964390.1 protein_id gnl|my_center|LOCUS_13560 81026 82456 gene locus_tag LOCUS_13570 gene gspE 81026 82456 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_13570 82507 84516 gene locus_tag LOCUS_13580 82507 84516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 84519 85766 gene locus_tag LOCUS_13590 84519 85766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 85944 87176 gene locus_tag LOCUS_13600 85944 87176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 87465 87872 gene locus_tag LOCUS_13610 87465 87872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 88314 88673 gene locus_tag LOCUS_13620 88314 88673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 88688 89149 gene locus_tag LOCUS_13630 88688 89149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 89139 90287 gene locus_tag LOCUS_13640 89139 90287 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_13640 91235 90507 gene locus_tag LOCUS_13650 91235 90507 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142669.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence017 814 2 gene locus_tag LOCUS_13660 814 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1958 900 gene locus_tag LOCUS_13670 1958 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2203 5196 gene locus_tag LOCUS_13680 2203 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5620 6126 gene locus_tag LOCUS_13690 5620 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6273 7346 gene locus_tag LOCUS_13700 6273 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7402 8814 gene locus_tag LOCUS_13710 7402 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 11296 8822 gene locus_tag LOCUS_13720 gene mur/alr 11296 8822 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_13720 11475 11882 gene locus_tag LOCUS_13730 11475 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 12611 11985 gene locus_tag LOCUS_13740 12611 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 12868 13791 gene locus_tag LOCUS_13750 12868 13791 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_13750 13919 14650 gene locus_tag LOCUS_13760 13919 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 16158 14653 gene locus_tag LOCUS_13770 gene phrB2 16158 14653 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_13770 16401 16550 gene locus_tag LOCUS_13780 16401 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 17457 16774 gene locus_tag LOCUS_13790 17457 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 18267 17815 gene locus_tag LOCUS_13800 18267 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_13800 18660 18439 gene locus_tag LOCUS_13810 18660 18439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_13810 19411 18839 gene locus_tag LOCUS_13820 19411 18839 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_13820 19566 20681 gene locus_tag LOCUS_13830 19566 20681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 21796 20678 gene locus_tag LOCUS_13840 21796 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 22995 21916 gene locus_tag LOCUS_13850 22995 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 24205 23117 gene locus_tag LOCUS_13860 24205 23117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 25617 24376 gene locus_tag LOCUS_13870 25617 24376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 26158 27159 gene locus_tag LOCUS_13880 26158 27159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 28170 27196 gene locus_tag LOCUS_13890 28170 27196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 28886 28368 gene locus_tag LOCUS_13900 28886 28368 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_13900 29509 28994 gene locus_tag LOCUS_13910 29509 28994 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_13910 30080 31501 gene locus_tag LOCUS_13920 30080 31501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_13920 33094 31841 gene locus_tag LOCUS_13930 33094 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 33201 33860 gene locus_tag LOCUS_13940 gene tal 33201 33860 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R94 protein_id gnl|my_center|LOCUS_13940 34286 33954 gene locus_tag LOCUS_13950 34286 33954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 35172 34486 gene locus_tag LOCUS_13960 35172 34486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_13960 36293 35352 gene locus_tag LOCUS_13970 36293 35352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 38402 36630 gene locus_tag LOCUS_13980 38402 36630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 39069 38494 gene locus_tag LOCUS_13990 39069 38494 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_13990 39548 39171 gene locus_tag LOCUS_14000 39548 39171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 41374 39644 gene locus_tag LOCUS_14010 41374 39644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 42713 41490 gene locus_tag LOCUS_14020 gene sbcD 42713 41490 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5N4 protein_id gnl|my_center|LOCUS_14020 42961 43623 gene locus_tag LOCUS_14030 42961 43623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109233.1 protein_id gnl|my_center|LOCUS_14030 43751 44611 gene locus_tag LOCUS_14040 43751 44611 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_14040 45257 44670 gene locus_tag LOCUS_14050 45257 44670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 45503 46858 gene locus_tag LOCUS_14060 45503 46858 CDS product alginate regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_14060 47175 48641 gene locus_tag LOCUS_14070 47175 48641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 48717 50240 gene locus_tag LOCUS_14080 48717 50240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 50756 50403 gene locus_tag LOCUS_14090 50756 50403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_14090 51929 51030 gene locus_tag LOCUS_14100 51929 51030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 52530 53426 gene locus_tag LOCUS_14110 52530 53426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 53443 54306 gene locus_tag LOCUS_14120 53443 54306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 54598 54852 gene locus_tag LOCUS_14130 54598 54852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 55832 55176 gene locus_tag LOCUS_14140 55832 55176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 56061 57872 gene locus_tag LOCUS_14150 56061 57872 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_14150 66028 57944 gene locus_tag LOCUS_14160 66028 57944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 74274 66025 gene locus_tag LOCUS_14170 74274 66025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 74929 76056 gene locus_tag LOCUS_14180 74929 76056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 77169 76342 gene locus_tag LOCUS_14190 77169 76342 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_14190 77311 77670 gene locus_tag LOCUS_14200 77311 77670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 77721 78773 gene locus_tag LOCUS_14210 gene dinB 77721 78773 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_14210 79032 79568 gene locus_tag LOCUS_14220 79032 79568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 79883 80512 gene locus_tag LOCUS_14230 79883 80512 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence018 3172 4515 gene locus_tag LOCUS_14240 3172 4515 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203470.1 protein_id gnl|my_center|LOCUS_14240 4600 5415 gene locus_tag LOCUS_14250 4600 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142578.1 protein_id gnl|my_center|LOCUS_14250 5544 6026 gene locus_tag LOCUS_14260 5544 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7057 6032 gene locus_tag LOCUS_14270 7057 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7544 8677 gene locus_tag LOCUS_14280 7544 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8731 9357 gene locus_tag LOCUS_14290 8731 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 9390 10112 gene locus_tag LOCUS_14300 gene ykgE 9390 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102123.1 protein_id gnl|my_center|LOCUS_14300 10873 10127 gene locus_tag LOCUS_14310 10873 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 11916 10870 gene locus_tag LOCUS_14320 11916 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 12110 14191 gene locus_tag LOCUS_14330 12110 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15635 14388 gene locus_tag LOCUS_14340 15635 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 15866 16486 gene locus_tag LOCUS_14350 15866 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 17881 16592 gene locus_tag LOCUS_14360 17881 16592 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_14360 18440 17907 gene locus_tag LOCUS_14370 18440 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 18886 18686 gene locus_tag LOCUS_14380 18886 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 19382 18987 gene locus_tag LOCUS_14390 19382 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 20173 19553 gene locus_tag LOCUS_14400 20173 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 20653 20234 gene locus_tag LOCUS_14410 20653 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 21878 20745 gene locus_tag LOCUS_14420 21878 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 22860 22108 gene locus_tag LOCUS_14430 22860 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920698.1 protein_id gnl|my_center|LOCUS_14430 24339 22969 gene locus_tag LOCUS_14440 24339 22969 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657969.1 protein_id gnl|my_center|LOCUS_14440 25025 24336 gene locus_tag LOCUS_14450 25025 24336 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_14450 25694 25086 gene locus_tag LOCUS_14460 25694 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388406.1 protein_id gnl|my_center|LOCUS_14460 26708 25707 gene locus_tag LOCUS_14470 26708 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 27690 26713 gene locus_tag LOCUS_14480 27690 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 27857 29992 gene locus_tag LOCUS_14490 27857 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 30283 30963 gene locus_tag LOCUS_14500 30283 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 31072 31632 gene locus_tag LOCUS_14510 31072 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 31955 33139 gene locus_tag LOCUS_14520 31955 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 33143 34225 gene locus_tag LOCUS_14530 33143 34225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 34227 35843 gene locus_tag LOCUS_14540 34227 35843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 35853 36536 gene locus_tag LOCUS_14550 gene trmD 35853 36536 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_14550 37884 36961 gene locus_tag LOCUS_14560 37884 36961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_14560 38639 38223 gene locus_tag LOCUS_14570 38639 38223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 39690 38689 gene locus_tag LOCUS_14580 39690 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 40251 39757 gene locus_tag LOCUS_14590 40251 39757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 41032 40277 gene locus_tag LOCUS_14600 41032 40277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 43907 41175 gene locus_tag LOCUS_14610 43907 41175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 44858 43917 gene locus_tag LOCUS_14620 44858 43917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 45033 45659 gene locus_tag LOCUS_14630 45033 45659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 46855 45758 gene locus_tag LOCUS_14640 46855 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 48088 46907 gene locus_tag LOCUS_14650 48088 46907 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_14650 48306 48395 gene locus_tag LOCUS_t00250 48306 48395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48636 48709 gene locus_tag LOCUS_t00260 48636 48709 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 48992 49065 gene locus_tag LOCUS_t00270 48992 49065 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50150 49173 gene locus_tag LOCUS_14660 50150 49173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 51424 50438 gene locus_tag LOCUS_14670 gene hpnA 51424 50438 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_14670 51549 51893 gene locus_tag LOCUS_14680 gene fdx 51549 51893 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44428 protein_id gnl|my_center|LOCUS_14680 52099 52338 gene locus_tag LOCUS_14690 52099 52338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 52615 52463 gene locus_tag LOCUS_14700 52615 52463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 53707 52754 gene locus_tag LOCUS_14710 53707 52754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 54366 53719 gene locus_tag LOCUS_14720 gene udk 54366 53719 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_14720 54783 55661 gene locus_tag LOCUS_14730 gene folD 54783 55661 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_14730 56012 55803 gene locus_tag LOCUS_14740 56012 55803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 55984 58410 gene locus_tag LOCUS_14750 55984 58410 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110242.1 protein_id gnl|my_center|LOCUS_14750 58613 59008 gene locus_tag LOCUS_14760 58613 59008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 59075 59965 gene locus_tag LOCUS_14770 gene era 59075 59965 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_14770 60064 60621 gene locus_tag LOCUS_14780 60064 60621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030373.1 protein_id gnl|my_center|LOCUS_14780 60670 61257 gene locus_tag LOCUS_14790 60670 61257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 61355 61786 gene locus_tag LOCUS_14800 61355 61786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 62945 62211 gene locus_tag LOCUS_14810 62945 62211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 63472 64041 gene locus_tag LOCUS_14820 63472 64041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 64044 65744 gene locus_tag LOCUS_14830 64044 65744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 66277 66699 gene locus_tag LOCUS_14840 gene mscL 66277 66699 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ8 protein_id gnl|my_center|LOCUS_14840 67395 66763 gene locus_tag LOCUS_14850 67395 66763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 68026 67604 gene locus_tag LOCUS_14860 68026 67604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 70526 68139 gene locus_tag LOCUS_14870 70526 68139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 72988 70622 gene locus_tag LOCUS_14880 72988 70622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 73561 73061 gene locus_tag LOCUS_14890 gene sixA 73561 73061 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_14890 73780 74547 gene locus_tag LOCUS_14900 73780 74547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 74752 77922 gene locus_tag LOCUS_14910 74752 77922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_14910 78052 79476 gene locus_tag LOCUS_14920 78052 79476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence019 4333 4746 gene locus_tag LOCUS_14930 gene trx 4333 4746 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_14930 4785 5132 gene locus_tag LOCUS_14940 4785 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6276 5194 gene locus_tag LOCUS_14950 6276 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 6682 7782 gene locus_tag LOCUS_14960 6682 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7914 10001 gene locus_tag LOCUS_14970 7914 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 10017 11267 gene locus_tag LOCUS_14980 10017 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 11440 12867 gene locus_tag LOCUS_14990 11440 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 12854 14041 gene locus_tag LOCUS_15000 12854 14041 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 protein_id gnl|my_center|LOCUS_15000 14797 14135 gene locus_tag LOCUS_15010 14797 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 15576 14911 gene locus_tag LOCUS_15020 15576 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 17792 15576 gene locus_tag LOCUS_15030 17792 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 17755 17907 gene locus_tag LOCUS_15040 17755 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 22822 17978 gene locus_tag LOCUS_15050 22822 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_15050 23456 23089 gene locus_tag LOCUS_tm00010 23456 23089 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 23721 24992 gene locus_tag LOCUS_15060 23721 24992 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_15060 25554 27338 gene locus_tag LOCUS_15070 25554 27338 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_15070 27887 27423 gene locus_tag LOCUS_15080 27887 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 28032 28217 gene locus_tag LOCUS_15090 28032 28217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 28969 28361 gene locus_tag LOCUS_15100 28969 28361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 29843 29241 gene locus_tag LOCUS_15110 29843 29241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 30544 29846 gene locus_tag LOCUS_15120 30544 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 31193 30558 gene locus_tag LOCUS_15130 31193 30558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 32425 31409 gene locus_tag LOCUS_15140 32425 31409 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_15140 32820 34874 gene locus_tag LOCUS_15150 32820 34874 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_15150 37579 35123 gene locus_tag LOCUS_15160 37579 35123 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_15160 38620 38111 gene locus_tag LOCUS_15170 38620 38111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 38708 39589 gene locus_tag LOCUS_15180 38708 39589 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_15180 39746 40147 gene locus_tag LOCUS_15190 39746 40147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 40168 40959 gene locus_tag LOCUS_15200 gene uppP 40168 40959 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_15200 41000 41608 gene locus_tag LOCUS_15210 41000 41608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 41805 43154 gene locus_tag LOCUS_15220 41805 43154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 43246 43650 gene locus_tag LOCUS_15230 43246 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 44471 43773 gene locus_tag LOCUS_15240 44471 43773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 44720 44959 gene locus_tag LOCUS_15250 44720 44959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 45056 48454 gene locus_tag LOCUS_15260 45056 48454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 48568 49317 gene locus_tag LOCUS_15270 48568 49317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 52087 49403 gene locus_tag LOCUS_15280 52087 49403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 52415 53500 gene locus_tag LOCUS_15290 52415 53500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 53796 54494 gene locus_tag LOCUS_15300 gene npdA 53796 54494 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_15300 54495 55061 gene locus_tag LOCUS_15310 54495 55061 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_15310 55681 55067 gene locus_tag LOCUS_15320 55681 55067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 56881 55865 gene locus_tag LOCUS_15330 56881 55865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 57078 58733 gene locus_tag LOCUS_15340 57078 58733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 59087 59638 gene locus_tag LOCUS_15350 59087 59638 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_15350 59705 60991 gene locus_tag LOCUS_15360 59705 60991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 61124 62419 gene locus_tag LOCUS_15370 61124 62419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080595.1 protein_id gnl|my_center|LOCUS_15370 62561 63895 gene locus_tag LOCUS_15380 62561 63895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 63910 65448 gene locus_tag LOCUS_15390 63910 65448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 65604 66728 gene locus_tag LOCUS_15400 65604 66728 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_15400 66960 69281 gene locus_tag LOCUS_15410 66960 69281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_15410 69496 70374 gene locus_tag LOCUS_15420 69496 70374 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_15420 70988 70527 gene locus_tag LOCUS_15430 70988 70527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 72202 71144 gene locus_tag LOCUS_15440 gene queA 72202 71144 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_15440 73234 72314 gene locus_tag LOCUS_15450 73234 72314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 75622 73262 gene locus_tag LOCUS_15460 75622 73262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_15460 75789 76571 gene locus_tag LOCUS_15470 75789 76571 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_15470 78927 76672 gene locus_tag LOCUS_15480 78927 76672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence020 128 334 gene locus_tag LOCUS_15490 128 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1639 416 gene locus_tag LOCUS_15500 gene pepT 1639 416 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_15500 1807 2601 gene locus_tag LOCUS_15510 1807 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2619 3308 gene locus_tag LOCUS_15520 2619 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3339 3587 gene locus_tag LOCUS_15530 3339 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3700 4917 gene locus_tag LOCUS_15540 gene ald 3700 4917 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_15540 4932 5615 gene locus_tag LOCUS_15550 4932 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5639 7246 gene locus_tag LOCUS_15560 5639 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 7441 7515 gene locus_tag LOCUS_t00280 7441 7515 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7594 7995 gene locus_tag LOCUS_15570 7594 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 8014 8202 gene locus_tag LOCUS_15580 gene rpmG 8014 8202 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_15580 8215 8391 gene locus_tag LOCUS_15590 8215 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8788 9750 gene locus_tag LOCUS_15600 gene ftsY 8788 9750 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_15600 10267 11589 gene locus_tag LOCUS_15610 10267 11589 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_15610 11838 12770 gene locus_tag LOCUS_15620 11838 12770 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_15620 13039 14031 gene locus_tag LOCUS_15630 gene irpA 13039 14031 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_15630 14367 14846 gene locus_tag LOCUS_15640 14367 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 14960 16516 gene locus_tag LOCUS_15650 14960 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 16516 17514 gene locus_tag LOCUS_15660 16516 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18849 18052 gene locus_tag LOCUS_15670 18849 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703203.1 protein_id gnl|my_center|LOCUS_15670 19839 19144 gene locus_tag LOCUS_15680 19839 19144 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_15680 21993 20071 gene locus_tag LOCUS_15690 21993 20071 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_15690 22773 22162 gene locus_tag LOCUS_15700 gene tdk 22773 22162 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYN2 protein_id gnl|my_center|LOCUS_15700 23761 22967 gene locus_tag LOCUS_15710 gene fjo14 23761 22967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_15710 23887 24669 gene locus_tag LOCUS_15720 23887 24669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_15720 28987 24686 gene locus_tag LOCUS_15730 28987 24686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 29842 29135 gene locus_tag LOCUS_15740 29842 29135 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_15740 32771 29997 gene locus_tag LOCUS_15750 32771 29997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 33731 33060 gene locus_tag LOCUS_15760 33731 33060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 34365 35024 gene locus_tag LOCUS_15770 gene msrA 34365 35024 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_15770 35897 35103 gene locus_tag LOCUS_15780 35897 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 38834 35919 gene locus_tag LOCUS_15790 38834 35919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 41922 39397 gene locus_tag LOCUS_15800 gene priA 41922 39397 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A451 protein_id gnl|my_center|LOCUS_15800 43586 42144 gene locus_tag LOCUS_15810 43586 42144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 44017 45627 gene locus_tag LOCUS_15820 44017 45627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 46695 45688 gene locus_tag LOCUS_15830 46695 45688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 47691 46927 gene locus_tag LOCUS_15840 47691 46927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 54030 47851 gene locus_tag LOCUS_15850 54030 47851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 57972 54295 gene locus_tag LOCUS_15860 57972 54295 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_15860 59333 58302 gene locus_tag LOCUS_15870 59333 58302 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_15870 59791 59459 gene locus_tag LOCUS_15880 59791 59459 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_15880 60020 62305 gene locus_tag LOCUS_15890 60020 62305 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_15890 63357 62824 gene locus_tag LOCUS_15900 63357 62824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 64161 63652 gene locus_tag LOCUS_15910 64161 63652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 64675 64220 gene locus_tag LOCUS_15920 64675 64220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 65722 64796 gene locus_tag LOCUS_15930 65722 64796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 68585 65865 gene locus_tag LOCUS_15940 68585 65865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 68754 70220 gene locus_tag LOCUS_15950 68754 70220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 70381 71616 gene locus_tag LOCUS_15960 70381 71616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 71938 72690 gene locus_tag LOCUS_15970 71938 72690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 73858 72794 gene locus_tag LOCUS_15980 gene fjo30 73858 72794 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_15980 74511 73924 gene locus_tag LOCUS_15990 74511 73924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 76060 74558 gene locus_tag LOCUS_16000 76060 74558 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence021 851 345 gene locus_tag LOCUS_16010 851 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1203 907 gene locus_tag LOCUS_16020 1203 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1636 1187 gene locus_tag LOCUS_16030 1636 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2150 1695 gene locus_tag LOCUS_16040 2150 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3759 2221 gene locus_tag LOCUS_16050 3759 2221 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_16050 7208 3759 gene locus_tag LOCUS_16060 7208 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7438 8214 gene locus_tag LOCUS_16070 7438 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 9633 8608 gene locus_tag LOCUS_16080 9633 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_16080 10508 9855 gene locus_tag LOCUS_16090 10508 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_16090 10782 11774 gene locus_tag LOCUS_16100 gene porP 10782 11774 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_16100 12079 14604 gene locus_tag LOCUS_16110 12079 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14942 15637 gene locus_tag LOCUS_16120 14942 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15690 17180 gene locus_tag LOCUS_16130 15690 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 18986 17259 gene locus_tag LOCUS_16140 18986 17259 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_16140 19155 19529 gene locus_tag LOCUS_16150 19155 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 19544 20038 gene locus_tag LOCUS_16160 19544 20038 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_16160 21055 20045 gene locus_tag LOCUS_16170 gene aroF 21055 20045 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYH8 protein_id gnl|my_center|LOCUS_16170 21863 21108 gene locus_tag LOCUS_16180 gene trpA 21863 21108 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_16180 23329 22163 gene locus_tag LOCUS_16190 gene trpB 23329 22163 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_16190 24138 23524 gene locus_tag LOCUS_16200 gene trpF 24138 23524 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX4 protein_id gnl|my_center|LOCUS_16200 24973 24149 gene locus_tag LOCUS_16210 gene trpC 24973 24149 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_16210 26047 25034 gene locus_tag LOCUS_16220 gene trpD 26047 25034 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_16220 26640 26044 gene locus_tag LOCUS_16230 gene pabA 26640 26044 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_16230 28054 26660 gene locus_tag LOCUS_16240 gene trpE 28054 26660 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_16240 28566 29243 gene locus_tag LOCUS_16250 28566 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 29258 30082 gene locus_tag LOCUS_16260 29258 30082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 30087 30413 gene locus_tag LOCUS_16270 30087 30413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 30422 31345 gene locus_tag LOCUS_16280 30422 31345 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_16280 32830 31778 gene locus_tag LOCUS_16290 32830 31778 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_16290 34130 33075 gene locus_tag LOCUS_16300 34130 33075 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_16300 34507 34836 gene locus_tag LOCUS_16310 34507 34836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 34849 35484 gene locus_tag LOCUS_16320 34849 35484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 36107 35487 gene locus_tag LOCUS_16330 36107 35487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 38358 36229 gene locus_tag LOCUS_16340 38358 36229 CDS product fatty oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 protein_id gnl|my_center|LOCUS_16340 38837 38481 gene locus_tag LOCUS_16350 38837 38481 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_16350 40183 38951 gene locus_tag LOCUS_16360 40183 38951 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974356.1 protein_id gnl|my_center|LOCUS_16360 40623 43706 gene locus_tag LOCUS_16370 40623 43706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 43750 44547 gene locus_tag LOCUS_16380 43750 44547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 44554 46065 gene locus_tag LOCUS_16390 44554 46065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 46360 47862 gene locus_tag LOCUS_16400 46360 47862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 48142 49683 gene locus_tag LOCUS_16410 48142 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 50697 49735 gene locus_tag LOCUS_16420 gene rfaF 50697 49735 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_16420 50775 51977 gene locus_tag LOCUS_16430 50775 51977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 52255 53460 gene locus_tag LOCUS_16440 52255 53460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 54510 53407 gene locus_tag LOCUS_16450 54510 53407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 54805 56931 gene locus_tag LOCUS_16460 54805 56931 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_16460 56948 58249 gene locus_tag LOCUS_16470 56948 58249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 58278 59015 gene locus_tag LOCUS_16480 58278 59015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 59326 65250 gene locus_tag LOCUS_16490 59326 65250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence022 341 916 gene locus_tag LOCUS_16500 341 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1621 1049 gene locus_tag LOCUS_16510 1621 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2873 1644 gene locus_tag LOCUS_16520 2873 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3386 2922 gene locus_tag LOCUS_16530 3386 2922 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_16530 4902 3466 gene locus_tag LOCUS_16540 4902 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 5138 4950 gene locus_tag LOCUS_16550 5138 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5360 6340 gene locus_tag LOCUS_16560 gene corA-1 5360 6340 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB7 protein_id gnl|my_center|LOCUS_16560 7010 6348 gene locus_tag LOCUS_16570 7010 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 8290 7013 gene locus_tag LOCUS_16580 8290 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 8521 9459 gene locus_tag LOCUS_16590 8521 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9707 10423 gene locus_tag LOCUS_16600 gene clpP 9707 10423 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_16600 10506 11204 gene locus_tag LOCUS_16610 gene clpP 10506 11204 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_16610 11288 12547 gene locus_tag LOCUS_16620 gene clpX 11288 12547 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_16620 15893 12675 gene locus_tag LOCUS_16630 15893 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_16630 16452 15931 gene locus_tag LOCUS_16640 16452 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 16665 18899 gene locus_tag LOCUS_16650 16665 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 18906 19769 gene locus_tag LOCUS_16660 18906 19769 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_16660 20491 19814 gene locus_tag LOCUS_16670 gene mqnB 20491 19814 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ9 protein_id gnl|my_center|LOCUS_16670 21204 20488 gene locus_tag LOCUS_16680 21204 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_16680 21879 21214 gene locus_tag LOCUS_16690 21879 21214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_16690 27869 22083 gene locus_tag LOCUS_16700 27869 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 30082 28043 gene locus_tag LOCUS_16710 30082 28043 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_16710 31261 30302 gene locus_tag LOCUS_16720 31261 30302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 31780 31358 gene locus_tag LOCUS_16730 31780 31358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 37478 31812 gene locus_tag LOCUS_16740 37478 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 38759 37869 gene locus_tag LOCUS_16750 38759 37869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 40479 38932 gene locus_tag LOCUS_16760 40479 38932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 41031 40555 gene locus_tag LOCUS_16770 41031 40555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 41495 42064 gene locus_tag LOCUS_16780 41495 42064 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_16780 43944 42127 gene locus_tag LOCUS_16790 43944 42127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 44293 44763 gene locus_tag LOCUS_16800 44293 44763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 44756 45376 gene locus_tag LOCUS_16810 44756 45376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_16810 45373 47238 gene locus_tag LOCUS_16820 45373 47238 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_16820 47241 48395 gene locus_tag LOCUS_16830 47241 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 49040 49411 gene locus_tag LOCUS_16840 49040 49411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 49709 50266 gene locus_tag LOCUS_16850 49709 50266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 50259 51323 gene locus_tag LOCUS_16860 gene carA 50259 51323 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ3 protein_id gnl|my_center|LOCUS_16860 51320 54394 gene locus_tag LOCUS_16870 51320 54394 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAA8 protein_id gnl|my_center|LOCUS_16870 54633 55328 gene locus_tag LOCUS_16880 54633 55328 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_16880 55394 56812 gene locus_tag LOCUS_16890 55394 56812 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144213.1 protein_id gnl|my_center|LOCUS_16890 56825 58204 gene locus_tag LOCUS_16900 56825 58204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 58456 59250 gene locus_tag LOCUS_16910 gene thyA 58456 59250 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_16910 59524 60126 gene locus_tag LOCUS_16920 59524 60126 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_16920 60519 60220 gene locus_tag LOCUS_16930 60519 60220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 61074 60577 gene locus_tag LOCUS_16940 61074 60577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 61910 61155 gene locus_tag LOCUS_16950 61910 61155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 62326 61979 gene locus_tag LOCUS_16960 62326 61979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 62901 62332 gene locus_tag LOCUS_16970 62901 62332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 63859 62945 gene locus_tag LOCUS_16980 gene glsA 63859 62945 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_16980 64267 63866 gene locus_tag LOCUS_16990 64267 63866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 64423 65421 gene locus_tag LOCUS_17000 64423 65421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 65864 66493 gene locus_tag LOCUS_17010 65864 66493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 66548 68914 gene locus_tag LOCUS_17020 66548 68914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 71363 69030 gene locus_tag LOCUS_17030 71363 69030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 71739 73487 gene locus_tag LOCUS_17040 71739 73487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence023 3074 1782 gene locus_tag LOCUS_17050 gene capL 3074 1782 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_17050 4200 3085 gene locus_tag LOCUS_17060 4200 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5198 4242 gene locus_tag LOCUS_17070 5198 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6338 5433 gene locus_tag LOCUS_17080 6338 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 7795 6335 gene locus_tag LOCUS_17090 7795 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 8986 7814 gene locus_tag LOCUS_17100 8986 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 10581 9112 gene locus_tag LOCUS_17110 10581 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10958 10653 gene locus_tag LOCUS_17120 10958 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 11458 11868 gene locus_tag LOCUS_17130 11458 11868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 11872 12666 gene locus_tag LOCUS_17140 11872 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16389 12685 gene locus_tag LOCUS_17150 16389 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 17158 16478 gene locus_tag LOCUS_17160 gene lspA 17158 16478 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_17160 20574 17305 gene locus_tag LOCUS_17170 20574 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_17170 22384 20813 gene locus_tag LOCUS_17180 22384 20813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 22701 22381 gene locus_tag LOCUS_17190 22701 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 23986 23144 gene locus_tag LOCUS_17200 23986 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 24195 24109 gene locus_tag LOCUS_t00290 24195 24109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25126 24416 gene locus_tag LOCUS_17210 25126 24416 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_17210 25950 25429 gene locus_tag LOCUS_17220 25950 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 26934 25972 gene locus_tag LOCUS_17230 26934 25972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 28388 27057 gene locus_tag LOCUS_17240 28388 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 29401 28496 gene locus_tag LOCUS_17250 gene fcl 29401 28496 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_17250 30661 29666 gene locus_tag LOCUS_17260 gene gmd 30661 29666 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVN3 protein_id gnl|my_center|LOCUS_17260 30858 31226 gene locus_tag LOCUS_17270 30858 31226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_17270 32193 31216 gene locus_tag LOCUS_17280 32193 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 33044 32391 gene locus_tag LOCUS_17290 33044 32391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 33367 34038 gene locus_tag LOCUS_17300 33367 34038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 34670 34035 gene locus_tag LOCUS_17310 34670 34035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_17310 35194 35925 gene locus_tag LOCUS_17320 35194 35925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 37972 36380 gene locus_tag LOCUS_17330 37972 36380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 39257 38139 gene locus_tag LOCUS_17340 39257 38139 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931892.1 protein_id gnl|my_center|LOCUS_17340 40566 39394 gene locus_tag LOCUS_17350 40566 39394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 41560 42651 gene locus_tag LOCUS_17360 41560 42651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 43100 42648 gene locus_tag LOCUS_17370 43100 42648 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707827.1 protein_id gnl|my_center|LOCUS_17370 43787 43305 gene locus_tag LOCUS_17380 43787 43305 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_17380 44709 43789 gene locus_tag LOCUS_17390 44709 43789 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_17390 45090 44716 gene locus_tag LOCUS_17400 45090 44716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 46182 45163 gene locus_tag LOCUS_17410 46182 45163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 47012 46179 gene locus_tag LOCUS_17420 47012 46179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 48211 47141 gene locus_tag LOCUS_17430 48211 47141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 50129 48288 gene locus_tag LOCUS_17440 50129 48288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 52093 50192 gene locus_tag LOCUS_17450 52093 50192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 53064 52168 gene locus_tag LOCUS_17460 53064 52168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 53467 55020 gene locus_tag LOCUS_17470 gene dnaB 53467 55020 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_17470 55108 55917 gene locus_tag LOCUS_17480 55108 55917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 55984 56946 gene locus_tag LOCUS_17490 55984 56946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069751.1 protein_id gnl|my_center|LOCUS_17490 57157 57960 gene locus_tag LOCUS_17500 57157 57960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 58141 60156 gene locus_tag LOCUS_17510 58141 60156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 60159 61340 gene locus_tag LOCUS_17520 60159 61340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 61642 62196 gene locus_tag LOCUS_17530 61642 62196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 62312 62530 gene locus_tag LOCUS_17540 62312 62530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 62973 63356 gene locus_tag LOCUS_17550 gene yjgF 62973 63356 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_17550 63440 64825 gene locus_tag LOCUS_17560 63440 64825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_17560 65058 65474 gene locus_tag LOCUS_17570 65058 65474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 65606 66022 gene locus_tag LOCUS_17580 65606 66022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 66192 66602 gene locus_tag LOCUS_17590 66192 66602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 67192 66722 gene locus_tag LOCUS_17600 67192 66722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880015.1 protein_id gnl|my_center|LOCUS_17600 70765 67691 gene locus_tag LOCUS_17610 70765 67691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_17610 70889 72376 gene locus_tag LOCUS_17620 70889 72376 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence024 <1 900 gene locus_tag LOCUS_17630 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 1385 2110 gene locus_tag LOCUS_17640 gene pssA 1385 2110 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_17640 2120 4447 gene locus_tag LOCUS_17650 2120 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5273 4485 gene locus_tag LOCUS_17660 gene parA 5273 4485 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_17660 5854 6756 gene locus_tag LOCUS_17670 5854 6756 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_17670 6854 7603 gene locus_tag LOCUS_17680 6854 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7984 8071 gene locus_tag LOCUS_t00300 7984 8071 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8490 8563 gene locus_tag LOCUS_t00310 8490 8563 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8925 10667 gene locus_tag LOCUS_17690 8925 10667 CDS product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06769 protein_id gnl|my_center|LOCUS_17690 10768 11958 gene locus_tag LOCUS_17700 10768 11958 CDS product amino acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373755.1 protein_id gnl|my_center|LOCUS_17700 12033 12392 gene locus_tag LOCUS_17710 12033 12392 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_17710 12448 13761 gene locus_tag LOCUS_17720 12448 13761 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 protein_id gnl|my_center|LOCUS_17720 14304 15014 gene locus_tag LOCUS_17730 14304 15014 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_17730 15566 15108 gene locus_tag LOCUS_17740 15566 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 16028 17053 gene locus_tag LOCUS_17750 16028 17053 CDS product glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249726.1 protein_id gnl|my_center|LOCUS_17750 17101 18246 gene locus_tag LOCUS_17760 17101 18246 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_17760 18259 19290 gene locus_tag LOCUS_17770 18259 19290 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_17770 19621 20601 gene locus_tag LOCUS_17780 gene porP 19621 20601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_17780 21200 22570 gene locus_tag LOCUS_17790 21200 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 22583 23017 gene locus_tag LOCUS_17800 22583 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 23184 24485 gene locus_tag LOCUS_17810 gene der 23184 24485 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_17810 24969 24628 gene locus_tag LOCUS_17820 24969 24628 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_17820 26078 24999 gene locus_tag LOCUS_17830 26078 24999 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_17830 26256 26945 gene locus_tag LOCUS_17840 26256 26945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 27259 29907 gene locus_tag LOCUS_17850 27259 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 29991 30353 gene locus_tag LOCUS_17860 29991 30353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 31907 30645 gene locus_tag LOCUS_17870 31907 30645 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_17870 34827 32014 gene locus_tag LOCUS_17880 34827 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 37848 35044 gene locus_tag LOCUS_17890 37848 35044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 38100 39020 gene locus_tag LOCUS_17900 38100 39020 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_17900 39507 39055 gene locus_tag LOCUS_17910 39507 39055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 39911 41233 gene locus_tag LOCUS_17920 gene murA 39911 41233 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_17920 42717 41341 gene locus_tag LOCUS_17930 gene mvaA 42717 41341 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_17930 43924 42824 gene locus_tag LOCUS_17940 gene fni 43924 42824 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD90 protein_id gnl|my_center|LOCUS_17940 44087 45382 gene locus_tag LOCUS_17950 44087 45382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 46015 45500 gene locus_tag LOCUS_17960 46015 45500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 47125 46103 gene locus_tag LOCUS_17970 47125 46103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 47372 48157 gene locus_tag LOCUS_17980 47372 48157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_17980 48322 48855 gene locus_tag LOCUS_17990 48322 48855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 49111 49731 gene locus_tag LOCUS_18000 49111 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_18000 50288 49752 gene locus_tag LOCUS_18010 50288 49752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 51545 50520 gene locus_tag LOCUS_18020 gene thiL 51545 50520 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN4 protein_id gnl|my_center|LOCUS_18020 52498 51857 gene locus_tag LOCUS_18030 52498 51857 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_18030 52660 56256 gene locus_tag LOCUS_18040 52660 56256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 56548 58179 gene locus_tag LOCUS_18050 56548 58179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 58511 59404 gene locus_tag LOCUS_18060 58511 59404 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530436.1 protein_id gnl|my_center|LOCUS_18060 60131 59406 gene locus_tag LOCUS_18070 60131 59406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 61223 60141 gene locus_tag LOCUS_18080 61223 60141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 61714 61226 gene locus_tag LOCUS_18090 61714 61226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 61793 62890 gene locus_tag LOCUS_18100 61793 62890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 63641 62832 gene locus_tag LOCUS_18110 gene phnP 63641 62832 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_18110 64088 67129 gene locus_tag LOCUS_18120 64088 67129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 67560 70730 gene locus_tag LOCUS_18130 67560 70730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 71234 70938 gene locus_tag LOCUS_18140 71234 70938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 72023 71289 gene locus_tag LOCUS_18150 72023 71289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence025 127 459 gene locus_tag LOCUS_18160 127 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 708 3632 gene locus_tag LOCUS_18170 708 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5172 3643 gene locus_tag LOCUS_18180 5172 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 5743 5177 gene locus_tag LOCUS_18190 5743 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 6574 5747 gene locus_tag LOCUS_18200 gene cheR 6574 5747 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_18200 11412 6574 gene locus_tag LOCUS_18210 11412 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 11914 12396 gene locus_tag LOCUS_18220 11914 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_18220 12411 12989 gene locus_tag LOCUS_18230 gene adk 12411 12989 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ0 protein_id gnl|my_center|LOCUS_18230 12993 13352 gene locus_tag LOCUS_18240 12993 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 13466 13915 gene locus_tag LOCUS_18250 13466 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 13912 14487 gene locus_tag LOCUS_18260 13912 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 14558 15190 gene locus_tag LOCUS_18270 14558 15190 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_18270 15309 15854 gene locus_tag LOCUS_18280 15309 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 16081 16785 gene locus_tag LOCUS_18290 16081 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 17093 18025 gene locus_tag LOCUS_18300 gene queG 17093 18025 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_18300 18059 18706 gene locus_tag LOCUS_18310 18059 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 18793 19860 gene locus_tag LOCUS_18320 gene serC 18793 19860 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_18320 20107 20922 gene locus_tag LOCUS_18330 20107 20922 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_18330 21431 22093 gene locus_tag LOCUS_18340 21431 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 22579 23415 gene locus_tag LOCUS_18350 22579 23415 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_18350 23479 24027 gene locus_tag LOCUS_18360 gene yfiT 23479 24027 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_18360 24119 25603 gene locus_tag LOCUS_18370 24119 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 25768 26376 gene locus_tag LOCUS_18380 25768 26376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 26408 26992 gene locus_tag LOCUS_18390 26408 26992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 27005 27454 gene locus_tag LOCUS_18400 27005 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 27484 27939 gene locus_tag LOCUS_18410 27484 27939 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_18410 29058 27928 gene locus_tag LOCUS_18420 29058 27928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 29747 29166 gene locus_tag LOCUS_18430 gene yezE 29747 29166 CDS product putative HTH-type transcriptional regulator YezE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WY76 protein_id gnl|my_center|LOCUS_18430 30597 29842 gene locus_tag LOCUS_18440 30597 29842 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_18440 30744 31418 gene locus_tag LOCUS_18450 30744 31418 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_18450 31548 31754 gene locus_tag LOCUS_18460 31548 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 31881 32798 gene locus_tag LOCUS_18470 31881 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 32820 33320 gene locus_tag LOCUS_18480 32820 33320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 33322 33858 gene locus_tag LOCUS_18490 33322 33858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 34526 36673 gene locus_tag LOCUS_18500 34526 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 36796 37053 gene locus_tag LOCUS_18510 gene rpsT 36796 37053 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_18510 37170 37850 gene locus_tag LOCUS_18520 37170 37850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 38313 37873 gene locus_tag LOCUS_18530 38313 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_18530 38675 38358 gene locus_tag LOCUS_18540 38675 38358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 38974 43086 gene locus_tag LOCUS_18550 38974 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 43174 43845 gene locus_tag LOCUS_18560 43174 43845 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722886.1 protein_id gnl|my_center|LOCUS_18560 44079 44456 gene locus_tag LOCUS_18570 44079 44456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 45040 45570 gene locus_tag LOCUS_18580 45040 45570 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_18580 48488 45669 gene locus_tag LOCUS_18590 48488 45669 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_18590 48925 50097 gene locus_tag LOCUS_18600 48925 50097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 50829 50158 gene locus_tag LOCUS_18610 50829 50158 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_18610 50973 53774 gene locus_tag LOCUS_18620 gene polA 50973 53774 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_18620 53829 55646 gene locus_tag LOCUS_18630 53829 55646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 55683 56843 gene locus_tag LOCUS_18640 55683 56843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979163.1 protein_id gnl|my_center|LOCUS_18640 56847 57533 gene locus_tag LOCUS_18650 56847 57533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 58121 57552 gene locus_tag LOCUS_18660 58121 57552 CDS product UPF0548 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RST8 protein_id gnl|my_center|LOCUS_18660 58176 61268 gene locus_tag LOCUS_18670 58176 61268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 61271 62020 gene locus_tag LOCUS_18680 61271 62020 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_18680 62215 63192 gene locus_tag LOCUS_18690 62215 63192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 63544 63762 gene locus_tag LOCUS_18700 63544 63762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 63785 65257 gene locus_tag LOCUS_18710 63785 65257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 65442 66821 gene locus_tag LOCUS_18720 65442 66821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 67227 68285 gene locus_tag LOCUS_18730 67227 68285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence026 274 3840 gene locus_tag LOCUS_18740 274 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5662 4064 gene locus_tag LOCUS_18750 5662 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12155 5769 gene locus_tag LOCUS_18760 12155 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 13232 12339 gene locus_tag LOCUS_18770 13232 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 14013 15509 gene locus_tag LOCUS_18780 14013 15509 CDS product gamma-glutamyl carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208365.1 protein_id gnl|my_center|LOCUS_18780 16640 15516 gene locus_tag LOCUS_18790 16640 15516 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_18790 16853 17452 gene locus_tag LOCUS_18800 16853 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 17596 18093 gene locus_tag LOCUS_18810 17596 18093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 18343 18915 gene locus_tag LOCUS_18820 18343 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 19682 18945 gene locus_tag LOCUS_18830 gene truA 19682 18945 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_18830 20032 19700 gene locus_tag LOCUS_18840 20032 19700 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_18840 20795 20073 gene locus_tag LOCUS_18850 20795 20073 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_18850 21023 21601 gene locus_tag LOCUS_18860 gene adk 21023 21601 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA6 protein_id gnl|my_center|LOCUS_18860 21798 22589 gene locus_tag LOCUS_18870 21798 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 22713 23708 gene locus_tag LOCUS_18880 gene obg 22713 23708 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_18880 23843 24310 gene locus_tag LOCUS_18890 23843 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 24323 24922 gene locus_tag LOCUS_18900 24323 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 24975 25964 gene locus_tag LOCUS_18910 24975 25964 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_18910 26162 27958 gene locus_tag LOCUS_18920 26162 27958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 30878 27960 gene locus_tag LOCUS_18930 30878 27960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 31823 31065 gene locus_tag LOCUS_18940 31823 31065 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_18940 31962 31887 gene locus_tag LOCUS_t00320 31962 31887 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32104 32018 gene locus_tag LOCUS_t00330 32104 32018 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32262 32187 gene locus_tag LOCUS_t00340 32262 32187 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32607 33434 gene locus_tag LOCUS_18950 32607 33434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 33487 34122 gene locus_tag LOCUS_18960 33487 34122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 34211 34426 gene locus_tag LOCUS_18970 34211 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 34927 35142 gene locus_tag LOCUS_18980 34927 35142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 35221 36768 gene locus_tag LOCUS_18990 35221 36768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 36908 37861 gene locus_tag LOCUS_19000 36908 37861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 38649 37912 gene locus_tag LOCUS_19010 38649 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 39743 38652 gene locus_tag LOCUS_19020 39743 38652 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_19020 40899 39967 gene locus_tag LOCUS_19030 40899 39967 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_19030 41261 42553 gene locus_tag LOCUS_19040 41261 42553 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_19040 42709 44037 gene locus_tag LOCUS_19050 42709 44037 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_19050 44160 45383 gene locus_tag LOCUS_19060 44160 45383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 45376 46158 gene locus_tag LOCUS_19070 45376 46158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 46303 49041 gene locus_tag LOCUS_19080 46303 49041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 49430 50902 gene locus_tag LOCUS_19090 49430 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 51050 51709 gene locus_tag LOCUS_19100 51050 51709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 53119 51716 gene locus_tag LOCUS_19110 53119 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 55516 53372 gene locus_tag LOCUS_19120 55516 53372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 55790 57364 gene locus_tag LOCUS_19130 55790 57364 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_19130 57441 58358 gene locus_tag LOCUS_19140 57441 58358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 58442 58801 gene locus_tag LOCUS_19150 58442 58801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 61200 58807 gene locus_tag LOCUS_19160 61200 58807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 62892 61363 gene locus_tag LOCUS_19170 gene asnS 62892 61363 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I6 protein_id gnl|my_center|LOCUS_19170 63932 63306 gene locus_tag LOCUS_19180 63932 63306 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 protein_id gnl|my_center|LOCUS_19180 65055 64069 gene locus_tag LOCUS_19190 65055 64069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 67695 65323 gene locus_tag LOCUS_19200 67695 65323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence027 846 103 gene locus_tag LOCUS_19210 846 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528477.1 protein_id gnl|my_center|LOCUS_19210 2179 977 gene locus_tag LOCUS_19220 2179 977 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_19220 2563 2183 gene locus_tag LOCUS_19230 2563 2183 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403077.1 protein_id gnl|my_center|LOCUS_19230 5263 2747 gene locus_tag LOCUS_19240 5263 2747 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_19240 6161 7066 gene locus_tag LOCUS_19250 6161 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7150 7686 gene locus_tag LOCUS_19260 gene dcd 7150 7686 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_19260 7958 7683 gene locus_tag LOCUS_19270 7958 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 8065 8886 gene locus_tag LOCUS_19280 gene mvaB 8065 8886 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_19280 9196 9876 gene locus_tag LOCUS_19290 9196 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9870 10727 gene locus_tag LOCUS_19300 9870 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 10750 11289 gene locus_tag LOCUS_19310 10750 11289 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_19310 11316 12392 gene locus_tag LOCUS_19320 11316 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 12603 12767 gene locus_tag LOCUS_19330 12603 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 12848 14272 gene locus_tag LOCUS_19340 12848 14272 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_19340 14502 14996 gene locus_tag LOCUS_19350 gene lrp 14502 14996 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45265 protein_id gnl|my_center|LOCUS_19350 17255 15276 gene locus_tag LOCUS_19360 17255 15276 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_19360 18283 17354 gene locus_tag LOCUS_19370 18283 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_19370 18974 23893 gene locus_tag LOCUS_19380 18974 23893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 24050 24955 gene locus_tag LOCUS_19390 24050 24955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 26595 25450 gene locus_tag LOCUS_19400 26595 25450 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_19400 28133 26670 gene locus_tag LOCUS_19410 gene dacC 28133 26670 CDS product D-alanyl-D-alanine carboxypeptidase DacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39844 protein_id gnl|my_center|LOCUS_19410 28322 28651 gene locus_tag LOCUS_19420 28322 28651 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_19420 29080 34650 gene locus_tag LOCUS_19430 29080 34650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_19430 34911 35672 gene locus_tag LOCUS_19440 34911 35672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 35694 36128 gene locus_tag LOCUS_19450 35694 36128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 36147 36689 gene locus_tag LOCUS_19460 36147 36689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 36827 37873 gene locus_tag LOCUS_19470 36827 37873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 38914 37859 gene locus_tag LOCUS_19480 38914 37859 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_19480 39641 38925 gene locus_tag LOCUS_19490 39641 38925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_19490 40917 39805 gene locus_tag LOCUS_19500 40917 39805 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_19500 41660 41169 gene locus_tag LOCUS_19510 41660 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 42198 41803 gene locus_tag LOCUS_19520 42198 41803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 42386 46435 gene locus_tag LOCUS_19530 42386 46435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 46438 47376 gene locus_tag LOCUS_19540 46438 47376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 47455 48450 gene locus_tag LOCUS_19550 47455 48450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 49525 49136 gene locus_tag LOCUS_19560 49525 49136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 57016 49574 gene locus_tag LOCUS_19570 57016 49574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 57762 57070 gene locus_tag LOCUS_19580 57762 57070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 65529 57775 gene locus_tag LOCUS_19590 65529 57775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 66160 65531 gene locus_tag LOCUS_19600 66160 65531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 66684 66160 gene locus_tag LOCUS_19610 66684 66160 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence028 166 390 gene locus_tag LOCUS_19620 166 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2229 571 gene locus_tag LOCUS_19630 2229 571 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_19630 3100 2456 gene locus_tag LOCUS_19640 3100 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3885 3139 gene locus_tag LOCUS_19650 gene menG 3885 3139 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_19650 4252 4749 gene locus_tag LOCUS_19660 gene engB 4252 4749 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T4 protein_id gnl|my_center|LOCUS_19660 4919 6217 gene locus_tag LOCUS_19670 4919 6217 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_19670 6320 7930 gene locus_tag LOCUS_19680 6320 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 9031 7934 gene locus_tag LOCUS_19690 9031 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_19690 9891 9136 gene locus_tag LOCUS_19700 9891 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 10759 10076 gene locus_tag LOCUS_19710 10759 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 11582 10869 gene locus_tag LOCUS_19720 11582 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 12455 11682 gene locus_tag LOCUS_19730 12455 11682 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_19730 12709 13263 gene locus_tag LOCUS_19740 12709 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 13299 14525 gene locus_tag LOCUS_19750 13299 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 14558 19921 gene locus_tag LOCUS_19760 14558 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 20378 19977 gene locus_tag LOCUS_19770 20378 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 22363 20570 gene locus_tag LOCUS_19780 gene lepA 22363 20570 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_19780 24496 22547 gene locus_tag LOCUS_19790 24496 22547 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_19790 25764 24904 gene locus_tag LOCUS_19800 25764 24904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 26562 25813 gene locus_tag LOCUS_19810 gene cmk 26562 25813 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_19810 28236 26677 gene locus_tag LOCUS_19820 28236 26677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 30383 28464 gene locus_tag LOCUS_19830 gene ogt 30383 28464 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_19830 32648 30486 gene locus_tag LOCUS_19840 gene pepX2 32648 30486 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963251.1 protein_id gnl|my_center|LOCUS_19840 33084 33722 gene locus_tag LOCUS_19850 33084 33722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 34465 33923 gene locus_tag LOCUS_19860 34465 33923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 35823 34474 gene locus_tag LOCUS_19870 35823 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 36346 36008 gene locus_tag LOCUS_19880 gene phnA 36346 36008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123128.1 protein_id gnl|my_center|LOCUS_19880 38664 36412 gene locus_tag LOCUS_19890 38664 36412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403912.1 protein_id gnl|my_center|LOCUS_19890 41017 38867 gene locus_tag LOCUS_19900 41017 38867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 41442 42089 gene locus_tag LOCUS_19910 41442 42089 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_19910 42101 43681 gene locus_tag LOCUS_19920 42101 43681 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CTN1 protein_id gnl|my_center|LOCUS_19920 44054 44803 gene locus_tag LOCUS_19930 44054 44803 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_19930 44905 46128 gene locus_tag LOCUS_19940 44905 46128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 46183 47460 gene locus_tag LOCUS_19950 46183 47460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_19950 47706 48395 gene locus_tag LOCUS_19960 47706 48395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_19960 48404 49663 gene locus_tag LOCUS_19970 48404 49663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_19970 50380 49886 gene locus_tag LOCUS_19980 50380 49886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 50636 51064 gene locus_tag LOCUS_19990 50636 51064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 51155 51898 gene locus_tag LOCUS_20000 51155 51898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 52142 53041 gene locus_tag LOCUS_20010 52142 53041 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_20010 56288 53085 gene locus_tag LOCUS_20020 56288 53085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_20020 56804 57370 gene locus_tag LOCUS_20030 56804 57370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 57628 58146 gene locus_tag LOCUS_20040 57628 58146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 58249 58500 gene locus_tag LOCUS_20050 58249 58500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 59960 58962 gene locus_tag LOCUS_20060 59960 58962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 61006 60086 gene locus_tag LOCUS_20070 61006 60086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 62763 61132 gene locus_tag LOCUS_20080 62763 61132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 63015 64559 gene locus_tag LOCUS_20090 63015 64559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 64742 66301 gene locus_tag LOCUS_20100 64742 66301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence029 1226 879 gene locus_tag LOCUS_20110 1226 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2451 1333 gene locus_tag LOCUS_20120 2451 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3733 2558 gene locus_tag LOCUS_20130 3733 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4760 3822 gene locus_tag LOCUS_20140 4760 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 5777 4764 gene locus_tag LOCUS_20150 5777 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 6686 5784 gene locus_tag LOCUS_20160 6686 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7444 6755 gene locus_tag LOCUS_20170 7444 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136052.1 protein_id gnl|my_center|LOCUS_20170 8883 7678 gene locus_tag LOCUS_20180 8883 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 10260 8902 gene locus_tag LOCUS_20190 10260 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 11362 10322 gene locus_tag LOCUS_20200 11362 10322 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_20200 13014 11488 gene locus_tag LOCUS_20210 gene hsdM 13014 11488 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_20210 13580 13014 gene locus_tag LOCUS_20220 13580 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 13975 16233 gene locus_tag LOCUS_20230 13975 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 16223 17530 gene locus_tag LOCUS_20240 16223 17530 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268608.1 protein_id gnl|my_center|LOCUS_20240 17603 18343 gene locus_tag LOCUS_20250 17603 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 18471 18397 gene locus_tag LOCUS_t00350 18471 18397 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25927 18626 gene locus_tag LOCUS_20260 25927 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 27417 26281 gene locus_tag LOCUS_20270 27417 26281 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_20270 27765 28601 gene locus_tag LOCUS_20280 27765 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 28794 29837 gene locus_tag LOCUS_20290 gene rlmN 28794 29837 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_20290 30545 29847 gene locus_tag LOCUS_20300 30545 29847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 32328 30550 gene locus_tag LOCUS_20310 32328 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 33037 32477 gene locus_tag LOCUS_20320 33037 32477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 33666 33103 gene locus_tag LOCUS_20330 33666 33103 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_20330 34294 33728 gene locus_tag LOCUS_20340 34294 33728 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_20340 35839 34511 gene locus_tag LOCUS_20350 35839 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 37946 36165 gene locus_tag LOCUS_20360 37946 36165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 38361 42380 gene locus_tag LOCUS_20370 38361 42380 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_20370 43925 42456 gene locus_tag LOCUS_20380 43925 42456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 47152 43928 gene locus_tag LOCUS_20390 47152 43928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 52140 47431 gene locus_tag LOCUS_20400 52140 47431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 52395 56486 gene locus_tag LOCUS_20410 52395 56486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 59057 56493 gene locus_tag LOCUS_20420 59057 56493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 60318 59203 gene locus_tag LOCUS_20430 60318 59203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 60535 64608 gene locus_tag LOCUS_20440 60535 64608 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence030 205 675 gene locus_tag LOCUS_20450 205 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3768 841 gene locus_tag LOCUS_20460 3768 841 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_20460 5010 3853 gene locus_tag LOCUS_20470 5010 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 6203 5382 gene locus_tag LOCUS_20480 6203 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 7096 6467 gene locus_tag LOCUS_20490 7096 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 9654 7144 gene locus_tag LOCUS_20500 9654 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 10877 9780 gene locus_tag LOCUS_20510 10877 9780 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_20510 11807 10986 gene locus_tag LOCUS_20520 11807 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 12752 11853 gene locus_tag LOCUS_20530 12752 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 15565 13229 gene locus_tag LOCUS_20540 15565 13229 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_20540 15988 17220 gene locus_tag LOCUS_20550 15988 17220 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_20550 17383 18471 gene locus_tag LOCUS_20560 17383 18471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 18555 19193 gene locus_tag LOCUS_20570 18555 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 19380 20279 gene locus_tag LOCUS_20580 19380 20279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 21773 20325 gene locus_tag LOCUS_20590 21773 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 22030 25347 gene locus_tag LOCUS_20600 22030 25347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 25744 26979 gene locus_tag LOCUS_20610 gene hutI 25744 26979 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_20610 28438 27068 gene locus_tag LOCUS_20620 28438 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 29104 28649 gene locus_tag LOCUS_20630 29104 28649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_20630 30051 29170 gene locus_tag LOCUS_20640 30051 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 30320 32689 gene locus_tag LOCUS_20650 30320 32689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 33653 32766 gene locus_tag LOCUS_20660 gene atpG 33653 32766 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_20660 35350 33749 gene locus_tag LOCUS_20670 gene atpA 35350 33749 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_20670 35914 35354 gene locus_tag LOCUS_20680 gene atpH 35914 35354 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RGY4 protein_id gnl|my_center|LOCUS_20680 36489 35977 gene locus_tag LOCUS_20690 gene atpF 36489 35977 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9U9 protein_id gnl|my_center|LOCUS_20690 37005 36811 gene locus_tag LOCUS_20700 37005 36811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 38120 37047 gene locus_tag LOCUS_20710 38120 37047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 38651 38887 gene locus_tag LOCUS_20720 38651 38887 CDS product cytochrome b5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642199.1 protein_id gnl|my_center|LOCUS_20720 39159 38953 gene locus_tag LOCUS_20730 39159 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 41759 39351 gene locus_tag LOCUS_20740 41759 39351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 44626 41927 gene locus_tag LOCUS_20750 44626 41927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 48044 44670 gene locus_tag LOCUS_20760 48044 44670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 49328 48351 gene locus_tag LOCUS_20770 49328 48351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 49945 49466 gene locus_tag LOCUS_20780 49945 49466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 50758 54078 gene locus_tag LOCUS_20790 50758 54078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071340.1 protein_id gnl|my_center|LOCUS_20790 54248 55801 gene locus_tag LOCUS_20800 gene pcd 54248 55801 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_20800 55938 56642 gene locus_tag LOCUS_20810 55938 56642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 56769 57161 gene locus_tag LOCUS_20820 56769 57161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 57167 57874 gene locus_tag LOCUS_20830 57167 57874 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_20830 58160 59560 gene locus_tag LOCUS_20840 58160 59560 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_20840 59721 60698 gene locus_tag LOCUS_20850 59721 60698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 60878 61939 gene locus_tag LOCUS_20860 60878 61939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 62165 62749 gene locus_tag LOCUS_20870 62165 62749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 62845 64110 gene locus_tag LOCUS_20880 62845 64110 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence031 420 947 gene locus_tag LOCUS_20890 420 947 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085826.1 protein_id gnl|my_center|LOCUS_20890 925 1461 gene locus_tag LOCUS_20900 925 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1574 2059 gene locus_tag LOCUS_20910 1574 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3355 2327 gene locus_tag LOCUS_20920 3355 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 4454 3504 gene locus_tag LOCUS_20930 4454 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 4586 5077 gene locus_tag LOCUS_20940 4586 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5260 5910 gene locus_tag LOCUS_20950 gene sfp 5260 5910 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_20950 6009 6485 gene locus_tag LOCUS_20960 6009 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 6804 7865 gene locus_tag LOCUS_20970 6804 7865 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_20970 8045 8293 gene locus_tag LOCUS_20980 8045 8293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706824.1 protein_id gnl|my_center|LOCUS_20980 10209 8341 gene locus_tag LOCUS_20990 10209 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 10737 10321 gene locus_tag LOCUS_21000 gene yqiW 10737 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_21000 10929 11294 gene locus_tag LOCUS_21010 10929 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 11381 12322 gene locus_tag LOCUS_21020 11381 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_21020 12513 13544 gene locus_tag LOCUS_21030 12513 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 13762 14778 gene locus_tag LOCUS_21040 13762 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 15922 14996 gene locus_tag LOCUS_21050 15922 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964316.1 protein_id gnl|my_center|LOCUS_21050 16161 16736 gene locus_tag LOCUS_21060 16161 16736 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_21060 16901 18334 gene locus_tag LOCUS_21070 16901 18334 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_21070 19478 18345 gene locus_tag LOCUS_21080 gene rfaG 19478 18345 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476086.1 protein_id gnl|my_center|LOCUS_21080 20935 19487 gene locus_tag LOCUS_21090 20935 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 21821 20964 gene locus_tag LOCUS_21100 21821 20964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 22341 21862 gene locus_tag LOCUS_21110 22341 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 25017 22636 gene locus_tag LOCUS_21120 25017 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 26665 25193 gene locus_tag LOCUS_21130 26665 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 26891 27655 gene locus_tag LOCUS_21140 26891 27655 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_21140 27994 28506 gene locus_tag LOCUS_21150 27994 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 28910 30373 gene locus_tag LOCUS_21160 gene glt 28910 30373 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082931.1 protein_id gnl|my_center|LOCUS_21160 32538 30430 gene locus_tag LOCUS_21170 32538 30430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 33532 32570 gene locus_tag LOCUS_21180 33532 32570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 34320 33739 gene locus_tag LOCUS_21190 34320 33739 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_21190 35747 34323 gene locus_tag LOCUS_21200 35747 34323 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_21200 37084 35858 gene locus_tag LOCUS_21210 37084 35858 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_21210 39066 37093 gene locus_tag LOCUS_21220 39066 37093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 39745 44562 gene locus_tag LOCUS_21230 39745 44562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 44706 45617 gene locus_tag LOCUS_21240 44706 45617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 45704 48880 gene locus_tag LOCUS_21250 45704 48880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 49240 48953 gene locus_tag LOCUS_21260 gene rplT 49240 48953 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_21260 49603 49409 gene locus_tag LOCUS_21270 gene rpmI 49603 49409 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_21270 50130 49771 gene locus_tag LOCUS_21280 50130 49771 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_21280 50422 50997 gene locus_tag LOCUS_21290 50422 50997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 51171 51920 gene locus_tag LOCUS_21300 51171 51920 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108300.1 protein_id gnl|my_center|LOCUS_21300 51926 52858 gene locus_tag LOCUS_21310 51926 52858 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_21310 53178 54611 gene locus_tag LOCUS_21320 gene dnaA 53178 54611 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_21320 55309 54680 gene locus_tag LOCUS_21330 55309 54680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 55617 56606 gene locus_tag LOCUS_21340 55617 56606 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766067.1 protein_id gnl|my_center|LOCUS_21340 58577 56679 gene locus_tag LOCUS_21350 58577 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 60444 58588 gene locus_tag LOCUS_21360 60444 58588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 61444 60605 gene locus_tag LOCUS_21370 61444 60605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence032 1307 1705 gene locus_tag LOCUS_21380 1307 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4374 2113 gene locus_tag LOCUS_21390 4374 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 4640 4843 gene locus_tag LOCUS_21400 4640 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4865 5233 gene locus_tag LOCUS_21410 4865 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6060 5290 gene locus_tag LOCUS_21420 gene pecR 6060 5290 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_21420 7188 6259 gene locus_tag LOCUS_21430 gene prfB 7188 6259 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_21430 7605 8663 gene locus_tag LOCUS_21440 7605 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 8896 10638 gene locus_tag LOCUS_21450 gene gaa 8896 10638 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_21450 11430 10678 gene locus_tag LOCUS_21460 11430 10678 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_21460 11697 12086 gene locus_tag LOCUS_21470 11697 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 12177 12614 gene locus_tag LOCUS_21480 12177 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 12639 14129 gene locus_tag LOCUS_21490 12639 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 17024 14187 gene locus_tag LOCUS_21500 17024 14187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_21500 17844 17251 gene locus_tag LOCUS_21510 gene hisIE 17844 17251 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_21510 18614 17856 gene locus_tag LOCUS_21520 gene hisF 18614 17856 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z6 protein_id gnl|my_center|LOCUS_21520 19460 18735 gene locus_tag LOCUS_21530 gene hisA 19460 18735 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_21530 20047 19457 gene locus_tag LOCUS_21540 gene hisH 20047 19457 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_21540 21252 20107 gene locus_tag LOCUS_21550 gene hisB 21252 20107 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA7 protein_id gnl|my_center|LOCUS_21550 22307 21276 gene locus_tag LOCUS_21560 gene hisC 22307 21276 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE8 protein_id gnl|my_center|LOCUS_21560 23675 22374 gene locus_tag LOCUS_21570 gene hisD 23675 22374 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_21570 24651 23794 gene locus_tag LOCUS_21580 gene hisG 24651 23794 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE6 protein_id gnl|my_center|LOCUS_21580 36248 24984 gene locus_tag LOCUS_21590 36248 24984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 46635 36358 gene locus_tag LOCUS_21600 46635 36358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 48262 47267 gene locus_tag LOCUS_21610 48262 47267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 50278 48557 gene locus_tag LOCUS_21620 50278 48557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_21620 51440 50409 gene locus_tag LOCUS_21630 51440 50409 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_21630 52140 51643 gene locus_tag LOCUS_21640 52140 51643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 53448 52438 gene locus_tag LOCUS_21650 53448 52438 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_21650 55290 53821 gene locus_tag LOCUS_21660 55290 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 56843 55581 gene locus_tag LOCUS_21670 gene cysN 56843 55581 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_21670 57856 56954 gene locus_tag LOCUS_21680 gene cysD 57856 56954 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_21680 58489 57893 gene locus_tag LOCUS_21690 gene cysC 58489 57893 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_21690 59326 58580 gene locus_tag LOCUS_21700 gene lptB 59326 58580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_21700 60321 59629 gene locus_tag LOCUS_21710 60321 59629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_21710 60830 60324 gene locus_tag LOCUS_21720 60830 60324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence033 1134 154 gene locus_tag LOCUS_21730 1134 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1473 5321 gene locus_tag LOCUS_21740 1473 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5599 9003 gene locus_tag LOCUS_21750 5599 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 9781 9098 gene locus_tag LOCUS_21760 9781 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 10173 12071 gene locus_tag LOCUS_21770 10173 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 12276 13664 gene locus_tag LOCUS_21780 12276 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 14582 13812 gene locus_tag LOCUS_21790 14582 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 15750 14761 gene locus_tag LOCUS_21800 15750 14761 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_21800 16996 16019 gene locus_tag LOCUS_21810 16996 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19356 16996 gene locus_tag LOCUS_21820 19356 16996 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_21820 20323 19472 gene locus_tag LOCUS_21830 gene prmC 20323 19472 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_21830 20705 22369 gene locus_tag LOCUS_21840 20705 22369 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_21840 22526 23866 gene locus_tag LOCUS_21850 22526 23866 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_21850 24053 25426 gene locus_tag LOCUS_21860 24053 25426 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_21860 25655 26809 gene locus_tag LOCUS_21870 25655 26809 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391267.1 protein_id gnl|my_center|LOCUS_21870 26847 28535 gene locus_tag LOCUS_21880 26847 28535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 28641 29624 gene locus_tag LOCUS_21890 28641 29624 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_21890 30735 29926 gene locus_tag LOCUS_21900 30735 29926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 32249 30822 gene locus_tag LOCUS_21910 32249 30822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 32905 32318 gene locus_tag LOCUS_21920 32905 32318 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_21920 33226 35619 gene locus_tag LOCUS_21930 33226 35619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 35736 37280 gene locus_tag LOCUS_21940 gene gpmI 35736 37280 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_21940 37411 37902 gene locus_tag LOCUS_21950 37411 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 38207 41947 gene locus_tag LOCUS_21960 38207 41947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 42194 45904 gene locus_tag LOCUS_21970 42194 45904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 46856 45969 gene locus_tag LOCUS_21980 46856 45969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 50033 46956 gene locus_tag LOCUS_21990 gene fpp2 50033 46956 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962408.1 protein_id gnl|my_center|LOCUS_21990 50384 51655 gene locus_tag LOCUS_22000 gene tyrS 50384 51655 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_22000 51735 52547 gene locus_tag LOCUS_22010 51735 52547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918230.1 protein_id gnl|my_center|LOCUS_22010 52624 53151 gene locus_tag LOCUS_22020 52624 53151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 53656 53213 gene locus_tag LOCUS_22030 53656 53213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 53853 54815 gene locus_tag LOCUS_22040 53853 54815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 55649 54828 gene locus_tag LOCUS_22050 55649 54828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_22050 55757 56260 gene locus_tag LOCUS_22060 55757 56260 CDS product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706212.1 protein_id gnl|my_center|LOCUS_22060 56332 57114 gene locus_tag LOCUS_22070 gene surE 56332 57114 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_22070 >Feature sequence034 1115 243 gene locus_tag LOCUS_22080 1115 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_22080 2235 1240 gene locus_tag LOCUS_22090 2235 1240 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_22090 3049 2393 gene locus_tag LOCUS_22100 3049 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3507 3112 gene locus_tag LOCUS_22110 3507 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5329 3611 gene locus_tag LOCUS_22120 5329 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_22120 6517 5492 gene locus_tag LOCUS_22130 gene pheS 6517 5492 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_22130 6876 7979 gene locus_tag LOCUS_22140 6876 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8133 8582 gene locus_tag LOCUS_22150 8133 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 9061 10068 gene locus_tag LOCUS_22160 9061 10068 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_22160 10185 13337 gene locus_tag LOCUS_22170 10185 13337 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_22170 13433 14824 gene locus_tag LOCUS_22180 13433 14824 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_22180 16923 15157 gene locus_tag LOCUS_22190 16923 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 18399 17083 gene locus_tag LOCUS_22200 18399 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 19084 18722 gene locus_tag LOCUS_22210 19084 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 19527 21071 gene locus_tag LOCUS_22220 gene glyQS 19527 21071 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_22220 21252 23129 gene locus_tag LOCUS_22230 21252 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 23306 24391 gene locus_tag LOCUS_22240 23306 24391 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_22240 24378 25070 gene locus_tag LOCUS_22250 24378 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 26110 25067 gene locus_tag LOCUS_22260 26110 25067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 26799 26185 gene locus_tag LOCUS_22270 26799 26185 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_22270 28217 27195 gene locus_tag LOCUS_22280 gene trpS 28217 27195 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43835 protein_id gnl|my_center|LOCUS_22280 28317 29012 gene locus_tag LOCUS_22290 28317 29012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 29875 29036 gene locus_tag LOCUS_22300 29875 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 30165 29980 gene locus_tag LOCUS_22310 30165 29980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 32242 30563 gene locus_tag LOCUS_22320 32242 30563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_22320 32409 33275 gene locus_tag LOCUS_22330 gene ubiA 32409 33275 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013770.1 protein_id gnl|my_center|LOCUS_22330 35718 33721 gene locus_tag LOCUS_22340 35718 33721 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_22340 36100 36786 gene locus_tag LOCUS_22350 36100 36786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 36820 37410 gene locus_tag LOCUS_22360 36820 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_22360 37689 38018 gene locus_tag LOCUS_22370 37689 38018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 38251 38694 gene locus_tag LOCUS_22380 38251 38694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 38748 39050 gene locus_tag LOCUS_22390 38748 39050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 39034 39546 gene locus_tag LOCUS_22400 39034 39546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 39924 39643 gene locus_tag LOCUS_22410 39924 39643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 40615 39983 gene locus_tag LOCUS_22420 40615 39983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 40846 43131 gene locus_tag LOCUS_22430 40846 43131 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_22430 43244 44053 gene locus_tag LOCUS_22440 43244 44053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 44063 44677 gene locus_tag LOCUS_22450 44063 44677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 47292 44674 gene locus_tag LOCUS_22460 47292 44674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 47503 48084 gene locus_tag LOCUS_22470 47503 48084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 48163 49227 gene locus_tag LOCUS_22480 48163 49227 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070584.1 protein_id gnl|my_center|LOCUS_22480 49282 50034 gene locus_tag LOCUS_22490 49282 50034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 52112 50202 gene locus_tag LOCUS_22500 52112 50202 CDS product putative serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5F6 protein_id gnl|my_center|LOCUS_22500 >Feature sequence035 230 156 gene locus_tag LOCUS_t00360 230 156 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 477 1025 gene locus_tag LOCUS_22510 477 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1326 1027 gene locus_tag LOCUS_22520 1326 1027 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_22520 2481 1507 gene locus_tag LOCUS_22530 2481 1507 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_22530 2687 3640 gene locus_tag LOCUS_22540 2687 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6862 3650 gene locus_tag LOCUS_22550 6862 3650 CDS product DNA-dependent ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972514.1 protein_id gnl|my_center|LOCUS_22550 7101 8609 gene locus_tag LOCUS_22560 7101 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 8946 10208 gene locus_tag LOCUS_22570 gene fahA 8946 10208 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_22570 10696 10289 gene locus_tag LOCUS_22580 10696 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 12020 10857 gene locus_tag LOCUS_22590 gene hisC 12020 10857 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_22590 13371 12445 gene locus_tag LOCUS_22600 13371 12445 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_22600 14194 13439 gene locus_tag LOCUS_22610 14194 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 15466 14708 gene locus_tag LOCUS_22620 gene aroE 15466 14708 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_22620 16392 15466 gene locus_tag LOCUS_22630 16392 15466 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_22630 17549 16467 gene locus_tag LOCUS_22640 gene prfA 17549 16467 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_22640 18456 17620 gene locus_tag LOCUS_22650 gene punA 18456 17620 CDS product purine nucleoside phosphorylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46354 protein_id gnl|my_center|LOCUS_22650 19078 19527 gene locus_tag LOCUS_22660 19078 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 20590 19568 gene locus_tag LOCUS_22670 gene lpxK 20590 19568 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_22670 21015 21362 gene locus_tag LOCUS_22680 21015 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 22249 21488 gene locus_tag LOCUS_22690 22249 21488 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_22690 22887 22312 gene locus_tag LOCUS_22700 22887 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 24229 22967 gene locus_tag LOCUS_22710 24229 22967 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_22710 24887 24429 gene locus_tag LOCUS_22720 gene ssb-2 24887 24429 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Z8 protein_id gnl|my_center|LOCUS_22720 26139 25012 gene locus_tag LOCUS_22730 26139 25012 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_22730 26470 26279 gene locus_tag LOCUS_22740 26470 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 26561 27157 gene locus_tag LOCUS_22750 26561 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 27217 29298 gene locus_tag LOCUS_22760 27217 29298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_22760 29801 29385 gene locus_tag LOCUS_22770 29801 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 31290 30262 gene locus_tag LOCUS_22780 31290 30262 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_22780 31830 31459 gene locus_tag LOCUS_22790 31830 31459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 32397 31867 gene locus_tag LOCUS_22800 32397 31867 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_22800 33190 32384 gene locus_tag LOCUS_22810 33190 32384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_22810 33842 33207 gene locus_tag LOCUS_22820 33842 33207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 34313 33852 gene locus_tag LOCUS_22830 34313 33852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 34879 34448 gene locus_tag LOCUS_22840 34879 34448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 35783 35004 gene locus_tag LOCUS_22850 35783 35004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 37193 36591 gene locus_tag LOCUS_22860 37193 36591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 37786 37193 gene locus_tag LOCUS_22870 37786 37193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_22870 37950 40523 gene locus_tag LOCUS_22880 37950 40523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 43588 40856 gene locus_tag LOCUS_22890 gene alaS 43588 40856 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_22890 44042 43791 gene locus_tag LOCUS_22900 44042 43791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 45836 44154 gene locus_tag LOCUS_22910 45836 44154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 46788 45940 gene locus_tag LOCUS_22920 46788 45940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 47695 46916 gene locus_tag LOCUS_22930 47695 46916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 48779 47808 gene locus_tag LOCUS_22940 gene pfkA 48779 47808 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_22940 49224 48814 gene locus_tag LOCUS_22950 49224 48814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 49552 51366 gene locus_tag LOCUS_22960 49552 51366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence036 1139 606 gene locus_tag LOCUS_22970 gene rplI 1139 606 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAM4 protein_id gnl|my_center|LOCUS_22970 1443 1177 gene locus_tag LOCUS_22980 gene rpsR 1443 1177 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_22980 1904 1503 gene locus_tag LOCUS_22990 gene rpsF 1904 1503 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_22990 3488 2217 gene locus_tag LOCUS_23000 3488 2217 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_23000 6617 3576 gene locus_tag LOCUS_23010 6617 3576 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_23010 7005 7790 gene locus_tag LOCUS_23020 7005 7790 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_23020 9705 7837 gene locus_tag LOCUS_23030 9705 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 12300 9856 gene locus_tag LOCUS_23040 gene nrdA 12300 9856 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_23040 12674 12417 gene locus_tag LOCUS_23050 12674 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 13824 12850 gene locus_tag LOCUS_23060 gene nrdB 13824 12850 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_23060 14749 14369 gene locus_tag LOCUS_23070 14749 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 15139 15495 gene locus_tag LOCUS_23080 15139 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 15474 16544 gene locus_tag LOCUS_23090 15474 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 16547 17059 gene locus_tag LOCUS_23100 16547 17059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 17070 17873 gene locus_tag LOCUS_23110 17070 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 18404 17808 gene locus_tag LOCUS_23120 18404 17808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 19040 18426 gene locus_tag LOCUS_23130 19040 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 19554 19018 gene locus_tag LOCUS_23140 19554 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 20414 19737 gene locus_tag LOCUS_23150 20414 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 21637 20762 gene locus_tag LOCUS_23160 21637 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 23039 22056 gene locus_tag LOCUS_23170 23039 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 23573 23115 gene locus_tag LOCUS_23180 23573 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 23819 24928 gene locus_tag LOCUS_23190 gene lpxB 23819 24928 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_23190 25015 27312 gene locus_tag LOCUS_23200 25015 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 27924 27337 gene locus_tag LOCUS_23210 27924 27337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957050.1 protein_id gnl|my_center|LOCUS_23210 28085 30475 gene locus_tag LOCUS_23220 gene pbpC 28085 30475 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_23220 31240 30686 gene locus_tag LOCUS_23230 31240 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 33173 31254 gene locus_tag LOCUS_23240 33173 31254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 35408 33870 gene locus_tag LOCUS_23250 35408 33870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 35598 36821 gene locus_tag LOCUS_23260 35598 36821 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_23260 37027 36848 gene locus_tag LOCUS_23270 37027 36848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 37201 37046 gene locus_tag LOCUS_23280 37201 37046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 37157 37342 gene locus_tag LOCUS_23290 37157 37342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 43892 37632 gene locus_tag LOCUS_23300 43892 37632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 44155 44688 gene locus_tag LOCUS_23310 44155 44688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 44728 45222 gene locus_tag LOCUS_23320 44728 45222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 46008 45706 gene locus_tag LOCUS_23330 46008 45706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23330 46429 46001 gene locus_tag LOCUS_23340 46429 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 46738 47031 gene locus_tag LOCUS_23350 46738 47031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 47054 47197 gene locus_tag LOCUS_23360 47054 47197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 47366 47668 gene locus_tag LOCUS_23370 47366 47668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 47692 48474 gene locus_tag LOCUS_23380 47692 48474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 49811 48669 gene locus_tag LOCUS_23390 gene mqnC 49811 48669 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE5 protein_id gnl|my_center|LOCUS_23390 >Feature sequence037 240 55 gene locus_tag LOCUS_23400 240 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 493 2289 gene locus_tag LOCUS_23410 gene gsiA 493 2289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_23410 2414 3814 gene locus_tag LOCUS_23420 2414 3814 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931971.1 protein_id gnl|my_center|LOCUS_23420 4162 5271 gene locus_tag LOCUS_23430 4162 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 5435 6847 gene locus_tag LOCUS_23440 gene lpdA1 5435 6847 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_23440 7043 7504 gene locus_tag LOCUS_23450 7043 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 9233 7587 gene locus_tag LOCUS_23460 9233 7587 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_23460 10845 9298 gene locus_tag LOCUS_23470 gene prc 10845 9298 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_23470 11470 10988 gene locus_tag LOCUS_23480 11470 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 12299 11502 gene locus_tag LOCUS_23490 gene murI 12299 11502 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFN6 protein_id gnl|my_center|LOCUS_23490 12621 14444 gene locus_tag LOCUS_23500 12621 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 14458 15042 gene locus_tag LOCUS_23510 14458 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 15069 15401 gene locus_tag LOCUS_23520 15069 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 15405 16058 gene locus_tag LOCUS_23530 15405 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_23530 16842 16081 gene locus_tag LOCUS_23540 16842 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 18279 17197 gene locus_tag LOCUS_23550 18279 17197 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_23550 19592 18438 gene locus_tag LOCUS_23560 gene bioF 19592 18438 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_23560 19861 20484 gene locus_tag LOCUS_23570 19861 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 20487 20969 gene locus_tag LOCUS_23580 20487 20969 CDS product 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809749.1 protein_id gnl|my_center|LOCUS_23580 20985 21698 gene locus_tag LOCUS_23590 20985 21698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23590 22741 21734 gene locus_tag LOCUS_23600 22741 21734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_23600 23798 22935 gene locus_tag LOCUS_23610 23798 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 23994 24200 gene locus_tag LOCUS_23620 23994 24200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 25043 24213 gene locus_tag LOCUS_23630 25043 24213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 26009 25167 gene locus_tag LOCUS_23640 26009 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 26773 26102 gene locus_tag LOCUS_23650 26773 26102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 26996 28039 gene locus_tag LOCUS_23660 26996 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 28155 28463 gene locus_tag LOCUS_23670 28155 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 28460 28846 gene locus_tag LOCUS_23680 28460 28846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 29102 29416 gene locus_tag LOCUS_23690 gene ydzA 29102 29416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_23690 31825 29549 gene locus_tag LOCUS_23700 31825 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 36048 32020 gene locus_tag LOCUS_23710 36048 32020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 40004 36312 gene locus_tag LOCUS_23720 40004 36312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 40228 41685 gene locus_tag LOCUS_23730 40228 41685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 41757 42125 gene locus_tag LOCUS_23740 41757 42125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 42254 42520 gene locus_tag LOCUS_23750 42254 42520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 42826 43677 gene locus_tag LOCUS_23760 42826 43677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_23760 46710 43762 gene locus_tag LOCUS_23770 46710 43762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 48108 47095 gene locus_tag LOCUS_23780 48108 47095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 48422 48832 gene locus_tag LOCUS_23790 48422 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 49054 49944 gene locus_tag LOCUS_23800 49054 49944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence038 234 1415 gene locus_tag LOCUS_23810 234 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1807 1418 gene locus_tag LOCUS_23820 1807 1418 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901086.1 protein_id gnl|my_center|LOCUS_23820 2301 1915 gene locus_tag LOCUS_23830 2301 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3512 2448 gene locus_tag LOCUS_23840 3512 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948228.1 protein_id gnl|my_center|LOCUS_23840 4346 3534 gene locus_tag LOCUS_23850 4346 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 4799 4356 gene locus_tag LOCUS_23860 4799 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4777 5004 gene locus_tag LOCUS_23870 4777 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4997 5329 gene locus_tag LOCUS_23880 4997 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 5810 5337 gene locus_tag LOCUS_23890 5810 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 6602 5877 gene locus_tag LOCUS_23900 6602 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 6747 7214 gene locus_tag LOCUS_23910 6747 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035532.1 protein_id gnl|my_center|LOCUS_23910 8172 7459 gene locus_tag LOCUS_23920 8172 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 8757 8197 gene locus_tag LOCUS_23930 8757 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_23930 9329 8769 gene locus_tag LOCUS_23940 9329 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9858 9349 gene locus_tag LOCUS_23950 9858 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 10507 10097 gene locus_tag LOCUS_23960 10507 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 11253 10519 gene locus_tag LOCUS_23970 11253 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 11977 11273 gene locus_tag LOCUS_23980 11977 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 12420 11998 gene locus_tag LOCUS_23990 12420 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 13054 12365 gene locus_tag LOCUS_24000 13054 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24000 14810 13185 gene locus_tag LOCUS_24010 14810 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 15426 14911 gene locus_tag LOCUS_24020 15426 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 16200 15658 gene locus_tag LOCUS_24030 16200 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 16994 16266 gene locus_tag LOCUS_24040 16994 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 18492 17047 gene locus_tag LOCUS_24050 18492 17047 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_24050 19028 18804 gene locus_tag LOCUS_24060 19028 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 20030 19182 gene locus_tag LOCUS_24070 20030 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 21884 20043 gene locus_tag LOCUS_24080 21884 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 22092 22652 gene locus_tag LOCUS_24090 22092 22652 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97K31 protein_id gnl|my_center|LOCUS_24090 23140 22676 gene locus_tag LOCUS_24100 23140 22676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 24513 23374 gene locus_tag LOCUS_24110 24513 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 24800 25549 gene locus_tag LOCUS_24120 24800 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 26396 25563 gene locus_tag LOCUS_24130 26396 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 26966 26478 gene locus_tag LOCUS_24140 26966 26478 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_24140 27966 27229 gene locus_tag LOCUS_24150 27966 27229 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_24150 28691 28149 gene locus_tag LOCUS_24160 28691 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 28848 29810 gene locus_tag LOCUS_24170 28848 29810 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_24170 30268 30738 gene locus_tag LOCUS_24180 30268 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 32243 30792 gene locus_tag LOCUS_24190 32243 30792 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_24190 33701 32397 gene locus_tag LOCUS_24200 33701 32397 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920961.1 protein_id gnl|my_center|LOCUS_24200 35101 33989 gene locus_tag LOCUS_24210 35101 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 35820 35122 gene locus_tag LOCUS_24220 35820 35122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_24220 35989 36495 gene locus_tag LOCUS_24230 35989 36495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 37550 36711 gene locus_tag LOCUS_24240 37550 36711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 38255 37812 gene locus_tag LOCUS_24250 38255 37812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_24250 39376 38513 gene locus_tag LOCUS_24260 39376 38513 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 protein_id gnl|my_center|LOCUS_24260 39885 39433 gene locus_tag LOCUS_24270 39885 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 40878 39967 gene locus_tag LOCUS_24280 40878 39967 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_24280 41838 40888 gene locus_tag LOCUS_24290 41838 40888 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_24290 43179 42313 gene locus_tag LOCUS_24300 43179 42313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 44262 43267 gene locus_tag LOCUS_24310 44262 43267 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_24310 44361 44717 gene locus_tag LOCUS_24320 44361 44717 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_24320 45339 44743 gene locus_tag LOCUS_24330 45339 44743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 46150 45590 gene locus_tag LOCUS_24340 46150 45590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 47297 46395 gene locus_tag LOCUS_24350 47297 46395 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_24350 47391 47987 gene locus_tag LOCUS_24360 gene mdaB 47391 47987 CDS product NADPH quinone reductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207799.1 protein_id gnl|my_center|LOCUS_24360 48335 48096 gene locus_tag LOCUS_24370 48335 48096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 48961 48683 gene locus_tag LOCUS_24380 48961 48683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence039 3426 2443 gene locus_tag LOCUS_24390 3426 2443 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_24390 3712 4938 gene locus_tag LOCUS_24400 3712 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_24400 5107 10023 gene locus_tag LOCUS_24410 5107 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 12441 10099 gene locus_tag LOCUS_24420 12441 10099 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_24420 13331 12873 gene locus_tag LOCUS_24430 13331 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 13815 15182 gene locus_tag LOCUS_24440 13815 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 15294 16952 gene locus_tag LOCUS_24450 15294 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 17013 18623 gene locus_tag LOCUS_24460 17013 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 19551 18628 gene locus_tag LOCUS_24470 19551 18628 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_24470 19665 21488 gene locus_tag LOCUS_24480 19665 21488 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_24480 21840 24002 gene locus_tag LOCUS_24490 21840 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 24023 25402 gene locus_tag LOCUS_24500 24023 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 26504 25470 gene locus_tag LOCUS_24510 26504 25470 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_24510 27841 27002 gene locus_tag LOCUS_24520 27841 27002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 28259 29056 gene locus_tag LOCUS_24530 gene lpxH 28259 29056 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_24530 29166 29987 gene locus_tag LOCUS_24540 29166 29987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 30219 30292 gene locus_tag LOCUS_t00370 30219 30292 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30679 30876 gene locus_tag LOCUS_24550 30679 30876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 31250 31420 gene locus_tag LOCUS_24560 31250 31420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 31721 33046 gene locus_tag LOCUS_24570 31721 33046 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_24570 33056 33760 gene locus_tag LOCUS_24580 33056 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 34234 37224 gene locus_tag LOCUS_24590 34234 37224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 40732 37307 gene locus_tag LOCUS_24600 40732 37307 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_24600 42681 41395 gene locus_tag LOCUS_24610 42681 41395 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_24610 44161 42974 gene locus_tag LOCUS_24620 44161 42974 CDS product type I restriction modification enzyme, S subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123347.1 protein_id gnl|my_center|LOCUS_24620 45692 44175 gene locus_tag LOCUS_24630 gene hsdM 45692 44175 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_24630 47346 45853 gene locus_tag LOCUS_24640 47346 45853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 48515 47388 gene locus_tag LOCUS_24650 48515 47388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence040 475 1467 gene locus_tag LOCUS_24660 475 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1596 2798 gene locus_tag LOCUS_24670 1596 2798 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_24670 4248 2803 gene locus_tag LOCUS_24680 4248 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 4317 5468 gene locus_tag LOCUS_24690 4317 5468 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_24690 5705 6367 gene locus_tag LOCUS_24700 5705 6367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_24700 6425 7198 gene locus_tag LOCUS_24710 6425 7198 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_24710 9458 7542 gene locus_tag LOCUS_24720 9458 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 10452 9490 gene locus_tag LOCUS_24730 10452 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 12197 10707 gene locus_tag LOCUS_24740 12197 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 14465 12279 gene locus_tag LOCUS_24750 14465 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 15509 14499 gene locus_tag LOCUS_24760 15509 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 16085 15546 gene locus_tag LOCUS_24770 16085 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 16771 16091 gene locus_tag LOCUS_24780 16771 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 17248 16784 gene locus_tag LOCUS_24790 17248 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 18197 17289 gene locus_tag LOCUS_24800 18197 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 22466 18390 gene locus_tag LOCUS_24810 22466 18390 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_24810 22765 23982 gene locus_tag LOCUS_24820 22765 23982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 25685 24177 gene locus_tag LOCUS_24830 25685 24177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_24830 28823 25707 gene locus_tag LOCUS_24840 28823 25707 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404904.1 protein_id gnl|my_center|LOCUS_24840 28989 28840 gene locus_tag LOCUS_24850 28989 28840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 30312 29311 gene locus_tag LOCUS_24860 30312 29311 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_24860 30815 30351 gene locus_tag LOCUS_24870 30815 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 32903 30987 gene locus_tag LOCUS_24880 gene asnB-2 32903 30987 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_24880 33538 33206 gene locus_tag LOCUS_24890 33538 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 33881 33645 gene locus_tag LOCUS_24900 33881 33645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 34615 33881 gene locus_tag LOCUS_24910 34615 33881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_24910 36268 34907 gene locus_tag LOCUS_24920 36268 34907 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366535.1 protein_id gnl|my_center|LOCUS_24920 39345 36289 gene locus_tag LOCUS_24930 39345 36289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 39508 40059 gene locus_tag LOCUS_24940 gene nlpD 39508 40059 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255725.1 protein_id gnl|my_center|LOCUS_24940 40067 40936 gene locus_tag LOCUS_24950 40067 40936 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_24950 40933 41430 gene locus_tag LOCUS_24960 40933 41430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 41439 41783 gene locus_tag LOCUS_24970 41439 41783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_24970 41862 42542 gene locus_tag LOCUS_24980 41862 42542 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_24980 46731 42634 gene locus_tag LOCUS_24990 46731 42634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 47167 47523 gene locus_tag LOCUS_25000 47167 47523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 48107 47532 gene locus_tag LOCUS_25010 48107 47532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence041 290 87 gene locus_tag LOCUS_25020 290 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1360 392 gene locus_tag LOCUS_25030 1360 392 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_25030 2355 1849 gene locus_tag LOCUS_25040 gene rpsP 2355 1849 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_25040 3996 2557 gene locus_tag LOCUS_25050 3996 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4502 4870 gene locus_tag LOCUS_25060 4502 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4998 8558 gene locus_tag LOCUS_25070 4998 8558 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962756.1 protein_id gnl|my_center|LOCUS_25070 8804 9310 gene locus_tag LOCUS_25080 gene csfT 8804 9310 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_25080 9300 10595 gene locus_tag LOCUS_25090 9300 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13900 10652 gene locus_tag LOCUS_25100 13900 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 14199 20381 gene locus_tag LOCUS_25110 14199 20381 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_25110 20688 21572 gene locus_tag LOCUS_25120 20688 21572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 21630 24161 gene locus_tag LOCUS_25130 21630 24161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 24235 25932 gene locus_tag LOCUS_25140 24235 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 27524 25995 gene locus_tag LOCUS_25150 27524 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 28329 27592 gene locus_tag LOCUS_25160 28329 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 28551 29516 gene locus_tag LOCUS_25170 28551 29516 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_25170 29549 30277 gene locus_tag LOCUS_25180 29549 30277 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_25180 30472 30287 gene locus_tag LOCUS_25190 30472 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 30458 31126 gene locus_tag LOCUS_25200 30458 31126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105161.1 protein_id gnl|my_center|LOCUS_25200 31225 32151 gene locus_tag LOCUS_25210 gene yegK 31225 32151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76395 protein_id gnl|my_center|LOCUS_25210 32217 34436 gene locus_tag LOCUS_25220 32217 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 34621 34932 gene locus_tag LOCUS_25230 gene rpmE2 34621 34932 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_25230 35228 37129 gene locus_tag LOCUS_25240 35228 37129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 38200 37277 gene locus_tag LOCUS_25250 38200 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 38397 39446 gene locus_tag LOCUS_25260 gene metX 38397 39446 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_25260 40946 39447 gene locus_tag LOCUS_25270 40946 39447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_25270 41104 41784 gene locus_tag LOCUS_25280 41104 41784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 41810 42661 gene locus_tag LOCUS_25290 41810 42661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 43356 42682 gene locus_tag LOCUS_25300 43356 42682 CDS product peptidoglycan peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_714690.1 protein_id gnl|my_center|LOCUS_25300 44295 43432 gene locus_tag LOCUS_25310 44295 43432 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286976.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence042 1119 385 gene locus_tag LOCUS_25320 1119 385 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_25320 1298 3178 gene locus_tag LOCUS_25330 1298 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3216 3971 gene locus_tag LOCUS_25340 3216 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4049 5344 gene locus_tag LOCUS_25350 4049 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 5380 6417 gene locus_tag LOCUS_25360 5380 6417 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_25360 6651 6950 gene locus_tag LOCUS_25370 6651 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 7537 7052 gene locus_tag LOCUS_25380 7537 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 8567 7629 gene locus_tag LOCUS_25390 8567 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 9858 8929 gene locus_tag LOCUS_25400 9858 8929 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_25400 11935 9884 gene locus_tag LOCUS_25410 11935 9884 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_25410 13744 12128 gene locus_tag LOCUS_25420 13744 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 13978 14511 gene locus_tag LOCUS_25430 13978 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 16073 14610 gene locus_tag LOCUS_25440 16073 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 17802 16816 gene locus_tag LOCUS_25450 17802 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 24909 17821 gene locus_tag LOCUS_25460 24909 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 30084 25387 gene locus_tag LOCUS_25470 30084 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 30900 30310 gene locus_tag LOCUS_25480 30900 30310 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_25480 31139 31333 gene locus_tag LOCUS_25490 31139 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 33712 31262 gene locus_tag LOCUS_25500 33712 31262 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_25500 35137 33929 gene locus_tag LOCUS_25510 35137 33929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 35267 36748 gene locus_tag LOCUS_25520 35267 36748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_25520 39128 36909 gene locus_tag LOCUS_25530 39128 36909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 41440 39581 gene locus_tag LOCUS_25540 41440 39581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 41743 42147 gene locus_tag LOCUS_25550 41743 42147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 42218 43315 gene locus_tag LOCUS_25560 42218 43315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 44727 43465 gene locus_tag LOCUS_25570 44727 43465 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIE0 protein_id gnl|my_center|LOCUS_25570 >Feature sequence043 1664 330 gene locus_tag LOCUS_25580 gene erg3 1664 330 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_25580 3068 1794 gene locus_tag LOCUS_25590 3068 1794 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_25590 3997 3080 gene locus_tag LOCUS_25600 3997 3080 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_25600 5221 4196 gene locus_tag LOCUS_25610 5221 4196 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_25610 5622 6299 gene locus_tag LOCUS_25620 5622 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 6436 7740 gene locus_tag LOCUS_25630 6436 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 7772 8476 gene locus_tag LOCUS_25640 7772 8476 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_25640 9297 8575 gene locus_tag LOCUS_25650 9297 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016054.1 protein_id gnl|my_center|LOCUS_25650 9630 10193 gene locus_tag LOCUS_25660 9630 10193 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_25660 10302 12710 gene locus_tag LOCUS_25670 10302 12710 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_25670 12799 13218 gene locus_tag LOCUS_25680 12799 13218 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_25680 13413 14582 gene locus_tag LOCUS_25690 13413 14582 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_25690 14774 16249 gene locus_tag LOCUS_25700 14774 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 16218 16460 gene locus_tag LOCUS_25710 16218 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 16706 17116 gene locus_tag LOCUS_25720 gene rpsL 16706 17116 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_25720 17268 17738 gene locus_tag LOCUS_25730 gene rpsG 17268 17738 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_25730 17804 19939 gene locus_tag LOCUS_25740 gene fusA 17804 19939 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_25740 20043 20351 gene locus_tag LOCUS_25750 gene rpsJ 20043 20351 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_25750 20418 21074 gene locus_tag LOCUS_25760 gene rplC 20418 21074 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A476 protein_id gnl|my_center|LOCUS_25760 21081 21908 gene locus_tag LOCUS_25770 21081 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 21929 22279 gene locus_tag LOCUS_25780 gene rplW 21929 22279 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_25780 22328 23164 gene locus_tag LOCUS_25790 gene rplB 22328 23164 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_25790 23167 23436 gene locus_tag LOCUS_25800 gene rpsS 23167 23436 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_25800 23472 23885 gene locus_tag LOCUS_25810 23472 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 23906 24655 gene locus_tag LOCUS_25820 gene rpsC 23906 24655 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A482 protein_id gnl|my_center|LOCUS_25820 24790 25209 gene locus_tag LOCUS_25830 gene rplP 24790 25209 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH9 protein_id gnl|my_center|LOCUS_25830 25228 25506 gene locus_tag LOCUS_25840 25228 25506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 25522 25788 gene locus_tag LOCUS_25850 gene rpsQ 25522 25788 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_25850 25805 26173 gene locus_tag LOCUS_25860 gene rplN 25805 26173 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_25860 26183 26512 gene locus_tag LOCUS_25870 gene rplX 26183 26512 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYX8 protein_id gnl|my_center|LOCUS_25870 26512 27063 gene locus_tag LOCUS_25880 gene rplE 26512 27063 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_25880 27072 27341 gene locus_tag LOCUS_25890 gene rpsN 27072 27341 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAI5 protein_id gnl|my_center|LOCUS_25890 27481 27885 gene locus_tag LOCUS_25900 gene rpsH 27481 27885 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_25900 27927 28484 gene locus_tag LOCUS_25910 gene rplF 27927 28484 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_25910 28635 29015 gene locus_tag LOCUS_25920 gene rplR 28635 29015 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_25920 29040 29558 gene locus_tag LOCUS_25930 gene rpsE 29040 29558 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_25930 29585 29764 gene locus_tag LOCUS_25940 gene rpmD 29585 29764 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP0 protein_id gnl|my_center|LOCUS_25940 29797 30510 gene locus_tag LOCUS_25950 29797 30510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 30594 31952 gene locus_tag LOCUS_25960 gene secY 30594 31952 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_25960 32070 32288 gene locus_tag LOCUS_25970 gene infA 32070 32288 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7W6 protein_id gnl|my_center|LOCUS_25970 32452 32829 gene locus_tag LOCUS_25980 gene rpsM 32452 32829 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A499 protein_id gnl|my_center|LOCUS_25980 32869 33258 gene locus_tag LOCUS_25990 gene rpsK 32869 33258 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3P1 protein_id gnl|my_center|LOCUS_25990 33314 33928 gene locus_tag LOCUS_26000 gene rpsD 33314 33928 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_26000 34088 35086 gene locus_tag LOCUS_26010 gene rpoA 34088 35086 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_26010 35222 35764 gene locus_tag LOCUS_26020 gene rplQ 35222 35764 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_26020 35837 37207 gene locus_tag LOCUS_26030 35837 37207 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_26030 37299 38285 gene locus_tag LOCUS_26040 37299 38285 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_26040 38980 38282 gene locus_tag LOCUS_26050 38980 38282 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_26050 40205 38973 gene locus_tag LOCUS_26060 40205 38973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 40620 41375 gene locus_tag LOCUS_26070 40620 41375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 42118 41372 gene locus_tag LOCUS_26080 42118 41372 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_26080 43992 42136 gene locus_tag LOCUS_26090 43992 42136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 44357 45067 gene locus_tag LOCUS_26100 44357 45067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence044 3568 344 gene locus_tag LOCUS_26110 3568 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 5443 3611 gene locus_tag LOCUS_26120 5443 3611 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_26120 5647 6720 gene locus_tag LOCUS_26130 5647 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_26130 8285 6888 gene locus_tag LOCUS_26140 8285 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 9971 8406 gene locus_tag LOCUS_26150 9971 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 10707 11954 gene locus_tag LOCUS_26160 gene pdhC 10707 11954 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_26160 12295 15549 gene locus_tag LOCUS_26170 12295 15549 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MI38 protein_id gnl|my_center|LOCUS_26170 15760 16686 gene locus_tag LOCUS_26180 15760 16686 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_26180 17842 16778 gene locus_tag LOCUS_26190 17842 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 18083 19210 gene locus_tag LOCUS_26200 18083 19210 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_26200 19213 19716 gene locus_tag LOCUS_26210 19213 19716 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506656.1 protein_id gnl|my_center|LOCUS_26210 19888 19804 gene locus_tag LOCUS_t00380 19888 19804 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22089 20182 gene locus_tag LOCUS_26220 gene dnaK 22089 20182 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_26220 23592 22369 gene locus_tag LOCUS_26230 23592 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 23981 24796 gene locus_tag LOCUS_26240 gene panB 23981 24796 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_26240 24834 25943 gene locus_tag LOCUS_26250 gene pabC 24834 25943 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_26250 26103 26471 gene locus_tag LOCUS_26260 26103 26471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 26689 27912 gene locus_tag LOCUS_26270 26689 27912 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_26270 28477 28001 gene locus_tag LOCUS_26280 28477 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 29121 28477 gene locus_tag LOCUS_26290 29121 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 29312 29722 gene locus_tag LOCUS_26300 29312 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 29725 30078 gene locus_tag LOCUS_26310 29725 30078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 30273 31526 gene locus_tag LOCUS_26320 gene aspC2 30273 31526 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_26320 31574 33262 gene locus_tag LOCUS_26330 gene pckA 31574 33262 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_26330 33475 33765 gene locus_tag LOCUS_26340 33475 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 33938 34588 gene locus_tag LOCUS_26350 33938 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 34676 35395 gene locus_tag LOCUS_26360 34676 35395 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9H7 protein_id gnl|my_center|LOCUS_26360 35434 38127 gene locus_tag LOCUS_26370 35434 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 38992 38138 gene locus_tag LOCUS_26380 38992 38138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 39967 39077 gene locus_tag LOCUS_26390 39967 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 40144 40791 gene locus_tag LOCUS_26400 40144 40791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 41602 40820 gene locus_tag LOCUS_26410 gene yhaZ 41602 40820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521726.1 protein_id gnl|my_center|LOCUS_26410 42167 41592 gene locus_tag LOCUS_26420 42167 41592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 42301 43089 gene locus_tag LOCUS_26430 42301 43089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 43175 44524 gene locus_tag LOCUS_26440 43175 44524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence045 589 1770 gene locus_tag LOCUS_26450 589 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704906.1 protein_id gnl|my_center|LOCUS_26450 1974 3176 gene locus_tag LOCUS_26460 1974 3176 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_26460 3179 4165 gene locus_tag LOCUS_26470 3179 4165 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_26470 4733 4293 gene locus_tag LOCUS_26480 4733 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 4839 6518 gene locus_tag LOCUS_26490 4839 6518 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_26490 8377 6608 gene locus_tag LOCUS_26500 8377 6608 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_26500 8657 9067 gene locus_tag LOCUS_26510 8657 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 9187 9708 gene locus_tag LOCUS_26520 9187 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 9772 11241 gene locus_tag LOCUS_26530 9772 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 11387 11662 gene locus_tag LOCUS_26540 11387 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 12984 11737 gene locus_tag LOCUS_26550 12984 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 13209 14393 gene locus_tag LOCUS_26560 13209 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 15467 14373 gene locus_tag LOCUS_26570 15467 14373 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_26570 16098 15544 gene locus_tag LOCUS_26580 16098 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 18874 16109 gene locus_tag LOCUS_26590 gene sucA 18874 16109 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_26590 19568 19149 gene locus_tag LOCUS_26600 19568 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 20000 19584 gene locus_tag LOCUS_26610 20000 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 20348 20007 gene locus_tag LOCUS_26620 20348 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 22606 20408 gene locus_tag LOCUS_26630 22606 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 23672 22899 gene locus_tag LOCUS_26640 gene sdhB 23672 22899 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_26640 25750 23735 gene locus_tag LOCUS_26650 gene sdhA 25750 23735 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_26650 26383 25802 gene locus_tag LOCUS_26660 26383 25802 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_26660 28152 27460 gene locus_tag LOCUS_26670 28152 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 29598 29284 gene locus_tag LOCUS_26680 29598 29284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 31518 29713 gene locus_tag LOCUS_26690 31518 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 32057 32731 gene locus_tag LOCUS_26700 32057 32731 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_26700 33052 33372 gene locus_tag LOCUS_26710 33052 33372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 33551 33919 gene locus_tag LOCUS_26720 33551 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 34061 35191 gene locus_tag LOCUS_26730 34061 35191 CDS product glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 protein_id gnl|my_center|LOCUS_26730 35813 35382 gene locus_tag LOCUS_26740 35813 35382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 38056 36140 gene locus_tag LOCUS_26750 38056 36140 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_26750 38231 38734 gene locus_tag LOCUS_26760 38231 38734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 38745 39245 gene locus_tag LOCUS_26770 38745 39245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 39333 40529 gene locus_tag LOCUS_26780 39333 40529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 42741 40597 gene locus_tag LOCUS_26790 gene mcm3 42741 40597 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_26790 43295 42855 gene locus_tag LOCUS_26800 43295 42855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 44155 43301 gene locus_tag LOCUS_26810 44155 43301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence046 751 2220 gene locus_tag LOCUS_26820 751 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 protein_id gnl|my_center|LOCUS_26820 2298 3218 gene locus_tag LOCUS_26830 2298 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 6186 3385 gene locus_tag LOCUS_26840 6186 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 6466 7878 gene locus_tag LOCUS_26850 6466 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 8188 8994 gene locus_tag LOCUS_26860 8188 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 9046 9771 gene locus_tag LOCUS_26870 9046 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 10305 9898 gene locus_tag LOCUS_26880 10305 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 11814 10387 gene locus_tag LOCUS_26890 11814 10387 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_26890 12817 11930 gene locus_tag LOCUS_26900 12817 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 13015 13548 gene locus_tag LOCUS_26910 13015 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 13709 14338 gene locus_tag LOCUS_26920 13709 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 14342 14686 gene locus_tag LOCUS_26930 14342 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 15960 14815 gene locus_tag LOCUS_26940 15960 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 16545 16117 gene locus_tag LOCUS_26950 16545 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_26950 18018 17014 gene locus_tag LOCUS_26960 18018 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 18741 18103 gene locus_tag LOCUS_26970 18741 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 20569 18794 gene locus_tag LOCUS_26980 20569 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 21182 22600 gene locus_tag LOCUS_26990 gene actA 21182 22600 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_26990 22720 26082 gene locus_tag LOCUS_27000 22720 26082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 26159 27580 gene locus_tag LOCUS_27010 gene actC 26159 27580 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_27010 27648 28181 gene locus_tag LOCUS_27020 gene actD 27648 28181 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_27020 28231 28968 gene locus_tag LOCUS_27030 gene actE 28231 28968 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_27030 29090 30721 gene locus_tag LOCUS_27040 29090 30721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 30859 32232 gene locus_tag LOCUS_27050 30859 32232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 32324 34192 gene locus_tag LOCUS_27060 gene ctaD 32324 34192 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_27060 34231 35148 gene locus_tag LOCUS_27070 gene ctaB 34231 35148 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_27070 35175 35750 gene locus_tag LOCUS_27080 gene ctaE 35175 35750 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_27080 35784 36791 gene locus_tag LOCUS_27090 35784 36791 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_27090 36827 37288 gene locus_tag LOCUS_27100 36827 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 37511 38086 gene locus_tag LOCUS_27110 37511 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 38154 38690 gene locus_tag LOCUS_27120 gene yozB 38154 38690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_27120 38713 39024 gene locus_tag LOCUS_27130 38713 39024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 39100 40464 gene locus_tag LOCUS_27140 39100 40464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 40667 41926 gene locus_tag LOCUS_27150 gene hemA 40667 41926 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJZ3 protein_id gnl|my_center|LOCUS_27150 41996 42904 gene locus_tag LOCUS_27160 gene hemC 41996 42904 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_27160 >Feature sequence047 1236 1967 gene locus_tag LOCUS_27170 gene kdsB 1236 1967 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_27170 2094 2651 gene locus_tag LOCUS_27180 2094 2651 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_27180 3658 2654 gene locus_tag LOCUS_27190 3658 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4779 3922 gene locus_tag LOCUS_27200 4779 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 5836 5021 gene locus_tag LOCUS_27210 5836 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 6933 6085 gene locus_tag LOCUS_27220 6933 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 8086 7193 gene locus_tag LOCUS_27230 8086 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 8999 8250 gene locus_tag LOCUS_27240 gene sodA 8999 8250 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW1 protein_id gnl|my_center|LOCUS_27240 10412 9240 gene locus_tag LOCUS_27250 10412 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 10613 11656 gene locus_tag LOCUS_27260 gene gpsA 10613 11656 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_27260 11802 12278 gene locus_tag LOCUS_27270 11802 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 12575 13045 gene locus_tag LOCUS_27280 12575 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 13530 13108 gene locus_tag LOCUS_27290 13530 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 14129 13542 gene locus_tag LOCUS_27300 14129 13542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 15282 14266 gene locus_tag LOCUS_27310 gene pdhA 15282 14266 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_27310 16558 15452 gene locus_tag LOCUS_27320 16558 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 17317 16628 gene locus_tag LOCUS_27330 17317 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 17511 19868 gene locus_tag LOCUS_27340 17511 19868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 20325 19948 gene locus_tag LOCUS_27350 20325 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 22584 20644 gene locus_tag LOCUS_27360 22584 20644 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_27360 23288 22731 gene locus_tag LOCUS_27370 23288 22731 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_27370 24135 23557 gene locus_tag LOCUS_27380 24135 23557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_27380 24260 24670 gene locus_tag LOCUS_27390 24260 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202918.1 protein_id gnl|my_center|LOCUS_27390 28949 24660 gene locus_tag LOCUS_27400 28949 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 29448 31361 gene locus_tag LOCUS_27410 gene pop 29448 31361 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_27410 31572 32309 gene locus_tag LOCUS_27420 31572 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 32320 32865 gene locus_tag LOCUS_27430 32320 32865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 33096 33515 gene locus_tag LOCUS_27440 33096 33515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 34821 33973 gene locus_tag LOCUS_27450 34821 33973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 36524 35625 gene locus_tag LOCUS_27460 gene xerD 36524 35625 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_27460 37828 36935 gene locus_tag LOCUS_27470 37828 36935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 38228 37881 gene locus_tag LOCUS_27480 38228 37881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 38720 38274 gene locus_tag LOCUS_27490 38720 38274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_27490 39873 38938 gene locus_tag LOCUS_27500 gene nusB 39873 38938 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_27500 40988 40569 gene locus_tag LOCUS_27510 40988 40569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 42472 41324 gene locus_tag LOCUS_27520 42472 41324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence048 844 140 gene locus_tag LOCUS_27530 844 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1087 2082 gene locus_tag LOCUS_27540 1087 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2095 2955 gene locus_tag LOCUS_27550 2095 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3128 3802 gene locus_tag LOCUS_27560 3128 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3956 4270 gene locus_tag LOCUS_27570 3956 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 10294 4817 gene locus_tag LOCUS_27580 10294 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 11246 10554 gene locus_tag LOCUS_27590 11246 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 12229 11300 gene locus_tag LOCUS_27600 gene fmt 12229 11300 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_27600 12798 12355 gene locus_tag LOCUS_27610 12798 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 13478 12810 gene locus_tag LOCUS_27620 gene rpe 13478 12810 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEV5 protein_id gnl|my_center|LOCUS_27620 15293 13707 gene locus_tag LOCUS_27630 15293 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 18599 15450 gene locus_tag LOCUS_27640 18599 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_27640 18832 19662 gene locus_tag LOCUS_27650 18832 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_27650 20096 19827 gene locus_tag LOCUS_27660 20096 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 20808 20113 gene locus_tag LOCUS_27670 20808 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 21380 20922 gene locus_tag LOCUS_27680 21380 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 21732 23522 gene locus_tag LOCUS_27690 21732 23522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 24580 23537 gene locus_tag LOCUS_27700 24580 23537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 25438 24608 gene locus_tag LOCUS_27710 gene tylF 25438 24608 CDS product macrocin O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726905.1 protein_id gnl|my_center|LOCUS_27710 26989 25442 gene locus_tag LOCUS_27720 26989 25442 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_27720 27433 27633 gene locus_tag LOCUS_27730 27433 27633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 27738 29408 gene locus_tag LOCUS_27740 27738 29408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 31959 29566 gene locus_tag LOCUS_27750 31959 29566 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_27750 32570 32295 gene locus_tag LOCUS_27760 32570 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 32597 32791 gene locus_tag LOCUS_27770 32597 32791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 32776 33087 gene locus_tag LOCUS_27780 32776 33087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 33198 34010 gene locus_tag LOCUS_27790 33198 34010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 34003 34332 gene locus_tag LOCUS_27800 34003 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 34547 35752 gene locus_tag LOCUS_27810 gene coaBC 34547 35752 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_27810 35846 36766 gene locus_tag LOCUS_27820 35846 36766 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_27820 38917 36782 gene locus_tag LOCUS_27830 38917 36782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 38997 39182 gene locus_tag LOCUS_27840 38997 39182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 39191 39541 gene locus_tag LOCUS_27850 gene fdx1 39191 39541 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_27850 39629 39703 gene locus_tag LOCUS_t00390 39629 39703 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 39805 40869 gene locus_tag LOCUS_27860 39805 40869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence049 188 1858 gene locus_tag LOCUS_27870 188 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2387 1941 gene locus_tag LOCUS_27880 2387 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3022 2543 gene locus_tag LOCUS_27890 3022 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3591 3115 gene locus_tag LOCUS_27900 3591 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 4470 3697 gene locus_tag LOCUS_27910 4470 3697 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_27910 4617 5015 gene locus_tag LOCUS_27920 gene rsfS 4617 5015 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_27920 5196 5029 gene locus_tag LOCUS_27930 5196 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 5390 7420 gene locus_tag LOCUS_27940 gene ftsH 5390 7420 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_27940 7704 8333 gene locus_tag LOCUS_27950 7704 8333 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_27950 8591 9112 gene locus_tag LOCUS_27960 8591 9112 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_27960 9087 9572 gene locus_tag LOCUS_27970 9087 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 9736 10272 gene locus_tag LOCUS_27980 9736 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_27980 10599 11162 gene locus_tag LOCUS_27990 10599 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 11817 11254 gene locus_tag LOCUS_28000 gene frr 11817 11254 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_28000 12769 12056 gene locus_tag LOCUS_28010 gene pyrH 12769 12056 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_28010 13694 12861 gene locus_tag LOCUS_28020 gene tsf 13694 12861 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_28020 14478 13750 gene locus_tag LOCUS_28030 gene rpsB 14478 13750 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P29 protein_id gnl|my_center|LOCUS_28030 14942 14556 gene locus_tag LOCUS_28040 gene rpsI 14942 14556 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_28040 15408 14959 gene locus_tag LOCUS_28050 gene rplM 15408 14959 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_28050 18216 15955 gene locus_tag LOCUS_28060 18216 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 18530 20188 gene locus_tag LOCUS_28070 18530 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 20949 20263 gene locus_tag LOCUS_28080 20949 20263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 21685 21029 gene locus_tag LOCUS_28090 21685 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 22469 21750 gene locus_tag LOCUS_28100 22469 21750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 23728 23051 gene locus_tag LOCUS_28110 23728 23051 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_28110 24604 23924 gene locus_tag LOCUS_28120 24604 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 25287 24628 gene locus_tag LOCUS_28130 25287 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 26079 25375 gene locus_tag LOCUS_28140 26079 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 26541 28172 gene locus_tag LOCUS_28150 gene lysS 26541 28172 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_28150 28268 31246 gene locus_tag LOCUS_28160 28268 31246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 31508 31260 gene locus_tag LOCUS_28170 31508 31260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_28170 32003 35026 gene locus_tag LOCUS_28180 32003 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_28180 35153 35839 gene locus_tag LOCUS_28190 35153 35839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 35956 36636 gene locus_tag LOCUS_28200 35956 36636 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_28200 36733 37992 gene locus_tag LOCUS_28210 36733 37992 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_28210 38090 39352 gene locus_tag LOCUS_28220 38090 39352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence050 3032 2109 gene locus_tag LOCUS_28230 3032 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3226 3990 gene locus_tag LOCUS_28240 3226 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 4684 3998 gene locus_tag LOCUS_28250 4684 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 5924 4716 gene locus_tag LOCUS_28260 5924 4716 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_28260 7683 6004 gene locus_tag LOCUS_28270 7683 6004 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_28270 8965 8066 gene locus_tag LOCUS_28280 gene ilvE2 8965 8066 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_28280 9687 9046 gene locus_tag LOCUS_28290 9687 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 11046 9715 gene locus_tag LOCUS_28300 11046 9715 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_28300 11161 11616 gene locus_tag LOCUS_28310 11161 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 11870 12760 gene locus_tag LOCUS_28320 11870 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 13030 13824 gene locus_tag LOCUS_28330 13030 13824 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_28330 14674 13829 gene locus_tag LOCUS_28340 14674 13829 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_28340 17552 14709 gene locus_tag LOCUS_28350 17552 14709 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA87 protein_id gnl|my_center|LOCUS_28350 17801 18619 gene locus_tag LOCUS_28360 17801 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 21131 18597 gene locus_tag LOCUS_28370 21131 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 24093 21274 gene locus_tag LOCUS_28380 gene leuS 24093 21274 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG4 protein_id gnl|my_center|LOCUS_28380 24316 25218 gene locus_tag LOCUS_28390 24316 25218 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_28390 26167 25523 gene locus_tag LOCUS_28400 26167 25523 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_28400 26304 26609 gene locus_tag LOCUS_28410 26304 26609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 26804 29089 gene locus_tag LOCUS_28420 26804 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 29198 29905 gene locus_tag LOCUS_28430 gene aat 29198 29905 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC5 protein_id gnl|my_center|LOCUS_28430 29916 30143 gene locus_tag LOCUS_28440 29916 30143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 31002 30208 gene locus_tag LOCUS_28450 31002 30208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 31281 31631 gene locus_tag LOCUS_28460 31281 31631 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_28460 32280 31621 gene locus_tag LOCUS_28470 32280 31621 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_28470 32447 35215 gene locus_tag LOCUS_28480 32447 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 35426 36370 gene locus_tag LOCUS_28490 35426 36370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 37027 36584 gene locus_tag LOCUS_28500 37027 36584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 37381 38058 gene locus_tag LOCUS_28510 37381 38058 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_28510 38042 39100 gene locus_tag LOCUS_28520 38042 39100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378843.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence051 4578 2326 gene locus_tag LOCUS_28530 4578 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 4900 5472 gene locus_tag LOCUS_28540 4900 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5522 6598 gene locus_tag LOCUS_28550 gene aroB 5522 6598 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_28550 7112 6582 gene locus_tag LOCUS_28560 7112 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 8161 7190 gene locus_tag LOCUS_28570 8161 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_28570 9611 8166 gene locus_tag LOCUS_28580 9611 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447105.1 protein_id gnl|my_center|LOCUS_28580 9922 12951 gene locus_tag LOCUS_28590 9922 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 13063 13929 gene locus_tag LOCUS_28600 13063 13929 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_28600 14181 17351 gene locus_tag LOCUS_28610 14181 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 17990 17502 gene locus_tag LOCUS_28620 17990 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 18149 18670 gene locus_tag LOCUS_28630 18149 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 19574 18831 gene locus_tag LOCUS_28640 19574 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 19898 20641 gene locus_tag LOCUS_28650 19898 20641 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_28650 20805 21479 gene locus_tag LOCUS_28660 20805 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 21642 22283 gene locus_tag LOCUS_28670 21642 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 23613 22534 gene locus_tag LOCUS_28680 23613 22534 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_28680 24670 23672 gene locus_tag LOCUS_28690 24670 23672 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_28690 24982 27516 gene locus_tag LOCUS_28700 24982 27516 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_28700 27529 28950 gene locus_tag LOCUS_28710 27529 28950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 29003 30562 gene locus_tag LOCUS_28720 29003 30562 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_28720 30839 31273 gene locus_tag LOCUS_28730 gene dut 30839 31273 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_28730 31349 32347 gene locus_tag LOCUS_28740 31349 32347 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_28740 32604 34346 gene locus_tag LOCUS_28750 32604 34346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 34339 35139 gene locus_tag LOCUS_28760 34339 35139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 35253 36431 gene locus_tag LOCUS_28770 35253 36431 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_28770 36849 38057 gene locus_tag LOCUS_28780 gene hflX 36849 38057 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_28780 38185 38394 gene locus_tag LOCUS_28790 38185 38394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 38457 39032 gene locus_tag LOCUS_28800 38457 39032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence052 158 520 gene locus_tag LOCUS_28810 158 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1273 521 gene locus_tag LOCUS_28820 1273 521 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_28820 2248 1394 gene locus_tag LOCUS_28830 gene blaA 2248 1394 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_28830 2502 2245 gene locus_tag LOCUS_28840 2502 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 2970 4130 gene locus_tag LOCUS_28850 2970 4130 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_28850 4488 11624 gene locus_tag LOCUS_28860 4488 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 11847 12227 gene locus_tag LOCUS_28870 11847 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_28870 12349 14064 gene locus_tag LOCUS_28880 gene pif1 12349 14064 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_28880 14276 15979 gene locus_tag LOCUS_28890 14276 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 17687 16047 gene locus_tag LOCUS_28900 gene groL 17687 16047 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QU2 protein_id gnl|my_center|LOCUS_28900 18026 17760 gene locus_tag LOCUS_28910 gene groS 18026 17760 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_28910 18688 18266 gene locus_tag LOCUS_28920 18688 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 19210 18794 gene locus_tag LOCUS_28930 19210 18794 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_28930 20447 19419 gene locus_tag LOCUS_28940 20447 19419 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_28940 20603 21748 gene locus_tag LOCUS_28950 20603 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 21851 23476 gene locus_tag LOCUS_28960 21851 23476 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_28960 23699 25312 gene locus_tag LOCUS_28970 23699 25312 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_28970 25524 29186 gene locus_tag LOCUS_28980 25524 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 29568 37202 gene locus_tag LOCUS_28990 29568 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 37563 38108 gene locus_tag LOCUS_29000 37563 38108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 38842 38111 gene locus_tag LOCUS_29010 38842 38111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence053 763 1323 gene locus_tag LOCUS_29020 763 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2110 1478 gene locus_tag LOCUS_29030 2110 1478 CDS product lantibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896245.1 protein_id gnl|my_center|LOCUS_29030 2972 2190 gene locus_tag LOCUS_29040 gene lpxA 2972 2190 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_29040 4357 2978 gene locus_tag LOCUS_29050 gene fabZ 4357 2978 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_29050 5571 4504 gene locus_tag LOCUS_29060 5571 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 6203 5685 gene locus_tag LOCUS_29070 6203 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 7090 6413 gene locus_tag LOCUS_29080 7090 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7416 7928 gene locus_tag LOCUS_29090 7416 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 8182 10671 gene locus_tag LOCUS_29100 gene pheT 8182 10671 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA39 protein_id gnl|my_center|LOCUS_29100 10652 10915 gene locus_tag LOCUS_29110 10652 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 10925 11212 gene locus_tag LOCUS_29120 10925 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 11364 13001 gene locus_tag LOCUS_29130 gene rny 11364 13001 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG0 protein_id gnl|my_center|LOCUS_29130 13711 13070 gene locus_tag LOCUS_29140 13711 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 14593 13766 gene locus_tag LOCUS_29150 14593 13766 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_29150 14746 16986 gene locus_tag LOCUS_29160 14746 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 17235 17687 gene locus_tag LOCUS_29170 17235 17687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 18445 17696 gene locus_tag LOCUS_29180 18445 17696 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_29180 21442 18566 gene locus_tag LOCUS_29190 21442 18566 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_29190 22506 21811 gene locus_tag LOCUS_29200 22506 21811 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_29200 23814 22741 gene locus_tag LOCUS_29210 23814 22741 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_29210 25053 23899 gene locus_tag LOCUS_29220 gene alr 25053 23899 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_29220 26176 25061 gene locus_tag LOCUS_29230 gene celE 26176 25061 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_29230 26636 26184 gene locus_tag LOCUS_29240 26636 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 26965 27870 gene locus_tag LOCUS_29250 gene psuG 26965 27870 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I109 protein_id gnl|my_center|LOCUS_29250 30001 27863 gene locus_tag LOCUS_29260 30001 27863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 30240 30019 gene locus_tag LOCUS_29270 30240 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 30762 30349 gene locus_tag LOCUS_29280 30762 30349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 32925 31429 gene locus_tag LOCUS_29290 32925 31429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204900.1 protein_id gnl|my_center|LOCUS_29290 33272 38263 gene locus_tag LOCUS_29300 33272 38263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence054 <1 1951 gene locus_tag LOCUS_29310 <1 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2273 3304 gene locus_tag LOCUS_29320 gene spsE 2273 3304 CDS product sialic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_29320 3469 4023 gene locus_tag LOCUS_29330 3469 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4168 5622 gene locus_tag LOCUS_29340 4168 5622 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870353.1 protein_id gnl|my_center|LOCUS_29340 6303 5608 gene locus_tag LOCUS_29350 6303 5608 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_29350 6701 6306 gene locus_tag LOCUS_29360 6701 6306 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_29360 7071 6712 gene locus_tag LOCUS_29370 7071 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 7560 7075 gene locus_tag LOCUS_29380 gene greA 7560 7075 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_29380 11867 7803 gene locus_tag LOCUS_29390 11867 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 13103 12069 gene locus_tag LOCUS_29400 13103 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 17295 13207 gene locus_tag LOCUS_29410 17295 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 21202 17375 gene locus_tag LOCUS_29420 21202 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 22373 21420 gene locus_tag LOCUS_29430 22373 21420 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_29430 23331 22549 gene locus_tag LOCUS_29440 gene rsmA 23331 22549 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_29440 23544 24992 gene locus_tag LOCUS_29450 gene pepA 23544 24992 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD74 protein_id gnl|my_center|LOCUS_29450 25201 26517 gene locus_tag LOCUS_29460 gene pdxA 25201 26517 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_29460 27225 26596 gene locus_tag LOCUS_29470 gene rsmG 27225 26596 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_29470 30360 27268 gene locus_tag LOCUS_29480 30360 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_29480 33419 30501 gene locus_tag LOCUS_29490 33419 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_29490 36672 33541 gene locus_tag LOCUS_29500 36672 33541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_29500 38013 36901 gene locus_tag LOCUS_29510 38013 36901 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence055 744 142 gene locus_tag LOCUS_29520 gene coaE 744 142 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817G7 protein_id gnl|my_center|LOCUS_29520 1459 761 gene locus_tag LOCUS_29530 1459 761 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_29530 1645 2190 gene locus_tag LOCUS_29540 1645 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2456 3514 gene locus_tag LOCUS_29550 2456 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3519 4481 gene locus_tag LOCUS_29560 3519 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 5874 4684 gene locus_tag LOCUS_29570 gene kbl 5874 4684 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_29570 7006 6029 gene locus_tag LOCUS_29580 gene ltd 7006 6029 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_29580 7263 7985 gene locus_tag LOCUS_29590 7263 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 8153 9163 gene locus_tag LOCUS_29600 8153 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 9329 9928 gene locus_tag LOCUS_29610 9329 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 10050 11573 gene locus_tag LOCUS_29620 10050 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 11721 13376 gene locus_tag LOCUS_29630 11721 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_29630 13537 14556 gene locus_tag LOCUS_29640 13537 14556 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_29640 15353 14892 gene locus_tag LOCUS_29650 15353 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 16677 15970 gene locus_tag LOCUS_29660 16677 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 18038 16833 gene locus_tag LOCUS_29670 18038 16833 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_29670 18553 19494 gene locus_tag LOCUS_29680 18553 19494 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_29680 19814 20569 gene locus_tag LOCUS_29690 19814 20569 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_29690 20758 23139 gene locus_tag LOCUS_29700 20758 23139 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_29700 23825 23145 gene locus_tag LOCUS_29710 23825 23145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_29710 24212 25411 gene locus_tag LOCUS_29720 gene sucC 24212 25411 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_29720 27305 25605 gene locus_tag LOCUS_29730 27305 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 28497 27439 gene locus_tag LOCUS_29740 28497 27439 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_29740 29164 28589 gene locus_tag LOCUS_29750 gene yhgD 29164 28589 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206879.1 protein_id gnl|my_center|LOCUS_29750 29434 30333 gene locus_tag LOCUS_29760 gene rlmF 29434 30333 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU40 protein_id gnl|my_center|LOCUS_29760 30399 30638 gene locus_tag LOCUS_29770 30399 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 31837 30635 gene locus_tag LOCUS_29780 31837 30635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 32023 32880 gene locus_tag LOCUS_29790 32023 32880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 36156 32947 gene locus_tag LOCUS_29800 36156 32947 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_29800 36770 37006 gene locus_tag LOCUS_29810 36770 37006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 38192 37086 gene locus_tag LOCUS_29820 38192 37086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence056 278 787 gene locus_tag LOCUS_29830 278 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 877 3465 gene locus_tag LOCUS_29840 877 3465 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_29840 4382 3531 gene locus_tag LOCUS_29850 4382 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 4993 4661 gene locus_tag LOCUS_29860 4993 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 5781 5101 gene locus_tag LOCUS_29870 5781 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 6605 5856 gene locus_tag LOCUS_29880 6605 5856 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_29880 7088 7765 gene locus_tag LOCUS_29890 7088 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 7852 9378 gene locus_tag LOCUS_29900 gene mqo 7852 9378 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_29900 9608 10264 gene locus_tag LOCUS_29910 9608 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 10666 10857 gene locus_tag LOCUS_29920 gene cspC 10666 10857 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_29920 10992 12251 gene locus_tag LOCUS_29930 10992 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 12263 12802 gene locus_tag LOCUS_29940 12263 12802 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_29940 13464 12901 gene locus_tag LOCUS_29950 13464 12901 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_29950 15263 13467 gene locus_tag LOCUS_29960 gene edd 15263 13467 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_29960 16311 15625 gene locus_tag LOCUS_29970 gene pgl 16311 15625 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S1 protein_id gnl|my_center|LOCUS_29970 17769 16312 gene locus_tag LOCUS_29980 gene zwf 17769 16312 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_29980 18304 18591 gene locus_tag LOCUS_29990 18304 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 18607 19041 gene locus_tag LOCUS_30000 18607 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 19169 20641 gene locus_tag LOCUS_30010 19169 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 20692 21462 gene locus_tag LOCUS_30020 20692 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 21504 22550 gene locus_tag LOCUS_30030 21504 22550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 22637 25552 gene locus_tag LOCUS_30040 22637 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_30040 25572 26201 gene locus_tag LOCUS_30050 25572 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 26216 26890 gene locus_tag LOCUS_30060 26216 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 27114 27686 gene locus_tag LOCUS_30070 27114 27686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 27911 28516 gene locus_tag LOCUS_30080 27911 28516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 30531 28531 gene locus_tag LOCUS_30090 30531 28531 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405118.1 protein_id gnl|my_center|LOCUS_30090 30767 31210 gene locus_tag LOCUS_30100 30767 31210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 31413 31874 gene locus_tag LOCUS_30110 31413 31874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 32476 33789 gene locus_tag LOCUS_30120 32476 33789 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_30120 38021 33873 gene locus_tag LOCUS_30130 38021 33873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence057 1151 420 gene locus_tag LOCUS_30140 1151 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3063 1141 gene locus_tag LOCUS_30150 3063 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 4604 3195 gene locus_tag LOCUS_30160 4604 3195 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_30160 4841 6346 gene locus_tag LOCUS_30170 4841 6346 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_30170 6587 8299 gene locus_tag LOCUS_30180 6587 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_30180 8349 9533 gene locus_tag LOCUS_30190 8349 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 9595 10353 gene locus_tag LOCUS_30200 9595 10353 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_30200 10367 11257 gene locus_tag LOCUS_30210 10367 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 11503 12750 gene locus_tag LOCUS_30220 11503 12750 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_30220 13176 14348 gene locus_tag LOCUS_30230 13176 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 14350 14853 gene locus_tag LOCUS_30240 14350 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 15228 16103 gene locus_tag LOCUS_30250 15228 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 16137 16664 gene locus_tag LOCUS_30260 16137 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 17698 16706 gene locus_tag LOCUS_30270 gene fabH 17698 16706 CDS product protein GumO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637793.2 protein_id gnl|my_center|LOCUS_30270 18971 17676 gene locus_tag LOCUS_30280 18971 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_30280 19809 18961 gene locus_tag LOCUS_30290 19809 18961 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181763.1 protein_id gnl|my_center|LOCUS_30290 20822 19839 gene locus_tag LOCUS_30300 20822 19839 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_30300 22063 20966 gene locus_tag LOCUS_30310 22063 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_30310 23604 22261 gene locus_tag LOCUS_30320 gene kmo 23604 22261 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX41 protein_id gnl|my_center|LOCUS_30320 25576 23870 gene locus_tag LOCUS_30330 25576 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 27067 25757 gene locus_tag LOCUS_30340 27067 25757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088334.1 protein_id gnl|my_center|LOCUS_30340 27262 27756 gene locus_tag LOCUS_30350 27262 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 protein_id gnl|my_center|LOCUS_30350 29208 27907 gene locus_tag LOCUS_30360 gene kynU 29208 27907 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_30360 30406 29387 gene locus_tag LOCUS_30370 30406 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 31114 30521 gene locus_tag LOCUS_30380 31114 30521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 31676 31158 gene locus_tag LOCUS_30390 gene nbaC 31676 31158 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_30390 32218 31802 gene locus_tag LOCUS_30400 32218 31802 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_30400 33760 32315 gene locus_tag LOCUS_30410 33760 32315 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_30410 34626 33838 gene locus_tag LOCUS_30420 34626 33838 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_30420 36387 34984 gene locus_tag LOCUS_30430 36387 34984 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002075981.1 protein_id gnl|my_center|LOCUS_30430 37688 36603 gene locus_tag LOCUS_30440 37688 36603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence058 155 469 gene locus_tag LOCUS_30450 155 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 758 1756 gene locus_tag LOCUS_30460 gene hemB 758 1756 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_30460 2079 3353 gene locus_tag LOCUS_30470 2079 3353 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_30470 3477 4442 gene locus_tag LOCUS_30480 3477 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4494 6017 gene locus_tag LOCUS_30490 4494 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_30490 7635 6007 gene locus_tag LOCUS_30500 7635 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 9138 8059 gene locus_tag LOCUS_30510 9138 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 10196 9210 gene locus_tag LOCUS_30520 10196 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 10508 12379 gene locus_tag LOCUS_30530 10508 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 12554 12309 gene locus_tag LOCUS_30540 12554 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 12824 13666 gene locus_tag LOCUS_30550 12824 13666 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_30550 13834 15417 gene locus_tag LOCUS_30560 13834 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 17719 16415 gene locus_tag LOCUS_30570 gene pabB 17719 16415 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_30570 18903 17761 gene locus_tag LOCUS_30580 18903 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 19376 18906 gene locus_tag LOCUS_30590 gene purE 19376 18906 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS7 protein_id gnl|my_center|LOCUS_30590 20597 19473 gene locus_tag LOCUS_30600 gene purK 20597 19473 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_30600 22493 20763 gene locus_tag LOCUS_30610 22493 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 23979 22693 gene locus_tag LOCUS_30620 23979 22693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 24761 24168 gene locus_tag LOCUS_30630 24761 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 25038 24811 gene locus_tag LOCUS_30640 25038 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 28170 25189 gene locus_tag LOCUS_30650 28170 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 28841 28257 gene locus_tag LOCUS_30660 28841 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 29243 30097 gene locus_tag LOCUS_30670 29243 30097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 31123 30101 gene locus_tag LOCUS_30680 31123 30101 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_30680 31769 31155 gene locus_tag LOCUS_30690 31769 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_30690 32576 31815 gene locus_tag LOCUS_30700 32576 31815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 33365 32763 gene locus_tag LOCUS_30710 33365 32763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_30710 34525 33563 gene locus_tag LOCUS_30720 gene etfA 34525 33563 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_30720 35367 34627 gene locus_tag LOCUS_30730 gene etfB 35367 34627 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_30730 36667 35624 gene locus_tag LOCUS_30740 36667 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence059 5428 4649 gene locus_tag LOCUS_30750 gene tpiA 5428 4649 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_30750 6155 5511 gene locus_tag LOCUS_30760 6155 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 6494 7111 gene locus_tag LOCUS_30770 6494 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_30770 9231 7180 gene locus_tag LOCUS_30780 9231 7180 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_30780 10447 9665 gene locus_tag LOCUS_30790 10447 9665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260645.1 protein_id gnl|my_center|LOCUS_30790 10809 11978 gene locus_tag LOCUS_30800 10809 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 12007 13290 gene locus_tag LOCUS_30810 12007 13290 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037517.1 protein_id gnl|my_center|LOCUS_30810 14839 13331 gene locus_tag LOCUS_30820 14839 13331 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_30820 19862 15045 gene locus_tag LOCUS_30830 19862 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 23320 20417 gene locus_tag LOCUS_30840 gene gcvP 23320 20417 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_30840 23610 25664 gene locus_tag LOCUS_30850 23610 25664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 25674 27809 gene locus_tag LOCUS_30860 25674 27809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 27896 30547 gene locus_tag LOCUS_30870 27896 30547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 30935 31837 gene locus_tag LOCUS_30880 30935 31837 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140901.1 protein_id gnl|my_center|LOCUS_30880 31925 33274 gene locus_tag LOCUS_30890 31925 33274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 33296 35632 gene locus_tag LOCUS_30900 33296 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 35629 36315 gene locus_tag LOCUS_30910 35629 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence060 1351 215 gene locus_tag LOCUS_30920 1351 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2118 1372 gene locus_tag LOCUS_30930 2118 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 3030 2236 gene locus_tag LOCUS_30940 3030 2236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_30940 5275 3074 gene locus_tag LOCUS_30950 5275 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 5597 5406 gene locus_tag LOCUS_30960 5597 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 7534 5894 gene locus_tag LOCUS_30970 7534 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 8217 7531 gene locus_tag LOCUS_30980 8217 7531 CDS product serine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392982.1 protein_id gnl|my_center|LOCUS_30980 8551 8189 gene locus_tag LOCUS_30990 8551 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 8707 8555 gene locus_tag LOCUS_31000 8707 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 9074 8745 gene locus_tag LOCUS_31010 9074 8745 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWJ2 protein_id gnl|my_center|LOCUS_31010 9975 9391 gene locus_tag LOCUS_31020 9975 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 10442 10071 gene locus_tag LOCUS_31030 10442 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 10927 10532 gene locus_tag LOCUS_31040 gene rsbT 10927 10532 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42411 protein_id gnl|my_center|LOCUS_31040 11838 10951 gene locus_tag LOCUS_31050 11838 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 13054 12002 gene locus_tag LOCUS_31060 13054 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 15177 13735 gene locus_tag LOCUS_31070 15177 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 16235 15279 gene locus_tag LOCUS_31080 16235 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 18695 16413 gene locus_tag LOCUS_31090 18695 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 18900 20261 gene locus_tag LOCUS_31100 18900 20261 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_31100 21812 20364 gene locus_tag LOCUS_31110 gene leuB 21812 20364 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_31110 21942 22454 gene locus_tag LOCUS_31120 21942 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 23436 22516 gene locus_tag LOCUS_31130 23436 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_31130 23539 23829 gene locus_tag LOCUS_31140 23539 23829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 23903 24802 gene locus_tag LOCUS_31150 23903 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 24958 25269 gene locus_tag LOCUS_31160 24958 25269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 25945 25238 gene locus_tag LOCUS_31170 25945 25238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 27855 26038 gene locus_tag LOCUS_31180 27855 26038 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_31180 28226 27999 gene locus_tag LOCUS_31190 28226 27999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 28908 28261 gene locus_tag LOCUS_31200 28908 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 29303 29073 gene locus_tag LOCUS_31210 29303 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 29621 30664 gene locus_tag LOCUS_31220 gene mreB 29621 30664 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_31220 30789 31628 gene locus_tag LOCUS_31230 30789 31628 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_31230 31621 32121 gene locus_tag LOCUS_31240 31621 32121 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_31240 32182 34035 gene locus_tag LOCUS_31250 32182 34035 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_31250 34096 34899 gene locus_tag LOCUS_31260 34096 34899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_31260 34896 35954 gene locus_tag LOCUS_31270 34896 35954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 36074 36493 gene locus_tag LOCUS_31280 36074 36493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence061 4428 4171 gene locus_tag LOCUS_31290 4428 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 5817 4675 gene locus_tag LOCUS_31300 5817 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 6274 5903 gene locus_tag LOCUS_31310 6274 5903 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_31310 8922 6637 gene locus_tag LOCUS_31320 gene pbpC 8922 6637 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_31320 9190 10485 gene locus_tag LOCUS_31330 9190 10485 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_31330 11916 10630 gene locus_tag LOCUS_31340 11916 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 16061 12033 gene locus_tag LOCUS_31350 16061 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 16818 16321 gene locus_tag LOCUS_31360 gene tpx 16818 16321 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_31360 18097 17018 gene locus_tag LOCUS_31370 18097 17018 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 protein_id gnl|my_center|LOCUS_31370 19192 18203 gene locus_tag LOCUS_31380 19192 18203 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_31380 20362 19355 gene locus_tag LOCUS_31390 gene kcnb2 20362 19355 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_31390 20617 23127 gene locus_tag LOCUS_31400 20617 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_31400 23861 23253 gene locus_tag LOCUS_31410 23861 23253 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_31410 24583 23855 gene locus_tag LOCUS_31420 24583 23855 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_31420 26421 24706 gene locus_tag LOCUS_31430 26421 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 26781 26578 gene locus_tag LOCUS_31440 26781 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 26980 27402 gene locus_tag LOCUS_31450 26980 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 27430 28161 gene locus_tag LOCUS_31460 27430 28161 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008650623.1 protein_id gnl|my_center|LOCUS_31460 28247 28699 gene locus_tag LOCUS_31470 28247 28699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 28696 30006 gene locus_tag LOCUS_31480 28696 30006 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_31480 30084 32108 gene locus_tag LOCUS_31490 30084 32108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 33187 32105 gene locus_tag LOCUS_31500 33187 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 33291 34274 gene locus_tag LOCUS_31510 gene glpQ 33291 34274 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_31510 34782 34375 gene locus_tag LOCUS_31520 34782 34375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 35324 34947 gene locus_tag LOCUS_31530 35324 34947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence062 238 585 gene locus_tag LOCUS_31540 238 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125308.1 protein_id gnl|my_center|LOCUS_31540 711 1331 gene locus_tag LOCUS_31550 711 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1420 2544 gene locus_tag LOCUS_31560 1420 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 2673 3383 gene locus_tag LOCUS_31570 2673 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3534 5942 gene locus_tag LOCUS_31580 3534 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 5948 7735 gene locus_tag LOCUS_31590 5948 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 8986 7760 gene locus_tag LOCUS_31600 8986 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 11174 9069 gene locus_tag LOCUS_31610 11174 9069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_31610 12360 11293 gene locus_tag LOCUS_31620 12360 11293 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_31620 13170 12382 gene locus_tag LOCUS_31630 gene hmuV 13170 12382 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ08 protein_id gnl|my_center|LOCUS_31630 14258 13167 gene locus_tag LOCUS_31640 14258 13167 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 protein_id gnl|my_center|LOCUS_31640 15121 14261 gene locus_tag LOCUS_31650 15121 14261 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_31650 16545 15259 gene locus_tag LOCUS_31660 16545 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 18392 16722 gene locus_tag LOCUS_31670 gene rpoN 18392 16722 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_31670 20101 18689 gene locus_tag LOCUS_31680 20101 18689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_31680 20827 20252 gene locus_tag LOCUS_31690 20827 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 22603 21293 gene locus_tag LOCUS_31700 22603 21293 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_31700 24113 22989 gene locus_tag LOCUS_31710 24113 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_31710 25809 24280 gene locus_tag LOCUS_31720 25809 24280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964011.1 protein_id gnl|my_center|LOCUS_31720 25958 26287 gene locus_tag LOCUS_31730 25958 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 26277 26642 gene locus_tag LOCUS_31740 26277 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 27437 26643 gene locus_tag LOCUS_31750 27437 26643 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888042.1 protein_id gnl|my_center|LOCUS_31750 28539 27454 gene locus_tag LOCUS_31760 28539 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 31224 28621 gene locus_tag LOCUS_31770 31224 28621 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_31770 31608 32297 gene locus_tag LOCUS_31780 31608 32297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 32294 33391 gene locus_tag LOCUS_31790 32294 33391 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_31790 33893 33393 gene locus_tag LOCUS_31800 33893 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 34712 34020 gene locus_tag LOCUS_31810 34712 34020 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence063 562 1578 gene locus_tag LOCUS_31820 562 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2662 1637 gene locus_tag LOCUS_31830 2662 1637 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_31830 3419 2850 gene locus_tag LOCUS_31840 3419 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 5474 3486 gene locus_tag LOCUS_31850 5474 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 5615 7288 gene locus_tag LOCUS_31860 5615 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 7385 8236 gene locus_tag LOCUS_31870 7385 8236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_31870 8321 9628 gene locus_tag LOCUS_31880 8321 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 10605 9625 gene locus_tag LOCUS_31890 10605 9625 CDS product trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095497.1 protein_id gnl|my_center|LOCUS_31890 11316 10681 gene locus_tag LOCUS_31900 gene pnuC 11316 10681 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168038.1 protein_id gnl|my_center|LOCUS_31900 13377 11383 gene locus_tag LOCUS_31910 13377 11383 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_31910 14872 13487 gene locus_tag LOCUS_31920 14872 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 16208 15036 gene locus_tag LOCUS_31930 16208 15036 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_31930 16340 18040 gene locus_tag LOCUS_31940 16340 18040 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_31940 19317 18346 gene locus_tag LOCUS_31950 19317 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 19718 20899 gene locus_tag LOCUS_31960 19718 20899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 21414 21022 gene locus_tag LOCUS_31970 21414 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 21997 21425 gene locus_tag LOCUS_31980 21997 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 22654 22082 gene locus_tag LOCUS_31990 22654 22082 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_31990 23294 22695 gene locus_tag LOCUS_32000 23294 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 24448 23441 gene locus_tag LOCUS_32010 24448 23441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 24791 25441 gene locus_tag LOCUS_32020 24791 25441 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_32020 25795 27330 gene locus_tag LOCUS_32030 25795 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 27536 29176 gene locus_tag LOCUS_32040 27536 29176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 29839 29180 gene locus_tag LOCUS_32050 gene psd 29839 29180 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_32050 30218 32806 gene locus_tag LOCUS_32060 30218 32806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 32916 33692 gene locus_tag LOCUS_32070 gene crt 32916 33692 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_32070 34666 33800 gene locus_tag LOCUS_32080 34666 33800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence064 757 3954 gene locus_tag LOCUS_32090 757 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 4005 5666 gene locus_tag LOCUS_32100 4005 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_32100 6378 7928 gene locus_tag LOCUS_32110 6378 7928 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_32110 8387 9244 gene locus_tag LOCUS_32120 8387 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 10650 9223 gene locus_tag LOCUS_32130 10650 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 11673 10834 gene locus_tag LOCUS_32140 11673 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404655.1 protein_id gnl|my_center|LOCUS_32140 12951 11692 gene locus_tag LOCUS_32150 12951 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 13956 13054 gene locus_tag LOCUS_32160 13956 13054 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_32160 15413 13983 gene locus_tag LOCUS_32170 15413 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 15981 15460 gene locus_tag LOCUS_32180 15981 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 16195 18843 gene locus_tag LOCUS_32190 gene topA 16195 18843 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_32190 18950 19927 gene locus_tag LOCUS_32200 18950 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 20448 20071 gene locus_tag LOCUS_32210 20448 20071 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123631.1 protein_id gnl|my_center|LOCUS_32210 21327 20692 gene locus_tag LOCUS_32220 21327 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 21668 21417 gene locus_tag LOCUS_32230 21668 21417 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_32230 22391 21795 gene locus_tag LOCUS_32240 22391 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291518.1 protein_id gnl|my_center|LOCUS_32240 23575 22457 gene locus_tag LOCUS_32250 23575 22457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 23685 24113 gene locus_tag LOCUS_32260 23685 24113 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_32260 24213 24857 gene locus_tag LOCUS_32270 24213 24857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 26654 24951 gene locus_tag LOCUS_32280 26654 24951 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_32280 27712 27140 gene locus_tag LOCUS_32290 27712 27140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 29497 28043 gene locus_tag LOCUS_32300 gene degP/Q 29497 28043 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_32300 29758 30057 gene locus_tag LOCUS_32310 29758 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 30174 30959 gene locus_tag LOCUS_32320 gene dapF 30174 30959 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_32320 31059 31406 gene locus_tag LOCUS_32330 gene gldC 31059 31406 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_32330 31480 31932 gene locus_tag LOCUS_32340 31480 31932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 32212 32364 gene locus_tag LOCUS_32350 32212 32364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 32371 32814 gene locus_tag LOCUS_32360 32371 32814 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_32360 32864 34609 gene locus_tag LOCUS_32370 gene coxA2 32864 34609 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881442.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence065 786 2924 gene locus_tag LOCUS_32380 786 2924 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_32380 2997 3743 gene locus_tag LOCUS_32390 gene cutC 2997 3743 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 protein_id gnl|my_center|LOCUS_32390 3893 6172 gene locus_tag LOCUS_32400 3893 6172 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_32400 6497 8056 gene locus_tag LOCUS_32410 6497 8056 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_32410 9903 8365 gene locus_tag LOCUS_32420 9903 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 10276 11979 gene locus_tag LOCUS_32430 10276 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 12041 12838 gene locus_tag LOCUS_32440 12041 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 12848 13282 gene locus_tag LOCUS_32450 12848 13282 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075144.1 protein_id gnl|my_center|LOCUS_32450 13955 13479 gene locus_tag LOCUS_32460 13955 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 16204 14078 gene locus_tag LOCUS_32470 gene ligA 16204 14078 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66880 protein_id gnl|my_center|LOCUS_32470 16621 16244 gene locus_tag LOCUS_32480 16621 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 17053 19590 gene locus_tag LOCUS_32490 17053 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 19847 19587 gene locus_tag LOCUS_32500 19847 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 20655 19849 gene locus_tag LOCUS_32510 20655 19849 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_32510 21692 20871 gene locus_tag LOCUS_32520 21692 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 22181 22540 gene locus_tag LOCUS_32530 22181 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 22597 23685 gene locus_tag LOCUS_32540 22597 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 24367 23783 gene locus_tag LOCUS_32550 24367 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 25258 24431 gene locus_tag LOCUS_32560 25258 24431 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_32560 25839 25492 gene locus_tag LOCUS_32570 25839 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 26540 26040 gene locus_tag LOCUS_32580 26540 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 29710 26783 gene locus_tag LOCUS_32590 29710 26783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 32085 30166 gene locus_tag LOCUS_32600 32085 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 34370 32295 gene locus_tag LOCUS_32610 34370 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence066 <1 11340 gene locus_tag LOCUS_32620 <1 11340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein 11624 12682 gene locus_tag LOCUS_32630 11624 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 12843 13448 gene locus_tag LOCUS_32640 12843 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 13498 14970 gene locus_tag LOCUS_32650 gene fumC 13498 14970 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_32650 16617 15097 gene locus_tag LOCUS_32660 16617 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 17638 16640 gene locus_tag LOCUS_32670 17638 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 17889 20174 gene locus_tag LOCUS_32680 17889 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 20302 21087 gene locus_tag LOCUS_32690 20302 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 21115 22935 gene locus_tag LOCUS_32700 21115 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 23106 23465 gene locus_tag LOCUS_32710 23106 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 23465 24286 gene locus_tag LOCUS_32720 23465 24286 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_32720 24913 24269 gene locus_tag LOCUS_32730 24913 24269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 25257 26945 gene locus_tag LOCUS_32740 gene fadD 25257 26945 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758422.1 protein_id gnl|my_center|LOCUS_32740 27349 26951 gene locus_tag LOCUS_32750 27349 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 27492 30131 gene locus_tag LOCUS_32760 27492 30131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 30655 30182 gene locus_tag LOCUS_32770 30655 30182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 31712 31023 gene locus_tag LOCUS_32780 gene ung 31712 31023 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ40 protein_id gnl|my_center|LOCUS_32780 33557 31869 gene locus_tag LOCUS_32790 33557 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence067 180 944 gene locus_tag LOCUS_32800 180 944 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_32800 1123 2343 gene locus_tag LOCUS_32810 1123 2343 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A529 protein_id gnl|my_center|LOCUS_32810 2457 3953 gene locus_tag LOCUS_32820 gene accC 2457 3953 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_32820 3999 4406 gene locus_tag LOCUS_32830 3999 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 5946 4477 gene locus_tag LOCUS_32840 5946 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 6545 5973 gene locus_tag LOCUS_32850 6545 5973 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_32850 7195 6545 gene locus_tag LOCUS_32860 7195 6545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764500.1 protein_id gnl|my_center|LOCUS_32860 8580 7228 gene locus_tag LOCUS_32870 8580 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 8912 9859 gene locus_tag LOCUS_32880 8912 9859 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_32880 11142 9856 gene locus_tag LOCUS_32890 gene bioA 11142 9856 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_32890 11278 12045 gene locus_tag LOCUS_32900 11278 12045 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_32900 12065 12637 gene locus_tag LOCUS_32910 12065 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 13374 12634 gene locus_tag LOCUS_32920 13374 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 14250 13384 gene locus_tag LOCUS_32930 14250 13384 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_32930 15067 15939 gene locus_tag LOCUS_32940 15067 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 17174 15999 gene locus_tag LOCUS_32950 gene xseA 17174 15999 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_32950 18131 17241 gene locus_tag LOCUS_32960 18131 17241 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_32960 18551 25243 gene locus_tag LOCUS_32970 18551 25243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 25381 29325 gene locus_tag LOCUS_32980 25381 29325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence068 1423 341 gene locus_tag LOCUS_32990 1423 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2027 1449 gene locus_tag LOCUS_33000 gene ybaK2 2027 1449 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZ29 protein_id gnl|my_center|LOCUS_33000 2129 2833 gene locus_tag LOCUS_33010 2129 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3731 2934 gene locus_tag LOCUS_33020 3731 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 4484 3822 gene locus_tag LOCUS_33030 4484 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 5590 4568 gene locus_tag LOCUS_33040 5590 4568 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_33040 6137 5631 gene locus_tag LOCUS_33050 6137 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_33050 6798 6262 gene locus_tag LOCUS_33060 6798 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 7308 6805 gene locus_tag LOCUS_33070 7308 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 7519 8871 gene locus_tag LOCUS_33080 7519 8871 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_33080 9422 8889 gene locus_tag LOCUS_33090 9422 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 10143 9649 gene locus_tag LOCUS_33100 10143 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 11124 10231 gene locus_tag LOCUS_33110 gene xerC 11124 10231 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A461 protein_id gnl|my_center|LOCUS_33110 12054 11155 gene locus_tag LOCUS_33120 12054 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 14994 12391 gene locus_tag LOCUS_33130 gene clpB 14994 12391 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_33130 15940 15443 gene locus_tag LOCUS_33140 15940 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 16326 15943 gene locus_tag LOCUS_33150 16326 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 17467 16427 gene locus_tag LOCUS_33160 17467 16427 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z17 protein_id gnl|my_center|LOCUS_33160 18260 17448 gene locus_tag LOCUS_33170 18260 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 19924 18761 gene locus_tag LOCUS_33180 19924 18761 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_33180 20108 21502 gene locus_tag LOCUS_33190 20108 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 21723 22331 gene locus_tag LOCUS_33200 21723 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 22875 22432 gene locus_tag LOCUS_33210 22875 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 24092 22935 gene locus_tag LOCUS_33220 24092 22935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 24554 24381 gene locus_tag LOCUS_33230 24554 24381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 24560 25864 gene locus_tag LOCUS_33240 24560 25864 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_33240 26960 26205 gene locus_tag LOCUS_33250 26960 26205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 27416 27018 gene locus_tag LOCUS_33260 27416 27018 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_33260 29066 27507 gene locus_tag LOCUS_33270 29066 27507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069710.1 protein_id gnl|my_center|LOCUS_33270 29357 29761 gene locus_tag LOCUS_33280 29357 29761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 29929 30456 gene locus_tag LOCUS_33290 29929 30456 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI50 protein_id gnl|my_center|LOCUS_33290 30696 32588 gene locus_tag LOCUS_33300 30696 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence069 <1 4986 gene locus_tag LOCUS_33310 <1 4986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 5398 5234 gene locus_tag LOCUS_33320 5398 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 5692 5459 gene locus_tag LOCUS_33330 5692 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 5811 6467 gene locus_tag LOCUS_33340 5811 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 6484 7401 gene locus_tag LOCUS_33350 6484 7401 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_33350 7415 7930 gene locus_tag LOCUS_33360 7415 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 7917 9089 gene locus_tag LOCUS_33370 7917 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 9096 10109 gene locus_tag LOCUS_33380 9096 10109 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_33380 10106 10567 gene locus_tag LOCUS_33390 10106 10567 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095038.1 protein_id gnl|my_center|LOCUS_33390 10588 11706 gene locus_tag LOCUS_33400 10588 11706 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_33400 11708 12820 gene locus_tag LOCUS_33410 11708 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 12835 13863 gene locus_tag LOCUS_33420 12835 13863 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_33420 13959 14540 gene locus_tag LOCUS_33430 13959 14540 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_33430 14676 15791 gene locus_tag LOCUS_33440 14676 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 15801 17021 gene locus_tag LOCUS_33450 15801 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 17048 18166 gene locus_tag LOCUS_33460 17048 18166 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_33460 18168 19373 gene locus_tag LOCUS_33470 18168 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 19631 21748 gene locus_tag LOCUS_33480 19631 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 22019 22612 gene locus_tag LOCUS_33490 gene rplY 22019 22612 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ1 protein_id gnl|my_center|LOCUS_33490 22723 23424 gene locus_tag LOCUS_33500 gene pth 22723 23424 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_33500 23970 24416 gene locus_tag LOCUS_33510 23970 24416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 24625 25125 gene locus_tag LOCUS_33520 24625 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 25284 25793 gene locus_tag LOCUS_33530 25284 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 26364 25981 gene locus_tag LOCUS_33540 26364 25981 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807740.1 protein_id gnl|my_center|LOCUS_33540 26702 26376 gene locus_tag LOCUS_33550 26702 26376 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_33550 27417 28724 gene locus_tag LOCUS_33560 27417 28724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 30099 28846 gene locus_tag LOCUS_33570 gene sucB 30099 28846 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7J7 protein_id gnl|my_center|LOCUS_33570 31752 30550 gene locus_tag LOCUS_33580 31752 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence070 259 810 gene locus_tag LOCUS_33590 259 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 1029 2402 gene locus_tag LOCUS_33600 1029 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_33600 2493 3515 gene locus_tag LOCUS_33610 gene fadB5 2493 3515 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_33610 3701 4510 gene locus_tag LOCUS_33620 3701 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 4666 5694 gene locus_tag LOCUS_33630 4666 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 8634 5704 gene locus_tag LOCUS_33640 8634 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_33640 8831 9955 gene locus_tag LOCUS_33650 8831 9955 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759762.1 protein_id gnl|my_center|LOCUS_33650 10104 11048 gene locus_tag LOCUS_33660 10104 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 11109 12173 gene locus_tag LOCUS_33670 11109 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_33670 12344 14374 gene locus_tag LOCUS_33680 12344 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 15016 14390 gene locus_tag LOCUS_33690 15016 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 15180 15935 gene locus_tag LOCUS_33700 15180 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 15940 16302 gene locus_tag LOCUS_33710 15940 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 16280 17032 gene locus_tag LOCUS_33720 16280 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 17487 20600 gene locus_tag LOCUS_33730 17487 20600 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_33730 21864 20854 gene locus_tag LOCUS_33740 gene murB 21864 20854 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_33740 22220 21915 gene locus_tag LOCUS_33750 22220 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 25448 22476 gene locus_tag LOCUS_33760 25448 22476 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963047.1 protein_id gnl|my_center|LOCUS_33760 25604 27742 gene locus_tag LOCUS_33770 25604 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 28298 27894 gene locus_tag LOCUS_33780 28298 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 29412 28882 gene locus_tag LOCUS_33790 29412 28882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 30279 29557 gene locus_tag LOCUS_33800 30279 29557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 30935 30375 gene locus_tag LOCUS_33810 30935 30375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 31636 30989 gene locus_tag LOCUS_33820 31636 30989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence071 1440 163 gene locus_tag LOCUS_33830 gene lysC 1440 163 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_33830 1701 2870 gene locus_tag LOCUS_33840 1701 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3388 2987 gene locus_tag LOCUS_33850 3388 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 4336 3425 gene locus_tag LOCUS_33860 4336 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_33860 4803 4375 gene locus_tag LOCUS_33870 4803 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 6245 5370 gene locus_tag LOCUS_33880 6245 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 7079 6264 gene locus_tag LOCUS_33890 7079 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 7939 7289 gene locus_tag LOCUS_33900 7939 7289 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 protein_id gnl|my_center|LOCUS_33900 12819 8035 gene locus_tag LOCUS_33910 12819 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 16343 13140 gene locus_tag LOCUS_33920 16343 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 17640 16723 gene locus_tag LOCUS_33930 gene miaA 17640 16723 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_33930 18700 17738 gene locus_tag LOCUS_33940 18700 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 19999 19025 gene locus_tag LOCUS_33950 19999 19025 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_33950 21417 20002 gene locus_tag LOCUS_33960 gene fucP 21417 20002 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_33960 21595 21933 gene locus_tag LOCUS_33970 21595 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 22062 24152 gene locus_tag LOCUS_33980 gene ptrB 22062 24152 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_33980 24178 24807 gene locus_tag LOCUS_33990 24178 24807 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_33990 25881 25039 gene locus_tag LOCUS_34000 25881 25039 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409654.1 protein_id gnl|my_center|LOCUS_34000 26748 26089 gene locus_tag LOCUS_34010 26748 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_34010 27136 30216 gene locus_tag LOCUS_34020 27136 30216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 30503 31162 gene locus_tag LOCUS_34030 30503 31162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence072 1296 334 gene locus_tag LOCUS_34040 1296 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1562 2248 gene locus_tag LOCUS_34050 1562 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 4894 2249 gene locus_tag LOCUS_34060 gene ftsK 4894 2249 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_34060 5287 6042 gene locus_tag LOCUS_34070 5287 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 6734 6069 gene locus_tag LOCUS_34080 6734 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 7442 6750 gene locus_tag LOCUS_34090 7442 6750 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_34090 9063 7540 gene locus_tag LOCUS_34100 9063 7540 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_34100 9239 9562 gene locus_tag LOCUS_34110 9239 9562 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_34110 9636 10106 gene locus_tag LOCUS_34120 9636 10106 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_34120 10162 10740 gene locus_tag LOCUS_34130 10162 10740 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_34130 10862 11908 gene locus_tag LOCUS_34140 10862 11908 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_34140 12119 13774 gene locus_tag LOCUS_34150 12119 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 13876 14088 gene locus_tag LOCUS_34160 13876 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 14256 15410 gene locus_tag LOCUS_34170 14256 15410 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_34170 15581 16159 gene locus_tag LOCUS_34180 15581 16159 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_34180 16352 17416 gene locus_tag LOCUS_34190 16352 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 17488 18354 gene locus_tag LOCUS_34200 gene tatC 17488 18354 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_34200 18394 19563 gene locus_tag LOCUS_34210 18394 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 19668 20330 gene locus_tag LOCUS_34220 gene sirR 19668 20330 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_34220 20413 20871 gene locus_tag LOCUS_34230 gene smpB 20413 20871 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_34230 21178 21903 gene locus_tag LOCUS_34240 gene ddpX 21178 21903 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H017 protein_id gnl|my_center|LOCUS_34240 22002 22511 gene locus_tag LOCUS_34250 22002 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 22523 23068 gene locus_tag LOCUS_34260 22523 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 23211 23861 gene locus_tag LOCUS_34270 23211 23861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 24208 23858 gene locus_tag LOCUS_34280 24208 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 25059 24217 gene locus_tag LOCUS_34290 25059 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 25302 26351 gene locus_tag LOCUS_34300 25302 26351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 26364 26603 gene locus_tag LOCUS_34310 26364 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 27261 26641 gene locus_tag LOCUS_34320 27261 26641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 28320 27424 gene locus_tag LOCUS_34330 gene lipA 28320 27424 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_34330 29227 28427 gene locus_tag LOCUS_34340 29227 28427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_34340 29297 29830 gene locus_tag LOCUS_34350 29297 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 30131 29925 gene locus_tag LOCUS_34360 30131 29925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence073 3413 327 gene locus_tag LOCUS_34370 3413 327 CDS product tetratricopeptide repeat domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_34370 7271 3477 gene locus_tag LOCUS_34380 7271 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 10955 7422 gene locus_tag LOCUS_34390 10955 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 14663 11088 gene locus_tag LOCUS_34400 14663 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 19751 14742 gene locus_tag LOCUS_34410 19751 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 23370 19834 gene locus_tag LOCUS_34420 23370 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 27145 23588 gene locus_tag LOCUS_34430 27145 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 28525 27452 gene locus_tag LOCUS_34440 28525 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 29919 28798 gene locus_tag LOCUS_34450 29919 28798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence074 200 1207 gene locus_tag LOCUS_34460 200 1207 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN19 protein_id gnl|my_center|LOCUS_34460 2910 1291 gene locus_tag LOCUS_34470 2910 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 5825 3429 gene locus_tag LOCUS_34480 5825 3429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_34480 5959 6195 gene locus_tag LOCUS_34490 5959 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 6208 7767 gene locus_tag LOCUS_34500 6208 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 8294 7818 gene locus_tag LOCUS_34510 8294 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 8988 8362 gene locus_tag LOCUS_34520 8988 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 10372 9089 gene locus_tag LOCUS_34530 gene purA 10372 9089 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N4 protein_id gnl|my_center|LOCUS_34530 10629 11234 gene locus_tag LOCUS_34540 10629 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 11581 11231 gene locus_tag LOCUS_34550 11581 11231 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NN0 protein_id gnl|my_center|LOCUS_34550 12421 11948 gene locus_tag LOCUS_34560 12421 11948 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_34560 14792 12504 gene locus_tag LOCUS_34570 gene relA 14792 12504 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_34570 15342 15424 gene locus_tag LOCUS_t00400 15342 15424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15529 16986 gene locus_tag LOCUS_34580 gene tig 15529 16986 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ60 protein_id gnl|my_center|LOCUS_34580 18706 17144 gene locus_tag LOCUS_34590 18706 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 19244 18693 gene locus_tag LOCUS_34600 19244 18693 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_34600 20493 19402 gene locus_tag LOCUS_34610 20493 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 20578 20754 gene locus_tag LOCUS_34620 20578 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 22128 20866 gene locus_tag LOCUS_34630 22128 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_34630 24582 22210 gene locus_tag LOCUS_34640 24582 22210 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765755.1 protein_id gnl|my_center|LOCUS_34640 25699 24812 gene locus_tag LOCUS_34650 25699 24812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 26682 25798 gene locus_tag LOCUS_34660 26682 25798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 29801 27573 gene locus_tag LOCUS_34670 gene phuR 29801 27573 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence075 306 506 gene locus_tag LOCUS_34680 306 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 463 750 gene locus_tag LOCUS_34690 463 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34690 2425 1013 gene locus_tag LOCUS_34700 gene hsdS 2425 1013 CDS product type I restriction endonuclease EcoKI subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272445.1 protein_id gnl|my_center|LOCUS_34700 3821 2418 gene locus_tag LOCUS_34710 gene hsdM 3821 2418 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_34710 7249 4001 gene locus_tag LOCUS_34720 gene hsdR 7249 4001 CDS product type I restriction-modification system deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_34720 7850 8743 gene locus_tag LOCUS_34730 7850 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 8991 9896 gene locus_tag LOCUS_34740 8991 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 10364 10089 gene locus_tag LOCUS_34750 10364 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 10791 10357 gene locus_tag LOCUS_34760 10791 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 11269 11196 gene locus_tag LOCUS_t00410 11269 11196 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12697 11522 gene locus_tag LOCUS_34770 gene dnaJ 12697 11522 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_34770 13548 12877 gene locus_tag LOCUS_34780 gene grpE 13548 12877 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_34780 14324 13785 gene locus_tag LOCUS_34790 14324 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 15444 14692 gene locus_tag LOCUS_34800 15444 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 16896 15646 gene locus_tag LOCUS_34810 gene fabF 16896 15646 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_34810 17376 17125 gene locus_tag LOCUS_34820 gene acpP 17376 17125 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEW5 protein_id gnl|my_center|LOCUS_34820 18202 17606 gene locus_tag LOCUS_34830 18202 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 19837 18311 gene locus_tag LOCUS_34840 19837 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 20922 19921 gene locus_tag LOCUS_34850 20922 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_34850 21003 21887 gene locus_tag LOCUS_34860 21003 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 21988 22458 gene locus_tag LOCUS_34870 21988 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 22562 23656 gene locus_tag LOCUS_34880 22562 23656 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_34880 24016 25671 gene locus_tag LOCUS_34890 gene recN 24016 25671 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_34890 25671 26645 gene locus_tag LOCUS_34900 25671 26645 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_34900 27227 26649 gene locus_tag LOCUS_34910 27227 26649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 28435 27302 gene locus_tag LOCUS_34920 28435 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 29308 28775 gene locus_tag LOCUS_34930 29308 28775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 29957 29310 gene locus_tag LOCUS_34940 29957 29310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 >Feature sequence076 170 1633 gene locus_tag LOCUS_34950 gene iolA 170 1633 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_34950 1728 3047 gene locus_tag LOCUS_34960 1728 3047 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702442.1 protein_id gnl|my_center|LOCUS_34960 3057 4871 gene locus_tag LOCUS_34970 3057 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 5016 5540 gene locus_tag LOCUS_34980 5016 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 5668 7047 gene locus_tag LOCUS_34990 5668 7047 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861449.1 protein_id gnl|my_center|LOCUS_34990 7221 8087 gene locus_tag LOCUS_35000 7221 8087 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_35000 10546 8543 gene locus_tag LOCUS_35010 10546 8543 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268959.1 protein_id gnl|my_center|LOCUS_35010 11625 10558 gene locus_tag LOCUS_35020 11625 10558 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_35020 12497 11625 gene locus_tag LOCUS_35030 12497 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551545.1 protein_id gnl|my_center|LOCUS_35030 13521 12490 gene locus_tag LOCUS_35040 13521 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 14711 13746 gene locus_tag LOCUS_35050 14711 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 15109 14804 gene locus_tag LOCUS_35060 15109 14804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 15209 15883 gene locus_tag LOCUS_35070 15209 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 16487 15885 gene locus_tag LOCUS_35080 16487 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 17110 16544 gene locus_tag LOCUS_35090 17110 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 17819 17367 gene locus_tag LOCUS_35100 17819 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 18477 17980 gene locus_tag LOCUS_35110 18477 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 18700 20844 gene locus_tag LOCUS_35120 gene dpp11 18700 20844 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_35120 21085 23970 gene locus_tag LOCUS_35130 21085 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_35130 24144 26837 gene locus_tag LOCUS_35140 24144 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 26972 29965 gene locus_tag LOCUS_35150 26972 29965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence077 1150 272 gene locus_tag LOCUS_35160 1150 272 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_35160 1437 2513 gene locus_tag LOCUS_35170 1437 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 2510 3808 gene locus_tag LOCUS_35180 2510 3808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_35180 3990 4880 gene locus_tag LOCUS_35190 3990 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 4975 5784 gene locus_tag LOCUS_35200 4975 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 6287 5895 gene locus_tag LOCUS_35210 6287 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 7428 6442 gene locus_tag LOCUS_35220 gene pdhB 7428 6442 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_35220 7852 9168 gene locus_tag LOCUS_35230 7852 9168 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_35230 9242 10174 gene locus_tag LOCUS_35240 9242 10174 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_35240 10238 11599 gene locus_tag LOCUS_35250 10238 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_35250 11609 12217 gene locus_tag LOCUS_35260 11609 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 12282 13337 gene locus_tag LOCUS_35270 gene rmlB 12282 13337 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_35270 13452 15908 gene locus_tag LOCUS_35280 13452 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 15915 17096 gene locus_tag LOCUS_35290 15915 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 18396 17176 gene locus_tag LOCUS_35300 gene pgk 18396 17176 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_35300 19449 18457 gene locus_tag LOCUS_35310 gene gapA 19449 18457 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_35310 19555 21966 gene locus_tag LOCUS_35320 19555 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 21959 22807 gene locus_tag LOCUS_35330 21959 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 23235 23307 gene locus_tag LOCUS_t00420 23235 23307 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23378 23450 gene locus_tag LOCUS_t00430 23378 23450 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23521 23593 gene locus_tag LOCUS_t00440 23521 23593 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23910 26048 gene locus_tag LOCUS_35340 23910 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 27263 26157 gene locus_tag LOCUS_35350 27263 26157 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_35350 27849 27418 gene locus_tag LOCUS_35360 27849 27418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 28074 29345 gene locus_tag LOCUS_35370 28074 29345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140367.1 protein_id gnl|my_center|LOCUS_35370 >Feature sequence078 933 415 gene locus_tag LOCUS_35380 933 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 1404 2096 gene locus_tag LOCUS_35390 1404 2096 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_35390 2302 2730 gene locus_tag LOCUS_35400 2302 2730 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_35400 2792 3205 gene locus_tag LOCUS_35410 2792 3205 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_35410 3304 3594 gene locus_tag LOCUS_35420 3304 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3869 4666 gene locus_tag LOCUS_35430 3869 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 4796 5806 gene locus_tag LOCUS_35440 4796 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 5882 6571 gene locus_tag LOCUS_35450 5882 6571 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_35450 6665 7126 gene locus_tag LOCUS_35460 6665 7126 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45083 protein_id gnl|my_center|LOCUS_35460 8199 7195 gene locus_tag LOCUS_35470 gene recF 8199 7195 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZW6 protein_id gnl|my_center|LOCUS_35470 9634 8342 gene locus_tag LOCUS_35480 gene hemL 9634 8342 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC8 protein_id gnl|my_center|LOCUS_35480 10090 10809 gene locus_tag LOCUS_35490 10090 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 10978 12222 gene locus_tag LOCUS_35500 10978 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 13578 12232 gene locus_tag LOCUS_35510 13578 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 13758 16637 gene locus_tag LOCUS_35520 13758 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 18135 16669 gene locus_tag LOCUS_35530 18135 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 18549 20099 gene locus_tag LOCUS_35540 18549 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 20230 21063 gene locus_tag LOCUS_35550 gene uspA 20230 21063 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_35550 21594 22616 gene locus_tag LOCUS_35560 gene fabH1 21594 22616 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_35560 24684 22747 gene locus_tag LOCUS_35570 24684 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_35570 24803 25291 gene locus_tag LOCUS_35580 24803 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 25311 25826 gene locus_tag LOCUS_35590 25311 25826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 25900 26520 gene locus_tag LOCUS_35600 25900 26520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 26622 27338 gene locus_tag LOCUS_35610 26622 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 27867 27427 gene locus_tag LOCUS_35620 gene aroQ 27867 27427 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR7 protein_id gnl|my_center|LOCUS_35620 28603 27920 gene locus_tag LOCUS_35630 28603 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 29010 28684 gene locus_tag LOCUS_35640 29010 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence079 559 143 gene locus_tag LOCUS_35650 559 143 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_35650 1272 673 gene locus_tag LOCUS_35660 1272 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_35660 2846 1437 gene locus_tag LOCUS_35670 2846 1437 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_35670 3374 3793 gene locus_tag LOCUS_35680 3374 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4092 4943 gene locus_tag LOCUS_35690 4092 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 5073 6692 gene locus_tag LOCUS_35700 gene pyrG 5073 6692 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_35700 6817 7548 gene locus_tag LOCUS_35710 6817 7548 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_35710 7570 8010 gene locus_tag LOCUS_35720 7570 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 9548 8028 gene locus_tag LOCUS_35730 9548 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 11525 9639 gene locus_tag LOCUS_35740 11525 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 12718 11525 gene locus_tag LOCUS_35750 12718 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 13444 12740 gene locus_tag LOCUS_35760 13444 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_35760 14143 13655 gene locus_tag LOCUS_35770 14143 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_35770 14716 14249 gene locus_tag LOCUS_35780 14716 14249 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_35780 15307 14759 gene locus_tag LOCUS_35790 15307 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 16940 15480 gene locus_tag LOCUS_35800 16940 15480 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J51 protein_id gnl|my_center|LOCUS_35800 17761 17240 gene locus_tag LOCUS_35810 17761 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 18916 17861 gene locus_tag LOCUS_35820 18916 17861 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_35820 19224 22067 gene locus_tag LOCUS_35830 19224 22067 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_35830 22131 24152 gene locus_tag LOCUS_35840 22131 24152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 24279 25958 gene locus_tag LOCUS_35850 24279 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 28313 26043 gene locus_tag LOCUS_35860 28313 26043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence080 285 1145 gene locus_tag LOCUS_35870 285 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1259 3364 gene locus_tag LOCUS_35880 1259 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_35880 3544 4365 gene locus_tag LOCUS_35890 3544 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4642 5163 gene locus_tag LOCUS_35900 4642 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 5353 6201 gene locus_tag LOCUS_35910 5353 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_35910 6336 6557 gene locus_tag LOCUS_35920 6336 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 7387 6662 gene locus_tag LOCUS_35930 gene phhA 7387 6662 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268521.1 protein_id gnl|my_center|LOCUS_35930 8047 9216 gene locus_tag LOCUS_35940 8047 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 9232 10695 gene locus_tag LOCUS_35950 9232 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 10698 11849 gene locus_tag LOCUS_35960 10698 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 protein_id gnl|my_center|LOCUS_35960 11893 15903 gene locus_tag LOCUS_35970 11893 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 16404 16207 gene locus_tag LOCUS_35980 gene rpsU 16404 16207 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_35980 16584 17159 gene locus_tag LOCUS_35990 16584 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 17210 17710 gene locus_tag LOCUS_36000 17210 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 17794 18933 gene locus_tag LOCUS_36010 17794 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 19043 19993 gene locus_tag LOCUS_36020 19043 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 20723 20526 gene locus_tag LOCUS_36030 20723 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 21049 20777 gene locus_tag LOCUS_36040 21049 20777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 23778 21457 gene locus_tag LOCUS_36050 23778 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 23855 24796 gene locus_tag LOCUS_36060 23855 24796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 25609 24806 gene locus_tag LOCUS_36070 25609 24806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_36070 26206 25649 gene locus_tag LOCUS_36080 26206 25649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 26304 26759 gene locus_tag LOCUS_36090 26304 26759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 26815 27375 gene locus_tag LOCUS_36100 26815 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 28262 27396 gene locus_tag LOCUS_36110 28262 27396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence081 329 6751 gene locus_tag LOCUS_36120 329 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 8225 6804 gene locus_tag LOCUS_36130 8225 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 8445 9500 gene locus_tag LOCUS_36140 8445 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 9497 10384 gene locus_tag LOCUS_36150 9497 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 10450 10995 gene locus_tag LOCUS_36160 10450 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 11501 11055 gene locus_tag LOCUS_36170 11501 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 12954 11734 gene locus_tag LOCUS_36180 gene gcdH 12954 11734 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_36180 14747 13086 gene locus_tag LOCUS_36190 14747 13086 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_36190 15993 15133 gene locus_tag LOCUS_36200 15993 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 17391 16096 gene locus_tag LOCUS_36210 17391 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 21377 17784 gene locus_tag LOCUS_36220 21377 17784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_36220 22896 21544 gene locus_tag LOCUS_36230 gene natB 22896 21544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_36230 23794 22889 gene locus_tag LOCUS_36240 gene natA 23794 22889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_36240 24183 24638 gene locus_tag LOCUS_36250 24183 24638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence082 240 1493 gene locus_tag LOCUS_36260 240 1493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174245.1 protein_id gnl|my_center|LOCUS_36260 1994 3400 gene locus_tag LOCUS_36270 1994 3400 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_36270 3498 3809 gene locus_tag LOCUS_36280 3498 3809 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_36280 3856 4437 gene locus_tag LOCUS_36290 3856 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 4460 5119 gene locus_tag LOCUS_36300 4460 5119 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_36300 5174 5563 gene locus_tag LOCUS_36310 5174 5563 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108942.1 protein_id gnl|my_center|LOCUS_36310 5661 5921 gene locus_tag LOCUS_36320 5661 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 5958 6257 gene locus_tag LOCUS_36330 5958 6257 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_36330 7225 6368 gene locus_tag LOCUS_36340 7225 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 9393 7375 gene locus_tag LOCUS_36350 9393 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 9948 9490 gene locus_tag LOCUS_36360 gene dtd 9948 9490 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_36360 10198 11418 gene locus_tag LOCUS_36370 10198 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 13102 11588 gene locus_tag LOCUS_36380 13102 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 13330 14073 gene locus_tag LOCUS_36390 13330 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 14550 15026 gene locus_tag LOCUS_36400 14550 15026 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_36400 15037 17007 gene locus_tag LOCUS_36410 15037 17007 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_36410 17170 18432 gene locus_tag LOCUS_36420 17170 18432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_36420 20012 18567 gene locus_tag LOCUS_36430 gene hisS 20012 18567 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_36430 20131 20490 gene locus_tag LOCUS_36440 20131 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence083 318 884 gene locus_tag LOCUS_36450 318 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1087 1878 gene locus_tag LOCUS_36460 1087 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 2301 2023 gene locus_tag LOCUS_36470 2301 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3106 2195 gene locus_tag LOCUS_36480 3106 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3301 3678 gene locus_tag LOCUS_36490 3301 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 3726 4109 gene locus_tag LOCUS_36500 3726 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 4231 4461 gene locus_tag LOCUS_36510 4231 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 4662 5309 gene locus_tag LOCUS_36520 4662 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 6249 5338 gene locus_tag LOCUS_36530 6249 5338 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_36530 6432 8405 gene locus_tag LOCUS_36540 6432 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 8784 9341 gene locus_tag LOCUS_36550 8784 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 10854 9499 gene locus_tag LOCUS_36560 10854 9499 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_36560 12819 11104 gene locus_tag LOCUS_36570 12819 11104 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_36570 15586 12845 gene locus_tag LOCUS_36580 15586 12845 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 protein_id gnl|my_center|LOCUS_36580 15991 15590 gene locus_tag LOCUS_36590 15991 15590 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_36590 16945 16004 gene locus_tag LOCUS_36600 gene amiF 16945 16004 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25836 protein_id gnl|my_center|LOCUS_36600 18263 16947 gene locus_tag LOCUS_36610 gene gabT 18263 16947 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_36610 19974 18772 gene locus_tag LOCUS_36620 19974 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 20424 19984 gene locus_tag LOCUS_36630 20424 19984 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 protein_id gnl|my_center|LOCUS_36630 21968 20712 gene locus_tag LOCUS_36640 21968 20712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 24297 22402 gene locus_tag LOCUS_36650 24297 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 24608 25234 gene locus_tag LOCUS_36660 24608 25234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 25236 25880 gene locus_tag LOCUS_36670 25236 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 25899 26549 gene locus_tag LOCUS_36680 25899 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence084 21 2360 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatgctgctatgcctgcaatgggtttagtat 2944 2627 gene locus_tag LOCUS_36690 2944 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 3609 2941 gene locus_tag LOCUS_36700 3609 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 4656 3628 gene locus_tag LOCUS_36710 4656 3628 CDS product CRISPR-associated protein Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_36710 5179 4829 gene locus_tag LOCUS_36720 5179 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 5743 5228 gene locus_tag LOCUS_36730 5743 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 6234 5896 gene locus_tag LOCUS_36740 6234 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 7329 6250 gene locus_tag LOCUS_36750 7329 6250 CDS product type III-B CRISPR module RAMP protein Cmr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880199.1 protein_id gnl|my_center|LOCUS_36750 7682 7329 gene locus_tag LOCUS_36760 7682 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 8647 7682 gene locus_tag LOCUS_36770 8647 7682 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_36770 9848 8649 gene locus_tag LOCUS_36780 9848 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 10955 9855 gene locus_tag LOCUS_36790 10955 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 12874 10955 gene locus_tag LOCUS_36800 12874 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 13517 12867 gene locus_tag LOCUS_36810 13517 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 14837 14406 gene locus_tag LOCUS_36820 14837 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 15138 16661 gene locus_tag LOCUS_36830 15138 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 16702 17403 gene locus_tag LOCUS_36840 16702 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 17553 18197 gene locus_tag LOCUS_36850 gene spoU 17553 18197 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE14 protein_id gnl|my_center|LOCUS_36850 18468 20735 gene locus_tag LOCUS_36860 gene recD2 18468 20735 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_36860 20803 21318 gene locus_tag LOCUS_36870 20803 21318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 21397 23244 gene locus_tag LOCUS_36880 21397 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 23407 24807 gene locus_tag LOCUS_36890 gene speA 23407 24807 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_36890 25148 25777 gene locus_tag LOCUS_36900 gene bioD 25148 25777 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_36900 >Feature sequence085 758 402 gene locus_tag LOCUS_36910 758 402 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_36910 1896 772 gene locus_tag LOCUS_36920 1896 772 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_36920 3954 2047 gene locus_tag LOCUS_36930 3954 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 6262 4115 gene locus_tag LOCUS_36940 6262 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 8539 6800 gene locus_tag LOCUS_36950 8539 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 8784 9812 gene locus_tag LOCUS_36960 8784 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 10430 13924 gene locus_tag LOCUS_36970 10430 13924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108712.1 protein_id gnl|my_center|LOCUS_36970 14349 14071 gene locus_tag LOCUS_36980 14349 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 15050 14376 gene locus_tag LOCUS_36990 15050 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 15103 15285 gene locus_tag LOCUS_37000 15103 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 15361 16182 gene locus_tag LOCUS_37010 15361 16182 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_37010 16304 17422 gene locus_tag LOCUS_37020 gene hppD 16304 17422 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_37020 17831 17920 gene locus_tag LOCUS_t00450 17831 17920 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18094 18945 gene locus_tag LOCUS_37030 18094 18945 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_37030 19060 19545 gene locus_tag LOCUS_37040 19060 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 19671 20159 gene locus_tag LOCUS_37050 19671 20159 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_37050 20193 20663 gene locus_tag LOCUS_37060 20193 20663 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_37060 20886 21422 gene locus_tag LOCUS_37070 20886 21422 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_37070 21433 21891 gene locus_tag LOCUS_37080 21433 21891 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_37080 23050 21953 gene locus_tag LOCUS_37090 23050 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 23242 23964 gene locus_tag LOCUS_37100 23242 23964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 24301 26067 gene locus_tag LOCUS_37110 24301 26067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence086 919 191 gene locus_tag LOCUS_37120 919 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 2437 1088 gene locus_tag LOCUS_37130 2437 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 4063 2708 gene locus_tag LOCUS_37140 4063 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 6390 4216 gene locus_tag LOCUS_37150 gene metG 6390 4216 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_37150 7061 6615 gene locus_tag LOCUS_37160 7061 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 7894 7058 gene locus_tag LOCUS_37170 7894 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 8574 8077 gene locus_tag LOCUS_37180 8574 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 9027 8644 gene locus_tag LOCUS_37190 9027 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 10115 9372 gene locus_tag LOCUS_37200 10115 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 11525 10485 gene locus_tag LOCUS_37210 11525 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 12491 11712 gene locus_tag LOCUS_37220 12491 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 12736 17646 gene locus_tag LOCUS_37230 12736 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 17692 18618 gene locus_tag LOCUS_37240 17692 18618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_37240 18683 20638 gene locus_tag LOCUS_37250 18683 20638 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_37250 20667 21053 gene locus_tag LOCUS_37260 20667 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 21205 23073 gene locus_tag LOCUS_37270 21205 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 25859 23154 gene locus_tag LOCUS_37280 25859 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence087 355 1611 gene locus_tag LOCUS_37290 355 1611 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_37290 1648 2640 gene locus_tag LOCUS_37300 1648 2640 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_37300 2647 3102 gene locus_tag LOCUS_37310 2647 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 4070 3099 gene locus_tag LOCUS_37320 4070 3099 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_37320 4472 7087 gene locus_tag LOCUS_37330 4472 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 7272 7976 gene locus_tag LOCUS_37340 7272 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 8029 9282 gene locus_tag LOCUS_37350 8029 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 9690 10163 gene locus_tag LOCUS_37360 9690 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_37360 10378 10623 gene locus_tag LOCUS_37370 10378 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 11478 10813 gene locus_tag LOCUS_37380 11478 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_37380 13414 11564 gene locus_tag LOCUS_37390 gene glmS 13414 11564 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_37390 14689 13418 gene locus_tag LOCUS_37400 14689 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 15674 14853 gene locus_tag LOCUS_37410 15674 14853 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_37410 15866 16732 gene locus_tag LOCUS_37420 gene panC 15866 16732 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_37420 16873 17481 gene locus_tag LOCUS_37430 gene ppa 16873 17481 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B8Z8 protein_id gnl|my_center|LOCUS_37430 20012 17718 gene locus_tag LOCUS_37440 gene hppA1 20012 17718 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_37440 20417 21001 gene locus_tag LOCUS_37450 20417 21001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 21143 21937 gene locus_tag LOCUS_37460 gene suhB 21143 21937 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ADG6 protein_id gnl|my_center|LOCUS_37460 22620 21934 gene locus_tag LOCUS_37470 22620 21934 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_37470 23024 23734 gene locus_tag LOCUS_37480 23024 23734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 23742 25313 gene locus_tag LOCUS_37490 23742 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 25314 26033 gene locus_tag LOCUS_37500 25314 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence088 4125 1483 gene locus_tag LOCUS_37510 4125 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 4680 5666 gene locus_tag LOCUS_37520 4680 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 5784 7178 gene locus_tag LOCUS_37530 5784 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 7278 8198 gene locus_tag LOCUS_37540 7278 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 8493 9341 gene locus_tag LOCUS_37550 8493 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 9561 10970 gene locus_tag LOCUS_37560 gene aldH 9561 10970 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0U1 protein_id gnl|my_center|LOCUS_37560 11103 12104 gene locus_tag LOCUS_37570 11103 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_37570 12163 14382 gene locus_tag LOCUS_37580 12163 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 14432 15505 gene locus_tag LOCUS_37590 14432 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_37590 15516 17846 gene locus_tag LOCUS_37600 15516 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 17849 18553 gene locus_tag LOCUS_37610 17849 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 18636 19112 gene locus_tag LOCUS_37620 18636 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 19816 19304 gene locus_tag LOCUS_37630 19816 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 21775 19964 gene locus_tag LOCUS_37640 gene uvrC 21775 19964 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_37640 24492 21991 gene locus_tag LOCUS_37650 24492 21991 CDS product subtilisin proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124090.1 protein_id gnl|my_center|LOCUS_37650 25474 24482 gene locus_tag LOCUS_37660 25474 24482 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124092.1 protein_id gnl|my_center|LOCUS_37660 >Feature sequence089 1605 3686 gene locus_tag LOCUS_37670 1605 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 3711 4103 gene locus_tag LOCUS_37680 3711 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 4241 5062 gene locus_tag LOCUS_37690 4241 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069751.1 protein_id gnl|my_center|LOCUS_37690 5076 6257 gene locus_tag LOCUS_37700 5076 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 7040 6336 gene locus_tag LOCUS_37710 7040 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 7677 7018 gene locus_tag LOCUS_37720 7677 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 8523 7705 gene locus_tag LOCUS_37730 8523 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 9403 8702 gene locus_tag LOCUS_37740 9403 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 9635 11314 gene locus_tag LOCUS_37750 9635 11314 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_37750 11929 11390 gene locus_tag LOCUS_37760 11929 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 13364 12114 gene locus_tag LOCUS_37770 13364 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 14098 13424 gene locus_tag LOCUS_37780 14098 13424 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_37780 14949 14542 gene locus_tag LOCUS_37790 14949 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 15335 15174 gene locus_tag LOCUS_37800 gene rpmH 15335 15174 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_37800 17077 15476 gene locus_tag LOCUS_37810 17077 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 17719 18996 gene locus_tag LOCUS_37820 gene serS 17719 18996 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_37820 20460 19054 gene locus_tag LOCUS_37830 20460 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 21881 20463 gene locus_tag LOCUS_37840 21881 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 23327 21906 gene locus_tag LOCUS_37850 23327 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 24110 23448 gene locus_tag LOCUS_37860 gene pdxH 24110 23448 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_37860 24955 24224 gene locus_tag LOCUS_37870 24955 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 >Feature sequence090 207 809 gene locus_tag LOCUS_37880 207 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 1673 945 gene locus_tag LOCUS_37890 1673 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 3216 1972 gene locus_tag LOCUS_37900 gene erg3 3216 1972 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_37900 4094 3375 gene locus_tag LOCUS_37910 4094 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 5787 4513 gene locus_tag LOCUS_37920 5787 4513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_37920 6116 6985 gene locus_tag LOCUS_37930 gene rmlA 6116 6985 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MUA7 protein_id gnl|my_center|LOCUS_37930 7120 8460 gene locus_tag LOCUS_37940 gene gltA 7120 8460 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_37940 8948 8541 gene locus_tag LOCUS_37950 8948 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 10214 8964 gene locus_tag LOCUS_37960 gene aroA 10214 8964 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_37960 10689 10393 gene locus_tag LOCUS_37970 gene fjo15 10689 10393 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_37970 10961 13171 gene locus_tag LOCUS_37980 10961 13171 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_37980 14162 13254 gene locus_tag LOCUS_37990 gene gldN 14162 13254 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_37990 15392 14517 gene locus_tag LOCUS_38000 15392 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 17215 15539 gene locus_tag LOCUS_38010 gene gldM 17215 15539 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_38010 18056 17430 gene locus_tag LOCUS_38020 gene gldL 18056 17430 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_38020 19608 18343 gene locus_tag LOCUS_38030 gene gldK 19608 18343 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_38030 20749 19850 gene locus_tag LOCUS_38040 gene porP 20749 19850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_38040 22077 21025 gene locus_tag LOCUS_38050 22077 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 23476 22079 gene locus_tag LOCUS_38060 23476 22079 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_38060 >Feature sequence091 2801 483 gene locus_tag LOCUS_38070 2801 483 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_38070 5244 3238 gene locus_tag LOCUS_38080 5244 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 5496 6197 gene locus_tag LOCUS_38090 5496 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 6783 6259 gene locus_tag LOCUS_38100 6783 6259 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469118.1 protein_id gnl|my_center|LOCUS_38100 7352 6831 gene locus_tag LOCUS_38110 7352 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 7957 7562 gene locus_tag LOCUS_38120 7957 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 11170 8018 gene locus_tag LOCUS_38130 11170 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 11558 12391 gene locus_tag LOCUS_38140 11558 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 12403 12609 gene locus_tag LOCUS_38150 12403 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 14343 12679 gene locus_tag LOCUS_38160 gene glnS 14343 12679 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_38160 15294 14398 gene locus_tag LOCUS_38170 15294 14398 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_38170 15776 16558 gene locus_tag LOCUS_38180 15776 16558 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_38180 18679 16646 gene locus_tag LOCUS_38190 18679 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 20316 19300 gene locus_tag LOCUS_38200 20316 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_38200 21407 20550 gene locus_tag LOCUS_38210 21407 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 21597 22127 gene locus_tag LOCUS_38220 21597 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 22144 23016 gene locus_tag LOCUS_38230 22144 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 23022 24029 gene locus_tag LOCUS_38240 23022 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 24483 24115 gene locus_tag LOCUS_38250 24483 24115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 >Feature sequence092 2628 1363 gene locus_tag LOCUS_38260 2628 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 3068 2634 gene locus_tag LOCUS_38270 3068 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 3387 3983 gene locus_tag LOCUS_38280 3387 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 5647 4013 gene locus_tag LOCUS_38290 5647 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 6198 5698 gene locus_tag LOCUS_38300 6198 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 7196 6234 gene locus_tag LOCUS_38310 7196 6234 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_38310 8090 7272 gene locus_tag LOCUS_38320 8090 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 8798 8226 gene locus_tag LOCUS_38330 8798 8226 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_38330 9017 9478 gene locus_tag LOCUS_38340 9017 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 11715 9586 gene locus_tag LOCUS_38350 11715 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 12056 11721 gene locus_tag LOCUS_38360 12056 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 14281 12569 gene locus_tag LOCUS_38370 14281 12569 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_38370 14454 15305 gene locus_tag LOCUS_38380 14454 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_38380 15323 15799 gene locus_tag LOCUS_38390 15323 15799 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_38390 16299 15820 gene locus_tag LOCUS_38400 16299 15820 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478145.1 protein_id gnl|my_center|LOCUS_38400 16455 17090 gene locus_tag LOCUS_38410 16455 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 17237 19057 gene locus_tag LOCUS_38420 gene msbA 17237 19057 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_38420 20104 19124 gene locus_tag LOCUS_38430 20104 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 20641 20180 gene locus_tag LOCUS_38440 20641 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 22106 20727 gene locus_tag LOCUS_38450 22106 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 22640 22110 gene locus_tag LOCUS_38460 22640 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 22896 24380 gene locus_tag LOCUS_38470 22896 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence093 150 662 gene locus_tag LOCUS_38480 150 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 784 1269 gene locus_tag LOCUS_38490 784 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1281 3089 gene locus_tag LOCUS_38500 1281 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3295 3666 gene locus_tag LOCUS_38510 3295 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 3657 5603 gene locus_tag LOCUS_38520 3657 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 5659 6072 gene locus_tag LOCUS_38530 5659 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 6875 6075 gene locus_tag LOCUS_38540 6875 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 7351 13164 gene locus_tag LOCUS_38550 7351 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 13400 15661 gene locus_tag LOCUS_38560 13400 15661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 15866 17188 gene locus_tag LOCUS_38570 15866 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120538.1 protein_id gnl|my_center|LOCUS_38570 17587 18786 gene locus_tag LOCUS_38580 gene mqnE 17587 18786 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_38580 18944 19549 gene locus_tag LOCUS_38590 gene gpm 18944 19549 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_38590 19645 20385 gene locus_tag LOCUS_38600 gene mqnA 19645 20385 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_38600 20419 21096 gene locus_tag LOCUS_38610 20419 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 21295 21573 gene locus_tag LOCUS_38620 21295 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_38620 24003 21769 gene locus_tag LOCUS_38630 24003 21769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence094 2293 434 gene locus_tag LOCUS_38640 2293 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 2566 4026 gene locus_tag LOCUS_38650 2566 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 4040 4552 gene locus_tag LOCUS_38660 4040 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 4564 5271 gene locus_tag LOCUS_38670 4564 5271 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_38670 5898 5335 gene locus_tag LOCUS_38680 5898 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 6405 5911 gene locus_tag LOCUS_38690 gene crtZ 6405 5911 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_38690 7104 6427 gene locus_tag LOCUS_38700 7104 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 7335 7409 gene locus_tag LOCUS_t00460 7335 7409 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8850 7477 gene locus_tag LOCUS_38710 8850 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 12254 8922 gene locus_tag LOCUS_38720 12254 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 12372 13268 gene locus_tag LOCUS_38730 12372 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 13452 14444 gene locus_tag LOCUS_38740 13452 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 14704 14937 gene locus_tag LOCUS_38750 14704 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 15364 14987 gene locus_tag LOCUS_38760 15364 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710116.1 protein_id gnl|my_center|LOCUS_38760 16278 15520 gene locus_tag LOCUS_38770 16278 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 18550 16538 gene locus_tag LOCUS_38780 18550 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 18876 20291 gene locus_tag LOCUS_38790 gene lpdA2 18876 20291 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_38790 20741 21946 gene locus_tag LOCUS_38800 20741 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence095 2012 408 gene locus_tag LOCUS_38810 2012 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2653 3054 gene locus_tag LOCUS_38820 2653 3054 CDS product cytochrome C biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_38820 3085 5556 gene locus_tag LOCUS_38830 3085 5556 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_38830 5578 7137 gene locus_tag LOCUS_38840 5578 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 7138 7887 gene locus_tag LOCUS_38850 7138 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 7940 8443 gene locus_tag LOCUS_38860 7940 8443 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_38860 9193 8777 gene locus_tag LOCUS_38870 9193 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 9592 9293 gene locus_tag LOCUS_38880 9592 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 10142 9720 gene locus_tag LOCUS_38890 10142 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 11727 10591 gene locus_tag LOCUS_38900 gene porR 11727 10591 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_38900 12302 11757 gene locus_tag LOCUS_38910 12302 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 12554 14128 gene locus_tag LOCUS_38920 gene porX 12554 14128 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_38920 14430 16859 gene locus_tag LOCUS_38930 14430 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 16971 18734 gene locus_tag LOCUS_38940 16971 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 18737 20476 gene locus_tag LOCUS_38950 18737 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 21969 20473 gene locus_tag LOCUS_38960 21969 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 23454 21994 gene locus_tag LOCUS_38970 23454 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 23584 23375 gene locus_tag LOCUS_38980 23584 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 >Feature sequence096 1766 165 gene locus_tag LOCUS_38990 gene bshC 1766 165 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_38990 1974 3041 gene locus_tag LOCUS_39000 gene alkB 1974 3041 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_39000 3310 4650 gene locus_tag LOCUS_39010 gene ffh 3310 4650 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_39010 5314 5979 gene locus_tag LOCUS_39020 5314 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 6324 7127 gene locus_tag LOCUS_39030 6324 7127 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_39030 7332 7811 gene locus_tag LOCUS_39040 7332 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_39040 7960 8514 gene locus_tag LOCUS_39050 7960 8514 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_39050 8550 9359 gene locus_tag LOCUS_39060 8550 9359 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_39060 9771 9373 gene locus_tag LOCUS_39070 9771 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 10555 9800 gene locus_tag LOCUS_39080 10555 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 11544 10558 gene locus_tag LOCUS_39090 11544 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 13087 11786 gene locus_tag LOCUS_39100 13087 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 13812 14069 gene locus_tag LOCUS_39110 13812 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 14073 14468 gene locus_tag LOCUS_39120 14073 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 14483 14737 gene locus_tag LOCUS_39130 14483 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 14993 15241 gene locus_tag LOCUS_39140 14993 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 15247 15489 gene locus_tag LOCUS_39150 15247 15489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 16436 16981 gene locus_tag LOCUS_39160 16436 16981 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 protein_id gnl|my_center|LOCUS_39160 17181 17849 gene locus_tag LOCUS_39170 17181 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 18156 18611 gene locus_tag LOCUS_39180 18156 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 18720 18926 gene locus_tag LOCUS_39190 18720 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 19102 20319 gene locus_tag LOCUS_39200 19102 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 20473 21177 gene locus_tag LOCUS_39210 20473 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 21506 22042 gene locus_tag LOCUS_39220 21506 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 22146 22616 gene locus_tag LOCUS_39230 22146 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence097 173 1129 gene locus_tag LOCUS_39240 173 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 1157 1591 gene locus_tag LOCUS_39250 1157 1591 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887593.1 protein_id gnl|my_center|LOCUS_39250 1835 3577 gene locus_tag LOCUS_39260 1835 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 3713 4402 gene locus_tag LOCUS_39270 3713 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4472 5041 gene locus_tag LOCUS_39280 4472 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 5091 6017 gene locus_tag LOCUS_39290 5091 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 6051 6860 gene locus_tag LOCUS_39300 6051 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 7229 7759 gene locus_tag LOCUS_39310 7229 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 9252 7903 gene locus_tag LOCUS_39320 9252 7903 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_39320 10365 9664 gene locus_tag LOCUS_39330 10365 9664 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_39330 10521 11000 gene locus_tag LOCUS_39340 10521 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 11198 13426 gene locus_tag LOCUS_39350 11198 13426 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 protein_id gnl|my_center|LOCUS_39350 14430 13849 gene locus_tag LOCUS_39360 14430 13849 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_39360 14862 17684 gene locus_tag LOCUS_39370 14862 17684 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Y6 protein_id gnl|my_center|LOCUS_39370 17706 18806 gene locus_tag LOCUS_39380 17706 18806 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887230.1 protein_id gnl|my_center|LOCUS_39380 19375 20877 gene locus_tag LOCUS_39390 gene rprX 19375 20877 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence098 1109 381 gene locus_tag LOCUS_39400 1109 381 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403628.1 protein_id gnl|my_center|LOCUS_39400 1262 2524 gene locus_tag LOCUS_39410 1262 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 2527 3525 gene locus_tag LOCUS_39420 2527 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4430 3630 gene locus_tag LOCUS_39430 4430 3630 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_39430 4631 5524 gene locus_tag LOCUS_39440 gene ephD 4631 5524 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_39440 6637 5699 gene locus_tag LOCUS_39450 6637 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 7744 7100 gene locus_tag LOCUS_39460 gene cynT 7744 7100 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_39460 9077 7848 gene locus_tag LOCUS_39470 9077 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 9865 9188 gene locus_tag LOCUS_39480 gene trmB 9865 9188 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_39480 10797 9973 gene locus_tag LOCUS_39490 10797 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 12419 10968 gene locus_tag LOCUS_39500 gene pepD 12419 10968 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_39500 13463 12609 gene locus_tag LOCUS_39510 13463 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence099 422 1684 gene locus_tag LOCUS_39520 422 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 2165 1737 gene locus_tag LOCUS_39530 2165 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2350 3252 gene locus_tag LOCUS_39540 2350 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 3304 3621 gene locus_tag LOCUS_39550 3304 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 3751 5697 gene locus_tag LOCUS_39560 gene mutL 3751 5697 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A120 protein_id gnl|my_center|LOCUS_39560 5979 6737 gene locus_tag LOCUS_39570 5979 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 6742 7431 gene locus_tag LOCUS_39580 6742 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 7512 8021 gene locus_tag LOCUS_39590 7512 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 8636 8094 gene locus_tag LOCUS_39600 8636 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 9002 8646 gene locus_tag LOCUS_39610 9002 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 9616 9161 gene locus_tag LOCUS_39620 9616 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 10816 10121 gene locus_tag LOCUS_39630 10816 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 11956 11018 gene locus_tag LOCUS_39640 gene trxB1 11956 11018 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_39640 13550 12381 gene locus_tag LOCUS_39650 13550 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 13894 14436 gene locus_tag LOCUS_39660 13894 14436 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_39660 15688 14540 gene locus_tag LOCUS_39670 15688 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 16621 15845 gene locus_tag LOCUS_39680 16621 15845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_39680 16965 18470 gene locus_tag LOCUS_39690 16965 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 18644 19330 gene locus_tag LOCUS_39700 18644 19330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 19836 19396 gene locus_tag LOCUS_39710 19836 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 20462 20058 gene locus_tag LOCUS_39720 20462 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence100 654 235 gene locus_tag LOCUS_39730 654 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 988 1995 gene locus_tag LOCUS_39740 988 1995 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_39740 2360 4909 gene locus_tag LOCUS_39750 2360 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 5051 5938 gene locus_tag LOCUS_39760 5051 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 7387 5945 gene locus_tag LOCUS_39770 7387 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 7702 8325 gene locus_tag LOCUS_39780 7702 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 8570 9355 gene locus_tag LOCUS_39790 8570 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 9898 9485 gene locus_tag LOCUS_39800 9898 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 10140 11525 gene locus_tag LOCUS_39810 gene rhlE 10140 11525 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_39810 11671 12216 gene locus_tag LOCUS_39820 11671 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 12395 13396 gene locus_tag LOCUS_39830 12395 13396 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937475.1 protein_id gnl|my_center|LOCUS_39830 14265 13570 gene locus_tag LOCUS_39840 14265 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 14763 14311 gene locus_tag LOCUS_39850 14763 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 15781 14942 gene locus_tag LOCUS_39860 15781 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 16227 16661 gene locus_tag LOCUS_39870 16227 16661 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_39870 16735 17976 gene locus_tag LOCUS_39880 16735 17976 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_39880 18037 18903 gene locus_tag LOCUS_39890 18037 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 18950 19825 gene locus_tag LOCUS_39900 18950 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 >Feature sequence101 108 470 gene locus_tag LOCUS_39910 108 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 504 1109 gene locus_tag LOCUS_39920 504 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 1126 1512 gene locus_tag LOCUS_39930 1126 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 1516 2094 gene locus_tag LOCUS_39940 1516 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 2281 3657 gene locus_tag LOCUS_39950 gene hemN 2281 3657 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_39950 3933 7097 gene locus_tag LOCUS_39960 3933 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 7781 7308 gene locus_tag LOCUS_39970 7781 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 8191 7826 gene locus_tag LOCUS_39980 8191 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 8593 10335 gene locus_tag LOCUS_39990 8593 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 10556 10984 gene locus_tag LOCUS_40000 10556 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 11435 11944 gene locus_tag LOCUS_40010 11435 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_40010 11972 12910 gene locus_tag LOCUS_40020 11972 12910 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_40020 12945 13412 gene locus_tag LOCUS_40030 12945 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 16246 13586 gene locus_tag LOCUS_40040 gene cphA 16246 13586 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_40040 18056 16497 gene locus_tag LOCUS_40050 18056 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 <20025 18135 gene locus_tag LOCUS_40060 <20025 18135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence102 3904 554 gene locus_tag LOCUS_40070 3904 554 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_40070 4303 3917 gene locus_tag LOCUS_40080 4303 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4971 4396 gene locus_tag LOCUS_40090 4971 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 5157 6074 gene locus_tag LOCUS_40100 5157 6074 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_40100 6267 8123 gene locus_tag LOCUS_40110 6267 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 8131 9078 gene locus_tag LOCUS_40120 8131 9078 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_40120 9098 9799 gene locus_tag LOCUS_40130 9098 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 9964 12852 gene locus_tag LOCUS_40140 9964 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 13274 14716 gene locus_tag LOCUS_40150 13274 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 15598 14765 gene locus_tag LOCUS_40160 15598 14765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 15968 16042 gene locus_tag LOCUS_t00470 15968 16042 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16168 17391 gene locus_tag LOCUS_40170 16168 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 18121 17303 gene locus_tag LOCUS_40180 18121 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 18985 18482 gene locus_tag LOCUS_40190 18985 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 19396 19007 gene locus_tag LOCUS_40200 19396 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 >Feature sequence103 4130 3675 gene locus_tag LOCUS_40210 4130 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4511 5368 gene locus_tag LOCUS_40220 gene cphB 4511 5368 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_40220 6348 5419 gene locus_tag LOCUS_40230 6348 5419 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097437.1 protein_id gnl|my_center|LOCUS_40230 6593 6982 gene locus_tag LOCUS_40240 6593 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 7175 7357 gene locus_tag LOCUS_40250 7175 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 9545 7566 gene locus_tag LOCUS_40260 gene gyrB 9545 7566 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_40260 10570 9788 gene locus_tag LOCUS_40270 10570 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 10826 11773 gene locus_tag LOCUS_40280 10826 11773 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546428.1 protein_id gnl|my_center|LOCUS_40280 12402 11839 gene locus_tag LOCUS_40290 12402 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 13774 12605 gene locus_tag LOCUS_40300 13774 12605 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_40300 14332 13940 gene locus_tag LOCUS_40310 14332 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 15056 14346 gene locus_tag LOCUS_40320 gene lipB 15056 14346 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_40320 16081 15062 gene locus_tag LOCUS_40330 16081 15062 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_40330 16258 16617 gene locus_tag LOCUS_40340 16258 16617 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_40340 16754 17413 gene locus_tag LOCUS_40350 16754 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 17488 18012 gene locus_tag LOCUS_40360 17488 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 19452 18166 gene locus_tag LOCUS_40370 gene eno 19452 18166 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64074 protein_id gnl|my_center|LOCUS_40370 >Feature sequence104 1904 240 gene locus_tag LOCUS_40380 1904 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 3224 2151 gene locus_tag LOCUS_40390 3224 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 3736 3885 gene locus_tag LOCUS_40400 3736 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 4996 4142 gene locus_tag LOCUS_40410 4996 4142 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_40410 5548 5970 gene locus_tag LOCUS_40420 5548 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_40420 6077 7225 gene locus_tag LOCUS_40430 6077 7225 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_40430 9391 7250 gene locus_tag LOCUS_40440 9391 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 11644 9431 gene locus_tag LOCUS_40450 11644 9431 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404983.1 protein_id gnl|my_center|LOCUS_40450 13649 12024 gene locus_tag LOCUS_40460 13649 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 14252 15874 gene locus_tag LOCUS_40470 14252 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 16068 17234 gene locus_tag LOCUS_40480 16068 17234 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_40480 17447 18598 gene locus_tag LOCUS_40490 17447 18598 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_40490 18585 19199 gene locus_tag LOCUS_40500 18585 19199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 19387 19196 gene locus_tag LOCUS_40510 19387 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence105 969 145 gene locus_tag LOCUS_40520 969 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2006 1056 gene locus_tag LOCUS_40530 2006 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 3088 2030 gene locus_tag LOCUS_40540 3088 2030 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D8 protein_id gnl|my_center|LOCUS_40540 3392 3790 gene locus_tag LOCUS_40550 3392 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 3838 4083 gene locus_tag LOCUS_40560 3838 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4203 4679 gene locus_tag LOCUS_40570 4203 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 4833 4624 gene locus_tag LOCUS_40580 4833 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4934 8248 gene locus_tag LOCUS_40590 4934 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 8414 9880 gene locus_tag LOCUS_40600 8414 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 10264 11247 gene locus_tag LOCUS_40610 10264 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 12526 11324 gene locus_tag LOCUS_40620 12526 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 13450 12671 gene locus_tag LOCUS_40630 13450 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 13607 16501 gene locus_tag LOCUS_40640 13607 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 17746 16943 gene locus_tag LOCUS_40650 17746 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 18602 17739 gene locus_tag LOCUS_40660 18602 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence106 2972 153 gene locus_tag LOCUS_40670 2972 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143578.1 protein_id gnl|my_center|LOCUS_40670 3229 3771 gene locus_tag LOCUS_40680 gene ruvC 3229 3771 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R75 protein_id gnl|my_center|LOCUS_40680 4982 3852 gene locus_tag LOCUS_40690 gene recA 4982 3852 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_40690 5836 5225 gene locus_tag LOCUS_40700 5836 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 6312 6779 gene locus_tag LOCUS_40710 6312 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 7371 6895 gene locus_tag LOCUS_40720 7371 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 8046 7618 gene locus_tag LOCUS_40730 8046 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 8832 9950 gene locus_tag LOCUS_40740 gene dnaN 8832 9950 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_40740 10473 10117 gene locus_tag LOCUS_40750 10473 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 12993 10552 gene locus_tag LOCUS_40760 12993 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 14522 13092 gene locus_tag LOCUS_40770 14522 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 16102 14690 gene locus_tag LOCUS_40780 16102 14690 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_40780 16820 16077 gene locus_tag LOCUS_40790 gene coaX 16820 16077 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_40790 17229 17603 gene locus_tag LOCUS_40800 17229 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 18652 17930 gene locus_tag LOCUS_40810 gene rprY 18652 17930 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_40810 >Feature sequence107 1210 401 gene locus_tag LOCUS_40820 1210 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 2735 1380 gene locus_tag LOCUS_40830 2735 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 3364 2843 gene locus_tag LOCUS_40840 3364 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 4434 3538 gene locus_tag LOCUS_40850 4434 3538 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HK75 protein_id gnl|my_center|LOCUS_40850 4614 9572 gene locus_tag LOCUS_40860 4614 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 10363 9650 gene locus_tag LOCUS_40870 10363 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 10643 11560 gene locus_tag LOCUS_40880 gene nadE 10643 11560 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA55 protein_id gnl|my_center|LOCUS_40880 11557 12327 gene locus_tag LOCUS_40890 11557 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 12818 12336 gene locus_tag LOCUS_40900 12818 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 13627 12863 gene locus_tag LOCUS_40910 13627 12863 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861499.1 protein_id gnl|my_center|LOCUS_40910 15981 13774 gene locus_tag LOCUS_40920 gene katG 15981 13774 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_40920 16308 17252 gene locus_tag LOCUS_40930 gene oxyR 16308 17252 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_40930 17917 17327 gene locus_tag LOCUS_40940 17917 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 18505 18017 gene locus_tag LOCUS_40950 18505 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence108 64 1416 gene locus_tag LOCUS_40960 64 1416 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_40960 1719 2447 gene locus_tag LOCUS_40970 1719 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_40970 2644 4596 gene locus_tag LOCUS_40980 2644 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4630 5346 gene locus_tag LOCUS_40990 4630 5346 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_40990 5371 6669 gene locus_tag LOCUS_41000 5371 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 6741 9398 gene locus_tag LOCUS_41010 6741 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 10046 9468 gene locus_tag LOCUS_41020 10046 9468 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_41020 10499 10053 gene locus_tag LOCUS_41030 10499 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 10882 11970 gene locus_tag LOCUS_41040 10882 11970 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_41040 12088 13731 gene locus_tag LOCUS_41050 gene atoE 12088 13731 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_41050 14123 15031 gene locus_tag LOCUS_41060 14123 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_41060 15244 16257 gene locus_tag LOCUS_41070 15244 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 17039 16611 gene locus_tag LOCUS_41080 17039 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 17488 17048 gene locus_tag LOCUS_41090 17488 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 >Feature sequence109 162 3272 gene locus_tag LOCUS_41100 162 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 3521 4951 gene locus_tag LOCUS_41110 3521 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 5014 7425 gene locus_tag LOCUS_41120 5014 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 7797 10166 gene locus_tag LOCUS_41130 7797 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 10189 12564 gene locus_tag LOCUS_41140 10189 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 13462 12704 gene locus_tag LOCUS_41150 13462 12704 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_41150 14639 13563 gene locus_tag LOCUS_41160 14639 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 15097 15543 gene locus_tag LOCUS_41170 15097 15543 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_41170 15646 16377 gene locus_tag LOCUS_41180 15646 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 16374 16952 gene locus_tag LOCUS_41190 16374 16952 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_41190 >Feature sequence110 1398 2639 gene locus_tag LOCUS_41200 1398 2639 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_41200 3978 3007 gene locus_tag LOCUS_41210 3978 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 4564 4178 gene locus_tag LOCUS_41220 gene apaG 4564 4178 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5R0 protein_id gnl|my_center|LOCUS_41220 5159 4575 gene locus_tag LOCUS_41230 gene gmk 5159 4575 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_41230 6233 5475 gene locus_tag LOCUS_41240 6233 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_41240 6657 7253 gene locus_tag LOCUS_41250 6657 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 7333 7815 gene locus_tag LOCUS_41260 7333 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 7943 8872 gene locus_tag LOCUS_41270 7943 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 9423 9073 gene locus_tag LOCUS_41280 9423 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 9700 10008 gene locus_tag LOCUS_41290 9700 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 11100 10054 gene locus_tag LOCUS_41300 11100 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 11690 11292 gene locus_tag LOCUS_41310 11690 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 12054 11737 gene locus_tag LOCUS_41320 12054 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 12881 12171 gene locus_tag LOCUS_41330 12881 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 13534 13049 gene locus_tag LOCUS_41340 13534 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 14039 14386 gene locus_tag LOCUS_41350 14039 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 14405 14677 gene locus_tag LOCUS_41360 14405 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 14680 14964 gene locus_tag LOCUS_41370 14680 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 15134 15313 gene locus_tag LOCUS_41380 15134 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 16284 15838 gene locus_tag LOCUS_41390 16284 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence111 765 103 gene locus_tag LOCUS_41400 765 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 1816 872 gene locus_tag LOCUS_41410 1816 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_41410 2144 1809 gene locus_tag LOCUS_41420 2144 1809 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_41420 2340 2125 gene locus_tag LOCUS_41430 2340 2125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_41430 2936 3502 gene locus_tag LOCUS_41440 2936 3502 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_41440 3549 4802 gene locus_tag LOCUS_41450 3549 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 4928 8644 gene locus_tag LOCUS_41460 4928 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 8759 9334 gene locus_tag LOCUS_41470 8759 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 9428 9571 gene locus_tag LOCUS_41480 9428 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 10359 9787 gene locus_tag LOCUS_41490 10359 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 11223 10450 gene locus_tag LOCUS_41500 11223 10450 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_41500 14462 11304 gene locus_tag LOCUS_41510 14462 11304 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_41510 14734 15495 gene locus_tag LOCUS_41520 14734 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 15508 15966 gene locus_tag LOCUS_41530 15508 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 15963 16358 gene locus_tag LOCUS_41540 15963 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 >Feature sequence112 329 1408 gene locus_tag LOCUS_41550 329 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_41550 1614 1772 gene locus_tag LOCUS_41560 1614 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 2007 2207 gene locus_tag LOCUS_41570 2007 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2534 2947 gene locus_tag LOCUS_41580 2534 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 3622 3116 gene locus_tag LOCUS_41590 3622 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 3775 4230 gene locus_tag LOCUS_41600 3775 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 4296 5294 gene locus_tag LOCUS_41610 4296 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 5533 6978 gene locus_tag LOCUS_41620 5533 6978 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_41620 8311 7799 gene locus_tag LOCUS_41630 8311 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 8730 8389 gene locus_tag LOCUS_41640 8730 8389 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_41640 9698 8751 gene locus_tag LOCUS_41650 9698 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 10104 10655 gene locus_tag LOCUS_41660 10104 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 10812 11045 gene locus_tag LOCUS_41670 10812 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 13403 11208 gene locus_tag LOCUS_41680 13403 11208 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_41680 14560 13466 gene locus_tag LOCUS_41690 14560 13466 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728629.1 protein_id gnl|my_center|LOCUS_41690 15323 14577 gene locus_tag LOCUS_41700 15323 14577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_41700 16205 15432 gene locus_tag LOCUS_41710 16205 15432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_41710 >Feature sequence113 1267 599 gene locus_tag LOCUS_41720 1267 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 1778 1272 gene locus_tag LOCUS_41730 gene rfaY 1778 1272 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_41730 2307 1903 gene locus_tag LOCUS_41740 2307 1903 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_41740 2574 3887 gene locus_tag LOCUS_41750 2574 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 5122 3884 gene locus_tag LOCUS_41760 5122 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 6099 5185 gene locus_tag LOCUS_41770 6099 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 6540 6199 gene locus_tag LOCUS_41780 6540 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 7171 6623 gene locus_tag LOCUS_41790 7171 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 8184 7168 gene locus_tag LOCUS_41800 8184 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_41800 9353 8538 gene locus_tag LOCUS_41810 9353 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 9622 10602 gene locus_tag LOCUS_41820 9622 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 11980 10772 gene locus_tag LOCUS_41830 11980 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 12081 13184 gene locus_tag LOCUS_41840 12081 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 14799 13189 gene locus_tag LOCUS_41850 14799 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence114 203 1255 gene locus_tag LOCUS_41860 gene lpxD 203 1255 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A014 protein_id gnl|my_center|LOCUS_41860 1256 2053 gene locus_tag LOCUS_41870 1256 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 2870 1998 gene locus_tag LOCUS_41880 2870 1998 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_41880 3365 2895 gene locus_tag LOCUS_41890 3365 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 3738 3469 gene locus_tag LOCUS_41900 3738 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 3866 4027 gene locus_tag LOCUS_41910 3866 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 4052 4555 gene locus_tag LOCUS_41920 4052 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 5709 4660 gene locus_tag LOCUS_41930 5709 4660 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_41930 6961 5834 gene locus_tag LOCUS_41940 6961 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 8080 7175 gene locus_tag LOCUS_41950 8080 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 9032 8127 gene locus_tag LOCUS_41960 9032 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 9897 9088 gene locus_tag LOCUS_41970 gene uspA 9897 9088 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_41970 10160 10996 gene locus_tag LOCUS_41980 gene uspA 10160 10996 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_41980 13058 11010 gene locus_tag LOCUS_41990 13058 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_41990 13593 13111 gene locus_tag LOCUS_42000 gene cdd 13593 13111 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_42000 14121 15473 gene locus_tag LOCUS_42010 14121 15473 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_42010 >Feature sequence115 1291 245 gene locus_tag LOCUS_42020 1291 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 1414 3657 gene locus_tag LOCUS_42030 1414 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 4831 3779 gene locus_tag LOCUS_42040 4831 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 5695 4874 gene locus_tag LOCUS_42050 5695 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 6242 6676 gene locus_tag LOCUS_42060 6242 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 11061 6745 gene locus_tag LOCUS_42070 11061 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 11948 11232 gene locus_tag LOCUS_42080 11948 11232 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206316.1 protein_id gnl|my_center|LOCUS_42080 12890 12087 gene locus_tag LOCUS_42090 12890 12087 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_42090 13413 13084 gene locus_tag LOCUS_42100 13413 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 13995 13528 gene locus_tag LOCUS_42110 13995 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 >Feature sequence116 132 1139 gene locus_tag LOCUS_42120 132 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1208 2404 gene locus_tag LOCUS_42130 1208 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 2429 3181 gene locus_tag LOCUS_42140 2429 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 3302 4573 gene locus_tag LOCUS_42150 3302 4573 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_42150 5418 4690 gene locus_tag LOCUS_42160 5418 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 5523 6143 gene locus_tag LOCUS_42170 5523 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 6505 9387 gene locus_tag LOCUS_42180 6505 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_42180 9439 9855 gene locus_tag LOCUS_42190 9439 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 9984 10631 gene locus_tag LOCUS_42200 9984 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 10962 11543 gene locus_tag LOCUS_42210 10962 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 11742 12317 gene locus_tag LOCUS_42220 11742 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 12301 12672 gene locus_tag LOCUS_42230 12301 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 12605 12838 gene locus_tag LOCUS_42240 12605 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 15081 12925 gene locus_tag LOCUS_42250 gene recD2 15081 12925 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCL3 protein_id gnl|my_center|LOCUS_42250 >Feature sequence117 66 139 gene locus_tag LOCUS_t00480 66 139 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 519 3701 gene locus_tag LOCUS_42260 519 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 3862 6084 gene locus_tag LOCUS_42270 3862 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 7105 6182 gene locus_tag LOCUS_42280 7105 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_42280 7646 7230 gene locus_tag LOCUS_42290 7646 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 7887 8954 gene locus_tag LOCUS_42300 7887 8954 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_42300 10622 9297 gene locus_tag LOCUS_42310 gene phrB1 10622 9297 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_42310 10771 11877 gene locus_tag LOCUS_42320 gene gcvT 10771 11877 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_42320 11993 13174 gene locus_tag LOCUS_42330 11993 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 13184 13870 gene locus_tag LOCUS_42340 13184 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 14215 14679 gene locus_tag LOCUS_42350 14215 14679 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_42350 >Feature sequence118 757 164 gene locus_tag LOCUS_42360 757 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 1476 997 gene locus_tag LOCUS_42370 1476 997 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_42370 4020 1957 gene locus_tag LOCUS_42380 4020 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 5476 4193 gene locus_tag LOCUS_42390 5476 4193 CDS product mannanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918686.1 protein_id gnl|my_center|LOCUS_42390 5827 7287 gene locus_tag LOCUS_42400 5827 7287 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_42400 7449 8225 gene locus_tag LOCUS_42410 7449 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 8262 9065 gene locus_tag LOCUS_42420 8262 9065 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_42420 10132 9086 gene locus_tag LOCUS_42430 10132 9086 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_42430 10498 12075 gene locus_tag LOCUS_42440 gene prfC 10498 12075 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_42440 12172 12588 gene locus_tag LOCUS_42450 12172 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 12719 13975 gene locus_tag LOCUS_42460 12719 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 13869 14582 gene locus_tag LOCUS_42470 13869 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 14554 14886 gene locus_tag LOCUS_42480 14554 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 >Feature sequence119 1846 2625 gene locus_tag LOCUS_42490 1846 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 2618 4177 gene locus_tag LOCUS_42500 2618 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 5650 4190 gene locus_tag LOCUS_42510 5650 4190 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524967.1 protein_id gnl|my_center|LOCUS_42510 6734 5919 gene locus_tag LOCUS_42520 6734 5919 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_42520 8043 10460 gene locus_tag LOCUS_42530 8043 10460 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964024.1 protein_id gnl|my_center|LOCUS_42530 11071 10622 gene locus_tag LOCUS_42540 11071 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 12338 11082 gene locus_tag LOCUS_42550 12338 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 14112 12433 gene locus_tag LOCUS_42560 14112 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_42560 >Feature sequence120 1898 345 gene locus_tag LOCUS_42570 1898 345 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_42570 2508 2044 gene locus_tag LOCUS_42580 2508 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 3108 3944 gene locus_tag LOCUS_42590 gene zupT 3108 3944 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 protein_id gnl|my_center|LOCUS_42590 3971 4948 gene locus_tag LOCUS_42600 gene rocF 3971 4948 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_42600 6849 5062 gene locus_tag LOCUS_42610 6849 5062 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_42610 7204 6881 gene locus_tag LOCUS_42620 7204 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 7795 11178 gene locus_tag LOCUS_42630 7795 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 11261 12655 gene locus_tag LOCUS_42640 11261 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 12723 14201 gene locus_tag LOCUS_42650 12723 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 >Feature sequence121 1525 8964 gene locus_tag LOCUS_42660 1525 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 9441 10142 gene locus_tag LOCUS_42670 9441 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 11540 10503 gene locus_tag LOCUS_42680 11540 10503 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_42680 12622 11813 gene locus_tag LOCUS_42690 12622 11813 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_42690 <14006 12716 gene locus_tag LOCUS_42700 <14006 12716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor >Feature sequence122 5797 3170 gene locus_tag LOCUS_42710 5797 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 9082 6005 gene locus_tag LOCUS_42720 9082 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 13090 9425 gene locus_tag LOCUS_42730 13090 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence123 339 1943 gene locus_tag LOCUS_42740 339 1943 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2X1 protein_id gnl|my_center|LOCUS_42740 2072 2680 gene locus_tag LOCUS_42750 gene recR 2072 2680 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_42750 2837 4837 gene locus_tag LOCUS_42760 2837 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 5057 5815 gene locus_tag LOCUS_42770 5057 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 5936 6145 gene locus_tag LOCUS_42780 5936 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 6282 6680 gene locus_tag LOCUS_42790 6282 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 6726 7766 gene locus_tag LOCUS_42800 6726 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 7817 8935 gene locus_tag LOCUS_42810 7817 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030365.1 protein_id gnl|my_center|LOCUS_42810 8947 9423 gene locus_tag LOCUS_42820 8947 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 10066 9479 gene locus_tag LOCUS_42830 10066 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 11489 10140 gene locus_tag LOCUS_42840 11489 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 13062 11698 gene locus_tag LOCUS_42850 13062 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence124 826 299 gene locus_tag LOCUS_42860 826 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 3020 918 gene locus_tag LOCUS_42870 3020 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 5223 3430 gene locus_tag LOCUS_42880 5223 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 6583 5489 gene locus_tag LOCUS_42890 6583 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 6807 7802 gene locus_tag LOCUS_42900 6807 7802 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_42900 7860 8537 gene locus_tag LOCUS_42910 gene yegX 7860 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7H0 protein_id gnl|my_center|LOCUS_42910 8610 9395 gene locus_tag LOCUS_42920 8610 9395 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 protein_id gnl|my_center|LOCUS_42920 9576 12002 gene locus_tag LOCUS_42930 9576 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 12380 12865 gene locus_tag LOCUS_42940 12380 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 >Feature sequence125 1445 1134 gene locus_tag LOCUS_42950 1445 1134 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_42950 1888 1817 gene locus_tag LOCUS_t00490 1888 1817 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2013 1942 gene locus_tag LOCUS_t00500 2013 1942 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2506 2072 gene locus_tag LOCUS_42960 2506 2072 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_42960 2796 3041 gene locus_tag LOCUS_42970 2796 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 3132 3410 gene locus_tag LOCUS_42980 3132 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 3394 4206 gene locus_tag LOCUS_42990 3394 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 11588 4302 gene locus_tag LOCUS_43000 gene sprA 11588 4302 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_43000 12324 11722 gene locus_tag LOCUS_43010 gene ruvA 12324 11722 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_43010 >Feature sequence126 <1 2623 gene locus_tag LOCUS_43020 <1 2623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 3792 2881 gene locus_tag LOCUS_43030 3792 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 4963 3815 gene locus_tag LOCUS_43040 4963 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 6275 5091 gene locus_tag LOCUS_43050 6275 5091 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_43050 6508 7221 gene locus_tag LOCUS_43060 6508 7221 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107904.1 protein_id gnl|my_center|LOCUS_43060 7314 8588 gene locus_tag LOCUS_43070 7314 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 8621 9865 gene locus_tag LOCUS_43080 gene deaD-2 8621 9865 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_43080 9867 12374 gene locus_tag LOCUS_43090 9867 12374 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_43090 >Feature sequence127 899 150 gene locus_tag LOCUS_43100 899 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 7652 1149 gene locus_tag LOCUS_43110 7652 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 <12354 7797 gene locus_tag LOCUS_43120 <12354 7797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence128 415 1176 gene locus_tag LOCUS_43130 415 1176 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_43130 1270 3141 gene locus_tag LOCUS_43140 1270 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 3920 3138 gene locus_tag LOCUS_43150 3920 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 5633 3927 gene locus_tag LOCUS_43160 gene batD 5633 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_43160 6420 5746 gene locus_tag LOCUS_43170 6420 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 7116 6475 gene locus_tag LOCUS_43180 gene batC 7116 6475 CDS product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_43180 8244 7138 gene locus_tag LOCUS_43190 8244 7138 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_43190 9430 8555 gene locus_tag LOCUS_43200 9430 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_43200 10491 9616 gene locus_tag LOCUS_43210 10491 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43210 11596 10613 gene locus_tag LOCUS_43220 11596 10613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_43220 <12331 11577 gene locus_tag LOCUS_43230 <12331 11577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784896.1:ABC transporter ATP-binding protein >Feature sequence129 2464 263 gene locus_tag LOCUS_43240 2464 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 2989 4851 gene locus_tag LOCUS_43250 gene htpG 2989 4851 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_43250 5190 8942 gene locus_tag LOCUS_43260 5190 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583095.1 protein_id gnl|my_center|LOCUS_43260 9170 9958 gene locus_tag LOCUS_43270 9170 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 10019 10549 gene locus_tag LOCUS_43280 10019 10549 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855621.1 protein_id gnl|my_center|LOCUS_43280 10648 11205 gene locus_tag LOCUS_43290 gene aroK 10648 11205 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH27 protein_id gnl|my_center|LOCUS_43290 11206 11757 gene locus_tag LOCUS_43300 11206 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence130 1246 683 gene locus_tag LOCUS_43310 1246 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 1384 2130 gene locus_tag LOCUS_43320 1384 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 2551 2285 gene locus_tag LOCUS_43330 2551 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 3590 2535 gene locus_tag LOCUS_43340 3590 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 4514 4092 gene locus_tag LOCUS_43350 4514 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 5606 4569 gene locus_tag LOCUS_43360 5606 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 5754 7247 gene locus_tag LOCUS_43370 5754 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 7264 7728 gene locus_tag LOCUS_43380 7264 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 7826 8158 gene locus_tag LOCUS_43390 7826 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 8189 8707 gene locus_tag LOCUS_43400 8189 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 8864 9235 gene locus_tag LOCUS_43410 8864 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 9225 9485 gene locus_tag LOCUS_43420 9225 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 9525 9776 gene locus_tag LOCUS_43430 9525 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 9782 10495 gene locus_tag LOCUS_43440 9782 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 >Feature sequence131 503 1402 gene locus_tag LOCUS_43450 503 1402 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_43450 1426 3294 gene locus_tag LOCUS_43460 1426 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 3312 3743 gene locus_tag LOCUS_43470 3312 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 5292 3859 gene locus_tag LOCUS_43480 5292 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 6667 5603 gene locus_tag LOCUS_43490 gene holA 6667 5603 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_43490 7372 7049 gene locus_tag LOCUS_43500 7372 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 8575 7463 gene locus_tag LOCUS_43510 gene paaE 8575 7463 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_43510 9222 8623 gene locus_tag LOCUS_43520 9222 8623 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233008.1 protein_id gnl|my_center|LOCUS_43520 10847 9798 gene locus_tag LOCUS_43530 10847 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence132 521 1324 gene locus_tag LOCUS_43540 521 1324 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_43540 1611 1315 gene locus_tag LOCUS_43550 1611 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 3343 1598 gene locus_tag LOCUS_43560 3343 1598 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_43560 4180 3512 gene locus_tag LOCUS_43570 4180 3512 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_43570 5206 4556 gene locus_tag LOCUS_43580 5206 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 5633 5250 gene locus_tag LOCUS_43590 5633 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 7106 5703 gene locus_tag LOCUS_43600 7106 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 10479 7234 gene locus_tag LOCUS_43610 10479 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_43610 11109 10558 gene locus_tag LOCUS_43620 11109 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence133 1289 813 gene locus_tag LOCUS_43630 1289 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 3532 1607 gene locus_tag LOCUS_43640 gene argS 3532 1607 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_43640 3720 4211 gene locus_tag LOCUS_43650 3720 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 4260 4796 gene locus_tag LOCUS_43660 4260 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 4812 7673 gene locus_tag LOCUS_43670 4812 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 7870 9432 gene locus_tag LOCUS_43680 7870 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_43680 9519 10763 gene locus_tag LOCUS_43690 9519 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_43690 10866 10953 gene locus_tag LOCUS_t00510 10866 10953 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 <1 1752 gene locus_tag LOCUS_43700 <1 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P63:tricorn protease 1901 3250 gene locus_tag LOCUS_43710 1901 3250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_43710 3820 3266 gene locus_tag LOCUS_43720 3820 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 4474 3929 gene locus_tag LOCUS_43730 4474 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 4845 5549 gene locus_tag LOCUS_43740 4845 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 8052 5722 gene locus_tag LOCUS_43750 8052 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 8407 10884 gene locus_tag LOCUS_43760 8407 10884 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_43760 >Feature sequence135 170 1984 gene locus_tag LOCUS_43770 170 1984 CDS product 4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117803.1 protein_id gnl|my_center|LOCUS_43770 2654 1998 gene locus_tag LOCUS_43780 2654 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 2771 3163 gene locus_tag LOCUS_43790 2771 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 3629 3186 gene locus_tag LOCUS_43800 3629 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 4421 3687 gene locus_tag LOCUS_43810 4421 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 5114 6697 gene locus_tag LOCUS_43820 gene ggt 5114 6697 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_43820 6804 7331 gene locus_tag LOCUS_43830 6804 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 7344 8231 gene locus_tag LOCUS_43840 7344 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 8264 9094 gene locus_tag LOCUS_43850 8264 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 9102 9470 gene locus_tag LOCUS_43860 9102 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 9779 10420 gene locus_tag LOCUS_43870 gene yceI 9779 10420 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_43870 >Feature sequence136 3074 204 gene locus_tag LOCUS_43880 3074 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142223.1 protein_id gnl|my_center|LOCUS_43880 3816 3229 gene locus_tag LOCUS_43890 3816 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 4655 4188 gene locus_tag LOCUS_43900 4655 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 5173 4952 gene locus_tag LOCUS_43910 5173 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 5468 7585 gene locus_tag LOCUS_43920 5468 7585 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_43920 7672 8133 gene locus_tag LOCUS_43930 7672 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 8231 8626 gene locus_tag LOCUS_43940 8231 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 9287 8643 gene locus_tag LOCUS_43950 9287 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 9739 9365 gene locus_tag LOCUS_43960 9739 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 10302 9739 gene locus_tag LOCUS_43970 10302 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 >Feature sequence137 1278 6206 gene locus_tag LOCUS_43980 1278 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 >Feature sequence138 1187 93 gene locus_tag LOCUS_43990 1187 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 1458 2885 gene locus_tag LOCUS_44000 1458 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 3059 3940 gene locus_tag LOCUS_44010 3059 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 4736 3912 gene locus_tag LOCUS_44020 4736 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 4819 6603 gene locus_tag LOCUS_44030 4819 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 7994 6651 gene locus_tag LOCUS_44040 gene accC 7994 6651 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_44040 8602 8090 gene locus_tag LOCUS_44050 gene accB 8602 8090 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_44050 9244 8675 gene locus_tag LOCUS_44060 gene efp 9244 8675 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_44060 9470 9249 gene locus_tag LOCUS_44070 9470 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence139 686 123 gene locus_tag LOCUS_44080 686 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 782 1840 gene locus_tag LOCUS_44090 782 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_44090 1843 2763 gene locus_tag LOCUS_44100 1843 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_44100 2810 3682 gene locus_tag LOCUS_44110 2810 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 3892 4464 gene locus_tag LOCUS_44120 3892 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 4718 6193 gene locus_tag LOCUS_44130 4718 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 6442 7917 gene locus_tag LOCUS_44140 gene crtI 6442 7917 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_44140 7963 8805 gene locus_tag LOCUS_44150 gene crtB 7963 8805 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_44150 8805 9707 gene locus_tag LOCUS_44160 8805 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 >Feature sequence140 227 1411 gene locus_tag LOCUS_44170 227 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_44170 2612 1449 gene locus_tag LOCUS_44180 2612 1449 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_44180 3758 2763 gene locus_tag LOCUS_44190 3758 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_44190 4871 4125 gene locus_tag LOCUS_44200 4871 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 5601 4960 gene locus_tag LOCUS_44210 5601 4960 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_44210 6307 5612 gene locus_tag LOCUS_44220 6307 5612 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_44220 7205 6339 gene locus_tag LOCUS_44230 gene mscS 7205 6339 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_44230 8614 7226 gene locus_tag LOCUS_44240 gene tilS 8614 7226 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_44240 9131 8604 gene locus_tag LOCUS_44250 9131 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 9323 9703 gene locus_tag LOCUS_44260 9323 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 >Feature sequence141 183 494 gene locus_tag LOCUS_44270 gene ogt2 183 494 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_44270 849 562 gene locus_tag LOCUS_44280 849 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 1636 920 gene locus_tag LOCUS_44290 1636 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 1860 2258 gene locus_tag LOCUS_44300 1860 2258 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_44300 2274 2855 gene locus_tag LOCUS_44310 gene def 2274 2855 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_44310 2962 3630 gene locus_tag LOCUS_44320 2962 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_44320 3813 4205 gene locus_tag LOCUS_44330 3813 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 4595 6136 gene locus_tag LOCUS_44340 4595 6136 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_44340 9631 6227 gene locus_tag LOCUS_44350 9631 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 >Feature sequence142 <1 3790 gene locus_tag LOCUS_44360 <1 3790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 3919 4806 gene locus_tag LOCUS_44370 gene porP 3919 4806 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_44370 4941 6911 gene locus_tag LOCUS_44380 4941 6911 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_44380 7585 7286 gene locus_tag LOCUS_44390 7585 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 8182 7649 gene locus_tag LOCUS_44400 8182 7649 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_44400 >Feature sequence143 653 1282 gene locus_tag LOCUS_44410 653 1282 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 protein_id gnl|my_center|LOCUS_44410 1377 2723 gene locus_tag LOCUS_44420 1377 2723 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_44420 2738 3400 gene locus_tag LOCUS_44430 2738 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 3692 4624 gene locus_tag LOCUS_44440 3692 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 4699 5334 gene locus_tag LOCUS_44450 4699 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_44450 5336 6016 gene locus_tag LOCUS_44460 5336 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 6724 6035 gene locus_tag LOCUS_44470 6724 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 6912 7277 gene locus_tag LOCUS_44480 6912 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 7302 7955 gene locus_tag LOCUS_44490 7302 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 >Feature sequence144 293 3148 gene locus_tag LOCUS_44500 293 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 3624 4403 gene locus_tag LOCUS_44510 gene cysQ 3624 4403 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_44510 5459 4479 gene locus_tag LOCUS_44520 5459 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 5727 7550 gene locus_tag LOCUS_44530 gene fadD 5727 7550 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence145 1812 175 gene locus_tag LOCUS_44540 1812 175 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_44540 2347 3813 gene locus_tag LOCUS_44550 2347 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 4000 5340 gene locus_tag LOCUS_44560 4000 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 5418 7319 gene locus_tag LOCUS_44570 5418 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 >Feature sequence146 940 119 gene locus_tag LOCUS_44580 940 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 1870 1313 gene locus_tag LOCUS_44590 1870 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 2061 3041 gene locus_tag LOCUS_44600 2061 3041 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120210.1 protein_id gnl|my_center|LOCUS_44600 3161 3547 gene locus_tag LOCUS_44610 3161 3547 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 protein_id gnl|my_center|LOCUS_44610 3656 3904 gene locus_tag LOCUS_44620 3656 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 3904 4365 gene locus_tag LOCUS_44630 gene doc 3904 4365 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287933.1 protein_id gnl|my_center|LOCUS_44630 4367 4753 gene locus_tag LOCUS_44640 4367 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 4989 7037 gene locus_tag LOCUS_44650 4989 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 >Feature sequence147 705 2750 gene locus_tag LOCUS_44660 705 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 4383 2908 gene locus_tag LOCUS_44670 4383 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 6761 4488 gene locus_tag LOCUS_44680 6761 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 >Feature sequence148 2600 747 gene locus_tag LOCUS_44690 2600 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 3901 3023 gene locus_tag LOCUS_44700 3901 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_44700 <7040 3958 gene locus_tag LOCUS_44710 <7040 3958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor >Feature sequence149 222 1067 gene locus_tag LOCUS_44720 222 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 1143 1652 gene locus_tag LOCUS_44730 1143 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1699 2475 gene locus_tag LOCUS_44740 1699 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 3437 3730 gene locus_tag LOCUS_44750 3437 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 3759 4103 gene locus_tag LOCUS_44760 3759 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 4100 4897 gene locus_tag LOCUS_44770 4100 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 4922 5359 gene locus_tag LOCUS_44780 4922 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 >Feature sequence150 1752 142 gene locus_tag LOCUS_44790 1752 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 1854 2321 gene locus_tag LOCUS_44800 1854 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 4616 2283 gene locus_tag LOCUS_44810 4616 2283 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_44810 >Feature sequence151 <1 1905 gene locus_tag LOCUS_44820 <1 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2027 6181 gene locus_tag LOCUS_44830 2027 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 >Feature sequence152 1509 211 gene locus_tag LOCUS_44840 gene umuC 1509 211 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_44840 2001 1633 gene locus_tag LOCUS_44850 2001 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_44850 2528 2145 gene locus_tag LOCUS_44860 2528 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 2974 4527 gene locus_tag LOCUS_44870 2974 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 4636 5871 gene locus_tag LOCUS_44880 4636 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 >Feature sequence153 522 109 gene locus_tag LOCUS_44890 522 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 856 3285 gene locus_tag LOCUS_44900 856 3285 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_44900 3301 3666 gene locus_tag LOCUS_44910 3301 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 4200 3736 gene locus_tag LOCUS_44920 4200 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 5779 4313 gene locus_tag LOCUS_44930 5779 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence154 2243 225 gene locus_tag LOCUS_44940 2243 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 2521 4290 gene locus_tag LOCUS_44950 2521 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 5431 4370 gene locus_tag LOCUS_44960 5431 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_44960 >Feature sequence155 2 322 gene locus_tag LOCUS_44970 2 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 603 2849 gene locus_tag LOCUS_44980 603 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 3153 4985 gene locus_tag LOCUS_44990 gene typA 3153 4985 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_44990 >Feature sequence156 176 604 gene locus_tag LOCUS_45000 176 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_45000 1051 623 gene locus_tag LOCUS_45010 1051 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 1427 1146 gene locus_tag LOCUS_45020 1427 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 1995 1528 gene locus_tag LOCUS_45030 1995 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 2922 2176 gene locus_tag LOCUS_45040 2922 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 5042 3105 gene locus_tag LOCUS_45050 5042 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence157 <1 2370 gene locus_tag LOCUS_45060 <1 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123142.1:cell surface protein 2477 3238 gene locus_tag LOCUS_45070 2477 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 3266 3838 gene locus_tag LOCUS_45080 3266 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 3843 4850 gene locus_tag LOCUS_45090 3843 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 >Feature sequence158 3857 1677 gene locus_tag LOCUS_45100 3857 1677 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764507.1 protein_id gnl|my_center|LOCUS_45100 4409 3942 gene locus_tag LOCUS_45110 4409 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_45110 >Feature sequence159 1226 543 gene locus_tag LOCUS_45120 1226 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 1861 1328 gene locus_tag LOCUS_45130 1861 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 2870 2664 gene locus_tag LOCUS_45140 2870 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 4259 3159 gene locus_tag LOCUS_45150 4259 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 4846 4346 gene locus_tag LOCUS_45160 4846 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 >Feature sequence160 1398 367 gene locus_tag LOCUS_45170 gene pyrD 1398 367 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_45170 1842 2621 gene locus_tag LOCUS_45180 1842 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2699 3388 gene locus_tag LOCUS_45190 2699 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 3369 4088 gene locus_tag LOCUS_45200 3369 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 >Feature sequence161 272 4606 gene locus_tag LOCUS_45210 272 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 >Feature sequence162 >Feature sequence163 172 531 gene locus_tag LOCUS_45220 172 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 867 610 gene locus_tag LOCUS_45230 gene yoeB 867 610 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69348 protein_id gnl|my_center|LOCUS_45230 1561 887 gene locus_tag LOCUS_45240 1561 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 2523 2759 gene locus_tag LOCUS_45250 2523 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 3034 2765 gene locus_tag LOCUS_45260 3034 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 3064 3294 gene locus_tag LOCUS_45270 3064 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 3449 4030 gene locus_tag LOCUS_45280 3449 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 4091 4306 gene locus_tag LOCUS_45290 4091 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 >Feature sequence164 299 616 gene locus_tag LOCUS_45300 299 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 667 4383 gene locus_tag LOCUS_45310 667 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence165 410 129 gene locus_tag LOCUS_45320 410 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 1682 414 gene locus_tag LOCUS_45330 1682 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979163.1 protein_id gnl|my_center|LOCUS_45330 1819 3114 gene locus_tag LOCUS_45340 gene pepP 1819 3114 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_45340 3381 4229 gene locus_tag LOCUS_45350 3381 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 >Feature sequence166 661 1365 gene locus_tag LOCUS_45360 661 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 1352 1852 gene locus_tag LOCUS_45370 1352 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 1864 2280 gene locus_tag LOCUS_45380 1864 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_45380 2707 3489 gene locus_tag LOCUS_45390 2707 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 >Feature sequence167 91 753 gene locus_tag LOCUS_45400 91 753 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_45400 847 2004 gene locus_tag LOCUS_45410 847 2004 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_45410 2132 2794 gene locus_tag LOCUS_45420 2132 2794 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_45420 2809 3204 gene locus_tag LOCUS_45430 2809 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 >Feature sequence168 140 67 gene locus_tag LOCUS_t00520 140 67 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 862 290 gene locus_tag LOCUS_45440 862 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 1114 1419 gene locus_tag LOCUS_45450 1114 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 1483 1755 gene locus_tag LOCUS_45460 gene rpmA 1483 1755 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR3 protein_id gnl|my_center|LOCUS_45460 2677 1862 gene locus_tag LOCUS_45470 2677 1862 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_45470 3555 2761 gene locus_tag LOCUS_45480 3555 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 >Feature sequence169 182 961 gene locus_tag LOCUS_45490 182 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 1763 990 gene locus_tag LOCUS_45500 1763 990 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_45500 3134 1956 gene locus_tag LOCUS_45510 3134 1956 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_45510 >Feature sequence170 683 249 gene locus_tag LOCUS_45520 683 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 1289 834 gene locus_tag LOCUS_45530 1289 834 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_45530 1973 1689 gene locus_tag LOCUS_45540 1973 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 2248 2958 gene locus_tag LOCUS_45550 2248 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 >Feature sequence171 159 231 gene locus_tag LOCUS_t00530 159 231 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 497 1354 gene locus_tag LOCUS_45560 497 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 1361 2680 gene locus_tag LOCUS_45570 1361 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 >Feature sequence172 >Feature sequence173 754 128 gene locus_tag LOCUS_45580 754 128 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_45580 959 2530 gene locus_tag LOCUS_45590 gene gltX 959 2530 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_45590 >Feature sequence174 989 237 gene locus_tag LOCUS_45600 989 237 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_45600 1055 1789 gene locus_tag LOCUS_45610 1055 1789 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_45610 1815 2294 gene locus_tag LOCUS_45620 1815 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 >Feature sequence175 789 259 gene locus_tag LOCUS_45630 gene dfrA 789 259 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_45630 1100 1603 gene locus_tag LOCUS_45640 1100 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 2630 1623 gene locus_tag LOCUS_45650 2630 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 >Feature sequence176 591 1415 gene locus_tag LOCUS_45660 591 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 1479 2468 gene locus_tag LOCUS_45670 1479 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 >Feature sequence177 1018 293 gene locus_tag LOCUS_45680 1018 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 1191 1835 gene locus_tag LOCUS_45690 1191 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 2418 1900 gene locus_tag LOCUS_45700 2418 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 >Feature sequence178 >Feature sequence179 230 1750 gene locus_tag LOCUS_45710 230 1750 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence180 2 121 gene locus_tag LOCUS_45720 2 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 317 1159 gene locus_tag LOCUS_45730 gene xerC 317 1159 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_45730 1137 1982 gene locus_tag LOCUS_45740 1137 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 >Feature sequence181 997 167 gene locus_tag LOCUS_45750 997 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 1982 990 gene locus_tag LOCUS_45760 gene ykoT 1982 990 CDS product putative glycosyltransferase YkoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34755 protein_id gnl|my_center|LOCUS_45760 >Feature sequence182 1199 597 gene locus_tag LOCUS_45770 1199 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 1894 1196 gene locus_tag LOCUS_45780 1894 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 >Feature sequence183 2 121 gene locus_tag LOCUS_45790 2 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 317 1159 gene locus_tag LOCUS_45800 gene xerC 317 1159 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQK2 protein_id gnl|my_center|LOCUS_45800 1137 1982 gene locus_tag LOCUS_45810 1137 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 >Feature sequence184 >Feature sequence185 210 503 gene locus_tag LOCUS_45820 210 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 537 1325 gene locus_tag LOCUS_45830 537 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 1339 1473 gene locus_tag LOCUS_45840 1339 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence186 1320 784 gene locus_tag LOCUS_45850 1320 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 >Feature sequence187 >Feature sequence188 <1 1423 gene locus_tag LOCUS_45860 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114725.1:gluconolactonase >Feature sequence189 911 264 gene locus_tag LOCUS_45870 911 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 1349 996 gene locus_tag LOCUS_45880 1349 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880