>Feature sequence01 1748 522 gene locus_tag LOCUS_00010 gene cca 1748 522 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3M9 protein_id gnl|my_center|LOCUS_00010 3794 1827 gene locus_tag LOCUS_00020 3794 1827 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_00020 4838 3873 gene locus_tag LOCUS_00030 4838 3873 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_00030 5810 4878 gene locus_tag LOCUS_00040 gene hemF 5810 4878 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ2 protein_id gnl|my_center|LOCUS_00040 6372 5800 gene locus_tag LOCUS_00050 gene tsaC 6372 5800 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S6 protein_id gnl|my_center|LOCUS_00050 9100 6515 gene locus_tag LOCUS_00060 gene topA 9100 6515 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_00060 9757 9284 gene locus_tag LOCUS_00070 gene smg 9757 9284 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_00070 10908 9793 gene locus_tag LOCUS_00080 gene smf 10908 9793 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_00080 12089 10905 gene locus_tag LOCUS_00090 12089 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_00090 12201 12704 gene locus_tag LOCUS_00100 gene def 12201 12704 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_00100 12704 13630 gene locus_tag LOCUS_00110 gene fmt 12704 13630 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8F1 protein_id gnl|my_center|LOCUS_00110 13620 14927 gene locus_tag LOCUS_00120 gene rsmB 13620 14927 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_00120 15004 15570 gene locus_tag LOCUS_00130 15004 15570 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_00130 16510 15725 gene locus_tag LOCUS_00140 gene hisF1 16510 15725 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_00140 17271 16516 gene locus_tag LOCUS_00150 gene hisA 17271 16516 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPK3 protein_id gnl|my_center|LOCUS_00150 17977 17330 gene locus_tag LOCUS_00160 gene hisH1 17977 17330 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_00160 18450 17977 gene locus_tag LOCUS_00170 gene hisB 18450 17977 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE1 protein_id gnl|my_center|LOCUS_00170 18370 18606 gene locus_tag LOCUS_00180 18370 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19091 18654 gene locus_tag LOCUS_00190 gene dtd 19091 18654 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6M6 protein_id gnl|my_center|LOCUS_00190 20038 19088 gene locus_tag LOCUS_00200 gene thrB 20038 19088 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4W557 protein_id gnl|my_center|LOCUS_00200 20331 20038 gene locus_tag LOCUS_00210 20331 20038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21863 20391 gene locus_tag LOCUS_00220 gene trkH 21863 20391 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_00220 23258 21879 gene locus_tag LOCUS_00230 gene trkA 23258 21879 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_00230 23421 23825 gene locus_tag LOCUS_00240 gene hisI 23421 23825 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_00240 23833 24189 gene locus_tag LOCUS_00250 gene hisE 23833 24189 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY8 protein_id gnl|my_center|LOCUS_00250 24202 24456 gene locus_tag LOCUS_00260 gene tatA 24202 24456 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 protein_id gnl|my_center|LOCUS_00260 24489 24845 gene locus_tag LOCUS_00270 gene tatB 24489 24845 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH0 protein_id gnl|my_center|LOCUS_00270 24842 25594 gene locus_tag LOCUS_00280 gene tatC 24842 25594 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TG9 protein_id gnl|my_center|LOCUS_00280 25665 26402 gene locus_tag LOCUS_00290 25665 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26646 27419 gene locus_tag LOCUS_00300 gene ureD2 26646 27419 CDS product urease accessory protein UreD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP5 protein_id gnl|my_center|LOCUS_00300 27461 27763 gene locus_tag LOCUS_00310 gene ureA 27461 27763 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 protein_id gnl|my_center|LOCUS_00310 27774 28097 gene locus_tag LOCUS_00320 gene ureB 27774 28097 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42886 protein_id gnl|my_center|LOCUS_00320 28094 29794 gene locus_tag LOCUS_00330 gene ureC 28094 29794 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX4 protein_id gnl|my_center|LOCUS_00330 29827 30375 gene locus_tag LOCUS_00340 gene ureE 29827 30375 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQM6 protein_id gnl|my_center|LOCUS_00340 30368 31063 gene locus_tag LOCUS_00350 gene ureF 30368 31063 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ63 protein_id gnl|my_center|LOCUS_00350 31084 31695 gene locus_tag LOCUS_00360 gene ureG 31084 31695 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY9 protein_id gnl|my_center|LOCUS_00360 31831 33453 gene locus_tag LOCUS_00370 31831 33453 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206466.1 protein_id gnl|my_center|LOCUS_00370 33473 34462 gene locus_tag LOCUS_00380 33473 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 35638 34526 gene locus_tag LOCUS_00390 35638 34526 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816376.1 protein_id gnl|my_center|LOCUS_00390 36166 35717 gene locus_tag LOCUS_00400 gene az1 36166 35717 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R2 protein_id gnl|my_center|LOCUS_00400 37359 36232 gene locus_tag LOCUS_00410 37359 36232 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066962.1 protein_id gnl|my_center|LOCUS_00410 37492 38055 gene locus_tag LOCUS_00420 37492 38055 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_00420 39075 38044 gene locus_tag LOCUS_00430 39075 38044 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_00430 39443 39928 gene locus_tag LOCUS_00440 gene pilE 39443 39928 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_00440 40356 39937 gene locus_tag LOCUS_00450 40356 39937 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUF6 protein_id gnl|my_center|LOCUS_00450 40406 40687 gene locus_tag LOCUS_00460 40406 40687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 40744 41409 gene locus_tag LOCUS_00470 40744 41409 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_00470 42050 41484 gene locus_tag LOCUS_00480 42050 41484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 42825 42145 gene locus_tag LOCUS_00490 gene nfi 42825 42145 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A0 protein_id gnl|my_center|LOCUS_00490 43294 42815 gene locus_tag LOCUS_00500 gene mntR 43294 42815 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7U4 protein_id gnl|my_center|LOCUS_00500 44120 43299 gene locus_tag LOCUS_00510 gene aroE 44120 43299 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX8 protein_id gnl|my_center|LOCUS_00510 45188 44181 gene locus_tag LOCUS_00520 gene waaF 45188 44181 CDS product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_00520 46234 45230 gene locus_tag LOCUS_00530 gene hemB 46234 45230 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K025 protein_id gnl|my_center|LOCUS_00530 46361 47320 gene locus_tag LOCUS_00540 46361 47320 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_00540 47434 48018 gene locus_tag LOCUS_00550 47434 48018 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_00550 48015 48752 gene locus_tag LOCUS_00560 48015 48752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 49597 48749 gene locus_tag LOCUS_00570 49597 48749 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_00570 50939 49962 gene locus_tag LOCUS_00580 gene mdh 50939 49962 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_00580 51141 52397 gene locus_tag LOCUS_00590 51141 52397 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_00590 52552 53337 gene locus_tag LOCUS_00600 52552 53337 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_00600 53369 54619 gene locus_tag LOCUS_00610 53369 54619 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_00610 54612 55955 gene locus_tag LOCUS_00620 54612 55955 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_00620 56757 55846 gene locus_tag LOCUS_00630 56757 55846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 57703 56750 gene locus_tag LOCUS_00640 57703 56750 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763674.1 protein_id gnl|my_center|LOCUS_00640 58938 57895 gene locus_tag LOCUS_00650 gene hemE 58938 57895 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V23 protein_id gnl|my_center|LOCUS_00650 59709 58978 gene locus_tag LOCUS_00660 gene pyrF 59709 58978 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_00660 60774 59740 gene locus_tag LOCUS_00670 60774 59740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 62851 61442 gene locus_tag LOCUS_00680 gene gltD 62851 61442 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_00680 67383 62923 gene locus_tag LOCUS_00690 gene gltB 67383 62923 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_00690 68679 67582 gene locus_tag LOCUS_00700 gene aroB 68679 67582 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_00700 69257 68685 gene locus_tag LOCUS_00710 69257 68685 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_00710 69787 69257 gene locus_tag LOCUS_00720 gene aroK 69787 69257 CDS product shikimate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63602 protein_id gnl|my_center|LOCUS_00720 71567 69897 gene locus_tag LOCUS_00730 71567 69897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 73818 71617 gene locus_tag LOCUS_00740 gene pilQ 73818 71617 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_00740 74319 73828 gene locus_tag LOCUS_00750 gene pilP 74319 73828 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_00750 75014 74352 gene locus_tag LOCUS_00760 75014 74352 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 protein_id gnl|my_center|LOCUS_00760 75595 75011 gene locus_tag LOCUS_00770 gene pilN 75595 75011 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070654.1 protein_id gnl|my_center|LOCUS_00770 76626 75592 gene locus_tag LOCUS_00780 gene pilM 76626 75592 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_00780 77289 79655 gene locus_tag LOCUS_00790 gene ponA 77289 79655 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_00790 79747 80379 gene locus_tag LOCUS_00800 79747 80379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 80450 80905 gene locus_tag LOCUS_00810 80450 80905 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199454.1 protein_id gnl|my_center|LOCUS_00810 81712 80909 gene locus_tag LOCUS_00820 gene cysQ 81712 80909 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_00820 83053 81770 gene locus_tag LOCUS_00830 83053 81770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 83405 83731 gene locus_tag LOCUS_00840 gene trxA 83405 83731 CDS product thioredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA29 protein_id gnl|my_center|LOCUS_00840 83851 85431 gene locus_tag LOCUS_00850 gene rho 83851 85431 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A25 protein_id gnl|my_center|LOCUS_00850 86100 85507 gene locus_tag LOCUS_00860 86100 85507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 86723 86124 gene locus_tag LOCUS_00870 86723 86124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707504.1 protein_id gnl|my_center|LOCUS_00870 88384 86720 gene locus_tag LOCUS_00880 gene pqiB 88384 86720 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816051.1 protein_id gnl|my_center|LOCUS_00880 89805 88381 gene locus_tag LOCUS_00890 89805 88381 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890363.1 protein_id gnl|my_center|LOCUS_00890 91114 89822 gene locus_tag LOCUS_00900 gene gltA 91114 89822 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAG7 protein_id gnl|my_center|LOCUS_00900 92418 91147 gene locus_tag LOCUS_00910 92418 91147 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378855.1 protein_id gnl|my_center|LOCUS_00910 92735 92547 gene locus_tag LOCUS_00920 92735 92547 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406898.1 protein_id gnl|my_center|LOCUS_00920 93913 92735 gene locus_tag LOCUS_00930 93913 92735 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811160.1 protein_id gnl|my_center|LOCUS_00930 94499 93900 gene locus_tag LOCUS_00940 94499 93900 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHF4 protein_id gnl|my_center|LOCUS_00940 95224 94496 gene locus_tag LOCUS_00950 gene rph 95224 94496 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_00950 95366 96229 gene locus_tag LOCUS_00960 95366 96229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_00960 96226 96837 gene locus_tag LOCUS_00970 gene gmk 96226 96837 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329K8 protein_id gnl|my_center|LOCUS_00970 96903 97214 gene locus_tag LOCUS_00980 96903 97214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 97371 99530 gene locus_tag LOCUS_00990 gene spoT 97371 99530 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_00990 99608 99997 gene locus_tag LOCUS_01000 gene yjgF 99608 99997 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_01000 100059 102104 gene locus_tag LOCUS_01010 gene recG 100059 102104 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_01010 102162 104123 gene locus_tag LOCUS_01020 102162 104123 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_01020 104815 104153 gene locus_tag LOCUS_01030 104815 104153 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_01030 104925 105968 gene locus_tag LOCUS_01040 gene bioB 104925 105968 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 protein_id gnl|my_center|LOCUS_01040 105974 107197 gene locus_tag LOCUS_01050 gene bioF 105974 107197 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I617 protein_id gnl|my_center|LOCUS_01050 107220 108032 gene locus_tag LOCUS_01060 gene bioH 107220 108032 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF3 protein_id gnl|my_center|LOCUS_01060 108029 108691 gene locus_tag LOCUS_01070 gene bioD 108029 108691 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHA5 protein_id gnl|my_center|LOCUS_01070 108688 109863 gene locus_tag LOCUS_01080 108688 109863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 109860 111434 gene locus_tag LOCUS_01090 gene coxA 109860 111434 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_01090 111442 112206 gene locus_tag LOCUS_01100 111442 112206 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_01100 112203 112772 gene locus_tag LOCUS_01110 112203 112772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 112787 113788 gene locus_tag LOCUS_01120 112787 113788 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_01120 113781 114701 gene locus_tag LOCUS_01130 gene cyoE 113781 114701 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P7 protein_id gnl|my_center|LOCUS_01130 115324 114989 gene locus_tag LOCUS_01140 115324 114989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770497.1 protein_id gnl|my_center|LOCUS_01140 116012 115404 gene locus_tag LOCUS_01150 116012 115404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_01150 116215 118065 gene locus_tag LOCUS_01160 gene cysJ 116215 118065 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_01160 118333 120096 gene locus_tag LOCUS_01170 gene cysI 118333 120096 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32213 protein_id gnl|my_center|LOCUS_01170 120065 120709 gene locus_tag LOCUS_01180 120065 120709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 121416 120682 gene locus_tag LOCUS_01190 121416 120682 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727865.1 protein_id gnl|my_center|LOCUS_01190 121693 125106 gene locus_tag LOCUS_01200 121693 125106 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706981.1 protein_id gnl|my_center|LOCUS_01200 126117 125245 gene locus_tag LOCUS_01210 gene rpoH 126117 125245 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF81 protein_id gnl|my_center|LOCUS_01210 127264 126287 gene locus_tag LOCUS_01220 127264 126287 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 protein_id gnl|my_center|LOCUS_01220 127929 127267 gene locus_tag LOCUS_01230 gene ftsE 127929 127267 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_01230 128157 128357 gene locus_tag LOCUS_01240 128157 128357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 128462 128965 gene locus_tag LOCUS_01250 128462 128965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 128965 129453 gene locus_tag LOCUS_01260 128965 129453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 129528 130400 gene locus_tag LOCUS_01270 129528 130400 CDS product membrane fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521659.1 protein_id gnl|my_center|LOCUS_01270 130439 131356 gene locus_tag LOCUS_01280 130439 131356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01280 131259 131678 gene locus_tag LOCUS_01290 131259 131678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01290 131682 132923 gene locus_tag LOCUS_01300 131682 132923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244656.1 protein_id gnl|my_center|LOCUS_01300 132923 134131 gene locus_tag LOCUS_01310 gene tadA 132923 134131 CDS product ATPase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103953.1 protein_id gnl|my_center|LOCUS_01310 134128 135048 gene locus_tag LOCUS_01320 134128 135048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 135045 135953 gene locus_tag LOCUS_01330 135045 135953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 135980 136924 gene locus_tag LOCUS_01340 135980 136924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136921 137244 gene locus_tag LOCUS_01350 136921 137244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 137343 139127 gene locus_tag LOCUS_01360 137343 139127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105196.1 protein_id gnl|my_center|LOCUS_01360 140485 139151 gene locus_tag LOCUS_01370 140485 139151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 141565 140609 gene locus_tag LOCUS_01380 gene ftsY 141565 140609 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIF2 protein_id gnl|my_center|LOCUS_01380 143674 141623 gene locus_tag LOCUS_01390 143674 141623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 145035 143719 gene locus_tag LOCUS_01400 gene hemL 145035 143719 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC8 protein_id gnl|my_center|LOCUS_01400 145776 145153 gene locus_tag LOCUS_01410 gene thiE 145776 145153 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R7 protein_id gnl|my_center|LOCUS_01410 146546 145773 gene locus_tag LOCUS_01420 gene thiD 146546 145773 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_01420 147659 146880 gene locus_tag LOCUS_01430 gene cpdA 147659 146880 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQJ3 protein_id gnl|my_center|LOCUS_01430 147744 148340 gene locus_tag LOCUS_01440 147744 148340 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_01440 149391 148438 gene locus_tag LOCUS_01450 gene hprA 149391 148438 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_01450 149573 150061 gene locus_tag LOCUS_01460 149573 150061 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390600.1 protein_id gnl|my_center|LOCUS_01460 151110 150226 gene locus_tag LOCUS_01470 gene metF 151110 150226 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT4 protein_id gnl|my_center|LOCUS_01470 152639 151218 gene locus_tag LOCUS_01480 gene ahcY 152639 151218 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT2 protein_id gnl|my_center|LOCUS_01480 153906 152731 gene locus_tag LOCUS_01490 gene metK 153906 152731 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A817 protein_id gnl|my_center|LOCUS_01490 154640 153981 gene locus_tag LOCUS_01500 154640 153981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 154907 157147 gene locus_tag LOCUS_01510 gene fadJ 154907 157147 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK30 protein_id gnl|my_center|LOCUS_01510 157356 158474 gene locus_tag LOCUS_01520 gene mcr 157356 158474 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228953.1 protein_id gnl|my_center|LOCUS_01520 158536 159099 gene locus_tag LOCUS_01530 158536 159099 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_01530 160057 159251 gene locus_tag LOCUS_01540 160057 159251 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_01540 160154 160825 gene locus_tag LOCUS_01550 160154 160825 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941085.1 protein_id gnl|my_center|LOCUS_01550 161761 160859 gene locus_tag LOCUS_01560 161761 160859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_01560 162779 161835 gene locus_tag LOCUS_01570 162779 161835 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531745.1 protein_id gnl|my_center|LOCUS_01570 163734 162934 gene locus_tag LOCUS_01580 163734 162934 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547412.1 protein_id gnl|my_center|LOCUS_01580 164437 163793 gene locus_tag LOCUS_01590 gene ribB 164437 163793 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X59 protein_id gnl|my_center|LOCUS_01590 166418 165291 gene locus_tag LOCUS_01600 166418 165291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_01600 166858 168855 gene locus_tag LOCUS_01610 gene tkt2 166858 168855 CDS product transketolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZP0 protein_id gnl|my_center|LOCUS_01610 168901 169911 gene locus_tag LOCUS_01620 gene gap 168901 169911 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK56 protein_id gnl|my_center|LOCUS_01620 170043 171224 gene locus_tag LOCUS_01630 gene pgk 170043 171224 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_01630 171226 172071 gene locus_tag LOCUS_01640 171226 172071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_01640 172089 173291 gene locus_tag LOCUS_01650 172089 173291 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709647.1 protein_id gnl|my_center|LOCUS_01650 173335 174063 gene locus_tag LOCUS_01660 173335 174063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 174703 174056 gene locus_tag LOCUS_01670 gene nalD 174703 174056 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_01670 174817 176091 gene locus_tag LOCUS_01680 174817 176091 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197561.1 protein_id gnl|my_center|LOCUS_01680 176103 179318 gene locus_tag LOCUS_01690 176103 179318 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_01690 179311 180933 gene locus_tag LOCUS_01700 179311 180933 CDS product RND transporter NodT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 protein_id gnl|my_center|LOCUS_01700 181096 182244 gene locus_tag LOCUS_01710 181096 182244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390198.1 protein_id gnl|my_center|LOCUS_01710 182256 183050 gene locus_tag LOCUS_01720 182256 183050 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_01720 183066 184049 gene locus_tag LOCUS_01730 183066 184049 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_01730 184049 184603 gene locus_tag LOCUS_01740 184049 184603 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928612.1 protein_id gnl|my_center|LOCUS_01740 187917 185089 gene locus_tag LOCUS_01750 187917 185089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 188767 187883 gene locus_tag LOCUS_01760 188767 187883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 191671 189194 gene locus_tag LOCUS_01770 gene fadE 191671 189194 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_01770 192648 191779 gene locus_tag LOCUS_01780 192648 191779 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_01780 192829 193578 gene locus_tag LOCUS_01790 gene minC 192829 193578 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW11 protein_id gnl|my_center|LOCUS_01790 193582 194388 gene locus_tag LOCUS_01800 gene minD 193582 194388 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUR8 protein_id gnl|my_center|LOCUS_01800 194392 194652 gene locus_tag LOCUS_01810 gene minE 194392 194652 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_01810 194786 196417 gene locus_tag LOCUS_01820 194786 196417 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_01820 196492 197454 gene locus_tag LOCUS_01830 196492 197454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 protein_id gnl|my_center|LOCUS_01830 199117 197459 gene locus_tag LOCUS_01840 gene fadD 199117 197459 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 protein_id gnl|my_center|LOCUS_01840 200604 199219 gene locus_tag LOCUS_01850 200604 199219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 200817 202424 gene locus_tag LOCUS_01860 gene phaC2 200817 202424 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115652.1 protein_id gnl|my_center|LOCUS_01860 202408 203259 gene locus_tag LOCUS_01870 gene phaD 202408 203259 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_01870 203256 204221 gene locus_tag LOCUS_01880 gene phaD 203256 204221 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_01880 205023 204214 gene locus_tag LOCUS_01890 205023 204214 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_01890 205698 205081 gene locus_tag LOCUS_01900 gene rnt 205698 205081 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_01900 205826 207037 gene locus_tag LOCUS_01910 gene argG 205826 207037 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_01910 207147 207968 gene locus_tag LOCUS_01920 gene fkpA 207147 207968 CDS product putative FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYI8 protein_id gnl|my_center|LOCUS_01920 209688 208039 gene locus_tag LOCUS_01930 gene pckA1 209688 208039 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I3 protein_id gnl|my_center|LOCUS_01930 210957 209848 gene locus_tag LOCUS_01940 210957 209848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112968.1 protein_id gnl|my_center|LOCUS_01940 212092 210983 gene locus_tag LOCUS_01950 212092 210983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 212831 212169 gene locus_tag LOCUS_01960 212831 212169 CDS product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404171.1 protein_id gnl|my_center|LOCUS_01960 213478 212828 gene locus_tag LOCUS_01970 gene nth 213478 212828 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_01970 214380 213718 gene locus_tag LOCUS_01980 214380 213718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01980 216618 214558 gene locus_tag LOCUS_01990 gene metG 216618 214558 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_01990 216758 217849 gene locus_tag LOCUS_02000 216758 217849 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY87 protein_id gnl|my_center|LOCUS_02000 220458 217846 gene locus_tag LOCUS_02010 220458 217846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 221702 220707 gene locus_tag LOCUS_02020 gene qor 221702 220707 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 protein_id gnl|my_center|LOCUS_02020 221988 222554 gene locus_tag LOCUS_02030 gene dcd 221988 222554 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDP4 protein_id gnl|my_center|LOCUS_02030 223423 222659 gene locus_tag LOCUS_02040 223423 222659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 224091 223423 gene locus_tag LOCUS_02050 gene purN 224091 223423 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P723 protein_id gnl|my_center|LOCUS_02050 225155 224088 gene locus_tag LOCUS_02060 gene purM 225155 224088 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIF8 protein_id gnl|my_center|LOCUS_02060 225278 226324 gene locus_tag LOCUS_02070 gene perM 225278 226324 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_02070 226427 227119 gene locus_tag LOCUS_02080 226427 227119 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 protein_id gnl|my_center|LOCUS_02080 227672 227121 gene locus_tag LOCUS_02090 227672 227121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 229404 227698 gene locus_tag LOCUS_02100 gene proS 229404 227698 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_02100 229881 229438 gene locus_tag LOCUS_02110 229881 229438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_02110 230873 229878 gene locus_tag LOCUS_02120 230873 229878 CDS product Co/Zn/Cd cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601334.1 protein_id gnl|my_center|LOCUS_02120 231381 230887 gene locus_tag LOCUS_02130 231381 230887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974726.1 protein_id gnl|my_center|LOCUS_02130 231482 232495 gene locus_tag LOCUS_02140 231482 232495 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 protein_id gnl|my_center|LOCUS_02140 233614 232751 gene locus_tag LOCUS_02150 gene hemK 233614 232751 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT0 protein_id gnl|my_center|LOCUS_02150 234704 233619 gene locus_tag LOCUS_02160 gene prfA 234704 233619 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_02160 236020 234701 gene locus_tag LOCUS_02170 gene hemA 236020 234701 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_02170 236112 237887 gene locus_tag LOCUS_02180 236112 237887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_02180 237884 238513 gene locus_tag LOCUS_02190 gene lolB 237884 238513 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 protein_id gnl|my_center|LOCUS_02190 238624 238698 gene locus_tag LOCUS_t00010 238624 238698 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 238768 239730 gene locus_tag LOCUS_02200 gene prs 238768 239730 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUH1 protein_id gnl|my_center|LOCUS_02200 239897 240607 gene locus_tag LOCUS_02210 gene rplY 239897 240607 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_02210 240643 241224 gene locus_tag LOCUS_02220 gene pth 240643 241224 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K029 protein_id gnl|my_center|LOCUS_02220 241278 242369 gene locus_tag LOCUS_02230 gene ychF 241278 242369 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD71 protein_id gnl|my_center|LOCUS_02230 242440 242515 gene locus_tag LOCUS_t00020 242440 242515 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 243020 244453 gene locus_tag LOCUS_02240 gene cabC1 243020 244453 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_02240 244450 244944 gene locus_tag LOCUS_02250 244450 244944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892353.1 protein_id gnl|my_center|LOCUS_02250 245577 245110 gene locus_tag LOCUS_02260 245577 245110 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470538.1 protein_id gnl|my_center|LOCUS_02260 246637 245648 gene locus_tag LOCUS_02270 gene lcdH 246637 245648 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQB9 protein_id gnl|my_center|LOCUS_02270 247560 246634 gene locus_tag LOCUS_02280 247560 246634 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830494.1 protein_id gnl|my_center|LOCUS_02280 247767 248732 gene locus_tag LOCUS_02290 247767 248732 CDS product ammonia monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529931.1 protein_id gnl|my_center|LOCUS_02290 248813 250330 gene locus_tag LOCUS_02300 248813 250330 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532679.1 protein_id gnl|my_center|LOCUS_02300 250422 251381 gene locus_tag LOCUS_02310 gene dgoK 250422 251381 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194214.1 protein_id gnl|my_center|LOCUS_02310 251378 252010 gene locus_tag LOCUS_02320 251378 252010 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 protein_id gnl|my_center|LOCUS_02320 252267 253415 gene locus_tag LOCUS_02330 252267 253415 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 protein_id gnl|my_center|LOCUS_02330 254666 253716 gene locus_tag LOCUS_02340 254666 253716 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_02340 254826 255032 gene locus_tag LOCUS_02350 254826 255032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_02350 255025 255333 gene locus_tag LOCUS_02360 255025 255333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173741.1 protein_id gnl|my_center|LOCUS_02360 255344 257812 gene locus_tag LOCUS_02370 255344 257812 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 protein_id gnl|my_center|LOCUS_02370 258917 257787 gene locus_tag LOCUS_02380 258917 257787 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTW4 protein_id gnl|my_center|LOCUS_02380 259885 258953 gene locus_tag LOCUS_02390 gene gal 259885 258953 CDS product D-galactose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969077.1 protein_id gnl|my_center|LOCUS_02390 260784 259894 gene locus_tag LOCUS_02400 260784 259894 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 protein_id gnl|my_center|LOCUS_02400 261260 260781 gene locus_tag LOCUS_02410 261260 260781 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSK0 protein_id gnl|my_center|LOCUS_02410 262487 261315 gene locus_tag LOCUS_02420 262487 261315 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 protein_id gnl|my_center|LOCUS_02420 262698 264500 gene locus_tag LOCUS_02430 262698 264500 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_02430 264744 265046 gene locus_tag LOCUS_02440 264744 265046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 266449 265211 gene locus_tag LOCUS_02450 266449 265211 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_02450 266579 267445 gene locus_tag LOCUS_02460 266579 267445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 269080 267572 gene locus_tag LOCUS_02470 gene glpK 269080 267572 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDI0 protein_id gnl|my_center|LOCUS_02470 269846 269118 gene locus_tag LOCUS_02480 269846 269118 CDS product glycerol transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_02480 270859 270071 gene locus_tag LOCUS_02490 gene glpR 270859 270071 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035615.1 protein_id gnl|my_center|LOCUS_02490 271036 271512 gene locus_tag LOCUS_02500 gene tadA 271036 271512 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W8 protein_id gnl|my_center|LOCUS_02500 271606 272757 gene locus_tag LOCUS_02510 271606 272757 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205320.1 protein_id gnl|my_center|LOCUS_02510 272836 274098 gene locus_tag LOCUS_02520 gene gabT 272836 274098 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_02520 274473 276827 gene locus_tag LOCUS_02530 274473 276827 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 protein_id gnl|my_center|LOCUS_02530 277123 278580 gene locus_tag LOCUS_02540 gene betB 277123 278580 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ1 protein_id gnl|my_center|LOCUS_02540 278602 280263 gene locus_tag LOCUS_02550 gene betA 278602 280263 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AE7 protein_id gnl|my_center|LOCUS_02550 280410 282104 gene locus_tag LOCUS_02560 gene maeA 280410 282104 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYD5 protein_id gnl|my_center|LOCUS_02560 282556 282101 gene locus_tag LOCUS_02570 282556 282101 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_02570 283251 282595 gene locus_tag LOCUS_02580 gene tpm 283251 282595 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT3 protein_id gnl|my_center|LOCUS_02580 283952 283251 gene locus_tag LOCUS_02590 283952 283251 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887207.1 protein_id gnl|my_center|LOCUS_02590 285088 284051 gene locus_tag LOCUS_02600 gene dinB 285088 284051 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW8 protein_id gnl|my_center|LOCUS_02600 285239 285970 gene locus_tag LOCUS_02610 285239 285970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence02 <1 1730 gene locus_tag LOCUS_02620 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P2C7:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 1852 2376 gene locus_tag LOCUS_02630 gene ectA 1852 2376 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_02630 2413 3687 gene locus_tag LOCUS_02640 2413 3687 CDS product putative diaminobutyrate--2-oxoglutarate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703001.1 protein_id gnl|my_center|LOCUS_02640 3977 4366 gene locus_tag LOCUS_02650 gene ectC 3977 4366 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHF0 protein_id gnl|my_center|LOCUS_02650 4939 4628 gene locus_tag LOCUS_02660 4939 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 5038 5766 gene locus_tag LOCUS_02670 5038 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187867.1 protein_id gnl|my_center|LOCUS_02670 7377 6013 gene locus_tag LOCUS_02680 gene gsh1 7377 6013 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_02680 7515 8390 gene locus_tag LOCUS_02690 gene ubiA 7515 8390 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U39 protein_id gnl|my_center|LOCUS_02690 8420 9472 gene locus_tag LOCUS_02700 8420 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 9508 10869 gene locus_tag LOCUS_02710 gene bioA 9508 10869 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I693 protein_id gnl|my_center|LOCUS_02710 10999 11481 gene locus_tag LOCUS_02720 gene greA 10999 11481 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS95 protein_id gnl|my_center|LOCUS_02720 11772 11488 gene locus_tag LOCUS_02730 11772 11488 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918374.1 protein_id gnl|my_center|LOCUS_02730 11815 12435 gene locus_tag LOCUS_02740 gene rlmE 11815 12435 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_02740 12553 14517 gene locus_tag LOCUS_02750 gene hflB 12553 14517 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF0 protein_id gnl|my_center|LOCUS_02750 14629 15501 gene locus_tag LOCUS_02760 gene folP 14629 15501 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_02760 15532 16914 gene locus_tag LOCUS_02770 gene glmM 15532 16914 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62L77 protein_id gnl|my_center|LOCUS_02770 16935 17702 gene locus_tag LOCUS_02780 gene tpiA 16935 17702 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN5 protein_id gnl|my_center|LOCUS_02780 17712 18086 gene locus_tag LOCUS_02790 gene secG 17712 18086 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_02790 18102 18186 gene locus_tag LOCUS_t00030 18102 18186 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18596 18672 gene locus_tag LOCUS_t00040 18596 18672 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18748 19200 gene locus_tag LOCUS_02800 gene rimP 18748 19200 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_02800 19265 20782 gene locus_tag LOCUS_02810 gene nusA 19265 20782 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U6 protein_id gnl|my_center|LOCUS_02810 20860 23523 gene locus_tag LOCUS_02820 gene infB 20860 23523 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU80 protein_id gnl|my_center|LOCUS_02820 23526 23954 gene locus_tag LOCUS_02830 gene rbfA 23526 23954 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL4 protein_id gnl|my_center|LOCUS_02830 23980 24882 gene locus_tag LOCUS_02840 gene truB 23980 24882 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72154 protein_id gnl|my_center|LOCUS_02840 25087 25356 gene locus_tag LOCUS_02850 gene rpsO 25087 25356 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN0 protein_id gnl|my_center|LOCUS_02850 25455 27593 gene locus_tag LOCUS_02860 gene pnp 25455 27593 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR52 protein_id gnl|my_center|LOCUS_02860 28585 28142 gene locus_tag LOCUS_02870 gene dksA 28585 28142 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_02870 29454 28675 gene locus_tag LOCUS_02880 gene cysZ 29454 28675 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_02880 29514 30212 gene locus_tag LOCUS_02890 29514 30212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 30656 30267 gene locus_tag LOCUS_02900 gene queF 30656 30267 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVG9 protein_id gnl|my_center|LOCUS_02900 30819 34337 gene locus_tag LOCUS_02910 gene smc 30819 34337 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB8 protein_id gnl|my_center|LOCUS_02910 34390 35376 gene locus_tag LOCUS_02920 34390 35376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 35378 37477 gene locus_tag LOCUS_02930 gene ligA 35378 37477 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_02930 37945 38325 gene locus_tag LOCUS_02940 37945 38325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 38603 38337 gene locus_tag LOCUS_02950 38603 38337 CDS product cell division protein BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_02950 38934 38635 gene locus_tag LOCUS_02960 38934 38635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096279.1 protein_id gnl|my_center|LOCUS_02960 39025 39648 gene locus_tag LOCUS_02970 39025 39648 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396553.1 protein_id gnl|my_center|LOCUS_02970 39735 40748 gene locus_tag LOCUS_02980 gene trpS-2 39735 40748 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN23 protein_id gnl|my_center|LOCUS_02980 40756 41565 gene locus_tag LOCUS_02990 gene scpA 40756 41565 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CP8 protein_id gnl|my_center|LOCUS_02990 41562 42164 gene locus_tag LOCUS_03000 41562 42164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 42530 43309 gene locus_tag LOCUS_03010 42530 43309 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_03010 43500 44243 gene locus_tag LOCUS_03020 43500 44243 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC0 protein_id gnl|my_center|LOCUS_03020 44248 44958 gene locus_tag LOCUS_03030 44248 44958 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI70 protein_id gnl|my_center|LOCUS_03030 45669 44989 gene locus_tag LOCUS_03040 45669 44989 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_03040 46372 45671 gene locus_tag LOCUS_03050 gene ubiG 46372 45671 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_03050 48086 46764 gene locus_tag LOCUS_03060 48086 46764 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_03060 48345 50996 gene locus_tag LOCUS_03070 gene gyrA 48345 50996 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLA2 protein_id gnl|my_center|LOCUS_03070 51041 52123 gene locus_tag LOCUS_03080 gene serC 51041 52123 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ94 protein_id gnl|my_center|LOCUS_03080 52186 53379 gene locus_tag LOCUS_03090 52186 53379 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_03090 53473 54579 gene locus_tag LOCUS_03100 53473 54579 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_03100 54604 55722 gene locus_tag LOCUS_03110 gene hisC2 54604 55722 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_03110 55723 56625 gene locus_tag LOCUS_03120 55723 56625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 56622 57950 gene locus_tag LOCUS_03130 56622 57950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03130 57947 58642 gene locus_tag LOCUS_03140 gene cmk 57947 58642 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_03140 58757 60436 gene locus_tag LOCUS_03150 gene rpsA 58757 60436 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 protein_id gnl|my_center|LOCUS_03150 60650 60940 gene locus_tag LOCUS_03160 gene ihfB 60650 60940 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_03160 61053 61343 gene locus_tag LOCUS_03170 61053 61343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 61336 62526 gene locus_tag LOCUS_03180 gene lapB 61336 62526 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_03180 64348 62849 gene locus_tag LOCUS_03190 64348 62849 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ40 protein_id gnl|my_center|LOCUS_03190 64504 65598 gene locus_tag LOCUS_03200 64504 65598 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 protein_id gnl|my_center|LOCUS_03200 66858 65641 gene locus_tag LOCUS_03210 gene glcF 66858 65641 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R29 protein_id gnl|my_center|LOCUS_03210 67944 66862 gene locus_tag LOCUS_03220 gene glcE 67944 66862 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_03220 69449 67941 gene locus_tag LOCUS_03230 69449 67941 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_03230 70960 69548 gene locus_tag LOCUS_03240 70960 69548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_03240 71468 71001 gene locus_tag LOCUS_03250 71468 71001 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_03250 72019 71480 gene locus_tag LOCUS_03260 72019 71480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 72263 73129 gene locus_tag LOCUS_03270 gene dapA 72263 73129 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW75 protein_id gnl|my_center|LOCUS_03270 73248 73547 gene locus_tag LOCUS_03280 73248 73547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 73558 74268 gene locus_tag LOCUS_03290 73558 74268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 74271 75056 gene locus_tag LOCUS_03300 74271 75056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 75115 77208 gene locus_tag LOCUS_03310 75115 77208 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 protein_id gnl|my_center|LOCUS_03310 77205 77543 gene locus_tag LOCUS_03320 77205 77543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 77846 77936 gene locus_tag LOCUS_t00050 77846 77936 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78294 78058 gene locus_tag LOCUS_03330 78294 78058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 78181 80244 gene locus_tag LOCUS_03340 gene dnaX 78181 80244 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_03340 80241 80564 gene locus_tag LOCUS_03350 80241 80564 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_03350 80613 81209 gene locus_tag LOCUS_03360 gene recR 80613 81209 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW4 protein_id gnl|my_center|LOCUS_03360 81665 81333 gene locus_tag LOCUS_03370 81665 81333 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_03370 81789 82334 gene locus_tag LOCUS_03380 gene orn 81789 82334 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQM7 protein_id gnl|my_center|LOCUS_03380 83909 82461 gene locus_tag LOCUS_03390 gene phr 83909 82461 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_03390 85474 83906 gene locus_tag LOCUS_03400 85474 83906 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121705.1 protein_id gnl|my_center|LOCUS_03400 85737 86474 gene locus_tag LOCUS_03410 85737 86474 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268585.1 protein_id gnl|my_center|LOCUS_03410 86525 87169 gene locus_tag LOCUS_03420 gene cysC 86525 87169 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_03420 87507 87986 gene locus_tag LOCUS_03430 87507 87986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 88104 88568 gene locus_tag LOCUS_03440 88104 88568 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097923.1 protein_id gnl|my_center|LOCUS_03440 88680 90011 gene locus_tag LOCUS_03450 88680 90011 CDS product capsular polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527652.1 protein_id gnl|my_center|LOCUS_03450 90033 92309 gene locus_tag LOCUS_03460 90033 92309 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 protein_id gnl|my_center|LOCUS_03460 92954 92589 gene locus_tag LOCUS_03470 92954 92589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 93091 93960 gene locus_tag LOCUS_03480 93091 93960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 94096 94464 gene locus_tag LOCUS_03490 94096 94464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 95484 95720 gene locus_tag LOCUS_03500 95484 95720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 95708 96676 gene locus_tag LOCUS_03510 gene murB1 95708 96676 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTF4 protein_id gnl|my_center|LOCUS_03510 97158 97577 gene locus_tag LOCUS_03520 97158 97577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 99546 99986 gene locus_tag LOCUS_03530 99546 99986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 101481 102473 gene locus_tag LOCUS_03540 101481 102473 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679067.1 protein_id gnl|my_center|LOCUS_03540 102888 102664 gene locus_tag LOCUS_03550 102888 102664 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189132.1 protein_id gnl|my_center|LOCUS_03550 103202 102933 gene locus_tag LOCUS_03560 103202 102933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 104401 103325 gene locus_tag LOCUS_03570 gene rfbB-1 104401 103325 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E5 protein_id gnl|my_center|LOCUS_03570 104689 105975 gene locus_tag LOCUS_03580 gene wbpO 104689 105975 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039034.1 protein_id gnl|my_center|LOCUS_03580 107671 108063 gene locus_tag LOCUS_03590 107671 108063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 108077 109486 gene locus_tag LOCUS_03600 108077 109486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 109921 110928 gene locus_tag LOCUS_03610 gene uge 109921 110928 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_03610 111321 112382 gene locus_tag LOCUS_03620 gene rfe 111321 112382 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8H1 protein_id gnl|my_center|LOCUS_03620 113688 112675 gene locus_tag LOCUS_03630 gene galD 113688 112675 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168055.1 protein_id gnl|my_center|LOCUS_03630 113943 114146 gene locus_tag LOCUS_03640 113943 114146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 114612 114160 gene locus_tag LOCUS_03650 gene pilE 114612 114160 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_03650 114975 114757 gene locus_tag LOCUS_03660 gene infA 114975 114757 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CD1 protein_id gnl|my_center|LOCUS_03660 115861 115112 gene locus_tag LOCUS_03670 gene aat 115861 115112 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 protein_id gnl|my_center|LOCUS_03670 117000 115858 gene locus_tag LOCUS_03680 117000 115858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_03680 117371 117036 gene locus_tag LOCUS_03690 117371 117036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 117639 120164 gene locus_tag LOCUS_03700 gene ftsK 117639 120164 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U1 protein_id gnl|my_center|LOCUS_03700 120246 120908 gene locus_tag LOCUS_03710 gene lolA 120246 120908 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW06 protein_id gnl|my_center|LOCUS_03710 120905 121309 gene locus_tag LOCUS_03720 120905 121309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 121365 122654 gene locus_tag LOCUS_03730 gene rarA 121365 122654 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39918 protein_id gnl|my_center|LOCUS_03730 123328 122651 gene locus_tag LOCUS_03740 123328 122651 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 protein_id gnl|my_center|LOCUS_03740 124894 123449 gene locus_tag LOCUS_03750 124894 123449 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206542.1 protein_id gnl|my_center|LOCUS_03750 125214 125825 gene locus_tag LOCUS_03760 125214 125825 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_03760 129409 125861 gene locus_tag LOCUS_03770 129409 125861 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_03770 129516 130796 gene locus_tag LOCUS_03780 gene serS 129516 130796 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL5 protein_id gnl|my_center|LOCUS_03780 131798 130818 gene locus_tag LOCUS_03790 131798 130818 CDS product LysR family transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 protein_id gnl|my_center|LOCUS_03790 131918 132715 gene locus_tag LOCUS_03800 131918 132715 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_03800 132731 134152 gene locus_tag LOCUS_03810 gene cysG 132731 134152 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_03810 134222 134434 gene locus_tag LOCUS_03820 134222 134434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 135034 134363 gene locus_tag LOCUS_03830 135034 134363 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_03830 135555 135256 gene locus_tag LOCUS_03840 gene xseB 135555 135256 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67459 protein_id gnl|my_center|LOCUS_03840 136286 138202 gene locus_tag LOCUS_03850 gene parE 136286 138202 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ01 protein_id gnl|my_center|LOCUS_03850 138256 140478 gene locus_tag LOCUS_03860 gene parC 138256 140478 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_03860 140584 142776 gene locus_tag LOCUS_03870 gene comA 140584 142776 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_03870 142898 144670 gene locus_tag LOCUS_03880 gene msbA 142898 144670 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKX4 protein_id gnl|my_center|LOCUS_03880 144758 145702 gene locus_tag LOCUS_03890 gene lpxK 144758 145702 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z801 protein_id gnl|my_center|LOCUS_03890 145702 146442 gene locus_tag LOCUS_03900 gene kdsB 145702 146442 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGP8 protein_id gnl|my_center|LOCUS_03900 146439 146951 gene locus_tag LOCUS_03910 gene ptpA 146439 146951 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_03910 150338 147021 gene locus_tag LOCUS_03920 gene rne 150338 147021 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY6 protein_id gnl|my_center|LOCUS_03920 150646 151602 gene locus_tag LOCUS_03930 gene rluC 150646 151602 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN53 protein_id gnl|my_center|LOCUS_03930 151599 152258 gene locus_tag LOCUS_03940 151599 152258 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_03940 152868 152266 gene locus_tag LOCUS_03950 gene maf-2 152868 152266 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG5 protein_id gnl|my_center|LOCUS_03950 152981 153535 gene locus_tag LOCUS_03960 152981 153535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_03960 153557 153742 gene locus_tag LOCUS_03970 gene rpmF 153557 153742 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_03970 154001 154342 gene locus_tag LOCUS_03980 gene clpS 154001 154342 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y5 protein_id gnl|my_center|LOCUS_03980 154402 156423 gene locus_tag LOCUS_03990 154402 156423 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_03990 156442 156663 gene locus_tag LOCUS_04000 156442 156663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04000 158651 156906 gene locus_tag LOCUS_04010 gene pilB 158651 156906 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_04010 158881 158805 gene locus_tag LOCUS_t00060 158881 158805 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 159858 158890 gene locus_tag LOCUS_04020 gene ispB 159858 158890 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_04020 160021 160338 gene locus_tag LOCUS_04030 gene rplU 160021 160338 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUT0 protein_id gnl|my_center|LOCUS_04030 160372 160632 gene locus_tag LOCUS_04040 gene rpmA 160372 160632 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU3 protein_id gnl|my_center|LOCUS_04040 160730 161797 gene locus_tag LOCUS_04050 gene obg 160730 161797 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS9 protein_id gnl|my_center|LOCUS_04050 161787 162911 gene locus_tag LOCUS_04060 gene proB 161787 162911 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_04060 163573 163301 gene locus_tag LOCUS_04070 gene rpsT 163573 163301 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_04070 163771 165312 gene locus_tag LOCUS_04080 gene mviN 163771 165312 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K190 protein_id gnl|my_center|LOCUS_04080 165366 166304 gene locus_tag LOCUS_04090 gene ribF 165366 166304 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG7 protein_id gnl|my_center|LOCUS_04090 166301 166810 gene locus_tag LOCUS_04100 gene lspA 166301 166810 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJE2 protein_id gnl|my_center|LOCUS_04100 167242 166811 gene locus_tag LOCUS_04110 167242 166811 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_04110 171138 167239 gene locus_tag LOCUS_04120 171138 167239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 171683 171135 gene locus_tag LOCUS_04130 171683 171135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 172444 171680 gene locus_tag LOCUS_04140 172444 171680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 172977 172441 gene locus_tag LOCUS_04150 172977 172441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 173540 172977 gene locus_tag LOCUS_04160 173540 172977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 173721 173646 gene locus_tag LOCUS_t00070 173721 173646 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 173892 173981 gene locus_tag LOCUS_t00080 173892 173981 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 174049 175068 gene locus_tag LOCUS_04170 174049 175068 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_04170 176278 175130 gene locus_tag LOCUS_04180 gene dapE 176278 175130 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4H5 protein_id gnl|my_center|LOCUS_04180 176621 176268 gene locus_tag LOCUS_04190 176621 176268 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881844.1 protein_id gnl|my_center|LOCUS_04190 177449 176625 gene locus_tag LOCUS_04200 gene dapD 177449 176625 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8Y7 protein_id gnl|my_center|LOCUS_04200 180214 177533 gene locus_tag LOCUS_04210 gene glnD 180214 177533 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_04210 180944 180216 gene locus_tag LOCUS_04220 gene map 180944 180216 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_04220 181211 182125 gene locus_tag LOCUS_04230 gene rpsB 181211 182125 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS8 protein_id gnl|my_center|LOCUS_04230 182190 183071 gene locus_tag LOCUS_04240 gene tsf 182190 183071 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_04240 183283 184029 gene locus_tag LOCUS_04250 gene pyrH 183283 184029 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_04250 184026 184583 gene locus_tag LOCUS_04260 gene frr 184026 184583 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_04260 184640 185329 gene locus_tag LOCUS_04270 gene uppS 184640 185329 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG7 protein_id gnl|my_center|LOCUS_04270 185501 186322 gene locus_tag LOCUS_04280 gene cdsA-1 185501 186322 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_04280 186385 187749 gene locus_tag LOCUS_04290 186385 187749 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EF81 protein_id gnl|my_center|LOCUS_04290 187763 190108 gene locus_tag LOCUS_04300 gene bamA 187763 190108 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_04300 190162 191211 gene locus_tag LOCUS_04310 gene lpxD 190162 191211 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAW3 protein_id gnl|my_center|LOCUS_04310 191228 191668 gene locus_tag LOCUS_04320 gene fabZ 191228 191668 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_04320 191668 192441 gene locus_tag LOCUS_04330 gene lpxA 191668 192441 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG3 protein_id gnl|my_center|LOCUS_04330 192455 193615 gene locus_tag LOCUS_04340 gene lpxB 192455 193615 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_04340 193612 194232 gene locus_tag LOCUS_04350 gene rnhB 193612 194232 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_04350 194272 197772 gene locus_tag LOCUS_04360 gene dnaE 194272 197772 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9A0 protein_id gnl|my_center|LOCUS_04360 197801 198772 gene locus_tag LOCUS_04370 gene accA 197801 198772 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ8 protein_id gnl|my_center|LOCUS_04370 198769 200061 gene locus_tag LOCUS_04380 gene tilS 198769 200061 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR1 protein_id gnl|my_center|LOCUS_04380 200132 201796 gene locus_tag LOCUS_04390 gene pyrG 200132 201796 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA4 protein_id gnl|my_center|LOCUS_04390 201796 202632 gene locus_tag LOCUS_04400 gene kdsA 201796 202632 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z5 protein_id gnl|my_center|LOCUS_04400 202719 204002 gene locus_tag LOCUS_04410 gene eno 202719 204002 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J10 protein_id gnl|my_center|LOCUS_04410 204083 204508 gene locus_tag LOCUS_04420 204083 204508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 204727 205803 gene locus_tag LOCUS_04430 gene truD 204727 205803 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ1 protein_id gnl|my_center|LOCUS_04430 206323 205808 gene locus_tag LOCUS_04440 206323 205808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 206534 207283 gene locus_tag LOCUS_04450 gene surE 206534 207283 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR5 protein_id gnl|my_center|LOCUS_04450 207280 207960 gene locus_tag LOCUS_04460 gene pcm 207280 207960 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH9 protein_id gnl|my_center|LOCUS_04460 207960 208535 gene locus_tag LOCUS_04470 207960 208535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_04470 208643 209542 gene locus_tag LOCUS_04480 208643 209542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 209644 210852 gene locus_tag LOCUS_04490 209644 210852 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813076.1 protein_id gnl|my_center|LOCUS_04490 210874 212190 gene locus_tag LOCUS_04500 gene hom 210874 212190 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_04500 212191 213579 gene locus_tag LOCUS_04510 gene thrC 212191 213579 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_04510 213590 215305 gene locus_tag LOCUS_04520 gene recJ 213590 215305 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_04520 215972 215652 gene locus_tag LOCUS_04530 gene nirD 215972 215652 CDS product benzene 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_04530 217281 216010 gene locus_tag LOCUS_04540 gene sufS 217281 216010 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2S3 protein_id gnl|my_center|LOCUS_04540 218637 217300 gene locus_tag LOCUS_04550 gene sufD 218637 217300 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_04550 219395 218634 gene locus_tag LOCUS_04560 219395 218634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_04560 220964 219477 gene locus_tag LOCUS_04570 gene sufB 220964 219477 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958177.1 protein_id gnl|my_center|LOCUS_04570 221137 221622 gene locus_tag LOCUS_04580 221137 221622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 221739 222179 gene locus_tag LOCUS_04590 221739 222179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_04590 222169 222462 gene locus_tag LOCUS_04600 222169 222462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705505.1 protein_id gnl|my_center|LOCUS_04600 222894 222463 gene locus_tag LOCUS_04610 222894 222463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 225452 222990 gene locus_tag LOCUS_04620 225452 222990 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 protein_id gnl|my_center|LOCUS_04620 226115 225480 gene locus_tag LOCUS_04630 226115 225480 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_04630 226195 226656 gene locus_tag LOCUS_04640 226195 226656 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_04640 227304 226693 gene locus_tag LOCUS_04650 gene drgA 227304 226693 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118380.1 protein_id gnl|my_center|LOCUS_04650 228720 227329 gene locus_tag LOCUS_04660 gene purB 228720 227329 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K9 protein_id gnl|my_center|LOCUS_04660 228873 230264 gene locus_tag LOCUS_04670 gene fumC 228873 230264 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 protein_id gnl|my_center|LOCUS_04670 230326 230739 gene locus_tag LOCUS_04680 230326 230739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 231214 230771 gene locus_tag LOCUS_04690 231214 230771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_04690 231321 231842 gene locus_tag LOCUS_04700 231321 231842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 231842 233098 gene locus_tag LOCUS_04710 gene kynU 231842 233098 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y5 protein_id gnl|my_center|LOCUS_04710 233160 233405 gene locus_tag LOCUS_04720 233160 233405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 234222 233449 gene locus_tag LOCUS_04730 234222 233449 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 protein_id gnl|my_center|LOCUS_04730 235999 234431 gene locus_tag LOCUS_04740 235999 234431 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63696 protein_id gnl|my_center|LOCUS_04740 236166 236672 gene locus_tag LOCUS_04750 236166 236672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 236695 237174 gene locus_tag LOCUS_04760 236695 237174 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN7 protein_id gnl|my_center|LOCUS_04760 237317 237835 gene locus_tag LOCUS_04770 237317 237835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 237898 239724 gene locus_tag LOCUS_04780 gene uvrC 237898 239724 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_04780 239758 240324 gene locus_tag LOCUS_04790 gene pgsA 239758 240324 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_04790 240438 240512 gene locus_tag LOCUS_t00090 240438 240512 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 240588 240661 gene locus_tag LOCUS_t00100 240588 240661 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 240703 240789 gene locus_tag LOCUS_t00110 240703 240789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 240902 241789 gene locus_tag LOCUS_04800 240902 241789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_04800 241847 242749 gene locus_tag LOCUS_04810 gene galU-1 241847 242749 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKA0 protein_id gnl|my_center|LOCUS_04810 242910 245828 gene locus_tag LOCUS_04820 gene sucA 242910 245828 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526855.1 protein_id gnl|my_center|LOCUS_04820 245879 247213 gene locus_tag LOCUS_04830 gene sucB 245879 247213 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHD8 protein_id gnl|my_center|LOCUS_04830 >Feature sequence03 3046 1574 gene locus_tag LOCUS_04840 gene guaB 3046 1574 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 protein_id gnl|my_center|LOCUS_04840 3170 4546 gene locus_tag LOCUS_04850 gene xseA 3170 4546 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 protein_id gnl|my_center|LOCUS_04850 4603 5673 gene locus_tag LOCUS_04860 4603 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7177 5789 gene locus_tag LOCUS_04870 gene der 7177 5789 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV99 protein_id gnl|my_center|LOCUS_04870 8471 7296 gene locus_tag LOCUS_04880 gene bamB 8471 7296 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_04880 9142 8468 gene locus_tag LOCUS_04890 9142 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 10469 9195 gene locus_tag LOCUS_04900 gene hisS 10469 9195 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC33 protein_id gnl|my_center|LOCUS_04900 11526 10489 gene locus_tag LOCUS_04910 11526 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12287 11523 gene locus_tag LOCUS_04920 gene pilF 12287 11523 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 protein_id gnl|my_center|LOCUS_04920 13465 12284 gene locus_tag LOCUS_04930 gene rlmN 13465 12284 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ42 protein_id gnl|my_center|LOCUS_04930 13984 13514 gene locus_tag LOCUS_04940 gene ndk 13984 13514 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS2 protein_id gnl|my_center|LOCUS_04940 14401 14042 gene locus_tag LOCUS_04950 gene iscA 14401 14042 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E782 protein_id gnl|my_center|LOCUS_04950 14774 14406 gene locus_tag LOCUS_04960 14774 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 15964 14771 gene locus_tag LOCUS_04970 gene iscS 15964 14771 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKQ2 protein_id gnl|my_center|LOCUS_04970 16692 15964 gene locus_tag LOCUS_04980 gene cysE 16692 15964 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_04980 17616 16840 gene locus_tag LOCUS_04990 gene trmJ 17616 16840 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX37 protein_id gnl|my_center|LOCUS_04990 17687 18478 gene locus_tag LOCUS_05000 17687 18478 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705600.1 protein_id gnl|my_center|LOCUS_05000 20003 19059 gene locus_tag LOCUS_05010 gene secF 20003 19059 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_05010 21867 20017 gene locus_tag LOCUS_05020 gene secD 21867 20017 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74WU2 protein_id gnl|my_center|LOCUS_05020 22256 21927 gene locus_tag LOCUS_05030 gene yajC 22256 21927 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_05030 23544 22411 gene locus_tag LOCUS_05040 gene tgt 23544 22411 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_05040 23656 25173 gene locus_tag LOCUS_05050 23656 25173 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_05050 25230 25316 gene locus_tag LOCUS_t00120 25230 25316 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25484 26686 gene locus_tag LOCUS_05060 25484 26686 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 protein_id gnl|my_center|LOCUS_05060 27892 26939 gene locus_tag LOCUS_05070 27892 26939 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931661.1 protein_id gnl|my_center|LOCUS_05070 28315 29070 gene locus_tag LOCUS_05080 28315 29070 CDS product receptor protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038902.1 protein_id gnl|my_center|LOCUS_05080 29189 29404 gene locus_tag LOCUS_05090 29189 29404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 29440 30255 gene locus_tag LOCUS_05100 29440 30255 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038901.1 protein_id gnl|my_center|LOCUS_05100 30252 31964 gene locus_tag LOCUS_05110 30252 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 31964 32524 gene locus_tag LOCUS_05120 31964 32524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 32521 34095 gene locus_tag LOCUS_05130 32521 34095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 34535 34332 gene locus_tag LOCUS_05140 34535 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 34462 35265 gene locus_tag LOCUS_05150 34462 35265 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_05150 35300 35782 gene locus_tag LOCUS_05160 35300 35782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 35919 36182 gene locus_tag LOCUS_05170 35919 36182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 36287 36736 gene locus_tag LOCUS_05180 36287 36736 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWA0 protein_id gnl|my_center|LOCUS_05180 36955 37386 gene locus_tag LOCUS_05190 36955 37386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 37626 39632 gene locus_tag LOCUS_05200 37626 39632 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP48 protein_id gnl|my_center|LOCUS_05200 39629 40348 gene locus_tag LOCUS_05210 39629 40348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 40404 41624 gene locus_tag LOCUS_05220 40404 41624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 41628 42377 gene locus_tag LOCUS_05230 41628 42377 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_05230 42382 43074 gene locus_tag LOCUS_05240 42382 43074 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741281.1 protein_id gnl|my_center|LOCUS_05240 43061 43594 gene locus_tag LOCUS_05250 43061 43594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_05250 43591 44151 gene locus_tag LOCUS_05260 43591 44151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 44151 46373 gene locus_tag LOCUS_05270 44151 46373 CDS product conjugative coupling factor TraD, PFGI-1 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_05270 46373 47074 gene locus_tag LOCUS_05280 46373 47074 CDS product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007251563.1 protein_id gnl|my_center|LOCUS_05280 47209 47577 gene locus_tag LOCUS_05290 47209 47577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 47574 47807 gene locus_tag LOCUS_05300 47574 47807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 47827 48240 gene locus_tag LOCUS_05310 47827 48240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 48253 48636 gene locus_tag LOCUS_05320 48253 48636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190871.1 protein_id gnl|my_center|LOCUS_05320 48633 49322 gene locus_tag LOCUS_05330 48633 49322 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095173.1 protein_id gnl|my_center|LOCUS_05330 49322 50233 gene locus_tag LOCUS_05340 49322 50233 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769293.1 protein_id gnl|my_center|LOCUS_05340 50223 51668 gene locus_tag LOCUS_05350 50223 51668 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095175.1 protein_id gnl|my_center|LOCUS_05350 51634 52140 gene locus_tag LOCUS_05360 51634 52140 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740043.1 protein_id gnl|my_center|LOCUS_05360 52137 55007 gene locus_tag LOCUS_05370 52137 55007 CDS product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492036.1 protein_id gnl|my_center|LOCUS_05370 55004 55591 gene locus_tag LOCUS_05380 55004 55591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 55602 56000 gene locus_tag LOCUS_05390 55602 56000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 55997 56953 gene locus_tag LOCUS_05400 55997 56953 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267008.1 protein_id gnl|my_center|LOCUS_05400 56964 57383 gene locus_tag LOCUS_05410 56964 57383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 57448 58863 gene locus_tag LOCUS_05420 57448 58863 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153601.1 protein_id gnl|my_center|LOCUS_05420 58847 59224 gene locus_tag LOCUS_05430 58847 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 59237 60745 gene locus_tag LOCUS_05440 59237 60745 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038230.1 protein_id gnl|my_center|LOCUS_05440 61245 60802 gene locus_tag LOCUS_05450 61245 60802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 61450 61704 gene locus_tag LOCUS_05460 61450 61704 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884T6 protein_id gnl|my_center|LOCUS_05460 61701 62129 gene locus_tag LOCUS_05470 61701 62129 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_05470 62680 62384 gene locus_tag LOCUS_05480 62680 62384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 62909 62670 gene locus_tag LOCUS_05490 62909 62670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 63674 63213 gene locus_tag LOCUS_05500 63674 63213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 63904 63689 gene locus_tag LOCUS_05510 63904 63689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 64211 63963 gene locus_tag LOCUS_05520 64211 63963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 68809 64793 gene locus_tag LOCUS_05530 68809 64793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 69452 70699 gene locus_tag LOCUS_05540 69452 70699 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 protein_id gnl|my_center|LOCUS_05540 70699 70890 gene locus_tag LOCUS_05550 70699 70890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 72035 71094 gene locus_tag LOCUS_05560 72035 71094 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803681.1 protein_id gnl|my_center|LOCUS_05560 72577 72032 gene locus_tag LOCUS_05570 72577 72032 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208184.1 protein_id gnl|my_center|LOCUS_05570 73571 73017 gene locus_tag LOCUS_05580 73571 73017 CDS product hypothetical glyoxalase/bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701788.1 protein_id gnl|my_center|LOCUS_05580 74184 73588 gene locus_tag LOCUS_05590 74184 73588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 75146 74289 gene locus_tag LOCUS_05600 75146 74289 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728079.1 protein_id gnl|my_center|LOCUS_05600 75256 76173 gene locus_tag LOCUS_05610 75256 76173 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400772.1 protein_id gnl|my_center|LOCUS_05610 77211 76492 gene locus_tag LOCUS_05620 77211 76492 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916254.1 protein_id gnl|my_center|LOCUS_05620 78068 77208 gene locus_tag LOCUS_05630 gene hchA 78068 77208 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706906.1 protein_id gnl|my_center|LOCUS_05630 79305 78310 gene locus_tag LOCUS_05640 79305 78310 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_05640 79903 79322 gene locus_tag LOCUS_05650 79903 79322 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_05650 80897 79908 gene locus_tag LOCUS_05660 80897 79908 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209763.1 protein_id gnl|my_center|LOCUS_05660 80992 81885 gene locus_tag LOCUS_05670 80992 81885 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_05670 82410 82105 gene locus_tag LOCUS_05680 82410 82105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 82556 82819 gene locus_tag LOCUS_05690 82556 82819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 83098 83559 gene locus_tag LOCUS_05700 83098 83559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 83764 84204 gene locus_tag LOCUS_05710 83764 84204 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967473.1 protein_id gnl|my_center|LOCUS_05710 84304 84762 gene locus_tag LOCUS_05720 84304 84762 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR57 protein_id gnl|my_center|LOCUS_05720 84862 85446 gene locus_tag LOCUS_05730 84862 85446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 85548 85706 gene locus_tag LOCUS_05740 85548 85706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 85672 85947 gene locus_tag LOCUS_05750 85672 85947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 86064 86366 gene locus_tag LOCUS_05760 86064 86366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 86532 87047 gene locus_tag LOCUS_05770 86532 87047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 87283 87855 gene locus_tag LOCUS_05780 87283 87855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 88002 88520 gene locus_tag LOCUS_05790 88002 88520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 88935 89756 gene locus_tag LOCUS_05800 88935 89756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 89765 89995 gene locus_tag LOCUS_05810 89765 89995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 90009 90272 gene locus_tag LOCUS_05820 90009 90272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 90589 90371 gene locus_tag LOCUS_05830 90589 90371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 91219 91740 gene locus_tag LOCUS_05840 gene mntP 91219 91740 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ8 protein_id gnl|my_center|LOCUS_05840 91773 92489 gene locus_tag LOCUS_05850 91773 92489 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_05850 92708 92577 gene locus_tag LOCUS_05860 92708 92577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 92947 93330 gene locus_tag LOCUS_05870 92947 93330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05870 93299 93916 gene locus_tag LOCUS_05880 93299 93916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 94810 93944 gene locus_tag LOCUS_05890 94810 93944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 95013 94825 gene locus_tag LOCUS_05900 95013 94825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 97017 95017 gene locus_tag LOCUS_05910 97017 95017 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_05910 97306 97034 gene locus_tag LOCUS_05920 97306 97034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886866.1 protein_id gnl|my_center|LOCUS_05920 97373 98572 gene locus_tag LOCUS_05930 97373 98572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 protein_id gnl|my_center|LOCUS_05930 98586 99200 gene locus_tag LOCUS_05940 98586 99200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05940 99197 99784 gene locus_tag LOCUS_05950 99197 99784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 101266 102033 gene locus_tag LOCUS_05960 gene ccmA 101266 102033 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE58 protein_id gnl|my_center|LOCUS_05960 102027 102695 gene locus_tag LOCUS_05970 gene ccmB 102027 102695 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_05970 102888 103643 gene locus_tag LOCUS_05980 gene ccmC 102888 103643 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_05980 103633 103800 gene locus_tag LOCUS_05990 103633 103800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 103832 104257 gene locus_tag LOCUS_06000 gene ccmE 103832 104257 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z07 protein_id gnl|my_center|LOCUS_06000 104254 106239 gene locus_tag LOCUS_06010 gene ccmF 104254 106239 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_06010 106239 106772 gene locus_tag LOCUS_06020 gene ccmG 106239 106772 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_06020 106772 107266 gene locus_tag LOCUS_06030 106772 107266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 107263 108108 gene locus_tag LOCUS_06040 107263 108108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 108798 109424 gene locus_tag LOCUS_06050 108798 109424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 109469 111307 gene locus_tag LOCUS_06060 gene copA 109469 111307 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_06060 111300 112112 gene locus_tag LOCUS_06070 111300 112112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 112280 113233 gene locus_tag LOCUS_06080 112280 113233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 113293 114399 gene locus_tag LOCUS_06090 113293 114399 CDS product putative permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YET7 protein_id gnl|my_center|LOCUS_06090 114509 115054 gene locus_tag LOCUS_06100 114509 115054 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 protein_id gnl|my_center|LOCUS_06100 117714 115180 gene locus_tag LOCUS_06110 117714 115180 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971462.1 protein_id gnl|my_center|LOCUS_06110 118030 117731 gene locus_tag LOCUS_06120 118030 117731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173741.1 protein_id gnl|my_center|LOCUS_06120 118242 118030 gene locus_tag LOCUS_06130 118242 118030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_06130 118359 119015 gene locus_tag LOCUS_06140 118359 119015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 protein_id gnl|my_center|LOCUS_06140 119691 119278 gene locus_tag LOCUS_06150 gene merR 119691 119278 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2Q8 protein_id gnl|my_center|LOCUS_06150 119767 121416 gene locus_tag LOCUS_06160 gene merA 119767 121416 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003602726.1 protein_id gnl|my_center|LOCUS_06160 121459 121884 gene locus_tag LOCUS_06170 121459 121884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 122023 123375 gene locus_tag LOCUS_06180 122023 123375 CDS product putative FAD-dependent pyridine nucleotide-disulphide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700707.1 protein_id gnl|my_center|LOCUS_06180 123804 124448 gene locus_tag LOCUS_06190 123804 124448 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_06190 124445 124801 gene locus_tag LOCUS_06200 gene arsR 124445 124801 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809062.1 protein_id gnl|my_center|LOCUS_06200 124838 125320 gene locus_tag LOCUS_06210 124838 125320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 125379 125723 gene locus_tag LOCUS_06220 125379 125723 CDS product UPF0060 membrane protein R01043 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R68 protein_id gnl|my_center|LOCUS_06220 126090 126482 gene locus_tag LOCUS_06230 126090 126482 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936745.1 protein_id gnl|my_center|LOCUS_06230 126501 126923 gene locus_tag LOCUS_06240 gene arsC 126501 126923 CDS product protein ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45947 protein_id gnl|my_center|LOCUS_06240 127026 127436 gene locus_tag LOCUS_06250 127026 127436 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9P6 protein_id gnl|my_center|LOCUS_06250 127436 128164 gene locus_tag LOCUS_06260 gene ArsH 127436 128164 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337697.1 protein_id gnl|my_center|LOCUS_06260 128196 129500 gene locus_tag LOCUS_06270 gene arsB 128196 129500 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6G0 protein_id gnl|my_center|LOCUS_06270 130207 131340 gene locus_tag LOCUS_06280 130207 131340 CDS product amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_06280 131647 132225 gene locus_tag LOCUS_06290 131647 132225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 132315 133004 gene locus_tag LOCUS_06300 132315 133004 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 protein_id gnl|my_center|LOCUS_06300 133149 134369 gene locus_tag LOCUS_06310 133149 134369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403215.1 protein_id gnl|my_center|LOCUS_06310 134535 134852 gene locus_tag LOCUS_06320 134535 134852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531104.1 protein_id gnl|my_center|LOCUS_06320 134998 136119 gene locus_tag LOCUS_06330 134998 136119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_06330 136246 136752 gene locus_tag LOCUS_06340 gene dsbB 136246 136752 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_06340 137018 137410 gene locus_tag LOCUS_06350 gene cueR 137018 137410 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_06350 137546 137758 gene locus_tag LOCUS_06360 137546 137758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 137762 138409 gene locus_tag LOCUS_06370 137762 138409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 138740 141163 gene locus_tag LOCUS_06380 138740 141163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 141184 141798 gene locus_tag LOCUS_06390 141184 141798 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_06390 142381 142821 gene locus_tag LOCUS_06400 gene copG 142381 142821 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_06400 143070 142834 gene locus_tag LOCUS_06410 143070 142834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 143189 143479 gene locus_tag LOCUS_06420 143189 143479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 143549 144184 gene locus_tag LOCUS_06430 143549 144184 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_06430 144290 144955 gene locus_tag LOCUS_06440 144290 144955 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404339.1 protein_id gnl|my_center|LOCUS_06440 144992 145810 gene locus_tag LOCUS_06450 144992 145810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 145807 146994 gene locus_tag LOCUS_06460 145807 146994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 146981 147607 gene locus_tag LOCUS_06470 146981 147607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 148332 149012 gene locus_tag LOCUS_06480 148332 149012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 149063 150958 gene locus_tag LOCUS_06490 gene pcoA 149063 150958 CDS product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_06490 150951 151763 gene locus_tag LOCUS_06500 gene pcoB 150951 151763 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_06500 152235 152573 gene locus_tag LOCUS_06510 152235 152573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 152703 153095 gene locus_tag LOCUS_06520 gene nuoA1 152703 153095 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_06520 153092 154354 gene locus_tag LOCUS_06530 153092 154354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 154351 155259 gene locus_tag LOCUS_06540 154351 155259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 155256 155861 gene locus_tag LOCUS_06550 155256 155861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 155874 156179 gene locus_tag LOCUS_06560 gene nuoK 155874 156179 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2L3 protein_id gnl|my_center|LOCUS_06560 156179 158005 gene locus_tag LOCUS_06570 156179 158005 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_06570 158006 159499 gene locus_tag LOCUS_06580 158006 159499 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_06580 159501 160907 gene locus_tag LOCUS_06590 gene nuoN-1 159501 160907 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_06590 162168 161761 gene locus_tag LOCUS_06600 162168 161761 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707314.1 protein_id gnl|my_center|LOCUS_06600 162257 163798 gene locus_tag LOCUS_06610 gene lnt 162257 163798 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE4 protein_id gnl|my_center|LOCUS_06610 163897 164535 gene locus_tag LOCUS_06620 163897 164535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 164595 165224 gene locus_tag LOCUS_06630 164595 165224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 165267 165770 gene locus_tag LOCUS_06640 gene lspA 165267 165770 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRW3 protein_id gnl|my_center|LOCUS_06640 165751 166143 gene locus_tag LOCUS_06650 165751 166143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence04 212 784 gene locus_tag LOCUS_06660 gene efp 212 784 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_06660 827 1732 gene locus_tag LOCUS_06670 gene epmA 827 1732 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z197 protein_id gnl|my_center|LOCUS_06670 2626 1748 gene locus_tag LOCUS_06680 gene psd 2626 1748 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK8 protein_id gnl|my_center|LOCUS_06680 2755 3693 gene locus_tag LOCUS_06690 gene prmB 2755 3693 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_06690 3696 4796 gene locus_tag LOCUS_06700 gene aroC 3696 4796 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ85 protein_id gnl|my_center|LOCUS_06700 4796 5686 gene locus_tag LOCUS_06710 4796 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6526 5660 gene locus_tag LOCUS_06720 6526 5660 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_06720 6642 8051 gene locus_tag LOCUS_06730 gene leuC 6642 8051 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JK9 protein_id gnl|my_center|LOCUS_06730 8048 8854 gene locus_tag LOCUS_06740 8048 8854 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 protein_id gnl|my_center|LOCUS_06740 8859 9503 gene locus_tag LOCUS_06750 gene leuD 8859 9503 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1L9 protein_id gnl|my_center|LOCUS_06750 9559 10635 gene locus_tag LOCUS_06760 gene leuB 9559 10635 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_06760 10976 12760 gene locus_tag LOCUS_06770 10976 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 12764 13567 gene locus_tag LOCUS_06780 gene truA 12764 13567 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTA4 protein_id gnl|my_center|LOCUS_06780 13613 14245 gene locus_tag LOCUS_06790 gene trpF 13613 14245 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_06790 14242 15498 gene locus_tag LOCUS_06800 gene trpB 14242 15498 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9Z8 protein_id gnl|my_center|LOCUS_06800 15495 16376 gene locus_tag LOCUS_06810 gene trpA 15495 16376 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_06810 16406 17347 gene locus_tag LOCUS_06820 gene accD1 16406 17347 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MP2 protein_id gnl|my_center|LOCUS_06820 17344 18597 gene locus_tag LOCUS_06830 gene folC 17344 18597 CDS product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z501 protein_id gnl|my_center|LOCUS_06830 18594 19376 gene locus_tag LOCUS_06840 18594 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 19479 20024 gene locus_tag LOCUS_06850 19479 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_06850 20061 21572 gene locus_tag LOCUS_06860 gene purF 20061 21572 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_06860 21774 22979 gene locus_tag LOCUS_06870 gene metZ 21774 22979 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_06870 22976 23782 gene locus_tag LOCUS_06880 22976 23782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_06880 24705 23941 gene locus_tag LOCUS_06890 gene lpxH 24705 23941 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLW6 protein_id gnl|my_center|LOCUS_06890 25235 24750 gene locus_tag LOCUS_06900 gene ppiB 25235 24750 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNQ1 protein_id gnl|my_center|LOCUS_06900 26346 25324 gene locus_tag LOCUS_06910 gene dusA 26346 25324 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 protein_id gnl|my_center|LOCUS_06910 26444 27475 gene locus_tag LOCUS_06920 gene pyrD 26444 27475 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9A8 protein_id gnl|my_center|LOCUS_06920 28124 27600 gene locus_tag LOCUS_06930 28124 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 28191 28481 gene locus_tag LOCUS_06940 28191 28481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 28481 29923 gene locus_tag LOCUS_06950 28481 29923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 30000 31121 gene locus_tag LOCUS_06960 30000 31121 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706830.1 protein_id gnl|my_center|LOCUS_06960 31156 33765 gene locus_tag LOCUS_06970 gene pepN 31156 33765 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_06970 33841 34536 gene locus_tag LOCUS_06980 gene phoB 33841 34536 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_06980 34841 36178 gene locus_tag LOCUS_06990 gene phoR 34841 36178 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_06990 36490 37548 gene locus_tag LOCUS_07000 gene pstS 36490 37548 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VF5 protein_id gnl|my_center|LOCUS_07000 37656 38636 gene locus_tag LOCUS_07010 gene pstC 37656 38636 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N1 protein_id gnl|my_center|LOCUS_07010 38647 39480 gene locus_tag LOCUS_07020 gene pstA 38647 39480 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ65 protein_id gnl|my_center|LOCUS_07020 39490 40398 gene locus_tag LOCUS_07030 gene pstB 39490 40398 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU90 protein_id gnl|my_center|LOCUS_07030 40421 41176 gene locus_tag LOCUS_07040 40421 41176 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA8 protein_id gnl|my_center|LOCUS_07040 41265 43709 gene locus_tag LOCUS_07050 gene mrcB 41265 43709 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_07050 43721 44317 gene locus_tag LOCUS_07060 43721 44317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 44314 46242 gene locus_tag LOCUS_07070 44314 46242 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096139.1 protein_id gnl|my_center|LOCUS_07070 46239 46901 gene locus_tag LOCUS_07080 46239 46901 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 protein_id gnl|my_center|LOCUS_07080 46914 47444 gene locus_tag LOCUS_07090 46914 47444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_07090 48179 47424 gene locus_tag LOCUS_07100 gene rsmJ 48179 47424 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7B7 protein_id gnl|my_center|LOCUS_07100 48504 48184 gene locus_tag LOCUS_07110 48504 48184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 48852 48592 gene locus_tag LOCUS_07120 48852 48592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 48993 49331 gene locus_tag LOCUS_07130 48993 49331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 49324 49956 gene locus_tag LOCUS_07140 49324 49956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 50738 49953 gene locus_tag LOCUS_07150 50738 49953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_07150 52096 50738 gene locus_tag LOCUS_07160 52096 50738 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_07160 53048 52287 gene locus_tag LOCUS_07170 gene cobB 53048 52287 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGG3 protein_id gnl|my_center|LOCUS_07170 54673 53051 gene locus_tag LOCUS_07180 gene yhcX 54673 53051 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_07180 56694 54865 gene locus_tag LOCUS_07190 gene typA 56694 54865 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_07190 56832 58055 gene locus_tag LOCUS_07200 56832 58055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204242.1 protein_id gnl|my_center|LOCUS_07200 59347 58052 gene locus_tag LOCUS_07210 gene mntH 59347 58052 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HK76 protein_id gnl|my_center|LOCUS_07210 59492 61432 gene locus_tag LOCUS_07220 59492 61432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_07220 61455 61904 gene locus_tag LOCUS_07230 61455 61904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 63014 61959 gene locus_tag LOCUS_07240 63014 61959 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_07240 63416 63051 gene locus_tag LOCUS_07250 63416 63051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 64041 63469 gene locus_tag LOCUS_07260 64041 63469 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_07260 64445 64101 gene locus_tag LOCUS_07270 64445 64101 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058130.1 protein_id gnl|my_center|LOCUS_07270 64520 65350 gene locus_tag LOCUS_07280 64520 65350 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526276.1 protein_id gnl|my_center|LOCUS_07280 68480 65367 gene locus_tag LOCUS_07290 gene dnaE2 68480 65367 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTG0 protein_id gnl|my_center|LOCUS_07290 69949 68501 gene locus_tag LOCUS_07300 69949 68501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_07300 70830 69952 gene locus_tag LOCUS_07310 70830 69952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 70965 72026 gene locus_tag LOCUS_07320 70965 72026 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529297.1 protein_id gnl|my_center|LOCUS_07320 72422 72030 gene locus_tag LOCUS_07330 72422 72030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 72554 74026 gene locus_tag LOCUS_07340 gene amn 72554 74026 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89C85 protein_id gnl|my_center|LOCUS_07340 76921 74183 gene locus_tag LOCUS_07350 gene rpfA 76921 74183 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 protein_id gnl|my_center|LOCUS_07350 77672 77070 gene locus_tag LOCUS_07360 gene hflD 77672 77070 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A2 protein_id gnl|my_center|LOCUS_07360 78805 77669 gene locus_tag LOCUS_07370 gene mnmA 78805 77669 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9A1 protein_id gnl|my_center|LOCUS_07370 79269 78823 gene locus_tag LOCUS_07380 79269 78823 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_07380 79420 80373 gene locus_tag LOCUS_07390 79420 80373 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_07390 80412 81161 gene locus_tag LOCUS_07400 gene fabG 80412 81161 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_07400 81259 81498 gene locus_tag LOCUS_07410 gene acpP 81259 81498 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_07410 81635 82840 gene locus_tag LOCUS_07420 gene fabF1 81635 82840 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_07420 82837 84240 gene locus_tag LOCUS_07430 gene trpE 82837 84240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_07430 84233 85066 gene locus_tag LOCUS_07440 gene pabC 84233 85066 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_07440 85088 86092 gene locus_tag LOCUS_07450 85088 86092 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_07450 86092 86733 gene locus_tag LOCUS_07460 gene tmk 86092 86733 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_07460 86726 87715 gene locus_tag LOCUS_07470 86726 87715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 88397 87738 gene locus_tag LOCUS_07480 88397 87738 CDS product HTH-type transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADP7 protein_id gnl|my_center|LOCUS_07480 88653 90953 gene locus_tag LOCUS_07490 gene fadE 88653 90953 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_07490 91377 92075 gene locus_tag LOCUS_07500 91377 92075 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_07500 92079 93875 gene locus_tag LOCUS_07510 gene recQ 92079 93875 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_07510 93886 94095 gene locus_tag LOCUS_07520 93886 94095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 94181 96256 gene locus_tag LOCUS_07530 94181 96256 CDS product high-affinity choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 protein_id gnl|my_center|LOCUS_07530 96373 97047 gene locus_tag LOCUS_07540 96373 97047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_07540 97117 97782 gene locus_tag LOCUS_07550 97117 97782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 98438 97707 gene locus_tag LOCUS_07560 98438 97707 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185643.1 protein_id gnl|my_center|LOCUS_07560 98612 99766 gene locus_tag LOCUS_07570 gene cobG 98612 99766 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709477.1 protein_id gnl|my_center|LOCUS_07570 99796 100440 gene locus_tag LOCUS_07580 gene cobH 99796 100440 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_07580 100476 101189 gene locus_tag LOCUS_07590 gene cobI 100476 101189 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709475.1 protein_id gnl|my_center|LOCUS_07590 101186 101971 gene locus_tag LOCUS_07600 101186 101971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 102795 101965 gene locus_tag LOCUS_07610 gene cobK 102795 101965 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970290.1 protein_id gnl|my_center|LOCUS_07610 102779 103990 gene locus_tag LOCUS_07620 gene cobL 102779 103990 CDS product precorrin-6Y C(5,15)-methyltransferase [decarboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU0 protein_id gnl|my_center|LOCUS_07620 103987 104775 gene locus_tag LOCUS_07630 gene cobM 103987 104775 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 protein_id gnl|my_center|LOCUS_07630 105884 104772 gene locus_tag LOCUS_07640 gene cbiD 105884 104772 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZT9 protein_id gnl|my_center|LOCUS_07640 107115 105940 gene locus_tag LOCUS_07650 107115 105940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 107741 107130 gene locus_tag LOCUS_07660 107741 107130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 108154 108879 gene locus_tag LOCUS_07670 108154 108879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971224.1 protein_id gnl|my_center|LOCUS_07670 108890 110632 gene locus_tag LOCUS_07680 108890 110632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 protein_id gnl|my_center|LOCUS_07680 110629 111939 gene locus_tag LOCUS_07690 gene cobB 110629 111939 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I471 protein_id gnl|my_center|LOCUS_07690 111958 113031 gene locus_tag LOCUS_07700 gene cobW 111958 113031 CDS product protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ2 protein_id gnl|my_center|LOCUS_07700 113101 113322 gene locus_tag LOCUS_07710 113101 113322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 113510 117313 gene locus_tag LOCUS_07720 113510 117313 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104405.1 protein_id gnl|my_center|LOCUS_07720 117552 118034 gene locus_tag LOCUS_07730 117552 118034 CDS product putative cytidine/deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704189.1 protein_id gnl|my_center|LOCUS_07730 118689 118036 gene locus_tag LOCUS_07740 118689 118036 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_07740 120101 118686 gene locus_tag LOCUS_07750 120101 118686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 protein_id gnl|my_center|LOCUS_07750 121093 120098 gene locus_tag LOCUS_07760 121093 120098 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038902.1 protein_id gnl|my_center|LOCUS_07760 121228 121572 gene locus_tag LOCUS_07770 121228 121572 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087001.1 protein_id gnl|my_center|LOCUS_07770 121638 122192 gene locus_tag LOCUS_07780 121638 122192 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972227.1 protein_id gnl|my_center|LOCUS_07780 123187 122363 gene locus_tag LOCUS_07790 123187 122363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 123299 123661 gene locus_tag LOCUS_07800 123299 123661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 123702 125021 gene locus_tag LOCUS_07810 gene czcC 123702 125021 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_07810 125021 126286 gene locus_tag LOCUS_07820 125021 126286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 126302 129406 gene locus_tag LOCUS_07830 126302 129406 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_07830 129842 130765 gene locus_tag LOCUS_07840 gene czcD.1 129842 130765 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_07840 131338 131036 gene locus_tag LOCUS_07850 131338 131036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 133122 131377 gene locus_tag LOCUS_07860 gene deaD 133122 131377 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_07860 134759 133500 gene locus_tag LOCUS_07870 134759 133500 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_07870 135019 135624 gene locus_tag LOCUS_07880 135019 135624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 135627 136199 gene locus_tag LOCUS_07890 135627 136199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 136328 136843 gene locus_tag LOCUS_07900 136328 136843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 136856 137863 gene locus_tag LOCUS_07910 136856 137863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267645.1 protein_id gnl|my_center|LOCUS_07910 137860 140058 gene locus_tag LOCUS_07920 137860 140058 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267646.1 protein_id gnl|my_center|LOCUS_07920 140149 140583 gene locus_tag LOCUS_07930 140149 140583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 140573 140998 gene locus_tag LOCUS_07940 140573 140998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 140979 141185 gene locus_tag LOCUS_07950 140979 141185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 protein_id gnl|my_center|LOCUS_07950 141243 142427 gene locus_tag LOCUS_07960 gene glpQ 141243 142427 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104569.1 protein_id gnl|my_center|LOCUS_07960 143599 142421 gene locus_tag LOCUS_07970 143599 142421 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_07970 143681 143986 gene locus_tag LOCUS_07980 143681 143986 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972805.1 protein_id gnl|my_center|LOCUS_07980 144361 144819 gene locus_tag LOCUS_07990 144361 144819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 144967 145551 gene locus_tag LOCUS_08000 144967 145551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_08000 145738 146214 gene locus_tag LOCUS_08010 145738 146214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_08010 146257 146856 gene locus_tag LOCUS_08020 gene cynT 146257 146856 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_08020 146853 147572 gene locus_tag LOCUS_08030 146853 147572 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707192.1 protein_id gnl|my_center|LOCUS_08030 147599 148207 gene locus_tag LOCUS_08040 147599 148207 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_08040 148746 148216 gene locus_tag LOCUS_08050 148746 148216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 149052 149606 gene locus_tag LOCUS_08060 149052 149606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence05 578 1531 gene locus_tag LOCUS_08070 578 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08070 1625 3829 gene locus_tag LOCUS_08080 1625 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08080 4068 5543 gene locus_tag LOCUS_08090 gene putP 4068 5543 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816239.1 protein_id gnl|my_center|LOCUS_08090 5672 6526 gene locus_tag LOCUS_08100 5672 6526 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_08100 6549 8030 gene locus_tag LOCUS_08110 6549 8030 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 protein_id gnl|my_center|LOCUS_08110 8446 11133 gene locus_tag LOCUS_08120 gene aaiD 8446 11133 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_08120 12702 11272 gene locus_tag LOCUS_08130 12702 11272 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_08130 13701 12853 gene locus_tag LOCUS_08140 gene eutC 13701 12853 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX02 protein_id gnl|my_center|LOCUS_08140 15103 13694 gene locus_tag LOCUS_08150 gene eutB 15103 13694 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_08150 16868 15348 gene locus_tag LOCUS_08160 16868 15348 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705164.1 protein_id gnl|my_center|LOCUS_08160 17015 17956 gene locus_tag LOCUS_08170 17015 17956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 19194 18016 gene locus_tag LOCUS_08180 gene nagA 19194 18016 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34450 protein_id gnl|my_center|LOCUS_08180 20070 19198 gene locus_tag LOCUS_08190 20070 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204178.1 protein_id gnl|my_center|LOCUS_08190 21605 20199 gene locus_tag LOCUS_08200 21605 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 22258 21602 gene locus_tag LOCUS_08210 22258 21602 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_08210 22400 22765 gene locus_tag LOCUS_08220 22400 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 23333 22968 gene locus_tag LOCUS_08230 23333 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 23476 24693 gene locus_tag LOCUS_08240 gene argD 23476 24693 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN20 protein_id gnl|my_center|LOCUS_08240 24765 25628 gene locus_tag LOCUS_08250 24765 25628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 25682 26980 gene locus_tag LOCUS_08260 25682 26980 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268227.1 protein_id gnl|my_center|LOCUS_08260 27060 27398 gene locus_tag LOCUS_08270 27060 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 27518 28414 gene locus_tag LOCUS_08280 27518 28414 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 protein_id gnl|my_center|LOCUS_08280 29497 28703 gene locus_tag LOCUS_08290 29497 28703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 protein_id gnl|my_center|LOCUS_08290 30272 29547 gene locus_tag LOCUS_08300 gene aotM 30272 29547 CDS product arginine/ornithine transporter AotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_08300 30976 30272 gene locus_tag LOCUS_08310 gene hisQ 30976 30272 CDS product histidine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522525.1 protein_id gnl|my_center|LOCUS_08310 31761 30991 gene locus_tag LOCUS_08320 31761 30991 CDS product histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 protein_id gnl|my_center|LOCUS_08320 32351 31866 gene locus_tag LOCUS_08330 32351 31866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 32452 33573 gene locus_tag LOCUS_08340 32452 33573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_08340 33570 34259 gene locus_tag LOCUS_08350 33570 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 35029 34478 gene locus_tag LOCUS_08360 35029 34478 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_08360 35280 35804 gene locus_tag LOCUS_08370 35280 35804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 35948 36331 gene locus_tag LOCUS_08380 gene cbiX 35948 36331 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_08380 36424 36846 gene locus_tag LOCUS_08390 36424 36846 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267845.1 protein_id gnl|my_center|LOCUS_08390 36950 37432 gene locus_tag LOCUS_08400 gene greB 36950 37432 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DW4 protein_id gnl|my_center|LOCUS_08400 38400 37429 gene locus_tag LOCUS_08410 38400 37429 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389707.1 protein_id gnl|my_center|LOCUS_08410 38646 38443 gene locus_tag LOCUS_08420 38646 38443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 40753 38636 gene locus_tag LOCUS_08430 40753 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 protein_id gnl|my_center|LOCUS_08430 41409 40798 gene locus_tag LOCUS_08440 41409 40798 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_08440 41555 42607 gene locus_tag LOCUS_08450 41555 42607 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089758.1 protein_id gnl|my_center|LOCUS_08450 42600 47024 gene locus_tag LOCUS_08460 42600 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 48229 47021 gene locus_tag LOCUS_08470 gene phbA 48229 47021 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_08470 50322 48367 gene locus_tag LOCUS_08480 gene acsA 50322 48367 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD63 protein_id gnl|my_center|LOCUS_08480 50945 50427 gene locus_tag LOCUS_08490 50945 50427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 51060 51488 gene locus_tag LOCUS_08500 gene ohr 51060 51488 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_08500 51903 51520 gene locus_tag LOCUS_08510 51903 51520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 52633 51989 gene locus_tag LOCUS_08520 52633 51989 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037707.1 protein_id gnl|my_center|LOCUS_08520 54692 52761 gene locus_tag LOCUS_08530 54692 52761 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_08530 56033 55389 gene locus_tag LOCUS_08540 56033 55389 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUY1 protein_id gnl|my_center|LOCUS_08540 56140 57051 gene locus_tag LOCUS_08550 56140 57051 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 protein_id gnl|my_center|LOCUS_08550 57818 57048 gene locus_tag LOCUS_08560 gene djlA 57818 57048 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGU4 protein_id gnl|my_center|LOCUS_08560 58595 57909 gene locus_tag LOCUS_08570 58595 57909 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_08570 61848 59365 gene locus_tag LOCUS_08580 61848 59365 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_08580 62140 61841 gene locus_tag LOCUS_08590 62140 61841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 64023 62392 gene locus_tag LOCUS_08600 gene lig2 64023 62392 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 protein_id gnl|my_center|LOCUS_08600 64278 65150 gene locus_tag LOCUS_08610 64278 65150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 65147 65995 gene locus_tag LOCUS_08620 65147 65995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 66105 66875 gene locus_tag LOCUS_08630 66105 66875 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_08630 67956 66961 gene locus_tag LOCUS_08640 gene lipA 67956 66961 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_08640 68126 69271 gene locus_tag LOCUS_08650 68126 69271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114118.1 protein_id gnl|my_center|LOCUS_08650 70365 69268 gene locus_tag LOCUS_08660 70365 69268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_08660 71243 70368 gene locus_tag LOCUS_08670 71243 70368 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_08670 73423 71240 gene locus_tag LOCUS_08680 73423 71240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 74358 73420 gene locus_tag LOCUS_08690 74358 73420 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_08690 74534 75088 gene locus_tag LOCUS_08700 74534 75088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 76161 75085 gene locus_tag LOCUS_08710 gene dusB 76161 75085 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH1 protein_id gnl|my_center|LOCUS_08710 76213 76764 gene locus_tag LOCUS_08720 76213 76764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 76933 77463 gene locus_tag LOCUS_08730 76933 77463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 77490 78197 gene locus_tag LOCUS_08740 gene phoP 77490 78197 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_08740 78194 79540 gene locus_tag LOCUS_08750 gene phoQ 78194 79540 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_08750 79540 80076 gene locus_tag LOCUS_08760 79540 80076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 80076 81080 gene locus_tag LOCUS_08770 gene sppA 80076 81080 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_08770 81340 81077 gene locus_tag LOCUS_08780 81340 81077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 84023 81543 gene locus_tag LOCUS_08790 gene plsB 84023 81543 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU3 protein_id gnl|my_center|LOCUS_08790 84734 84039 gene locus_tag LOCUS_08800 84734 84039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 85530 84742 gene locus_tag LOCUS_08810 85530 84742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 86556 85567 gene locus_tag LOCUS_08820 86556 85567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 87383 86556 gene locus_tag LOCUS_08830 87383 86556 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030521.1 protein_id gnl|my_center|LOCUS_08830 87489 88334 gene locus_tag LOCUS_08840 87489 88334 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687145.1 protein_id gnl|my_center|LOCUS_08840 88589 88374 gene locus_tag LOCUS_08850 88589 88374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 88966 88586 gene locus_tag LOCUS_08860 88966 88586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 89280 88969 gene locus_tag LOCUS_08870 89280 88969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 90022 89324 gene locus_tag LOCUS_08880 90022 89324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 90080 90358 gene locus_tag LOCUS_08890 90080 90358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 90681 92300 gene locus_tag LOCUS_08900 gene prfC 90681 92300 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V6 protein_id gnl|my_center|LOCUS_08900 93894 92335 gene locus_tag LOCUS_08910 gene ppx 93894 92335 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036174.1 protein_id gnl|my_center|LOCUS_08910 94179 94790 gene locus_tag LOCUS_08920 94179 94790 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705408.1 protein_id gnl|my_center|LOCUS_08920 94833 95774 gene locus_tag LOCUS_08930 94833 95774 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_08930 97359 96169 gene locus_tag LOCUS_08940 97359 96169 CDS product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087365.1 protein_id gnl|my_center|LOCUS_08940 98495 97575 gene locus_tag LOCUS_08950 gene ttcA 98495 97575 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 protein_id gnl|my_center|LOCUS_08950 99389 98499 gene locus_tag LOCUS_08960 99389 98499 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_08960 100267 99386 gene locus_tag LOCUS_08970 gene exo 100267 99386 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_08970 100346 101119 gene locus_tag LOCUS_08980 100346 101119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 101340 102452 gene locus_tag LOCUS_08990 101340 102452 CDS product putative NAD(P) transhydrogenase, alpha1 subunit PntAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705302.1 protein_id gnl|my_center|LOCUS_08990 102495 102779 gene locus_tag LOCUS_09000 102495 102779 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_09000 102818 104215 gene locus_tag LOCUS_09010 102818 104215 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 protein_id gnl|my_center|LOCUS_09010 104358 104975 gene locus_tag LOCUS_09020 104358 104975 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_09020 105179 107374 gene locus_tag LOCUS_09030 gene priA 105179 107374 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E3 protein_id gnl|my_center|LOCUS_09030 107463 109133 gene locus_tag LOCUS_09040 gene argS 107463 109133 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_09040 109156 109950 gene locus_tag LOCUS_09050 109156 109950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_09050 112144 109985 gene locus_tag LOCUS_09060 gene uvrD 112144 109985 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KET2 protein_id gnl|my_center|LOCUS_09060 112243 113043 gene locus_tag LOCUS_09070 112243 113043 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 protein_id gnl|my_center|LOCUS_09070 113224 113499 gene locus_tag LOCUS_09080 113224 113499 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_09080 115030 113801 gene locus_tag LOCUS_09090 115030 113801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 116071 115034 gene locus_tag LOCUS_09100 gene oppF 116071 115034 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523425.1 protein_id gnl|my_center|LOCUS_09100 116160 116945 gene locus_tag LOCUS_09110 116160 116945 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_09110 118676 117075 gene locus_tag LOCUS_09120 118676 117075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 120282 118837 gene locus_tag LOCUS_09130 gene cls 120282 118837 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_09130 121086 120292 gene locus_tag LOCUS_09140 gene oppD 121086 120292 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106016.1 protein_id gnl|my_center|LOCUS_09140 122004 121090 gene locus_tag LOCUS_09150 122004 121090 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 protein_id gnl|my_center|LOCUS_09150 122918 122001 gene locus_tag LOCUS_09160 gene oppB 122918 122001 CDS product oligopeptide transport system permease protein OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45054 protein_id gnl|my_center|LOCUS_09160 124549 122918 gene locus_tag LOCUS_09170 124549 122918 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 protein_id gnl|my_center|LOCUS_09170 126620 124671 gene locus_tag LOCUS_09180 gene mnmG 126620 124671 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FS8 protein_id gnl|my_center|LOCUS_09180 128146 126749 gene locus_tag LOCUS_09190 128146 126749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 128311 130014 gene locus_tag LOCUS_09200 128311 130014 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_09200 130586 130110 gene locus_tag LOCUS_09210 130586 130110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821345.1 protein_id gnl|my_center|LOCUS_09210 131519 131007 gene locus_tag LOCUS_09220 131519 131007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 132742 131516 gene locus_tag LOCUS_09230 132742 131516 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_09230 133564 132770 gene locus_tag LOCUS_09240 133564 132770 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_09240 133694 134401 gene locus_tag LOCUS_09250 gene colR 133694 134401 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_09250 134391 135680 gene locus_tag LOCUS_09260 gene colS 134391 135680 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038221.1 protein_id gnl|my_center|LOCUS_09260 135802 136881 gene locus_tag LOCUS_09270 135802 136881 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705827.1 protein_id gnl|my_center|LOCUS_09270 136895 137857 gene locus_tag LOCUS_09280 gene rapK 136895 137857 CDS product pteridine-dependent deoxygenase like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639353.2 protein_id gnl|my_center|LOCUS_09280 138384 137869 gene locus_tag LOCUS_09290 138384 137869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 138518 139633 gene locus_tag LOCUS_09300 138518 139633 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268229.1 protein_id gnl|my_center|LOCUS_09300 139902 139717 gene locus_tag LOCUS_09310 139902 139717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 139810 140766 gene locus_tag LOCUS_09320 gene corA 139810 140766 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L5P6 protein_id gnl|my_center|LOCUS_09320 141745 140999 gene locus_tag LOCUS_09330 141745 140999 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943328.1 protein_id gnl|my_center|LOCUS_09330 143082 141742 gene locus_tag LOCUS_09340 143082 141742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940415.1 protein_id gnl|my_center|LOCUS_09340 143214 144230 gene locus_tag LOCUS_09350 143214 144230 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence06 323 1264 gene locus_tag LOCUS_09360 323 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1267 2496 gene locus_tag LOCUS_09370 1267 2496 CDS product KlaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_09370 3013 2567 gene locus_tag LOCUS_09380 3013 2567 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL22 protein_id gnl|my_center|LOCUS_09380 3158 4534 gene locus_tag LOCUS_09390 3158 4534 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_09390 4696 4917 gene locus_tag LOCUS_09400 4696 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6780 4939 gene locus_tag LOCUS_09410 gene betA 6780 4939 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228610.1 protein_id gnl|my_center|LOCUS_09410 7036 7470 gene locus_tag LOCUS_09420 7036 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 9103 8114 gene locus_tag LOCUS_09430 9103 8114 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 protein_id gnl|my_center|LOCUS_09430 9303 10460 gene locus_tag LOCUS_09440 9303 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_09440 12074 10887 gene locus_tag LOCUS_09450 gene fdh 12074 10887 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_09450 12326 12556 gene locus_tag LOCUS_09460 12326 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 15013 13145 gene locus_tag LOCUS_09470 gene recD 15013 13145 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY6 protein_id gnl|my_center|LOCUS_09470 18756 15010 gene locus_tag LOCUS_09480 gene recB 18756 15010 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P379 protein_id gnl|my_center|LOCUS_09480 19896 18823 gene locus_tag LOCUS_09490 19896 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119943.1 protein_id gnl|my_center|LOCUS_09490 23388 19975 gene locus_tag LOCUS_09500 gene recC 23388 19975 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY8 protein_id gnl|my_center|LOCUS_09500 24237 23428 gene locus_tag LOCUS_09510 gene modE 24237 23428 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204316.1 protein_id gnl|my_center|LOCUS_09510 24313 24389 gene locus_tag LOCUS_t00130 24313 24389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25802 24915 gene locus_tag LOCUS_09520 25802 24915 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_09520 28231 25853 gene locus_tag LOCUS_09530 28231 25853 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266658.1 protein_id gnl|my_center|LOCUS_09530 28725 29300 gene locus_tag LOCUS_09540 28725 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 29679 29365 gene locus_tag LOCUS_09550 29679 29365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 30413 29676 gene locus_tag LOCUS_09560 30413 29676 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393477.1 protein_id gnl|my_center|LOCUS_09560 31213 30410 gene locus_tag LOCUS_09570 31213 30410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_09570 32322 31219 gene locus_tag LOCUS_09580 32322 31219 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_09580 32647 33570 gene locus_tag LOCUS_09590 gene rdgC 32647 33570 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX7 protein_id gnl|my_center|LOCUS_09590 33584 34153 gene locus_tag LOCUS_09600 33584 34153 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 protein_id gnl|my_center|LOCUS_09600 36607 34190 gene locus_tag LOCUS_09610 gene lon 36607 34190 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H21 protein_id gnl|my_center|LOCUS_09610 37026 36622 gene locus_tag LOCUS_09620 37026 36622 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809153.1 protein_id gnl|my_center|LOCUS_09620 37840 37121 gene locus_tag LOCUS_09630 37840 37121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_09630 38193 37843 gene locus_tag LOCUS_09640 38193 37843 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_09640 39369 38278 gene locus_tag LOCUS_09650 39369 38278 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_09650 39529 40791 gene locus_tag LOCUS_09660 39529 40791 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_09660 41347 40952 gene locus_tag LOCUS_09670 41347 40952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 42066 41446 gene locus_tag LOCUS_09680 42066 41446 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035721.1 protein_id gnl|my_center|LOCUS_09680 44075 42417 gene locus_tag LOCUS_09690 44075 42417 CDS product sodium/hydrogen exchanger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522967.1 protein_id gnl|my_center|LOCUS_09690 44473 45318 gene locus_tag LOCUS_09700 44473 45318 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082924.1 protein_id gnl|my_center|LOCUS_09700 46474 45353 gene locus_tag LOCUS_09710 46474 45353 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_09710 46570 47406 gene locus_tag LOCUS_09720 46570 47406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 48216 47380 gene locus_tag LOCUS_09730 48216 47380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 49277 48213 gene locus_tag LOCUS_09740 49277 48213 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_09740 49672 49274 gene locus_tag LOCUS_09750 gene ptpS 49672 49274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_09750 50661 49672 gene locus_tag LOCUS_09760 50661 49672 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_09760 50824 52062 gene locus_tag LOCUS_09770 50824 52062 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_09770 53524 52085 gene locus_tag LOCUS_09780 53524 52085 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_09780 54276 53521 gene locus_tag LOCUS_09790 54276 53521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 54779 54276 gene locus_tag LOCUS_09800 gene gspM 54779 54276 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Y6 protein_id gnl|my_center|LOCUS_09800 55984 54776 gene locus_tag LOCUS_09810 gene gspL 55984 54776 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_09810 57021 56074 gene locus_tag LOCUS_09820 gene xcpX 57021 56074 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_09820 57698 57018 gene locus_tag LOCUS_09830 gene xcpW 57698 57018 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_09830 58165 57695 gene locus_tag LOCUS_09840 58165 57695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 58731 58162 gene locus_tag LOCUS_09850 58731 58162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 59294 58824 gene locus_tag LOCUS_09860 gene gspG 59294 58824 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_09860 60558 59338 gene locus_tag LOCUS_09870 gene gspF 60558 59338 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_09870 62254 60683 gene locus_tag LOCUS_09880 gene xcpR 62254 60683 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_09880 64508 62274 gene locus_tag LOCUS_09890 gene xcpQ 64508 62274 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_09890 65449 64505 gene locus_tag LOCUS_09900 gene gspC 65449 64505 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 protein_id gnl|my_center|LOCUS_09900 65605 67437 gene locus_tag LOCUS_09910 gene gspA 65605 67437 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_09910 67441 68211 gene locus_tag LOCUS_09920 67441 68211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 68234 68803 gene locus_tag LOCUS_09930 68234 68803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 68983 70293 gene locus_tag LOCUS_09940 68983 70293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 71027 70359 gene locus_tag LOCUS_09950 71027 70359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 72694 71033 gene locus_tag LOCUS_09960 72694 71033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 73141 72788 gene locus_tag LOCUS_09970 73141 72788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 74021 73611 gene locus_tag LOCUS_09980 74021 73611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 74489 74731 gene locus_tag LOCUS_09990 74489 74731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 75948 75343 gene locus_tag LOCUS_10000 75948 75343 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531635.1 protein_id gnl|my_center|LOCUS_10000 76687 76860 gene locus_tag LOCUS_10010 76687 76860 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDI1 protein_id gnl|my_center|LOCUS_10010 77181 76903 gene locus_tag LOCUS_10020 77181 76903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 77578 77174 gene locus_tag LOCUS_10030 77578 77174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 78118 77606 gene locus_tag LOCUS_10040 78118 77606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 78833 78758 gene locus_tag LOCUS_t00140 78833 78758 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 79029 81047 gene locus_tag LOCUS_10050 gene uvrB 79029 81047 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZD9 protein_id gnl|my_center|LOCUS_10050 81111 81187 gene locus_tag LOCUS_t00150 81111 81187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 81357 83264 gene locus_tag LOCUS_10060 gene thrS 81357 83264 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q70 protein_id gnl|my_center|LOCUS_10060 83352 83909 gene locus_tag LOCUS_10070 gene infC 83352 83909 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_10070 83944 84141 gene locus_tag LOCUS_10080 gene rpmI 83944 84141 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D02 protein_id gnl|my_center|LOCUS_10080 84246 84602 gene locus_tag LOCUS_10090 gene rplT 84246 84602 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_10090 84744 85745 gene locus_tag LOCUS_10100 gene pheS 84744 85745 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 protein_id gnl|my_center|LOCUS_10100 85755 88142 gene locus_tag LOCUS_10110 gene pheT 85755 88142 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUP6 protein_id gnl|my_center|LOCUS_10110 88144 88443 gene locus_tag LOCUS_10120 gene ihfA 88144 88443 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF98 protein_id gnl|my_center|LOCUS_10120 88427 88792 gene locus_tag LOCUS_10130 88427 88792 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_10130 88835 88911 gene locus_tag LOCUS_t00160 88835 88911 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 89746 90354 gene locus_tag LOCUS_10140 gene ccmA 89746 90354 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ7 protein_id gnl|my_center|LOCUS_10140 90435 91025 gene locus_tag LOCUS_10150 gene ccmB 90435 91025 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z04 protein_id gnl|my_center|LOCUS_10150 91195 91959 gene locus_tag LOCUS_10160 gene ccmC 91195 91959 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765259.1 protein_id gnl|my_center|LOCUS_10160 91952 92116 gene locus_tag LOCUS_10170 91952 92116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 92109 92573 gene locus_tag LOCUS_10180 92109 92573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 92570 94552 gene locus_tag LOCUS_10190 gene ccmF 92570 94552 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420290.1 protein_id gnl|my_center|LOCUS_10190 94552 95091 gene locus_tag LOCUS_10200 gene ccmG 94552 95091 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_10200 95088 95582 gene locus_tag LOCUS_10210 gene ccmH 95088 95582 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45405 protein_id gnl|my_center|LOCUS_10210 95579 96403 gene locus_tag LOCUS_10220 95579 96403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 96400 97368 gene locus_tag LOCUS_10230 gene gluQ 96400 97368 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAI1 protein_id gnl|my_center|LOCUS_10230 97825 97316 gene locus_tag LOCUS_10240 97825 97316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 99168 98014 gene locus_tag LOCUS_10250 99168 98014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 99419 100465 gene locus_tag LOCUS_10260 gene prfB 99419 100465 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN98 protein_id gnl|my_center|LOCUS_10260 100468 101973 gene locus_tag LOCUS_10270 gene lysU 100468 101973 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MNA4 protein_id gnl|my_center|LOCUS_10270 102866 101994 gene locus_tag LOCUS_10280 102866 101994 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207694.1 protein_id gnl|my_center|LOCUS_10280 102983 103216 gene locus_tag LOCUS_10290 102983 103216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 103260 103646 gene locus_tag LOCUS_10300 gene sdhC 103260 103646 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_10300 103681 104067 gene locus_tag LOCUS_10310 gene sdhD 103681 104067 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_10310 104067 105857 gene locus_tag LOCUS_10320 104067 105857 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV40 protein_id gnl|my_center|LOCUS_10320 105921 106700 gene locus_tag LOCUS_10330 gene sdhB 105921 106700 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_10330 106866 107120 gene locus_tag LOCUS_10340 106866 107120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098615.1 protein_id gnl|my_center|LOCUS_10340 107130 107591 gene locus_tag LOCUS_10350 107130 107591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 107591 108955 gene locus_tag LOCUS_10360 107591 108955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 109192 109767 gene locus_tag LOCUS_10370 109192 109767 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_10370 109775 110536 gene locus_tag LOCUS_10380 109775 110536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 110533 111570 gene locus_tag LOCUS_10390 gene mucB 110533 111570 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813793.1 protein_id gnl|my_center|LOCUS_10390 111678 113210 gene locus_tag LOCUS_10400 111678 113210 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_10400 113316 115115 gene locus_tag LOCUS_10410 gene lepA 113316 115115 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E312 protein_id gnl|my_center|LOCUS_10410 115156 115920 gene locus_tag LOCUS_10420 gene lepB-1 115156 115920 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_10420 115920 116627 gene locus_tag LOCUS_10430 gene rnc 115920 116627 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB52 protein_id gnl|my_center|LOCUS_10430 116624 117529 gene locus_tag LOCUS_10440 gene era 116624 117529 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 protein_id gnl|my_center|LOCUS_10440 117585 118331 gene locus_tag LOCUS_10450 gene recO 117585 118331 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S98 protein_id gnl|my_center|LOCUS_10450 118328 119092 gene locus_tag LOCUS_10460 gene pdxJ 118328 119092 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V7M2 protein_id gnl|my_center|LOCUS_10460 119159 120058 gene locus_tag LOCUS_10470 119159 120058 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_10470 120055 120699 gene locus_tag LOCUS_10480 120055 120699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 120696 122030 gene locus_tag LOCUS_10490 gene rlmD 120696 122030 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_10490 122030 122515 gene locus_tag LOCUS_10500 122030 122515 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_10500 122512 123540 gene locus_tag LOCUS_10510 gene nagZ 122512 123540 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC2 protein_id gnl|my_center|LOCUS_10510 123537 124817 gene locus_tag LOCUS_10520 123537 124817 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_10520 124817 125407 gene locus_tag LOCUS_10530 124817 125407 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099341.1 protein_id gnl|my_center|LOCUS_10530 125410 126156 gene locus_tag LOCUS_10540 125410 126156 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_10540 129800 126315 gene locus_tag LOCUS_10550 gene mfd 129800 126315 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_10550 130736 129870 gene locus_tag LOCUS_10560 gene aguB 130736 129870 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_10560 131788 130751 gene locus_tag LOCUS_10570 131788 130751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037343.1 protein_id gnl|my_center|LOCUS_10570 131925 133175 gene locus_tag LOCUS_10580 131925 133175 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_10580 133168 133881 gene locus_tag LOCUS_10590 gene lolD 133168 133881 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V9 protein_id gnl|my_center|LOCUS_10590 <134872 133960 gene locus_tag LOCUS_10600 <134872 133960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037417.1:EF-P beta-lysylation protein EpmB >Feature sequence07 <1 615 gene locus_tag LOCUS_10610 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:pyridine nucleotide-disulfide oxidoreductase 648 887 gene locus_tag LOCUS_10620 648 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 884 1612 gene locus_tag LOCUS_10630 884 1612 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_10630 1911 1660 gene locus_tag LOCUS_10640 1911 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_10640 2821 2015 gene locus_tag LOCUS_10650 2821 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3278 2808 gene locus_tag LOCUS_10660 3278 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4885 3287 gene locus_tag LOCUS_10670 4885 3287 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_10670 5778 4963 gene locus_tag LOCUS_10680 gene mutM 5778 4963 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3C4 protein_id gnl|my_center|LOCUS_10680 6658 5783 gene locus_tag LOCUS_10690 6658 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8010 6655 gene locus_tag LOCUS_10700 8010 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 8777 8007 gene locus_tag LOCUS_10710 8777 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 9730 8774 gene locus_tag LOCUS_10720 9730 8774 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_10720 10032 9877 gene locus_tag LOCUS_10730 gene rpmG 10032 9877 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44369 protein_id gnl|my_center|LOCUS_10730 10268 10032 gene locus_tag LOCUS_10740 gene rpmB 10268 10032 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_10740 11133 10435 gene locus_tag LOCUS_10750 11133 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 11928 11254 gene locus_tag LOCUS_10760 11928 11254 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_10760 11992 13212 gene locus_tag LOCUS_10770 gene coaBC 11992 13212 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_10770 13241 13696 gene locus_tag LOCUS_10780 gene dut 13241 13696 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP5 protein_id gnl|my_center|LOCUS_10780 13699 14616 gene locus_tag LOCUS_10790 gene argB 13699 14616 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_10790 15285 14617 gene locus_tag LOCUS_10800 gene pyrE 15285 14617 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P469 protein_id gnl|my_center|LOCUS_10800 15370 16161 gene locus_tag LOCUS_10810 gene xth-1 15370 16161 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_10810 16148 17539 gene locus_tag LOCUS_10820 16148 17539 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_10820 17536 18903 gene locus_tag LOCUS_10830 17536 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 19820 19047 gene locus_tag LOCUS_10840 19820 19047 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10840 19984 23022 gene locus_tag LOCUS_10850 19984 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23019 23747 gene locus_tag LOCUS_10860 23019 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 23744 26392 gene locus_tag LOCUS_10870 23744 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_10870 26376 27011 gene locus_tag LOCUS_10880 26376 27011 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_10880 27013 28014 gene locus_tag LOCUS_10890 27013 28014 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_10890 28020 28532 gene locus_tag LOCUS_10900 28020 28532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 28547 29599 gene locus_tag LOCUS_10910 28547 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889406.1 protein_id gnl|my_center|LOCUS_10910 29678 30199 gene locus_tag LOCUS_10920 29678 30199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 30224 31216 gene locus_tag LOCUS_10930 30224 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_10930 31249 32007 gene locus_tag LOCUS_10940 31249 32007 CDS product ADP-glucose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_10940 32029 33663 gene locus_tag LOCUS_10950 gene pepM 32029 33663 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188554.1 protein_id gnl|my_center|LOCUS_10950 33660 34823 gene locus_tag LOCUS_10960 33660 34823 CDS product thiamine pyrophosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_10960 34820 35893 gene locus_tag LOCUS_10970 gene phnW 34820 35893 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MZ1 protein_id gnl|my_center|LOCUS_10970 36018 37166 gene locus_tag LOCUS_10980 36018 37166 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_10980 37251 38384 gene locus_tag LOCUS_10990 37251 38384 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144044.1 protein_id gnl|my_center|LOCUS_10990 38520 39269 gene locus_tag LOCUS_11000 38520 39269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_11000 40174 39572 gene locus_tag LOCUS_11010 gene idi 40174 39572 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1C1 protein_id gnl|my_center|LOCUS_11010 42456 40171 gene locus_tag LOCUS_11020 42456 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 43570 42548 gene locus_tag LOCUS_11030 43570 42548 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616885.1 protein_id gnl|my_center|LOCUS_11030 44535 43567 gene locus_tag LOCUS_11040 gene mvaD 44535 43567 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_11040 44694 46211 gene locus_tag LOCUS_11050 44694 46211 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_11050 47548 46502 gene locus_tag LOCUS_11060 47548 46502 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 protein_id gnl|my_center|LOCUS_11060 47732 48748 gene locus_tag LOCUS_11070 47732 48748 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_11070 50154 48868 gene locus_tag LOCUS_11080 50154 48868 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_11080 50750 50151 gene locus_tag LOCUS_11090 50750 50151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 51578 50877 gene locus_tag LOCUS_11100 gene trmB 51578 50877 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM56 protein_id gnl|my_center|LOCUS_11100 52600 51599 gene locus_tag LOCUS_11110 gene thiG 52600 51599 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_11110 52795 54813 gene locus_tag LOCUS_11120 52795 54813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 54800 55432 gene locus_tag LOCUS_11130 54800 55432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 55429 56499 gene locus_tag LOCUS_11140 gene mutY 55429 56499 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 protein_id gnl|my_center|LOCUS_11140 56496 56768 gene locus_tag LOCUS_11150 56496 56768 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F553 protein_id gnl|my_center|LOCUS_11150 56841 56916 gene locus_tag LOCUS_t00170 56841 56916 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 57052 57810 gene locus_tag LOCUS_11160 57052 57810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 58617 58066 gene locus_tag LOCUS_11170 58617 58066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 59474 58626 gene locus_tag LOCUS_11180 59474 58626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 59728 60981 gene locus_tag LOCUS_11190 gene proV 59728 60981 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_11190 60974 61918 gene locus_tag LOCUS_11200 60974 61918 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_11200 61970 62854 gene locus_tag LOCUS_11210 61970 62854 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_11210 62980 64173 gene locus_tag LOCUS_11220 62980 64173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_11220 65969 64170 gene locus_tag LOCUS_11230 gene atmA 65969 64170 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_11230 66562 66002 gene locus_tag LOCUS_11240 gene blc 66562 66002 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_11240 68076 66613 gene locus_tag LOCUS_11250 gene agcS-2 68076 66613 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_11250 70453 68324 gene locus_tag LOCUS_11260 70453 68324 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_11260 70803 71978 gene locus_tag LOCUS_11270 70803 71978 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_11270 72009 72206 gene locus_tag LOCUS_11280 72009 72206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 72256 73587 gene locus_tag LOCUS_11290 gene MltB 72256 73587 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_11290 75048 74065 gene locus_tag LOCUS_11300 75048 74065 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_11300 75127 75747 gene locus_tag LOCUS_11310 75127 75747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 protein_id gnl|my_center|LOCUS_11310 76607 75771 gene locus_tag LOCUS_11320 gene nei 76607 75771 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPW6 protein_id gnl|my_center|LOCUS_11320 77850 76648 gene locus_tag LOCUS_11330 77850 76648 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703819.1 protein_id gnl|my_center|LOCUS_11330 77960 78586 gene locus_tag LOCUS_11340 77960 78586 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_11340 80594 78699 gene locus_tag LOCUS_11350 gene uup 80594 78699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_11350 80693 82054 gene locus_tag LOCUS_11360 gene rmuC 80693 82054 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U3 protein_id gnl|my_center|LOCUS_11360 82051 83154 gene locus_tag LOCUS_11370 82051 83154 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_11370 83177 84277 gene locus_tag LOCUS_11380 83177 84277 CDS product putative permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YET7 protein_id gnl|my_center|LOCUS_11380 85463 84285 gene locus_tag LOCUS_11390 85463 84285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225999.1 protein_id gnl|my_center|LOCUS_11390 85987 85460 gene locus_tag LOCUS_11400 85987 85460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 86161 87846 gene locus_tag LOCUS_11410 gene cstA 86161 87846 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_11410 87848 88294 gene locus_tag LOCUS_11420 87848 88294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 88294 88569 gene locus_tag LOCUS_11430 88294 88569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 88614 89528 gene locus_tag LOCUS_11440 88614 89528 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_11440 90954 89968 gene locus_tag LOCUS_11450 90954 89968 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266314.1 protein_id gnl|my_center|LOCUS_11450 91069 91605 gene locus_tag LOCUS_11460 91069 91605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 91694 91619 gene locus_tag LOCUS_t00180 91694 91619 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 91795 92691 gene locus_tag LOCUS_11470 91795 92691 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 protein_id gnl|my_center|LOCUS_11470 92697 94121 gene locus_tag LOCUS_11480 92697 94121 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_11480 95887 94430 gene locus_tag LOCUS_11490 gene nuoN 95887 94430 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_11490 97446 95911 gene locus_tag LOCUS_11500 97446 95911 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554022.1 protein_id gnl|my_center|LOCUS_11500 99312 97459 gene locus_tag LOCUS_11510 99312 97459 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056574.1 protein_id gnl|my_center|LOCUS_11510 99617 99309 gene locus_tag LOCUS_11520 gene nuoK 99617 99309 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J2 protein_id gnl|my_center|LOCUS_11520 100174 99614 gene locus_tag LOCUS_11530 100174 99614 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500212.1 protein_id gnl|my_center|LOCUS_11530 100733 100185 gene locus_tag LOCUS_11540 gene nuoI 100733 100185 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XWV5 protein_id gnl|my_center|LOCUS_11540 101774 100797 gene locus_tag LOCUS_11550 gene nuoH 101774 100797 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ61 protein_id gnl|my_center|LOCUS_11550 104458 101771 gene locus_tag LOCUS_11560 gene nuoG 104458 101771 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1Y5 protein_id gnl|my_center|LOCUS_11560 105796 104477 gene locus_tag LOCUS_11570 105796 104477 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365587.1 protein_id gnl|my_center|LOCUS_11570 106266 105796 gene locus_tag LOCUS_11580 106266 105796 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 protein_id gnl|my_center|LOCUS_11580 108011 106263 gene locus_tag LOCUS_11590 gene nuoC 108011 106263 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ7 protein_id gnl|my_center|LOCUS_11590 108669 108016 gene locus_tag LOCUS_11600 gene nuoB 108669 108016 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ2 protein_id gnl|my_center|LOCUS_11600 109151 108699 gene locus_tag LOCUS_11610 gene nuoA 109151 108699 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ9 protein_id gnl|my_center|LOCUS_11610 109441 111372 gene locus_tag LOCUS_11620 109441 111372 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404227.1 protein_id gnl|my_center|LOCUS_11620 111502 112113 gene locus_tag LOCUS_11630 gene pmtA 111502 112113 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947869.1 protein_id gnl|my_center|LOCUS_11630 112554 112186 gene locus_tag LOCUS_11640 112554 112186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 113462 112590 gene locus_tag LOCUS_11650 113462 112590 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_11650 113551 113868 gene locus_tag LOCUS_11660 113551 113868 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_11660 114881 114000 gene locus_tag LOCUS_11670 114881 114000 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 protein_id gnl|my_center|LOCUS_11670 114961 115851 gene locus_tag LOCUS_11680 114961 115851 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_11680 116345 115848 gene locus_tag LOCUS_11690 116345 115848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404496.1 protein_id gnl|my_center|LOCUS_11690 116516 117472 gene locus_tag LOCUS_11700 116516 117472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_11700 118057 117548 gene locus_tag LOCUS_11710 gene msrA1 118057 117548 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W179 protein_id gnl|my_center|LOCUS_11710 118500 118054 gene locus_tag LOCUS_11720 gene msrB1 118500 118054 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W178 protein_id gnl|my_center|LOCUS_11720 118743 119057 gene locus_tag LOCUS_11730 118743 119057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 120547 119129 gene locus_tag LOCUS_11740 120547 119129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 120885 121748 gene locus_tag LOCUS_11750 120885 121748 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_11750 121795 122775 gene locus_tag LOCUS_11760 gene gnd 121795 122775 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 protein_id gnl|my_center|LOCUS_11760 123248 122793 gene locus_tag LOCUS_11770 123248 122793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 125252 123339 gene locus_tag LOCUS_11780 125252 123339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 126114 125461 gene locus_tag LOCUS_11790 126114 125461 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GU2 protein_id gnl|my_center|LOCUS_11790 127824 126385 gene locus_tag LOCUS_11800 127824 126385 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705774.1 protein_id gnl|my_center|LOCUS_11800 129713 127821 gene locus_tag LOCUS_11810 129713 127821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703646.1 protein_id gnl|my_center|LOCUS_11810 131197 129791 gene locus_tag LOCUS_11820 gene rhlE-2 131197 129791 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGU5 protein_id gnl|my_center|LOCUS_11820 131379 131894 gene locus_tag LOCUS_11830 131379 131894 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_11830 132053 133651 gene locus_tag LOCUS_11840 132053 133651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence08 497 1951 gene locus_tag LOCUS_11850 497 1951 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902277.1 protein_id gnl|my_center|LOCUS_11850 2493 2296 gene locus_tag LOCUS_11860 2493 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2658 4070 gene locus_tag LOCUS_11870 2658 4070 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_11870 4175 4975 gene locus_tag LOCUS_11880 4175 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_11880 6619 4985 gene locus_tag LOCUS_11890 6619 4985 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552083.1 protein_id gnl|my_center|LOCUS_11890 7043 6792 gene locus_tag LOCUS_11900 7043 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_11900 7183 8955 gene locus_tag LOCUS_11910 gene phoD 7183 8955 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_11910 9180 10034 gene locus_tag LOCUS_11920 gene lip1 9180 10034 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_11920 10886 10161 gene locus_tag LOCUS_11930 10886 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 protein_id gnl|my_center|LOCUS_11930 13166 11028 gene locus_tag LOCUS_11940 gene ptrB 13166 11028 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707320.1 protein_id gnl|my_center|LOCUS_11940 14577 13228 gene locus_tag LOCUS_11950 14577 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_11950 14633 15163 gene locus_tag LOCUS_11960 14633 15163 CDS product Appr-1-p processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403323.1 protein_id gnl|my_center|LOCUS_11960 15182 15748 gene locus_tag LOCUS_11970 15182 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037183.1 protein_id gnl|my_center|LOCUS_11970 15806 17728 gene locus_tag LOCUS_11980 15806 17728 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_11980 18236 17709 gene locus_tag LOCUS_11990 18236 17709 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_11990 18618 18220 gene locus_tag LOCUS_12000 18618 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 18680 19642 gene locus_tag LOCUS_12010 18680 19642 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_12010 20757 19630 gene locus_tag LOCUS_12020 20757 19630 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123502.1 protein_id gnl|my_center|LOCUS_12020 21509 20754 gene locus_tag LOCUS_12030 21509 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 23059 21539 gene locus_tag LOCUS_12040 23059 21539 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_12040 24645 23056 gene locus_tag LOCUS_12050 gene crtI 24645 23056 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_12050 24816 26267 gene locus_tag LOCUS_12060 24816 26267 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123505.1 protein_id gnl|my_center|LOCUS_12060 26693 26268 gene locus_tag LOCUS_12070 26693 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 28141 26690 gene locus_tag LOCUS_12080 gene yhcA 28141 26690 CDS product putative MFS-type transporter YhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54585 protein_id gnl|my_center|LOCUS_12080 29286 28195 gene locus_tag LOCUS_12090 29286 28195 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_12090 29524 31017 gene locus_tag LOCUS_12100 29524 31017 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932241.1 protein_id gnl|my_center|LOCUS_12100 31812 31054 gene locus_tag LOCUS_12110 31812 31054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 protein_id gnl|my_center|LOCUS_12110 32190 31897 gene locus_tag LOCUS_12120 32190 31897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 protein_id gnl|my_center|LOCUS_12120 33536 32217 gene locus_tag LOCUS_12130 33536 32217 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545031.1 protein_id gnl|my_center|LOCUS_12130 35143 33548 gene locus_tag LOCUS_12140 35143 33548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110405.1 protein_id gnl|my_center|LOCUS_12140 35749 35264 gene locus_tag LOCUS_12150 35749 35264 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_12150 35910 37604 gene locus_tag LOCUS_12160 gene leuA-2 35910 37604 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_12160 38927 37776 gene locus_tag LOCUS_12170 gene thrC 38927 37776 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226442.1 protein_id gnl|my_center|LOCUS_12170 40153 39002 gene locus_tag LOCUS_12180 40153 39002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408090.1 protein_id gnl|my_center|LOCUS_12180 40284 41096 gene locus_tag LOCUS_12190 40284 41096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_12190 41147 42181 gene locus_tag LOCUS_12200 41147 42181 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 protein_id gnl|my_center|LOCUS_12200 42881 42210 gene locus_tag LOCUS_12210 42881 42210 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_12210 44225 42963 gene locus_tag LOCUS_12220 44225 42963 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_12220 45072 44386 gene locus_tag LOCUS_12230 45072 44386 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707482.1 protein_id gnl|my_center|LOCUS_12230 45836 45147 gene locus_tag LOCUS_12240 45836 45147 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_12240 46889 46008 gene locus_tag LOCUS_12250 46889 46008 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035563.1 protein_id gnl|my_center|LOCUS_12250 48057 47203 gene locus_tag LOCUS_12260 48057 47203 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387789.1 protein_id gnl|my_center|LOCUS_12260 48222 48686 gene locus_tag LOCUS_12270 48222 48686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 48679 50244 gene locus_tag LOCUS_12280 48679 50244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 protein_id gnl|my_center|LOCUS_12280 50247 51389 gene locus_tag LOCUS_12290 50247 51389 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 protein_id gnl|my_center|LOCUS_12290 52141 51386 gene locus_tag LOCUS_12300 52141 51386 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_12300 52546 52196 gene locus_tag LOCUS_12310 gene csaA 52546 52196 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114937.1 protein_id gnl|my_center|LOCUS_12310 53432 52539 gene locus_tag LOCUS_12320 53432 52539 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P426 protein_id gnl|my_center|LOCUS_12320 53721 54545 gene locus_tag LOCUS_12330 53721 54545 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_12330 54548 55153 gene locus_tag LOCUS_12340 54548 55153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 55150 55722 gene locus_tag LOCUS_12350 55150 55722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 55902 57641 gene locus_tag LOCUS_12360 gene glpA 55902 57641 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_12360 61006 57941 gene locus_tag LOCUS_12370 gene hsdR2 61006 57941 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_12370 61836 61123 gene locus_tag LOCUS_12380 61836 61123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 63132 61846 gene locus_tag LOCUS_12390 gene hsdS 63132 61846 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538174.1 protein_id gnl|my_center|LOCUS_12390 65336 63129 gene locus_tag LOCUS_12400 65336 63129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 66500 66021 gene locus_tag LOCUS_12410 66500 66021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 67633 66560 gene locus_tag LOCUS_12420 67633 66560 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4R5 protein_id gnl|my_center|LOCUS_12420 67758 68957 gene locus_tag LOCUS_12430 67758 68957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600230.1 protein_id gnl|my_center|LOCUS_12430 69289 69023 gene locus_tag LOCUS_12440 69289 69023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 71238 69505 gene locus_tag LOCUS_12450 71238 69505 CDS product acetyl-/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_12450 72872 71235 gene locus_tag LOCUS_12460 72872 71235 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 protein_id gnl|my_center|LOCUS_12460 73627 72869 gene locus_tag LOCUS_12470 73627 72869 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R539 protein_id gnl|my_center|LOCUS_12470 74316 74104 gene locus_tag LOCUS_12480 74316 74104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 75251 74628 gene locus_tag LOCUS_12490 75251 74628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 76735 75251 gene locus_tag LOCUS_12500 76735 75251 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_12500 77475 76732 gene locus_tag LOCUS_12510 77475 76732 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_12510 80386 77597 gene locus_tag LOCUS_12520 80386 77597 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_12520 81211 80441 gene locus_tag LOCUS_12530 gene dsbG 81211 80441 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_12530 81352 81831 gene locus_tag LOCUS_12540 81352 81831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 82785 81832 gene locus_tag LOCUS_12550 82785 81832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 83789 82782 gene locus_tag LOCUS_12560 83789 82782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 84543 83794 gene locus_tag LOCUS_12570 84543 83794 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_12570 85345 84599 gene locus_tag LOCUS_12580 85345 84599 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFT2 protein_id gnl|my_center|LOCUS_12580 85437 86705 gene locus_tag LOCUS_12590 85437 86705 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_12590 86968 88434 gene locus_tag LOCUS_12600 86968 88434 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887198.1 protein_id gnl|my_center|LOCUS_12600 89437 88769 gene locus_tag LOCUS_12610 89437 88769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 89569 90975 gene locus_tag LOCUS_12620 89569 90975 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_12620 90972 91562 gene locus_tag LOCUS_12630 90972 91562 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_12630 91712 93112 gene locus_tag LOCUS_12640 91712 93112 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_12640 93120 93725 gene locus_tag LOCUS_12650 gene polC 93120 93725 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384535.1 protein_id gnl|my_center|LOCUS_12650 93775 94731 gene locus_tag LOCUS_12660 93775 94731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038755.1 protein_id gnl|my_center|LOCUS_12660 95668 94748 gene locus_tag LOCUS_12670 95668 94748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 96011 97534 gene locus_tag LOCUS_12680 96011 97534 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088125.1 protein_id gnl|my_center|LOCUS_12680 99626 98055 gene locus_tag LOCUS_12690 99626 98055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 100294 99692 gene locus_tag LOCUS_12700 100294 99692 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP1 protein_id gnl|my_center|LOCUS_12700 100514 101023 gene locus_tag LOCUS_12710 100514 101023 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_12710 101941 101039 gene locus_tag LOCUS_12720 101941 101039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 protein_id gnl|my_center|LOCUS_12720 102516 103112 gene locus_tag LOCUS_12730 gene pilin 102516 103112 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 protein_id gnl|my_center|LOCUS_12730 103109 103921 gene locus_tag LOCUS_12740 103109 103921 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465930.1 protein_id gnl|my_center|LOCUS_12740 104021 106528 gene locus_tag LOCUS_12750 gene mrkC 104021 106528 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_12750 106525 107553 gene locus_tag LOCUS_12760 gene mrkD 106525 107553 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206738.1 protein_id gnl|my_center|LOCUS_12760 107577 107966 gene locus_tag LOCUS_12770 107577 107966 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_12770 109223 107994 gene locus_tag LOCUS_12780 109223 107994 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267915.1 protein_id gnl|my_center|LOCUS_12780 109357 109584 gene locus_tag LOCUS_12790 109357 109584 CDS product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 protein_id gnl|my_center|LOCUS_12790 111074 109581 gene locus_tag LOCUS_12800 gene pepD 111074 109581 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208707.1 protein_id gnl|my_center|LOCUS_12800 112041 111139 gene locus_tag LOCUS_12810 112041 111139 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523143.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence09 2066 345 gene locus_tag LOCUS_12820 gene cydC 2066 345 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_12820 3763 2063 gene locus_tag LOCUS_12830 gene cydD 3763 2063 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_12830 4054 3869 gene locus_tag LOCUS_12840 4054 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5145 4105 gene locus_tag LOCUS_12850 gene cydB 5145 4105 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141196.1 protein_id gnl|my_center|LOCUS_12850 6594 5158 gene locus_tag LOCUS_12860 gene cydA 6594 5158 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141197.1 protein_id gnl|my_center|LOCUS_12860 7568 6699 gene locus_tag LOCUS_12870 7568 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8625 7825 gene locus_tag LOCUS_12880 8625 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10003 8753 gene locus_tag LOCUS_12890 10003 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10510 10947 gene locus_tag LOCUS_12900 10510 10947 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 protein_id gnl|my_center|LOCUS_12900 10944 11363 gene locus_tag LOCUS_12910 10944 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_12910 11653 11354 gene locus_tag LOCUS_12920 11653 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 12996 11758 gene locus_tag LOCUS_12930 12996 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13389 13907 gene locus_tag LOCUS_12940 13389 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13904 14737 gene locus_tag LOCUS_12950 gene dsbG 13904 14737 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_12950 15269 15193 gene locus_tag LOCUS_t00190 15269 15193 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15381 15289 gene locus_tag LOCUS_t00200 15381 15289 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16919 15648 gene locus_tag LOCUS_12960 16919 15648 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_12960 19603 16988 gene locus_tag LOCUS_12970 gene alaS 19603 16988 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS1 protein_id gnl|my_center|LOCUS_12970 19966 19667 gene locus_tag LOCUS_12980 19966 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117857.1 protein_id gnl|my_center|LOCUS_12980 20486 20028 gene locus_tag LOCUS_12990 gene recX 20486 20028 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_12990 22097 20997 gene locus_tag LOCUS_13000 gene recA 22097 20997 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_13000 22700 22191 gene locus_tag LOCUS_13010 22700 22191 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M829 protein_id gnl|my_center|LOCUS_13010 23221 22703 gene locus_tag LOCUS_13020 23221 22703 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_13020 23335 25851 gene locus_tag LOCUS_13030 gene mutS 23335 25851 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBB5 protein_id gnl|my_center|LOCUS_13030 27015 26047 gene locus_tag LOCUS_13040 27015 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368513.1 protein_id gnl|my_center|LOCUS_13040 28057 27104 gene locus_tag LOCUS_13050 28057 27104 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268081.1 protein_id gnl|my_center|LOCUS_13050 28641 28054 gene locus_tag LOCUS_13060 28641 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 28847 28638 gene locus_tag LOCUS_13070 28847 28638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 29360 29124 gene locus_tag LOCUS_13080 29360 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 29259 30485 gene locus_tag LOCUS_13090 29259 30485 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_13090 30482 34000 gene locus_tag LOCUS_13100 30482 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_13100 33990 34967 gene locus_tag LOCUS_13110 33990 34967 CDS product murein tetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ1 protein_id gnl|my_center|LOCUS_13110 35134 34943 gene locus_tag LOCUS_13120 35134 34943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 35560 36255 gene locus_tag LOCUS_13130 35560 36255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 36688 36278 gene locus_tag LOCUS_13140 gene panD 36688 36278 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58286 protein_id gnl|my_center|LOCUS_13140 37630 36899 gene locus_tag LOCUS_13150 37630 36899 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084048.1 protein_id gnl|my_center|LOCUS_13150 38770 37895 gene locus_tag LOCUS_13160 38770 37895 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_13160 40260 38773 gene locus_tag LOCUS_13170 40260 38773 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_13170 40886 40620 gene locus_tag LOCUS_13180 40886 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_13180 40998 42221 gene locus_tag LOCUS_13190 40998 42221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123657.1 protein_id gnl|my_center|LOCUS_13190 42225 43043 gene locus_tag LOCUS_13200 42225 43043 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123656.1 protein_id gnl|my_center|LOCUS_13200 43069 44307 gene locus_tag LOCUS_13210 43069 44307 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403215.1 protein_id gnl|my_center|LOCUS_13210 44352 45389 gene locus_tag LOCUS_13220 44352 45389 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 protein_id gnl|my_center|LOCUS_13220 45512 45787 gene locus_tag LOCUS_13230 45512 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 47387 45885 gene locus_tag LOCUS_13240 47387 45885 CDS product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 protein_id gnl|my_center|LOCUS_13240 47625 47380 gene locus_tag LOCUS_13250 47625 47380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 47845 48738 gene locus_tag LOCUS_13260 47845 48738 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811152.1 protein_id gnl|my_center|LOCUS_13260 48992 50224 gene locus_tag LOCUS_13270 48992 50224 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 protein_id gnl|my_center|LOCUS_13270 50221 51144 gene locus_tag LOCUS_13280 50221 51144 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_13280 51282 52106 gene locus_tag LOCUS_13290 gene murI 51282 52106 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22634 protein_id gnl|my_center|LOCUS_13290 53010 52123 gene locus_tag LOCUS_13300 gene pdxY 53010 52123 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYX0 protein_id gnl|my_center|LOCUS_13300 54254 53076 gene locus_tag LOCUS_13310 54254 53076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087637.1 protein_id gnl|my_center|LOCUS_13310 54442 55764 gene locus_tag LOCUS_13320 54442 55764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229352.1 protein_id gnl|my_center|LOCUS_13320 56179 58425 gene locus_tag LOCUS_13330 gene icd 56179 58425 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_13330 58609 59292 gene locus_tag LOCUS_13340 58609 59292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 59382 59813 gene locus_tag LOCUS_13350 59382 59813 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_13350 60768 59896 gene locus_tag LOCUS_13360 gene htpX 60768 59896 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EV3 protein_id gnl|my_center|LOCUS_13360 61023 62075 gene locus_tag LOCUS_13370 61023 62075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_13370 62149 62715 gene locus_tag LOCUS_13380 62149 62715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268590.1 protein_id gnl|my_center|LOCUS_13380 64560 62758 gene locus_tag LOCUS_13390 gene ggt 64560 62758 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089891.1 protein_id gnl|my_center|LOCUS_13390 65632 64646 gene locus_tag LOCUS_13400 65632 64646 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704493.1 protein_id gnl|my_center|LOCUS_13400 66641 65694 gene locus_tag LOCUS_13410 66641 65694 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_13410 67637 66732 gene locus_tag LOCUS_13420 67637 66732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_13420 68579 67707 gene locus_tag LOCUS_13430 68579 67707 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289749.1 protein_id gnl|my_center|LOCUS_13430 69859 68612 gene locus_tag LOCUS_13440 69859 68612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337440.1 protein_id gnl|my_center|LOCUS_13440 70992 69937 gene locus_tag LOCUS_13450 70992 69937 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_13450 71914 71105 gene locus_tag LOCUS_13460 71914 71105 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_13460 72968 72051 gene locus_tag LOCUS_13470 72968 72051 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_13470 73121 74263 gene locus_tag LOCUS_13480 73121 74263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 75468 74230 gene locus_tag LOCUS_13490 75468 74230 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_13490 76454 75519 gene locus_tag LOCUS_13500 76454 75519 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSA1 protein_id gnl|my_center|LOCUS_13500 77143 76451 gene locus_tag LOCUS_13510 gene mdcG 77143 76451 CDS product phosphoribosyl-dephospho-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6S5 protein_id gnl|my_center|LOCUS_13510 77953 77144 gene locus_tag LOCUS_13520 gene mdcE 77953 77144 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112668.1 protein_id gnl|my_center|LOCUS_13520 78807 77950 gene locus_tag LOCUS_13530 78807 77950 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266408.1 protein_id gnl|my_center|LOCUS_13530 79111 78800 gene locus_tag LOCUS_13540 gene mdcC 79111 78800 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V56 protein_id gnl|my_center|LOCUS_13540 79976 79092 gene locus_tag LOCUS_13550 gene mdcB 79976 79092 CDS product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6S9 protein_id gnl|my_center|LOCUS_13550 81634 79976 gene locus_tag LOCUS_13560 81634 79976 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 protein_id gnl|my_center|LOCUS_13560 81740 82708 gene locus_tag LOCUS_13570 81740 82708 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402946.1 protein_id gnl|my_center|LOCUS_13570 83480 82713 gene locus_tag LOCUS_13580 83480 82713 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402947.1 protein_id gnl|my_center|LOCUS_13580 83886 83473 gene locus_tag LOCUS_13590 83886 83473 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_13590 84181 85176 gene locus_tag LOCUS_13600 gene glk 84181 85176 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64254 protein_id gnl|my_center|LOCUS_13600 85427 86719 gene locus_tag LOCUS_13610 85427 86719 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387853.1 protein_id gnl|my_center|LOCUS_13610 86851 87774 gene locus_tag LOCUS_13620 86851 87774 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_13620 87758 88642 gene locus_tag LOCUS_13630 87758 88642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 protein_id gnl|my_center|LOCUS_13630 88721 89821 gene locus_tag LOCUS_13640 88721 89821 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527557.1 protein_id gnl|my_center|LOCUS_13640 90469 89837 gene locus_tag LOCUS_13650 gene eda 90469 89837 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224222.1 protein_id gnl|my_center|LOCUS_13650 92357 90528 gene locus_tag LOCUS_13660 gene edd 92357 90528 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726837.1 protein_id gnl|my_center|LOCUS_13660 93055 92372 gene locus_tag LOCUS_13670 gene pgl 93055 92372 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2N2 protein_id gnl|my_center|LOCUS_13670 94581 93103 gene locus_tag LOCUS_13680 gene zwf 94581 93103 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_13680 96247 94697 gene locus_tag LOCUS_13690 96247 94697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 97278 96607 gene locus_tag LOCUS_13700 gene fucA 97278 96607 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337432.1 protein_id gnl|my_center|LOCUS_13700 98252 97275 gene locus_tag LOCUS_13710 98252 97275 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067250.1 protein_id gnl|my_center|LOCUS_13710 98475 98400 gene locus_tag LOCUS_t00210 98475 98400 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 98578 99252 gene locus_tag LOCUS_13720 98578 99252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 protein_id gnl|my_center|LOCUS_13720 100006 99260 gene locus_tag LOCUS_13730 100006 99260 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_13730 100227 101921 gene locus_tag LOCUS_13740 100227 101921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13740 101934 102812 gene locus_tag LOCUS_13750 101934 102812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13750 103973 102894 gene locus_tag LOCUS_13760 103973 102894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 104623 104114 gene locus_tag LOCUS_13770 104623 104114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence10 2 1138 gene locus_tag LOCUS_13780 2 1138 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B646 protein_id gnl|my_center|LOCUS_13780 1231 2571 gene locus_tag LOCUS_13790 1231 2571 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_13790 2630 3967 gene locus_tag LOCUS_13800 2630 3967 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_13800 4196 5197 gene locus_tag LOCUS_13810 gene hemH1 4196 5197 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_13810 5197 6234 gene locus_tag LOCUS_13820 gene sohB 5197 6234 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_13820 6525 7937 gene locus_tag LOCUS_13830 6525 7937 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 protein_id gnl|my_center|LOCUS_13830 7990 8316 gene locus_tag LOCUS_13840 7990 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 8313 8651 gene locus_tag LOCUS_13850 gene zapA 8313 8651 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_13850 8929 9510 gene locus_tag LOCUS_13860 8929 9510 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_13860 9836 10309 gene locus_tag LOCUS_13870 9836 10309 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_13870 11396 10278 gene locus_tag LOCUS_13880 gene opsX 11396 10278 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_13880 12347 11400 gene locus_tag LOCUS_13890 12347 11400 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_13890 13332 12385 gene locus_tag LOCUS_13900 13332 12385 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_13900 14991 13402 gene locus_tag LOCUS_13910 gene ilvA1 14991 13402 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_13910 15133 15996 gene locus_tag LOCUS_13920 gene proC 15133 15996 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_13920 15993 16556 gene locus_tag LOCUS_13930 15993 16556 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958645.1 protein_id gnl|my_center|LOCUS_13930 16559 17707 gene locus_tag LOCUS_13940 gene metX 16559 17707 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 protein_id gnl|my_center|LOCUS_13940 17704 18333 gene locus_tag LOCUS_13950 17704 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_13950 18858 18406 gene locus_tag LOCUS_13960 18858 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_13960 19547 18888 gene locus_tag LOCUS_13970 19547 18888 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_13970 21495 19549 gene locus_tag LOCUS_13980 21495 19549 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_13980 22229 21546 gene locus_tag LOCUS_13990 22229 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 protein_id gnl|my_center|LOCUS_13990 22393 23178 gene locus_tag LOCUS_14000 gene mttC 22393 23178 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_14000 23278 23541 gene locus_tag LOCUS_14010 23278 23541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 23554 24045 gene locus_tag LOCUS_14020 23554 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 24298 25536 gene locus_tag LOCUS_14030 24298 25536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339152.1 protein_id gnl|my_center|LOCUS_14030 27370 25661 gene locus_tag LOCUS_14040 gene ilvD 27370 25661 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF68 protein_id gnl|my_center|LOCUS_14040 28332 27700 gene locus_tag LOCUS_14050 28332 27700 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_14050 28534 30387 gene locus_tag LOCUS_14060 gene dsbD 28534 30387 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946423.1 protein_id gnl|my_center|LOCUS_14060 30751 31224 gene locus_tag LOCUS_14070 30751 31224 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 protein_id gnl|my_center|LOCUS_14070 31224 32576 gene locus_tag LOCUS_14080 gene accC 31224 32576 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421282.1 protein_id gnl|my_center|LOCUS_14080 32584 33465 gene locus_tag LOCUS_14090 gene prmA 32584 33465 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNJ1 protein_id gnl|my_center|LOCUS_14090 33553 33813 gene locus_tag LOCUS_14100 gene fis 33553 33813 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XX11 protein_id gnl|my_center|LOCUS_14100 33882 35471 gene locus_tag LOCUS_14110 gene purH 33882 35471 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIJ7 protein_id gnl|my_center|LOCUS_14110 35647 38166 gene locus_tag LOCUS_14120 35647 38166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 38163 39197 gene locus_tag LOCUS_14130 38163 39197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 39618 39205 gene locus_tag LOCUS_14140 39618 39205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_14140 41090 39633 gene locus_tag LOCUS_14150 gene gatB 41090 39633 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 protein_id gnl|my_center|LOCUS_14150 42545 41100 gene locus_tag LOCUS_14160 gene gatA 42545 41100 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_14160 42922 42542 gene locus_tag LOCUS_14170 gene gatC 42922 42542 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS8 protein_id gnl|my_center|LOCUS_14170 43156 44196 gene locus_tag LOCUS_14180 gene mreB 43156 44196 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9X7 protein_id gnl|my_center|LOCUS_14180 44317 45234 gene locus_tag LOCUS_14190 gene mreC 44317 45234 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_14190 45231 45725 gene locus_tag LOCUS_14200 gene mreD 45231 45725 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BN4 protein_id gnl|my_center|LOCUS_14200 45805 47727 gene locus_tag LOCUS_14210 gene pbpA 45805 47727 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_14210 47724 48845 gene locus_tag LOCUS_14220 47724 48845 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268987.1 protein_id gnl|my_center|LOCUS_14220 48842 49852 gene locus_tag LOCUS_14230 gene mltB-2 48842 49852 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707030.1 protein_id gnl|my_center|LOCUS_14230 49854 50732 gene locus_tag LOCUS_14240 49854 50732 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_14240 50847 51992 gene locus_tag LOCUS_14250 gene dacC 50847 51992 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_14250 52039 52308 gene locus_tag LOCUS_14260 52039 52308 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHQ3 protein_id gnl|my_center|LOCUS_14260 52305 52970 gene locus_tag LOCUS_14270 gene lipB 52305 52970 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_14270 52998 53825 gene locus_tag LOCUS_14280 gene mlaF 52998 53825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_14280 53822 54604 gene locus_tag LOCUS_14290 53822 54604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 protein_id gnl|my_center|LOCUS_14290 54705 54487 gene locus_tag LOCUS_14300 54705 54487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 54708 55247 gene locus_tag LOCUS_14310 54708 55247 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_14310 55340 55951 gene locus_tag LOCUS_14320 55340 55951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040736.1 protein_id gnl|my_center|LOCUS_14320 55954 56265 gene locus_tag LOCUS_14330 55954 56265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 58574 56583 gene locus_tag LOCUS_14340 58574 56583 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_14340 62556 58678 gene locus_tag LOCUS_14350 gene purL 62556 58678 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RW0 protein_id gnl|my_center|LOCUS_14350 63338 62553 gene locus_tag LOCUS_14360 63338 62553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_14360 63760 63344 gene locus_tag LOCUS_14370 63760 63344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 63823 63733 gene locus_tag LOCUS_t00220 63823 63733 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 63953 65416 gene locus_tag LOCUS_14380 gene mltF 63953 65416 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ50 protein_id gnl|my_center|LOCUS_14380 66140 65511 gene locus_tag LOCUS_14390 gene cysH 66140 65511 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E839 protein_id gnl|my_center|LOCUS_14390 66339 68000 gene locus_tag LOCUS_14400 66339 68000 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_14400 68137 68886 gene locus_tag LOCUS_14410 68137 68886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 68994 69869 gene locus_tag LOCUS_14420 68994 69869 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688678.1 protein_id gnl|my_center|LOCUS_14420 70835 69900 gene locus_tag LOCUS_14430 70835 69900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 72334 70865 gene locus_tag LOCUS_14440 72334 70865 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_14440 72917 72441 gene locus_tag LOCUS_14450 72917 72441 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_14450 74449 72914 gene locus_tag LOCUS_14460 gene nnr 74449 72914 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_14460 76065 74449 gene locus_tag LOCUS_14470 gene pgi 76065 74449 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_14470 77032 76193 gene locus_tag LOCUS_14480 gene panC 77032 76193 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY87 protein_id gnl|my_center|LOCUS_14480 77962 77039 gene locus_tag LOCUS_14490 gene panB 77962 77039 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP07 protein_id gnl|my_center|LOCUS_14490 78675 78163 gene locus_tag LOCUS_14500 78675 78163 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_14500 79910 78672 gene locus_tag LOCUS_14510 gene pcnB 79910 78672 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_14510 80148 81647 gene locus_tag LOCUS_14520 80148 81647 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731449.1 protein_id gnl|my_center|LOCUS_14520 82813 81749 gene locus_tag LOCUS_14530 82813 81749 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_14530 83904 82810 gene locus_tag LOCUS_14540 gene lptF 83904 82810 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_14540 84104 85609 gene locus_tag LOCUS_14550 gene pepA 84104 85609 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_14550 85623 86057 gene locus_tag LOCUS_14560 85623 86057 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_14560 86107 89055 gene locus_tag LOCUS_14570 gene valS 86107 89055 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887M3 protein_id gnl|my_center|LOCUS_14570 89403 89897 gene locus_tag LOCUS_14580 gene fxsA 89403 89897 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_14580 89937 90872 gene locus_tag LOCUS_14590 89937 90872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_14590 90913 91845 gene locus_tag LOCUS_14600 90913 91845 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_14600 91842 93824 gene locus_tag LOCUS_14610 91842 93824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_14610 93877 94434 gene locus_tag LOCUS_14620 93877 94434 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_14620 95763 94486 gene locus_tag LOCUS_14630 95763 94486 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_14630 96230 95760 gene locus_tag LOCUS_14640 gene rimI 96230 95760 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_14640 97036 96227 gene locus_tag LOCUS_14650 97036 96227 CDS product phage-related DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205142.1 protein_id gnl|my_center|LOCUS_14650 98539 97046 gene locus_tag LOCUS_14660 98539 97046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 99339 98563 gene locus_tag LOCUS_14670 gene pssA 99339 98563 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_14670 100104 99436 gene locus_tag LOCUS_14680 gene psd 100104 99436 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLL2 protein_id gnl|my_center|LOCUS_14680 101151 100129 gene locus_tag LOCUS_14690 gene ilvC 101151 100129 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 protein_id gnl|my_center|LOCUS_14690 101751 101248 gene locus_tag LOCUS_14700 gene ilvH 101751 101248 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence11 <1 550 gene locus_tag LOCUS_14710 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83EP4:single-stranded DNA-binding protein 1400 570 gene locus_tag LOCUS_14720 1400 570 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_14720 1866 1414 gene locus_tag LOCUS_14730 1866 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2186 2974 gene locus_tag LOCUS_14740 2186 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4036 2948 gene locus_tag LOCUS_14750 4036 2948 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972346.1 protein_id gnl|my_center|LOCUS_14750 5427 4039 gene locus_tag LOCUS_14760 gene tctE 5427 4039 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 protein_id gnl|my_center|LOCUS_14760 6092 5424 gene locus_tag LOCUS_14770 6092 5424 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194607.1 protein_id gnl|my_center|LOCUS_14770 6245 7246 gene locus_tag LOCUS_14780 6245 7246 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 protein_id gnl|my_center|LOCUS_14780 7246 7698 gene locus_tag LOCUS_14790 gene tctB 7246 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208457.1 protein_id gnl|my_center|LOCUS_14790 7708 9222 gene locus_tag LOCUS_14800 7708 9222 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706152.1 protein_id gnl|my_center|LOCUS_14800 9299 10684 gene locus_tag LOCUS_14810 gene miaB 9299 10684 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV6 protein_id gnl|my_center|LOCUS_14810 10725 11717 gene locus_tag LOCUS_14820 10725 11717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_14820 11714 12187 gene locus_tag LOCUS_14830 gene ybeY 11714 12187 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX9 protein_id gnl|my_center|LOCUS_14830 12242 13087 gene locus_tag LOCUS_14840 gene ybeX 12242 13087 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_14840 13107 14660 gene locus_tag LOCUS_14850 gene lnt 13107 14660 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN85 protein_id gnl|my_center|LOCUS_14850 14871 17315 gene locus_tag LOCUS_14860 gene leuS 14871 17315 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG64 protein_id gnl|my_center|LOCUS_14860 17320 17886 gene locus_tag LOCUS_14870 17320 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 17891 18481 gene locus_tag LOCUS_14880 gene yfhC 17891 18481 CDS product putative NAD(P)H nitroreductase YfhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31571 protein_id gnl|my_center|LOCUS_14880 18607 19035 gene locus_tag LOCUS_14890 gene rplM 18607 19035 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_14890 19039 19431 gene locus_tag LOCUS_14900 gene rpsI 19039 19431 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SI4 protein_id gnl|my_center|LOCUS_14900 19486 19559 gene locus_tag LOCUS_t00230 19486 19559 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20264 21322 gene locus_tag LOCUS_14910 20264 21322 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030626.1 protein_id gnl|my_center|LOCUS_14910 21319 21966 gene locus_tag LOCUS_14920 21319 21966 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 protein_id gnl|my_center|LOCUS_14920 21993 22718 gene locus_tag LOCUS_14930 gene proW 21993 22718 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_14930 22785 23669 gene locus_tag LOCUS_14940 22785 23669 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972856.1 protein_id gnl|my_center|LOCUS_14940 24086 25390 gene locus_tag LOCUS_14950 24086 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 25613 25765 gene locus_tag LOCUS_14960 25613 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 25798 27090 gene locus_tag LOCUS_14970 25798 27090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 27090 29765 gene locus_tag LOCUS_14980 27090 29765 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_14980 30013 31947 gene locus_tag LOCUS_14990 gene nirA 30013 31947 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117878.1 protein_id gnl|my_center|LOCUS_14990 32257 33825 gene locus_tag LOCUS_15000 gene cysJ 32257 33825 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117879.1 protein_id gnl|my_center|LOCUS_15000 33894 34433 gene locus_tag LOCUS_15010 33894 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 36007 34532 gene locus_tag LOCUS_15020 36007 34532 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 protein_id gnl|my_center|LOCUS_15020 36145 36220 gene locus_tag LOCUS_t00240 36145 36220 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36718 36793 gene locus_tag LOCUS_t00250 36718 36793 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 36809 36883 gene locus_tag LOCUS_t00260 36809 36883 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 37010 38005 gene locus_tag LOCUS_15030 37010 38005 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 protein_id gnl|my_center|LOCUS_15030 38143 39468 gene locus_tag LOCUS_15040 gene tig 38143 39468 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_15040 39512 40150 gene locus_tag LOCUS_15050 gene clpP 39512 40150 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR6 protein_id gnl|my_center|LOCUS_15050 40265 41542 gene locus_tag LOCUS_15060 gene clpX 40265 41542 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_15060 41652 44039 gene locus_tag LOCUS_15070 gene lon 41652 44039 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_15070 44239 44511 gene locus_tag LOCUS_15080 gene hupB 44239 44511 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_15080 44553 44628 gene locus_tag LOCUS_t00270 44553 44628 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44643 44719 gene locus_tag LOCUS_t00280 44643 44719 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 44836 44912 gene locus_tag LOCUS_t00290 44836 44912 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 45110 47044 gene locus_tag LOCUS_15090 gene ppiD 45110 47044 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG15 protein_id gnl|my_center|LOCUS_15090 47921 47130 gene locus_tag LOCUS_15100 gene fabI 47921 47130 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG23 protein_id gnl|my_center|LOCUS_15100 49709 47985 gene locus_tag LOCUS_15110 49709 47985 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 protein_id gnl|my_center|LOCUS_15110 50493 49717 gene locus_tag LOCUS_15120 gene gloB 50493 49717 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPX6 protein_id gnl|my_center|LOCUS_15120 50639 51331 gene locus_tag LOCUS_15130 50639 51331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 51285 51731 gene locus_tag LOCUS_15140 gene rnhA 51285 51731 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YT0 protein_id gnl|my_center|LOCUS_15140 51752 52471 gene locus_tag LOCUS_15150 gene dnaQ 51752 52471 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_15150 54212 52509 gene locus_tag LOCUS_15160 54212 52509 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_15160 54507 54205 gene locus_tag LOCUS_15170 54507 54205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328229.1 protein_id gnl|my_center|LOCUS_15170 55970 54504 gene locus_tag LOCUS_15180 55970 54504 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_15180 57463 55967 gene locus_tag LOCUS_15190 57463 55967 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_15190 57945 57460 gene locus_tag LOCUS_15200 57945 57460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 58418 57942 gene locus_tag LOCUS_15210 58418 57942 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_15210 58985 58422 gene locus_tag LOCUS_15220 58985 58422 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_15220 59344 58982 gene locus_tag LOCUS_15230 59344 58982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 59627 59337 gene locus_tag LOCUS_15240 59627 59337 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_15240 60127 59624 gene locus_tag LOCUS_15250 60127 59624 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_15250 60943 60188 gene locus_tag LOCUS_15260 60943 60188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 61872 60940 gene locus_tag LOCUS_15270 61872 60940 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036699.1 protein_id gnl|my_center|LOCUS_15270 63486 62242 gene locus_tag LOCUS_15280 63486 62242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 63745 65892 gene locus_tag LOCUS_15290 gene fadB 63745 65892 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA0 protein_id gnl|my_center|LOCUS_15290 65936 67096 gene locus_tag LOCUS_15300 gene fadA 65936 67096 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_15300 67997 67167 gene locus_tag LOCUS_15310 67997 67167 CDS product 2,5-didehydrogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388041.1 protein_id gnl|my_center|LOCUS_15310 68374 69213 gene locus_tag LOCUS_15320 68374 69213 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_15320 69218 70612 gene locus_tag LOCUS_15330 69218 70612 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_15330 70605 71138 gene locus_tag LOCUS_15340 70605 71138 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_15340 71144 71554 gene locus_tag LOCUS_15350 71144 71554 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_15350 71529 72260 gene locus_tag LOCUS_15360 71529 72260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 72387 73550 gene locus_tag LOCUS_15370 72387 73550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_15370 73974 77099 gene locus_tag LOCUS_15380 73974 77099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 77203 79008 gene locus_tag LOCUS_15390 77203 79008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038526.1 protein_id gnl|my_center|LOCUS_15390 80236 79520 gene locus_tag LOCUS_15400 80236 79520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 80818 81342 gene locus_tag LOCUS_15410 80818 81342 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 protein_id gnl|my_center|LOCUS_15410 81791 82240 gene locus_tag LOCUS_15420 81791 82240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence12 31 608 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcaggcgcggggaacac 2213 714 gene locus_tag LOCUS_15430 gene mmsA-1 2213 714 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_15430 3117 2356 gene locus_tag LOCUS_15440 3117 2356 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGP9 protein_id gnl|my_center|LOCUS_15440 4043 3114 gene locus_tag LOCUS_15450 4043 3114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_15450 4187 4537 gene locus_tag LOCUS_15460 4187 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6384 4534 gene locus_tag LOCUS_15470 6384 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 protein_id gnl|my_center|LOCUS_15470 6950 6381 gene locus_tag LOCUS_15480 6950 6381 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 protein_id gnl|my_center|LOCUS_15480 8286 6940 gene locus_tag LOCUS_15490 gene alcA 8286 6940 CDS product lysine N6-hydroxylase/L-ornithine N5-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211878.1 protein_id gnl|my_center|LOCUS_15490 9838 8276 gene locus_tag LOCUS_15500 9838 8276 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211877.1 protein_id gnl|my_center|LOCUS_15500 12090 9973 gene locus_tag LOCUS_15510 gene foxA 12090 9973 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815403.1 protein_id gnl|my_center|LOCUS_15510 13276 12440 gene locus_tag LOCUS_15520 13276 12440 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920330.1 protein_id gnl|my_center|LOCUS_15520 14000 13332 gene locus_tag LOCUS_15530 14000 13332 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I767 protein_id gnl|my_center|LOCUS_15530 15655 13994 gene locus_tag LOCUS_15540 15655 13994 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973292.1 protein_id gnl|my_center|LOCUS_15540 16817 15717 gene locus_tag LOCUS_15550 gene phaC1 16817 15717 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206656.1 protein_id gnl|my_center|LOCUS_15550 16968 17786 gene locus_tag LOCUS_15560 16968 17786 CDS product 5'-3' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44176 protein_id gnl|my_center|LOCUS_15560 18193 17783 gene locus_tag LOCUS_15570 gene exbD 18193 17783 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RMT1 protein_id gnl|my_center|LOCUS_15570 18949 18209 gene locus_tag LOCUS_15580 18949 18209 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555938.1 protein_id gnl|my_center|LOCUS_15580 19833 18976 gene locus_tag LOCUS_15590 19833 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 20114 20956 gene locus_tag LOCUS_15600 20114 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336829.1 protein_id gnl|my_center|LOCUS_15600 20953 21648 gene locus_tag LOCUS_15610 20953 21648 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339223.1 protein_id gnl|my_center|LOCUS_15610 21676 22593 gene locus_tag LOCUS_15620 21676 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_15620 22623 23156 gene locus_tag LOCUS_15630 gene allA 22623 23156 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J9 protein_id gnl|my_center|LOCUS_15630 23153 24655 gene locus_tag LOCUS_15640 23153 24655 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971645.1 protein_id gnl|my_center|LOCUS_15640 24682 25404 gene locus_tag LOCUS_15650 24682 25404 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971646.1 protein_id gnl|my_center|LOCUS_15650 25507 25431 gene locus_tag LOCUS_t00300 25507 25431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25653 26534 gene locus_tag LOCUS_15660 gene folD 25653 26534 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U6 protein_id gnl|my_center|LOCUS_15660 27949 26561 gene locus_tag LOCUS_15670 gene cysS 27949 26561 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLW3 protein_id gnl|my_center|LOCUS_15670 28995 28024 gene locus_tag LOCUS_15680 gene thiL 28995 28024 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8X5 protein_id gnl|my_center|LOCUS_15680 29682 29011 gene locus_tag LOCUS_15690 29682 29011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 30163 29687 gene locus_tag LOCUS_15700 gene ribH 30163 29687 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61940 protein_id gnl|my_center|LOCUS_15700 30812 30219 gene locus_tag LOCUS_15710 gene ribE 30812 30219 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_15710 31936 30815 gene locus_tag LOCUS_15720 31936 30815 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJJ1 protein_id gnl|my_center|LOCUS_15720 32511 31933 gene locus_tag LOCUS_15730 gene nrdR 32511 31933 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_15730 33822 32533 gene locus_tag LOCUS_15740 gene glyA 33822 32533 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_15740 36969 34030 gene locus_tag LOCUS_15750 36969 34030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 38945 37149 gene locus_tag LOCUS_15760 gene aspS 38945 37149 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_15760 39673 39326 gene locus_tag LOCUS_15770 39673 39326 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929971.1 protein_id gnl|my_center|LOCUS_15770 41102 39753 gene locus_tag LOCUS_15780 41102 39753 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_15780 41324 41249 gene locus_tag LOCUS_t00310 41324 41249 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 41407 41332 gene locus_tag LOCUS_t00320 41407 41332 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 42552 41470 gene locus_tag LOCUS_15790 gene wbpE 42552 41470 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ76 protein_id gnl|my_center|LOCUS_15790 42667 42741 gene locus_tag LOCUS_t00330 42667 42741 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43111 42893 gene locus_tag LOCUS_15800 43111 42893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 44118 43126 gene locus_tag LOCUS_15810 44118 43126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 45437 44115 gene locus_tag LOCUS_15820 gene waaA 45437 44115 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_15820 46896 45442 gene locus_tag LOCUS_15830 gene hldE 46896 45442 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL4 protein_id gnl|my_center|LOCUS_15830 47009 47974 gene locus_tag LOCUS_15840 gene lpxL 47009 47974 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ1 protein_id gnl|my_center|LOCUS_15840 48675 47938 gene locus_tag LOCUS_15850 gene kdkA 48675 47938 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I7 protein_id gnl|my_center|LOCUS_15850 49732 48806 gene locus_tag LOCUS_15860 49732 48806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 50880 50044 gene locus_tag LOCUS_15870 50880 50044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 52133 50877 gene locus_tag LOCUS_15880 52133 50877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 53321 52176 gene locus_tag LOCUS_15890 53321 52176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 54379 53318 gene locus_tag LOCUS_15900 54379 53318 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_15900 55347 54421 gene locus_tag LOCUS_15910 55347 54421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 56312 55464 gene locus_tag LOCUS_15920 56312 55464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 56406 57500 gene locus_tag LOCUS_15930 56406 57500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 57566 59206 gene locus_tag LOCUS_15940 57566 59206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 59208 59903 gene locus_tag LOCUS_15950 59208 59903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 59896 60612 gene locus_tag LOCUS_15960 gene neuA 59896 60612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_15960 60635 61318 gene locus_tag LOCUS_15970 60635 61318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 62825 61338 gene locus_tag LOCUS_15980 62825 61338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 63445 62822 gene locus_tag LOCUS_15990 63445 62822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 63548 63871 gene locus_tag LOCUS_16000 63548 63871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 64770 63892 gene locus_tag LOCUS_16010 64770 63892 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_16010 65955 64789 gene locus_tag LOCUS_16020 65955 64789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 68892 66100 gene locus_tag LOCUS_16030 gene glnE 68892 66100 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 protein_id gnl|my_center|LOCUS_16030 69075 70385 gene locus_tag LOCUS_16040 69075 70385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 70519 71496 gene locus_tag LOCUS_16050 70519 71496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 71543 72742 gene locus_tag LOCUS_16060 71543 72742 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_16060 72743 73978 gene locus_tag LOCUS_16070 72743 73978 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_16070 74520 74017 gene locus_tag LOCUS_16080 74520 74017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 77310 75661 gene locus_tag LOCUS_16090 gene groL 77310 75661 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_16090 77650 77363 gene locus_tag LOCUS_16100 gene groS 77650 77363 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_16100 77933 79228 gene locus_tag LOCUS_16110 gene atoB 77933 79228 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence13 709 281 gene locus_tag LOCUS_16120 709 281 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_16120 914 2191 gene locus_tag LOCUS_16130 914 2191 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_16130 2244 3725 gene locus_tag LOCUS_16140 2244 3725 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528231.1 protein_id gnl|my_center|LOCUS_16140 3829 5268 gene locus_tag LOCUS_16150 3829 5268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896962.1 protein_id gnl|my_center|LOCUS_16150 5349 6029 gene locus_tag LOCUS_16160 5349 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6137 6949 gene locus_tag LOCUS_16170 6137 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403572.1 protein_id gnl|my_center|LOCUS_16170 7069 7731 gene locus_tag LOCUS_16180 7069 7731 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_16180 7736 7987 gene locus_tag LOCUS_16190 7736 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035426.1 protein_id gnl|my_center|LOCUS_16190 8255 8701 gene locus_tag LOCUS_16200 gene cynS 8255 8701 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJG2 protein_id gnl|my_center|LOCUS_16200 8838 9347 gene locus_tag LOCUS_16210 8838 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 9403 9786 gene locus_tag LOCUS_16220 9403 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 12111 9973 gene locus_tag LOCUS_16230 gene prc 12111 9973 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_16230 13239 12244 gene locus_tag LOCUS_16240 13239 12244 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_16240 13967 13236 gene locus_tag LOCUS_16250 13967 13236 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPV9 protein_id gnl|my_center|LOCUS_16250 14132 16300 gene locus_tag LOCUS_16260 14132 16300 CDS product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_16260 17106 16315 gene locus_tag LOCUS_16270 17106 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 17244 17169 gene locus_tag LOCUS_t00340 17244 17169 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17503 17285 gene locus_tag LOCUS_16280 17503 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 18115 17507 gene locus_tag LOCUS_16290 18115 17507 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_16290 18641 18177 gene locus_tag LOCUS_16300 18641 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 18666 20321 gene locus_tag LOCUS_16310 18666 20321 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528083.1 protein_id gnl|my_center|LOCUS_16310 20368 20919 gene locus_tag LOCUS_16320 20368 20919 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_16320 22320 20974 gene locus_tag LOCUS_16330 22320 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 24020 22422 gene locus_tag LOCUS_16340 24020 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 24291 25352 gene locus_tag LOCUS_16350 24291 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_16350 25410 26432 gene locus_tag LOCUS_16360 25410 26432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_16360 26782 27549 gene locus_tag LOCUS_16370 26782 27549 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529074.1 protein_id gnl|my_center|LOCUS_16370 28879 27521 gene locus_tag LOCUS_16380 28879 27521 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_16380 29991 28861 gene locus_tag LOCUS_16390 29991 28861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_16390 30441 31358 gene locus_tag LOCUS_16400 gene nahR 30441 31358 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_16400 33383 31692 gene locus_tag LOCUS_16410 33383 31692 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495210.1 protein_id gnl|my_center|LOCUS_16410 34044 33691 gene locus_tag LOCUS_16420 34044 33691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 34231 34953 gene locus_tag LOCUS_16430 34231 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 35155 35430 gene locus_tag LOCUS_16440 35155 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 35470 37491 gene locus_tag LOCUS_16450 gene mnmC 35470 37491 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_16450 37816 38937 gene locus_tag LOCUS_16460 gene aroF-2 37816 38937 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X3 protein_id gnl|my_center|LOCUS_16460 39461 38871 gene locus_tag LOCUS_16470 39461 38871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 39575 41113 gene locus_tag LOCUS_16480 gene sthA 39575 41113 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 protein_id gnl|my_center|LOCUS_16480 41110 41502 gene locus_tag LOCUS_16490 41110 41502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 41572 42507 gene locus_tag LOCUS_16500 41572 42507 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405445.1 protein_id gnl|my_center|LOCUS_16500 43281 42490 gene locus_tag LOCUS_16510 43281 42490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 44758 43334 gene locus_tag LOCUS_16520 44758 43334 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_16520 44969 46474 gene locus_tag LOCUS_16530 44969 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 46537 48057 gene locus_tag LOCUS_16540 gene nadB 46537 48057 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8J4 protein_id gnl|my_center|LOCUS_16540 48110 48958 gene locus_tag LOCUS_16550 gene nadC 48110 48958 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_16550 49032 49976 gene locus_tag LOCUS_16560 49032 49976 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA69 protein_id gnl|my_center|LOCUS_16560 50813 50076 gene locus_tag LOCUS_16570 50813 50076 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_16570 51013 52143 gene locus_tag LOCUS_16580 51013 52143 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 protein_id gnl|my_center|LOCUS_16580 52486 52172 gene locus_tag LOCUS_16590 52486 52172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124109.1 protein_id gnl|my_center|LOCUS_16590 52505 52957 gene locus_tag LOCUS_16600 52505 52957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 53991 52963 gene locus_tag LOCUS_16610 gene ptxS 53991 52963 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113738.1 protein_id gnl|my_center|LOCUS_16610 53951 54193 gene locus_tag LOCUS_16620 53951 54193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 54169 55590 gene locus_tag LOCUS_16630 gene pykA 54169 55590 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRG5 protein_id gnl|my_center|LOCUS_16630 55598 56647 gene locus_tag LOCUS_16640 55598 56647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_16640 56675 57283 gene locus_tag LOCUS_16650 56675 57283 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 protein_id gnl|my_center|LOCUS_16650 57280 58209 gene locus_tag LOCUS_16660 57280 58209 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_16660 58516 59502 gene locus_tag LOCUS_16670 58516 59502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 protein_id gnl|my_center|LOCUS_16670 60141 59503 gene locus_tag LOCUS_16680 gene msrA 60141 59503 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_16680 61573 60218 gene locus_tag LOCUS_16690 61573 60218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_16690 61983 61606 gene locus_tag LOCUS_16700 61983 61606 CDS product putative gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP33 protein_id gnl|my_center|LOCUS_16700 62253 62918 gene locus_tag LOCUS_16710 62253 62918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 62908 63762 gene locus_tag LOCUS_16720 62908 63762 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_16720 65366 63768 gene locus_tag LOCUS_16730 65366 63768 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531560.1 protein_id gnl|my_center|LOCUS_16730 66589 65363 gene locus_tag LOCUS_16740 66589 65363 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_16740 67977 66586 gene locus_tag LOCUS_16750 67977 66586 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931801.1 protein_id gnl|my_center|LOCUS_16750 68414 67977 gene locus_tag LOCUS_16760 68414 67977 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224731.1 protein_id gnl|my_center|LOCUS_16760 70195 68519 gene locus_tag LOCUS_16770 70195 68519 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_16770 71371 70394 gene locus_tag LOCUS_16780 gene murB 71371 70394 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0J2 protein_id gnl|my_center|LOCUS_16780 71503 72162 gene locus_tag LOCUS_16790 71503 72162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 72278 74080 gene locus_tag LOCUS_16800 72278 74080 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 protein_id gnl|my_center|LOCUS_16800 74085 75929 gene locus_tag LOCUS_16810 74085 75929 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084106.1 protein_id gnl|my_center|LOCUS_16810 75926 76522 gene locus_tag LOCUS_16820 gene plsY1 75926 76522 CDS product glycerol-3-phosphate acyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RSV1 protein_id gnl|my_center|LOCUS_16820 76519 77526 gene locus_tag LOCUS_16830 gene birA 76519 77526 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y0 protein_id gnl|my_center|LOCUS_16830 77668 77743 gene locus_tag LOCUS_t00350 77668 77743 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 78017 78982 gene locus_tag LOCUS_16840 78017 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946922.1 protein_id gnl|my_center|LOCUS_16840 79058 79142 gene locus_tag LOCUS_t00360 79058 79142 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 79250 79323 gene locus_tag LOCUS_t00370 79250 79323 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 79356 79430 gene locus_tag LOCUS_t00380 79356 79430 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 <1 682 gene locus_tag LOCUS_16850 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268628.1:short chain dehydrogenase 709 1749 gene locus_tag LOCUS_16860 gene lysl 709 1749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_16860 2871 2056 gene locus_tag LOCUS_16870 2871 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2956 3597 gene locus_tag LOCUS_16880 2956 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4493 3573 gene locus_tag LOCUS_16890 4493 3573 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_16890 4554 5450 gene locus_tag LOCUS_16900 4554 5450 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728349.1 protein_id gnl|my_center|LOCUS_16900 5456 5875 gene locus_tag LOCUS_16910 5456 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 7413 5872 gene locus_tag LOCUS_16920 7413 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_16920 7461 8411 gene locus_tag LOCUS_16930 7461 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 9625 8387 gene locus_tag LOCUS_16940 9625 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 12386 9660 gene locus_tag LOCUS_16950 12386 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 12791 12444 gene locus_tag LOCUS_16960 12791 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13950 12871 gene locus_tag LOCUS_16970 13950 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 14399 16288 gene locus_tag LOCUS_16980 14399 16288 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_16980 16303 16914 gene locus_tag LOCUS_16990 gene cobO 16303 16914 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_16990 17497 18912 gene locus_tag LOCUS_17000 17497 18912 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638408.2 protein_id gnl|my_center|LOCUS_17000 18909 19916 gene locus_tag LOCUS_17010 18909 19916 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_17010 19913 20674 gene locus_tag LOCUS_17020 gene hmuV 19913 20674 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_17020 20667 21191 gene locus_tag LOCUS_17030 gene cobU 20667 21191 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_17030 21188 22258 gene locus_tag LOCUS_17040 gene cobT 21188 22258 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6B1 protein_id gnl|my_center|LOCUS_17040 22360 22569 gene locus_tag LOCUS_17050 22360 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 24116 22719 gene locus_tag LOCUS_17060 24116 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 24531 25166 gene locus_tag LOCUS_17070 24531 25166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_17070 25163 25939 gene locus_tag LOCUS_17080 gene cobS 25163 25939 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6B3 protein_id gnl|my_center|LOCUS_17080 25930 26847 gene locus_tag LOCUS_17090 gene cobD 25930 26847 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6A8 protein_id gnl|my_center|LOCUS_17090 26844 27854 gene locus_tag LOCUS_17100 gene cobC 26844 27854 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_17100 27924 28823 gene locus_tag LOCUS_17110 gene btuF 27924 28823 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_17110 29409 28789 gene locus_tag LOCUS_17120 29409 28789 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106442.1 protein_id gnl|my_center|LOCUS_17120 30721 29483 gene locus_tag LOCUS_17130 gene fdmA2 30721 29483 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_17130 31202 30780 gene locus_tag LOCUS_17140 gene aroQ 31202 30780 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWV4 protein_id gnl|my_center|LOCUS_17140 31381 32016 gene locus_tag LOCUS_17150 31381 32016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_17150 33184 32252 gene locus_tag LOCUS_17160 33184 32252 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_17160 33556 33194 gene locus_tag LOCUS_17170 33556 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 35445 33574 gene locus_tag LOCUS_17180 gene thiC 35445 33574 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FE9 protein_id gnl|my_center|LOCUS_17180 36422 35802 gene locus_tag LOCUS_17190 gene pncA 36422 35802 CDS product nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972033.1 protein_id gnl|my_center|LOCUS_17190 37875 36427 gene locus_tag LOCUS_17200 37875 36427 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_17200 38048 38761 gene locus_tag LOCUS_17210 38048 38761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 38798 39601 gene locus_tag LOCUS_17220 38798 39601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 40891 39611 gene locus_tag LOCUS_17230 40891 39611 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957913.1 protein_id gnl|my_center|LOCUS_17230 42882 40954 gene locus_tag LOCUS_17240 42882 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 44285 42963 gene locus_tag LOCUS_17250 44285 42963 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_17250 44403 44987 gene locus_tag LOCUS_17260 44403 44987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 45730 45197 gene locus_tag LOCUS_17270 45730 45197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 45845 47155 gene locus_tag LOCUS_17280 gene purD 45845 47155 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV81 protein_id gnl|my_center|LOCUS_17280 48734 47229 gene locus_tag LOCUS_17290 48734 47229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 48952 48701 gene locus_tag LOCUS_17300 48952 48701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 49143 50144 gene locus_tag LOCUS_17310 49143 50144 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_17310 50204 51646 gene locus_tag LOCUS_17320 50204 51646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 protein_id gnl|my_center|LOCUS_17320 51643 52689 gene locus_tag LOCUS_17330 51643 52689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 protein_id gnl|my_center|LOCUS_17330 52772 53956 gene locus_tag LOCUS_17340 52772 53956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 55056 54100 gene locus_tag LOCUS_17350 55056 54100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 56777 55053 gene locus_tag LOCUS_17360 56777 55053 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_17360 57397 56795 gene locus_tag LOCUS_17370 57397 56795 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195230.1 protein_id gnl|my_center|LOCUS_17370 57499 57957 gene locus_tag LOCUS_17380 57499 57957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17380 57954 58397 gene locus_tag LOCUS_17390 57954 58397 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_17390 58481 59359 gene locus_tag LOCUS_17400 58481 59359 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_17400 59470 60069 gene locus_tag LOCUS_17410 59470 60069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 60704 60066 gene locus_tag LOCUS_17420 60704 60066 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_17420 60789 61952 gene locus_tag LOCUS_17430 60789 61952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088680.1 protein_id gnl|my_center|LOCUS_17430 62386 62069 gene locus_tag LOCUS_17440 62386 62069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_17440 63756 62395 gene locus_tag LOCUS_17450 63756 62395 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_17450 64215 63838 gene locus_tag LOCUS_17460 64215 63838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_17460 64628 64215 gene locus_tag LOCUS_17470 64628 64215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 65161 64667 gene locus_tag LOCUS_17480 65161 64667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 65676 65353 gene locus_tag LOCUS_17490 65676 65353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 66167 65718 gene locus_tag LOCUS_17500 66167 65718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 66920 66189 gene locus_tag LOCUS_17510 66920 66189 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_17510 66991 67482 gene locus_tag LOCUS_17520 66991 67482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 68060 67479 gene locus_tag LOCUS_17530 68060 67479 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_17530 68147 68848 gene locus_tag LOCUS_17540 68147 68848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_17540 69047 69667 gene locus_tag LOCUS_17550 69047 69667 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_17550 70517 69615 gene locus_tag LOCUS_17560 70517 69615 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256264.1 protein_id gnl|my_center|LOCUS_17560 70699 72210 gene locus_tag LOCUS_17570 70699 72210 CDS product putative conserved polyketide synthase associated protein PapA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701600.1 protein_id gnl|my_center|LOCUS_17570 72362 74953 gene locus_tag LOCUS_17580 72362 74953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 <75621 74947 gene locus_tag LOCUS_17590 <75621 74947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029637.1:MFS transporter >Feature sequence15 898 179 gene locus_tag LOCUS_17600 898 179 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262840.1 protein_id gnl|my_center|LOCUS_17600 1802 963 gene locus_tag LOCUS_17610 gene dapF 1802 963 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V327 protein_id gnl|my_center|LOCUS_17610 2406 1807 gene locus_tag LOCUS_17620 2406 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2467 2955 gene locus_tag LOCUS_17630 2467 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2980 3489 gene locus_tag LOCUS_17640 2980 3489 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 protein_id gnl|my_center|LOCUS_17640 4813 3752 gene locus_tag LOCUS_17650 4813 3752 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_17650 6195 4873 gene locus_tag LOCUS_17660 gene amiB 6195 4873 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948398.1 protein_id gnl|my_center|LOCUS_17660 8372 6303 gene locus_tag LOCUS_17670 8372 6303 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404623.1 protein_id gnl|my_center|LOCUS_17670 9212 8616 gene locus_tag LOCUS_17680 9212 8616 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126376.1 protein_id gnl|my_center|LOCUS_17680 9307 9624 gene locus_tag LOCUS_17690 gene sugE 9307 9624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185570.1 protein_id gnl|my_center|LOCUS_17690 9626 9940 gene locus_tag LOCUS_17700 9626 9940 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312623.1 protein_id gnl|my_center|LOCUS_17700 9980 10234 gene locus_tag LOCUS_17710 9980 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_17710 10231 11091 gene locus_tag LOCUS_17720 gene queD 10231 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_17720 11169 12503 gene locus_tag LOCUS_17730 11169 12503 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_17730 12608 13048 gene locus_tag LOCUS_17740 gene fur 12608 13048 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_17740 13178 14362 gene locus_tag LOCUS_17750 gene sat 13178 14362 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_17750 14386 14889 gene locus_tag LOCUS_17760 14386 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 15908 14895 gene locus_tag LOCUS_17770 gene czcD.1 15908 14895 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_17770 16225 15905 gene locus_tag LOCUS_17780 16225 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 17796 16375 gene locus_tag LOCUS_17790 gene gltX 17796 16375 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43818 protein_id gnl|my_center|LOCUS_17790 18198 18929 gene locus_tag LOCUS_17800 18198 18929 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123287.1 protein_id gnl|my_center|LOCUS_17800 21203 18936 gene locus_tag LOCUS_17810 gene metE 21203 18936 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTM7 protein_id gnl|my_center|LOCUS_17810 21318 22208 gene locus_tag LOCUS_17820 gene metR 21318 22208 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_17820 22567 22307 gene locus_tag LOCUS_17830 gene rpmE2 22567 22307 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS12 protein_id gnl|my_center|LOCUS_17830 25824 22639 gene locus_tag LOCUS_17840 gene ileS 25824 22639 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5D0 protein_id gnl|my_center|LOCUS_17840 26219 25920 gene locus_tag LOCUS_17850 26219 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 26321 26746 gene locus_tag LOCUS_17860 26321 26746 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_17860 27524 27072 gene locus_tag LOCUS_17870 27524 27072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 28048 27635 gene locus_tag LOCUS_17880 28048 27635 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_17880 28191 28712 gene locus_tag LOCUS_17890 28191 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036322.1 protein_id gnl|my_center|LOCUS_17890 29519 28770 gene locus_tag LOCUS_17900 gene gpmA 29519 28770 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7A1 protein_id gnl|my_center|LOCUS_17900 30037 29633 gene locus_tag LOCUS_17910 30037 29633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 30926 30078 gene locus_tag LOCUS_17920 30926 30078 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204290.1 protein_id gnl|my_center|LOCUS_17920 32317 30965 gene locus_tag LOCUS_17930 gene gor 32317 30965 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209534.1 protein_id gnl|my_center|LOCUS_17930 32471 34546 gene locus_tag LOCUS_17940 gene prlC 32471 34546 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_17940 35216 34752 gene locus_tag LOCUS_17950 35216 34752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 35301 36080 gene locus_tag LOCUS_17960 35301 36080 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_17960 38343 36187 gene locus_tag LOCUS_17970 38343 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 39693 38353 gene locus_tag LOCUS_17980 39693 38353 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118483.1 protein_id gnl|my_center|LOCUS_17980 40515 39721 gene locus_tag LOCUS_17990 40515 39721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 41309 40599 gene locus_tag LOCUS_18000 41309 40599 CDS product SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18000 43170 41329 gene locus_tag LOCUS_18010 43170 41329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 58504 43193 gene locus_tag LOCUS_18020 58504 43193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 59444 62596 gene locus_tag LOCUS_18030 59444 62596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 63653 64558 gene locus_tag LOCUS_18040 63653 64558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 65123 65980 gene locus_tag LOCUS_18050 65123 65980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 66041 66808 gene locus_tag LOCUS_18060 66041 66808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence16 54 509 gene locus_tag LOCUS_18070 54 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 580 1479 gene locus_tag LOCUS_18080 580 1479 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_18080 1476 2573 gene locus_tag LOCUS_18090 1476 2573 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_18090 3661 2606 gene locus_tag LOCUS_18100 3661 2606 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_18100 5528 3663 gene locus_tag LOCUS_18110 gene pepF 5528 3663 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_18110 6558 5563 gene locus_tag LOCUS_18120 6558 5563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 protein_id gnl|my_center|LOCUS_18120 8218 6593 gene locus_tag LOCUS_18130 gene opgD 8218 6593 CDS product glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TX5 protein_id gnl|my_center|LOCUS_18130 8795 8283 gene locus_tag LOCUS_18140 8795 8283 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_18140 8938 9531 gene locus_tag LOCUS_18150 8938 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9861 9553 gene locus_tag LOCUS_18160 9861 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 11179 9854 gene locus_tag LOCUS_18170 11179 9854 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_18170 11247 11474 gene locus_tag LOCUS_18180 11247 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 11431 12543 gene locus_tag LOCUS_18190 11431 12543 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228543.1 protein_id gnl|my_center|LOCUS_18190 12536 13444 gene locus_tag LOCUS_18200 12536 13444 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887945.1 protein_id gnl|my_center|LOCUS_18200 13441 14253 gene locus_tag LOCUS_18210 13441 14253 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 protein_id gnl|my_center|LOCUS_18210 14289 15362 gene locus_tag LOCUS_18220 14289 15362 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887947.1 protein_id gnl|my_center|LOCUS_18220 15615 16391 gene locus_tag LOCUS_18230 15615 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 17805 16510 gene locus_tag LOCUS_18240 17805 16510 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389294.1 protein_id gnl|my_center|LOCUS_18240 18019 19842 gene locus_tag LOCUS_18250 gene kefB 18019 19842 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884040.1 protein_id gnl|my_center|LOCUS_18250 20087 20476 gene locus_tag LOCUS_18260 20087 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 20573 21379 gene locus_tag LOCUS_18270 20573 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974301.1 protein_id gnl|my_center|LOCUS_18270 21886 22446 gene locus_tag LOCUS_18280 21886 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 23955 23056 gene locus_tag LOCUS_18290 23955 23056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 24064 24861 gene locus_tag LOCUS_18300 24064 24861 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 protein_id gnl|my_center|LOCUS_18300 25882 24854 gene locus_tag LOCUS_18310 gene queA 25882 24854 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH8 protein_id gnl|my_center|LOCUS_18310 26010 26765 gene locus_tag LOCUS_18320 26010 26765 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_18320 26796 27221 gene locus_tag LOCUS_18330 26796 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 27262 27702 gene locus_tag LOCUS_18340 gene mscL 27262 27702 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1X9 protein_id gnl|my_center|LOCUS_18340 28145 27696 gene locus_tag LOCUS_18350 28145 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 28250 28660 gene locus_tag LOCUS_18360 28250 28660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 28704 30233 gene locus_tag LOCUS_18370 28704 30233 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V22 protein_id gnl|my_center|LOCUS_18370 31350 30238 gene locus_tag LOCUS_18380 31350 30238 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_18380 31494 31748 gene locus_tag LOCUS_18390 31494 31748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 32821 31853 gene locus_tag LOCUS_18400 32821 31853 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 protein_id gnl|my_center|LOCUS_18400 33572 32931 gene locus_tag LOCUS_18410 gene pdxH 33572 32931 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_18410 33792 33580 gene locus_tag LOCUS_18420 33792 33580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_18420 33915 34901 gene locus_tag LOCUS_18430 33915 34901 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_18430 34943 36073 gene locus_tag LOCUS_18440 gene prpC 34943 36073 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E3 protein_id gnl|my_center|LOCUS_18440 36137 36529 gene locus_tag LOCUS_18450 36137 36529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225309.1 protein_id gnl|my_center|LOCUS_18450 36659 38185 gene locus_tag LOCUS_18460 36659 38185 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKA7 protein_id gnl|my_center|LOCUS_18460 38285 38647 gene locus_tag LOCUS_18470 38285 38647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 39078 38680 gene locus_tag LOCUS_18480 39078 38680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 39275 40978 gene locus_tag LOCUS_18490 gene glnS 39275 40978 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RG4 protein_id gnl|my_center|LOCUS_18490 40975 41643 gene locus_tag LOCUS_18500 gene rsmG 40975 41643 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTD7 protein_id gnl|my_center|LOCUS_18500 41734 42582 gene locus_tag LOCUS_18510 gene parA 41734 42582 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_18510 42594 43457 gene locus_tag LOCUS_18520 gene spoOJ 42594 43457 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_18520 43612 44019 gene locus_tag LOCUS_18530 43612 44019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 44023 44853 gene locus_tag LOCUS_18540 gene atpB 44023 44853 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AG1 protein_id gnl|my_center|LOCUS_18540 44903 45187 gene locus_tag LOCUS_18550 gene atpE 44903 45187 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR96 protein_id gnl|my_center|LOCUS_18550 45245 45718 gene locus_tag LOCUS_18560 gene atpF 45245 45718 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR97 protein_id gnl|my_center|LOCUS_18560 45721 46260 gene locus_tag LOCUS_18570 gene atpH 45721 46260 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_18570 46318 47859 gene locus_tag LOCUS_18580 gene atpA2 46318 47859 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_18580 47912 48772 gene locus_tag LOCUS_18590 gene atpG 47912 48772 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH4 protein_id gnl|my_center|LOCUS_18590 48841 50241 gene locus_tag LOCUS_18600 gene atpD 48841 50241 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43715 protein_id gnl|my_center|LOCUS_18600 50316 50729 gene locus_tag LOCUS_18610 gene atpC 50316 50729 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR4 protein_id gnl|my_center|LOCUS_18610 50810 52009 gene locus_tag LOCUS_18620 50810 52009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 52150 53796 gene locus_tag LOCUS_18630 gene opgD 52150 53796 CDS product putative glucans biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI02 protein_id gnl|my_center|LOCUS_18630 53826 56273 gene locus_tag LOCUS_18640 gene mdoH 53826 56273 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMZ5 protein_id gnl|my_center|LOCUS_18640 56304 57674 gene locus_tag LOCUS_18650 gene glmU 56304 57674 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH7 protein_id gnl|my_center|LOCUS_18650 57698 59536 gene locus_tag LOCUS_18660 gene glmS 57698 59536 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 protein_id gnl|my_center|LOCUS_18660 59949 60905 gene locus_tag LOCUS_18670 59949 60905 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_18670 61709 62338 gene locus_tag LOCUS_18680 61709 62338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 62399 63463 gene locus_tag LOCUS_18690 62399 63463 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence17 783 448 gene locus_tag LOCUS_18700 783 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1526 996 gene locus_tag LOCUS_18710 1526 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2349 1816 gene locus_tag LOCUS_18720 2349 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6381 2467 gene locus_tag LOCUS_18730 6381 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7902 7330 gene locus_tag LOCUS_18740 7902 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 9711 7981 gene locus_tag LOCUS_18750 gene poxB 9711 7981 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211361.1 protein_id gnl|my_center|LOCUS_18750 10218 11024 gene locus_tag LOCUS_18760 10218 11024 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815895.1 protein_id gnl|my_center|LOCUS_18760 11439 13004 gene locus_tag LOCUS_18770 11439 13004 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106258.1 protein_id gnl|my_center|LOCUS_18770 12988 13887 gene locus_tag LOCUS_18780 gene panE-2 12988 13887 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ9 protein_id gnl|my_center|LOCUS_18780 13884 14291 gene locus_tag LOCUS_18790 gene yneG 13884 14291 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 protein_id gnl|my_center|LOCUS_18790 15337 14576 gene locus_tag LOCUS_18800 15337 14576 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731497.1 protein_id gnl|my_center|LOCUS_18800 16707 15364 gene locus_tag LOCUS_18810 16707 15364 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_18810 16955 16767 gene locus_tag LOCUS_18820 16955 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18820 18104 17025 gene locus_tag LOCUS_18830 gene hisD 18104 17025 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UA68 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18830 18777 18214 gene locus_tag LOCUS_18840 18777 18214 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389795.1 protein_id gnl|my_center|LOCUS_18840 20524 18926 gene locus_tag LOCUS_18850 20524 18926 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_18850 20757 21608 gene locus_tag LOCUS_18860 20757 21608 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_18860 21656 22090 gene locus_tag LOCUS_18870 21656 22090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 22083 22934 gene locus_tag LOCUS_18880 gene estX 22083 22934 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 protein_id gnl|my_center|LOCUS_18880 23665 22964 gene locus_tag LOCUS_18890 23665 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947331.1 protein_id gnl|my_center|LOCUS_18890 24078 23665 gene locus_tag LOCUS_18900 24078 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_18900 25592 24237 gene locus_tag LOCUS_18910 gene fabG 25592 24237 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_18910 26842 25625 gene locus_tag LOCUS_18920 26842 25625 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_18920 28113 26839 gene locus_tag LOCUS_18930 gene yfeW 28113 26839 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_18930 30615 28114 gene locus_tag LOCUS_18940 30615 28114 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462399.1 protein_id gnl|my_center|LOCUS_18940 30744 31454 gene locus_tag LOCUS_18950 30744 31454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 33293 31464 gene locus_tag LOCUS_18960 gene atuH 33293 31464 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_18960 34236 33484 gene locus_tag LOCUS_18970 34236 33484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 35505 34252 gene locus_tag LOCUS_18980 35505 34252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_18980 36080 35613 gene locus_tag LOCUS_18990 36080 35613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_18990 36174 37250 gene locus_tag LOCUS_19000 36174 37250 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_19000 37597 37277 gene locus_tag LOCUS_19010 37597 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_19010 38138 37614 gene locus_tag LOCUS_19020 38138 37614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 39208 38210 gene locus_tag LOCUS_19030 39208 38210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775839.1 protein_id gnl|my_center|LOCUS_19030 39404 40333 gene locus_tag LOCUS_19040 39404 40333 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259051.1 protein_id gnl|my_center|LOCUS_19040 40377 41051 gene locus_tag LOCUS_19050 40377 41051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 41224 41940 gene locus_tag LOCUS_19060 41224 41940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 43447 41951 gene locus_tag LOCUS_19070 43447 41951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 44834 43431 gene locus_tag LOCUS_19080 44834 43431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 45036 46064 gene locus_tag LOCUS_19090 gene moaA 45036 46064 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S72 protein_id gnl|my_center|LOCUS_19090 46239 46550 gene locus_tag LOCUS_19100 46239 46550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 46893 46528 gene locus_tag LOCUS_19110 46893 46528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 48181 47174 gene locus_tag LOCUS_19120 gene lig 48181 47174 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227028.1 protein_id gnl|my_center|LOCUS_19120 48561 48178 gene locus_tag LOCUS_19130 48561 48178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 48701 49126 gene locus_tag LOCUS_19140 gene cdd 48701 49126 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_19140 49201 50091 gene locus_tag LOCUS_19150 49201 50091 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777086.1 protein_id gnl|my_center|LOCUS_19150 50947 50135 gene locus_tag LOCUS_19160 gene cof 50947 50135 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4F8 protein_id gnl|my_center|LOCUS_19160 51278 52468 gene locus_tag LOCUS_19170 gene phhC 51278 52468 CDS product aromatic-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43336 protein_id gnl|my_center|LOCUS_19170 52503 53432 gene locus_tag LOCUS_19180 52503 53432 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803681.1 protein_id gnl|my_center|LOCUS_19180 54703 53441 gene locus_tag LOCUS_19190 gene uraA 54703 53441 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_19190 55357 54725 gene locus_tag LOCUS_19200 gene upp 55357 54725 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ06 protein_id gnl|my_center|LOCUS_19200 56373 55441 gene locus_tag LOCUS_19210 56373 55441 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 protein_id gnl|my_center|LOCUS_19210 56471 57433 gene locus_tag LOCUS_19220 56471 57433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_19220 57437 57880 gene locus_tag LOCUS_19230 57437 57880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_19230 59109 58090 gene locus_tag LOCUS_19240 59109 58090 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_19240 61454 59223 gene locus_tag LOCUS_19250 61454 59223 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528642.1 protein_id gnl|my_center|LOCUS_19250 61965 61447 gene locus_tag LOCUS_19260 61965 61447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence18 37 1452 gene locus_tag LOCUS_19270 37 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1688 2701 gene locus_tag LOCUS_19280 1688 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2838 3671 gene locus_tag LOCUS_19290 2838 3671 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_19290 4051 5277 gene locus_tag LOCUS_19300 4051 5277 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889455.1 protein_id gnl|my_center|LOCUS_19300 5360 6127 gene locus_tag LOCUS_19310 5360 6127 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_19310 6127 7209 gene locus_tag LOCUS_19320 6127 7209 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_19320 7199 8032 gene locus_tag LOCUS_19330 gene surE 7199 8032 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L02 protein_id gnl|my_center|LOCUS_19330 8112 9782 gene locus_tag LOCUS_19340 8112 9782 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 protein_id gnl|my_center|LOCUS_19340 9819 11906 gene locus_tag LOCUS_19350 gene fadJ 9819 11906 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_19350 11931 13115 gene locus_tag LOCUS_19360 11931 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 protein_id gnl|my_center|LOCUS_19360 13160 14338 gene locus_tag LOCUS_19370 13160 14338 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198292.1 protein_id gnl|my_center|LOCUS_19370 15843 15088 gene locus_tag LOCUS_19380 15843 15088 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085849.1 protein_id gnl|my_center|LOCUS_19380 16025 17227 gene locus_tag LOCUS_19390 gene dcaF 16025 17227 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_19390 17262 18428 gene locus_tag LOCUS_19400 17262 18428 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_19400 18925 18473 gene locus_tag LOCUS_19410 18925 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 19527 19081 gene locus_tag LOCUS_19420 19527 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 20170 20421 gene locus_tag LOCUS_19430 20170 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 22621 20426 gene locus_tag LOCUS_19440 22621 20426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111156.1 protein_id gnl|my_center|LOCUS_19440 23179 24117 gene locus_tag LOCUS_19450 gene cyoA 23179 24117 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBG3 protein_id gnl|my_center|LOCUS_19450 24172 26157 gene locus_tag LOCUS_19460 gene cyoB 24172 26157 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 protein_id gnl|my_center|LOCUS_19460 26214 26810 gene locus_tag LOCUS_19470 gene cyoC 26214 26810 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809221.1 protein_id gnl|my_center|LOCUS_19470 26807 27157 gene locus_tag LOCUS_19480 gene cyoD 26807 27157 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_19480 28958 27444 gene locus_tag LOCUS_19490 28958 27444 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_19490 29102 29758 gene locus_tag LOCUS_19500 gene tal 29102 29758 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM7 protein_id gnl|my_center|LOCUS_19500 29770 30705 gene locus_tag LOCUS_19510 29770 30705 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048617.1 protein_id gnl|my_center|LOCUS_19510 30924 32255 gene locus_tag LOCUS_19520 30924 32255 CDS product sorbitol/mannitol ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972810.1 protein_id gnl|my_center|LOCUS_19520 32330 33298 gene locus_tag LOCUS_19530 32330 33298 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203801.1 protein_id gnl|my_center|LOCUS_19530 33295 34131 gene locus_tag LOCUS_19540 33295 34131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530860.1 protein_id gnl|my_center|LOCUS_19540 34235 35350 gene locus_tag LOCUS_19550 34235 35350 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_19550 35412 36887 gene locus_tag LOCUS_19560 35412 36887 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013396.1 protein_id gnl|my_center|LOCUS_19560 36995 39127 gene locus_tag LOCUS_19570 36995 39127 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884125.1 protein_id gnl|my_center|LOCUS_19570 40500 39454 gene locus_tag LOCUS_19580 40500 39454 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103769.1 protein_id gnl|my_center|LOCUS_19580 40977 40600 gene locus_tag LOCUS_19590 40977 40600 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705627.1 protein_id gnl|my_center|LOCUS_19590 41153 41920 gene locus_tag LOCUS_19600 41153 41920 CDS product iron-hydroxamate transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307174.1 protein_id gnl|my_center|LOCUS_19600 41917 42885 gene locus_tag LOCUS_19610 41917 42885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707922.1 protein_id gnl|my_center|LOCUS_19610 42882 44861 gene locus_tag LOCUS_19620 42882 44861 CDS product Fe3+-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 protein_id gnl|my_center|LOCUS_19620 45256 44858 gene locus_tag LOCUS_19630 45256 44858 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_19630 45318 45980 gene locus_tag LOCUS_19640 45318 45980 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_19640 46174 46974 gene locus_tag LOCUS_19650 46174 46974 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089099.1 protein_id gnl|my_center|LOCUS_19650 48663 47020 gene locus_tag LOCUS_19660 48663 47020 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706138.1 protein_id gnl|my_center|LOCUS_19660 49496 48750 gene locus_tag LOCUS_19670 49496 48750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 49678 51219 gene locus_tag LOCUS_19680 49678 51219 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_19680 53827 51293 gene locus_tag LOCUS_19690 53827 51293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930889.1 protein_id gnl|my_center|LOCUS_19690 54492 53824 gene locus_tag LOCUS_19700 54492 53824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_19700 54519 55190 gene locus_tag LOCUS_19710 gene tesA 54519 55190 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY8 protein_id gnl|my_center|LOCUS_19710 56940 55447 gene locus_tag LOCUS_19720 56940 55447 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_19720 58024 56933 gene locus_tag LOCUS_19730 58024 56933 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence19 531 265 gene locus_tag LOCUS_19740 531 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_19740 2958 790 gene locus_tag LOCUS_19750 gene glcB 2958 790 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 protein_id gnl|my_center|LOCUS_19750 3134 2955 gene locus_tag LOCUS_19760 3134 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4347 3181 gene locus_tag LOCUS_19770 4347 3181 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728729.1 protein_id gnl|my_center|LOCUS_19770 5771 4443 gene locus_tag LOCUS_19780 5771 4443 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_19780 6493 5768 gene locus_tag LOCUS_19790 6493 5768 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_19790 6660 7214 gene locus_tag LOCUS_19800 6660 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 7360 8895 gene locus_tag LOCUS_19810 7360 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_19810 8892 10229 gene locus_tag LOCUS_19820 8892 10229 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123111.1 protein_id gnl|my_center|LOCUS_19820 10271 13357 gene locus_tag LOCUS_19830 gene czcA 10271 13357 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_19830 13479 13928 gene locus_tag LOCUS_19840 13479 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 14790 13921 gene locus_tag LOCUS_19850 14790 13921 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_19850 15968 14787 gene locus_tag LOCUS_19860 15968 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_19860 17569 15968 gene locus_tag LOCUS_19870 17569 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 18387 17566 gene locus_tag LOCUS_19880 gene hemD 18387 17566 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035454.1 protein_id gnl|my_center|LOCUS_19880 19307 18387 gene locus_tag LOCUS_19890 gene hemC 19307 18387 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_19890 20165 19437 gene locus_tag LOCUS_19900 gene algR 20165 19437 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_19900 21214 20162 gene locus_tag LOCUS_19910 21214 20162 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_19910 21319 22710 gene locus_tag LOCUS_19920 gene argH 21319 22710 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_19920 22725 23228 gene locus_tag LOCUS_19930 22725 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 24190 23252 gene locus_tag LOCUS_19940 24190 23252 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919448.1 protein_id gnl|my_center|LOCUS_19940 24189 27215 gene locus_tag LOCUS_19950 24189 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 29162 27312 gene locus_tag LOCUS_19960 gene speA 29162 27312 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 protein_id gnl|my_center|LOCUS_19960 29202 30041 gene locus_tag LOCUS_19970 gene speE 29202 30041 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_19970 31053 30022 gene locus_tag LOCUS_19980 31053 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 31246 31686 gene locus_tag LOCUS_19990 31246 31686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 31807 31983 gene locus_tag LOCUS_20000 31807 31983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 32663 32031 gene locus_tag LOCUS_20010 gene fixJ 32663 32031 CDS product transcriptional regulatory protein FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23221 protein_id gnl|my_center|LOCUS_20010 33040 34296 gene locus_tag LOCUS_20020 33040 34296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 34702 34277 gene locus_tag LOCUS_20030 34702 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 35502 34804 gene locus_tag LOCUS_20040 35502 34804 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_20040 36713 35499 gene locus_tag LOCUS_20050 36713 35499 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040515.1 protein_id gnl|my_center|LOCUS_20050 36864 37127 gene locus_tag LOCUS_20060 36864 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 38756 37416 gene locus_tag LOCUS_20070 38756 37416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_20070 38915 39340 gene locus_tag LOCUS_20080 gene osmC 38915 39340 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404057.1 protein_id gnl|my_center|LOCUS_20080 39581 40063 gene locus_tag LOCUS_20090 gene slyD 39581 40063 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS66 protein_id gnl|my_center|LOCUS_20090 40109 40804 gene locus_tag LOCUS_20100 40109 40804 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_20100 41912 40878 gene locus_tag LOCUS_20110 41912 40878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 42307 43131 gene locus_tag LOCUS_20120 42307 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 43265 44710 gene locus_tag LOCUS_20130 43265 44710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 44991 44809 gene locus_tag LOCUS_20140 44991 44809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 45281 45442 gene locus_tag LOCUS_20150 45281 45442 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 protein_id gnl|my_center|LOCUS_20150 45590 46552 gene locus_tag LOCUS_20160 45590 46552 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_20160 46609 47082 gene locus_tag LOCUS_20170 46609 47082 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528863.1 protein_id gnl|my_center|LOCUS_20170 48505 47093 gene locus_tag LOCUS_20180 gene cry 48505 47093 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_20180 49141 48662 gene locus_tag LOCUS_20190 49141 48662 CDS product spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101282.1 protein_id gnl|my_center|LOCUS_20190 50256 49144 gene locus_tag LOCUS_20200 50256 49144 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_20200 51306 50335 gene locus_tag LOCUS_20210 gene apbA 51306 50335 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F457 protein_id gnl|my_center|LOCUS_20210 52097 51309 gene locus_tag LOCUS_20220 gene surE 52097 51309 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y494 protein_id gnl|my_center|LOCUS_20220 52193 52972 gene locus_tag LOCUS_20230 52193 52972 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_20230 53967 53002 gene locus_tag LOCUS_20240 53967 53002 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_20240 54452 54090 gene locus_tag LOCUS_20250 54452 54090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 54545 54916 gene locus_tag LOCUS_20260 54545 54916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 55074 54922 gene locus_tag LOCUS_20270 55074 54922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 55216 55884 gene locus_tag LOCUS_20280 55216 55884 CDS product glycerol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence20 1108 599 gene locus_tag LOCUS_20290 gene tpx 1108 599 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57668 protein_id gnl|my_center|LOCUS_20290 2487 1108 gene locus_tag LOCUS_20300 gene gcvPA 2487 1108 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B08 protein_id gnl|my_center|LOCUS_20300 2953 2558 gene locus_tag LOCUS_20310 gene gcvH 2953 2558 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHW5 protein_id gnl|my_center|LOCUS_20310 4151 3033 gene locus_tag LOCUS_20320 gene gcvT 4151 3033 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_20320 5745 4543 gene locus_tag LOCUS_20330 gene visC 5745 4543 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 protein_id gnl|my_center|LOCUS_20330 6971 5742 gene locus_tag LOCUS_20340 gene ubiH 6971 5742 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_20340 8305 6968 gene locus_tag LOCUS_20350 gene pepP 8305 6968 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_20350 8847 8302 gene locus_tag LOCUS_20360 8847 8302 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPP0 protein_id gnl|my_center|LOCUS_20360 9626 9183 gene locus_tag LOCUS_20370 9626 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 10905 9628 gene locus_tag LOCUS_20380 10905 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 11293 10937 gene locus_tag LOCUS_20390 11293 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 11418 12569 gene locus_tag LOCUS_20400 11418 12569 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_20400 12627 13970 gene locus_tag LOCUS_20410 gene argA 12627 13970 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 protein_id gnl|my_center|LOCUS_20410 13967 14725 gene locus_tag LOCUS_20420 13967 14725 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T0 protein_id gnl|my_center|LOCUS_20420 15040 14861 gene locus_tag LOCUS_20430 15040 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 15089 16039 gene locus_tag LOCUS_20440 gene gshB 15089 16039 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EKZ8 protein_id gnl|my_center|LOCUS_20440 16099 16653 gene locus_tag LOCUS_20450 16099 16653 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I86 protein_id gnl|my_center|LOCUS_20450 16646 17098 gene locus_tag LOCUS_20460 16646 17098 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_20460 17095 17598 gene locus_tag LOCUS_20470 gene pyrR 17095 17598 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6W6 protein_id gnl|my_center|LOCUS_20470 17621 18598 gene locus_tag LOCUS_20480 gene pyrB 17621 18598 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_20480 19892 18813 gene locus_tag LOCUS_20490 19892 18813 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_20490 21183 20278 gene locus_tag LOCUS_20500 gene rimK 21183 20278 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_20500 21739 21248 gene locus_tag LOCUS_20510 21739 21248 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_20510 22923 21736 gene locus_tag LOCUS_20520 gene pilU 22923 21736 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_20520 23957 22920 gene locus_tag LOCUS_20530 gene pilT 23957 22920 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_20530 24048 24761 gene locus_tag LOCUS_20540 24048 24761 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_20540 24790 25452 gene locus_tag LOCUS_20550 gene rpiA 24790 25452 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z6 protein_id gnl|my_center|LOCUS_20550 25472 25729 gene locus_tag LOCUS_20560 25472 25729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 25732 26169 gene locus_tag LOCUS_20570 25732 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 26191 27108 gene locus_tag LOCUS_20580 gene moaCB 26191 27108 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_20580 27637 27158 gene locus_tag LOCUS_20590 27637 27158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 28519 27752 gene locus_tag LOCUS_20600 28519 27752 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20600 28813 28604 gene locus_tag LOCUS_20610 28813 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 29648 28863 gene locus_tag LOCUS_20620 29648 28863 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V76 protein_id gnl|my_center|LOCUS_20620 30313 29654 gene locus_tag LOCUS_20630 30313 29654 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976190.1 protein_id gnl|my_center|LOCUS_20630 31575 30310 gene locus_tag LOCUS_20640 31575 30310 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 protein_id gnl|my_center|LOCUS_20640 32499 31579 gene locus_tag LOCUS_20650 32499 31579 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316718.1 protein_id gnl|my_center|LOCUS_20650 33271 32552 gene locus_tag LOCUS_20660 33271 32552 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200845.1 protein_id gnl|my_center|LOCUS_20660 33758 34717 gene locus_tag LOCUS_20670 33758 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_20670 34851 36251 gene locus_tag LOCUS_20680 34851 36251 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 protein_id gnl|my_center|LOCUS_20680 37411 36302 gene locus_tag LOCUS_20690 gene modC 37411 36302 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LU2 protein_id gnl|my_center|LOCUS_20690 38091 37408 gene locus_tag LOCUS_20700 gene modB 38091 37408 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_20700 38853 38098 gene locus_tag LOCUS_20710 gene modA 38853 38098 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 protein_id gnl|my_center|LOCUS_20710 39316 39978 gene locus_tag LOCUS_20720 39316 39978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 40343 41194 gene locus_tag LOCUS_20730 40343 41194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708148.1 protein_id gnl|my_center|LOCUS_20730 41187 41969 gene locus_tag LOCUS_20740 41187 41969 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531947.1 protein_id gnl|my_center|LOCUS_20740 41966 42583 gene locus_tag LOCUS_20750 41966 42583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 42729 44567 gene locus_tag LOCUS_20760 42729 44567 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 protein_id gnl|my_center|LOCUS_20760 44574 45500 gene locus_tag LOCUS_20770 44574 45500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066836.1 protein_id gnl|my_center|LOCUS_20770 45500 46369 gene locus_tag LOCUS_20780 45500 46369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061416.1 protein_id gnl|my_center|LOCUS_20780 46908 47667 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgcatgcggggaacgc >Feature sequence21 504 1772 gene locus_tag LOCUS_20790 504 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_20790 1769 2416 gene locus_tag LOCUS_20800 1769 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_20800 2795 2535 gene locus_tag LOCUS_20810 gene vapI 2795 2535 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_20810 3086 2805 gene locus_tag LOCUS_20820 3086 2805 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_20820 5042 3198 gene locus_tag LOCUS_20830 gene lpdA 5042 3198 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD04 protein_id gnl|my_center|LOCUS_20830 5407 5195 gene locus_tag LOCUS_20840 5407 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 5675 5397 gene locus_tag LOCUS_20850 5675 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 7507 5699 gene locus_tag LOCUS_20860 gene phdB 7507 5699 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD06 protein_id gnl|my_center|LOCUS_20860 10288 7598 gene locus_tag LOCUS_20870 gene pdhA 10288 7598 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SL9 protein_id gnl|my_center|LOCUS_20870 10880 10614 gene locus_tag LOCUS_20880 10880 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 11870 10920 gene locus_tag LOCUS_20890 11870 10920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815895.1 protein_id gnl|my_center|LOCUS_20890 11974 12741 gene locus_tag LOCUS_20900 11974 12741 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_20900 14152 12767 gene locus_tag LOCUS_20910 gene trmE 14152 12767 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6D2 protein_id gnl|my_center|LOCUS_20910 15940 14156 gene locus_tag LOCUS_20920 gene yidC 15940 14156 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_20920 16360 15998 gene locus_tag LOCUS_20930 gene rnpA 16360 15998 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_20930 16690 18003 gene locus_tag LOCUS_20940 gene dnaA 16690 18003 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FD8 protein_id gnl|my_center|LOCUS_20940 18259 19359 gene locus_tag LOCUS_20950 gene dnaN 18259 19359 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEH4 protein_id gnl|my_center|LOCUS_20950 19369 20442 gene locus_tag LOCUS_20960 gene recF 19369 20442 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Z0 protein_id gnl|my_center|LOCUS_20960 20594 23014 gene locus_tag LOCUS_20970 gene gyrB 20594 23014 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Y9 protein_id gnl|my_center|LOCUS_20970 23843 23292 gene locus_tag LOCUS_20980 23843 23292 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X71 protein_id gnl|my_center|LOCUS_20980 25921 23840 gene locus_tag LOCUS_20990 gene glyS 25921 23840 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9W7 protein_id gnl|my_center|LOCUS_20990 26820 25918 gene locus_tag LOCUS_21000 gene glyQ 26820 25918 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_21000 27085 28491 gene locus_tag LOCUS_21010 27085 28491 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_21010 28587 29144 gene locus_tag LOCUS_21020 28587 29144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 29198 30274 gene locus_tag LOCUS_21030 gene ntrB 29198 30274 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_21030 30312 31787 gene locus_tag LOCUS_21040 gene ntrC 30312 31787 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_21040 31870 32655 gene locus_tag LOCUS_21050 31870 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_21050 32652 34586 gene locus_tag LOCUS_21060 32652 34586 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_21060 35707 34583 gene locus_tag LOCUS_21070 35707 34583 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_21070 36088 37845 gene locus_tag LOCUS_21080 36088 37845 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_21080 37842 41723 gene locus_tag LOCUS_21090 37842 41723 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_21090 42640 42083 gene locus_tag LOCUS_21100 42640 42083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266302.1 protein_id gnl|my_center|LOCUS_21100 43306 42644 gene locus_tag LOCUS_21110 43306 42644 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_21110 43477 44586 gene locus_tag LOCUS_21120 43477 44586 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KES6 protein_id gnl|my_center|LOCUS_21120 44599 45447 gene locus_tag LOCUS_21130 gene frmB 44599 45447 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_21130 45495 45755 gene locus_tag LOCUS_21140 45495 45755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 45762 47024 gene locus_tag LOCUS_21150 gene lysA 45762 47024 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_21150 >Feature sequence22 1330 170 gene locus_tag LOCUS_21160 gene pqqE 1330 170 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A84 protein_id gnl|my_center|LOCUS_21160 2709 1816 gene locus_tag LOCUS_21170 2709 1816 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_21170 2949 3824 gene locus_tag LOCUS_21180 2949 3824 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930765.1 protein_id gnl|my_center|LOCUS_21180 4518 4024 gene locus_tag LOCUS_21190 gene coaD 4518 4024 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329M3 protein_id gnl|my_center|LOCUS_21190 5147 4515 gene locus_tag LOCUS_21200 5147 4515 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195251.1 protein_id gnl|my_center|LOCUS_21200 6604 5150 gene locus_tag LOCUS_21210 6604 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_21210 7882 6905 gene locus_tag LOCUS_21220 gene qor 7882 6905 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43903 protein_id gnl|my_center|LOCUS_21220 8741 7899 gene locus_tag LOCUS_21230 8741 7899 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_21230 12750 8818 gene locus_tag LOCUS_21240 12750 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 14465 12960 gene locus_tag LOCUS_21250 gene rng 14465 12960 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_21250 15071 14601 gene locus_tag LOCUS_21260 gene rlmH 15071 14601 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_21260 15498 15082 gene locus_tag LOCUS_21270 15498 15082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 16181 15495 gene locus_tag LOCUS_21280 gene nadD 16181 15495 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_21280 17475 16171 gene locus_tag LOCUS_21290 gene proA 17475 16171 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_21290 18530 17472 gene locus_tag LOCUS_21300 gene holA 18530 17472 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_21300 19302 18541 gene locus_tag LOCUS_21310 gene speD 19302 18541 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FX4 protein_id gnl|my_center|LOCUS_21310 19802 19383 gene locus_tag LOCUS_21320 19802 19383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_21320 21476 19947 gene locus_tag LOCUS_21330 21476 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 22010 21777 gene locus_tag LOCUS_21340 22010 21777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 23023 22217 gene locus_tag LOCUS_21350 gene trpC 23023 22217 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 protein_id gnl|my_center|LOCUS_21350 24067 23030 gene locus_tag LOCUS_21360 gene trpD 24067 23030 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_21360 24669 24064 gene locus_tag LOCUS_21370 gene trpG 24669 24064 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_21370 26197 24671 gene locus_tag LOCUS_21380 gene trpE 26197 24671 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20580 protein_id gnl|my_center|LOCUS_21380 26751 27047 gene locus_tag LOCUS_21390 26751 27047 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_21390 27790 27086 gene locus_tag LOCUS_21400 gene rpe 27790 27086 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU62 protein_id gnl|my_center|LOCUS_21400 27904 28551 gene locus_tag LOCUS_21410 27904 28551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21410 28663 28785 gene locus_tag LOCUS_21420 28663 28785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21420 29442 28807 gene locus_tag LOCUS_21430 29442 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 30348 29476 gene locus_tag LOCUS_21440 gene prpB 30348 29476 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_21440 31850 30381 gene locus_tag LOCUS_21450 gene putA 31850 30381 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_21450 32548 31940 gene locus_tag LOCUS_21460 32548 31940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 32745 33926 gene locus_tag LOCUS_21470 32745 33926 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_21470 34060 34227 gene locus_tag LOCUS_21480 gene rubA1 34060 34227 CDS product Rubredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK7 protein_id gnl|my_center|LOCUS_21480 34331 35488 gene locus_tag LOCUS_21490 gene rubB 34331 35488 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 protein_id gnl|my_center|LOCUS_21490 36688 35558 gene locus_tag LOCUS_21500 36688 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_21500 37208 36699 gene locus_tag LOCUS_21510 37208 36699 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_21510 37744 40767 gene locus_tag LOCUS_21520 gene nrdA 37744 40767 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886B0 protein_id gnl|my_center|LOCUS_21520 40863 42059 gene locus_tag LOCUS_21530 gene nrdB 40863 42059 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BF5 protein_id gnl|my_center|LOCUS_21530 42216 43535 gene locus_tag LOCUS_21540 42216 43535 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 protein_id gnl|my_center|LOCUS_21540 43528 44103 gene locus_tag LOCUS_21550 43528 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence23 2187 3677 gene locus_tag LOCUS_21560 2187 3677 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138556.1 protein_id gnl|my_center|LOCUS_21560 4118 4690 gene locus_tag LOCUS_21570 4118 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 5254 4814 gene locus_tag LOCUS_21580 5254 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 6404 6889 gene locus_tag LOCUS_21590 6404 6889 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973282.1 protein_id gnl|my_center|LOCUS_21590 7097 7714 gene locus_tag LOCUS_21600 7097 7714 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038852.1 protein_id gnl|my_center|LOCUS_21600 9300 8014 gene locus_tag LOCUS_21610 9300 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_21610 9624 9974 gene locus_tag LOCUS_21620 9624 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_21620 10331 11839 gene locus_tag LOCUS_21630 10331 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_21630 11856 12272 gene locus_tag LOCUS_21640 11856 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 12737 13909 gene locus_tag LOCUS_21650 12737 13909 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804109.1 protein_id gnl|my_center|LOCUS_21650 13906 14946 gene locus_tag LOCUS_21660 13906 14946 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804110.1 protein_id gnl|my_center|LOCUS_21660 14993 16234 gene locus_tag LOCUS_21670 gene ndh 14993 16234 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808608.1 protein_id gnl|my_center|LOCUS_21670 16325 16648 gene locus_tag LOCUS_21680 16325 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073455.1 protein_id gnl|my_center|LOCUS_21680 16653 17690 gene locus_tag LOCUS_21690 16653 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204911.1 protein_id gnl|my_center|LOCUS_21690 17854 18348 gene locus_tag LOCUS_21700 17854 18348 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_21700 18381 20717 gene locus_tag LOCUS_21710 gene katG 18381 20717 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNN4 protein_id gnl|my_center|LOCUS_21710 20852 21169 gene locus_tag LOCUS_21720 20852 21169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_21720 21988 21218 gene locus_tag LOCUS_21730 21988 21218 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532969.1 protein_id gnl|my_center|LOCUS_21730 23511 22093 gene locus_tag LOCUS_21740 gene xylE 23511 22093 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_21740 24659 23919 gene locus_tag LOCUS_21750 gene pdhR 24659 23919 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009388335.1 protein_id gnl|my_center|LOCUS_21750 24900 26249 gene locus_tag LOCUS_21760 24900 26249 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_21760 26298 27263 gene locus_tag LOCUS_21770 26298 27263 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976259.1 protein_id gnl|my_center|LOCUS_21770 27284 28234 gene locus_tag LOCUS_21780 27284 28234 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898171.1 protein_id gnl|my_center|LOCUS_21780 28764 28180 gene locus_tag LOCUS_21790 28764 28180 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBF1 protein_id gnl|my_center|LOCUS_21790 28887 29666 gene locus_tag LOCUS_21800 28887 29666 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881615.1 protein_id gnl|my_center|LOCUS_21800 30887 29688 gene locus_tag LOCUS_21810 gene ilvE 30887 29688 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC84 protein_id gnl|my_center|LOCUS_21810 31327 30902 gene locus_tag LOCUS_21820 gene attT 31327 30902 CDS product AttT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 protein_id gnl|my_center|LOCUS_21820 32058 31324 gene locus_tag LOCUS_21830 32058 31324 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_21830 32197 32445 gene locus_tag LOCUS_21840 32197 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 32703 32627 gene locus_tag LOCUS_t00390 32703 32627 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33690 32776 gene locus_tag LOCUS_21850 33690 32776 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_21850 33883 34359 gene locus_tag LOCUS_21860 33883 34359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 34492 36825 gene locus_tag LOCUS_21870 34492 36825 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_21870 36929 37183 gene locus_tag LOCUS_21880 36929 37183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 37623 37234 gene locus_tag LOCUS_21890 37623 37234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 38039 39349 gene locus_tag LOCUS_21900 gene atoE 38039 39349 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_21900 40210 39344 gene locus_tag LOCUS_21910 40210 39344 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 protein_id gnl|my_center|LOCUS_21910 40487 40305 gene locus_tag LOCUS_21920 40487 40305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 40679 42238 gene locus_tag LOCUS_21930 40679 42238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 42338 43336 gene locus_tag LOCUS_21940 42338 43336 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_21940 43344 44162 gene locus_tag LOCUS_21950 43344 44162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence24 1459 86 gene locus_tag LOCUS_21960 1459 86 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957472.1 protein_id gnl|my_center|LOCUS_21960 1671 4616 gene locus_tag LOCUS_21970 gene uvrA 1671 4616 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_21970 5671 4916 gene locus_tag LOCUS_21980 5671 4916 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_21980 6642 5668 gene locus_tag LOCUS_21990 gene rluD 6642 5668 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_21990 6762 7688 gene locus_tag LOCUS_22000 6762 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 9371 7755 gene locus_tag LOCUS_22010 gene nadE 9371 7755 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038206.1 protein_id gnl|my_center|LOCUS_22010 9829 9383 gene locus_tag LOCUS_22020 9829 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539285.1 protein_id gnl|my_center|LOCUS_22020 10360 9938 gene locus_tag LOCUS_22030 10360 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539285.1 protein_id gnl|my_center|LOCUS_22030 11432 10563 gene locus_tag LOCUS_22040 gene sucD 11432 10563 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHF4 protein_id gnl|my_center|LOCUS_22040 12642 11479 gene locus_tag LOCUS_22050 gene sucC 12642 11479 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY39 protein_id gnl|my_center|LOCUS_22050 12778 12993 gene locus_tag LOCUS_22060 12778 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 13014 14240 gene locus_tag LOCUS_22070 gene pilC 13014 14240 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_22070 14240 15121 gene locus_tag LOCUS_22080 gene pilD 14240 15121 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2R3 protein_id gnl|my_center|LOCUS_22080 15207 15848 gene locus_tag LOCUS_22090 gene coaE 15207 15848 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR62 protein_id gnl|my_center|LOCUS_22090 15916 16680 gene locus_tag LOCUS_22100 gene zapD 15916 16680 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F03 protein_id gnl|my_center|LOCUS_22100 16665 16910 gene locus_tag LOCUS_22110 16665 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 17970 17002 gene locus_tag LOCUS_22120 17970 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 protein_id gnl|my_center|LOCUS_22120 19184 17970 gene locus_tag LOCUS_22130 gene argJ 19184 17970 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAT7 protein_id gnl|my_center|LOCUS_22130 22047 19228 gene locus_tag LOCUS_22140 gene secA 22047 19228 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPW5 protein_id gnl|my_center|LOCUS_22140 22214 22666 gene locus_tag LOCUS_22150 22214 22666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 24574 22862 gene locus_tag LOCUS_22160 24574 22862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_22160 24830 26083 gene locus_tag LOCUS_22170 24830 26083 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_22170 27048 26050 gene locus_tag LOCUS_22180 27048 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 27763 27041 gene locus_tag LOCUS_22190 27763 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 28764 27760 gene locus_tag LOCUS_22200 28764 27760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 31298 28833 gene locus_tag LOCUS_22210 31298 28833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 32310 31372 gene locus_tag LOCUS_22220 32310 31372 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_22220 33150 32389 gene locus_tag LOCUS_22230 33150 32389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141101.1 protein_id gnl|my_center|LOCUS_22230 33949 33194 gene locus_tag LOCUS_22240 33949 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 35119 33959 gene locus_tag LOCUS_22250 35119 33959 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_22250 35412 35164 gene locus_tag LOCUS_22260 35412 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 38125 36353 gene locus_tag LOCUS_22270 38125 36353 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_22270 38526 39767 gene locus_tag LOCUS_22280 38526 39767 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331688.1 protein_id gnl|my_center|LOCUS_22280 39767 40549 gene locus_tag LOCUS_22290 39767 40549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919037.1 protein_id gnl|my_center|LOCUS_22290 40605 41576 gene locus_tag LOCUS_22300 40605 41576 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence25 25 1431 gene locus_tag LOCUS_22310 gene ffh 25 1431 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LS7 protein_id gnl|my_center|LOCUS_22310 1860 2267 gene locus_tag LOCUS_22320 1860 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2277 2807 gene locus_tag LOCUS_22330 gene rimM 2277 2807 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG24 protein_id gnl|my_center|LOCUS_22330 2816 3574 gene locus_tag LOCUS_22340 gene trmD 2816 3574 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBC1 protein_id gnl|my_center|LOCUS_22340 3688 4038 gene locus_tag LOCUS_22350 gene rplS 3688 4038 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH7 protein_id gnl|my_center|LOCUS_22350 4736 4155 gene locus_tag LOCUS_22360 4736 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5763 4747 gene locus_tag LOCUS_22370 gene trxB 5763 4747 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39916 protein_id gnl|my_center|LOCUS_22370 5908 7737 gene locus_tag LOCUS_22380 5908 7737 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQK4 protein_id gnl|my_center|LOCUS_22380 7749 8729 gene locus_tag LOCUS_22390 7749 8729 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482408.1 protein_id gnl|my_center|LOCUS_22390 9748 8942 gene locus_tag LOCUS_22400 9748 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 9843 11009 gene locus_tag LOCUS_22410 9843 11009 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_22410 12171 11032 gene locus_tag LOCUS_22420 12171 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_22420 12961 12191 gene locus_tag LOCUS_22430 12961 12191 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 protein_id gnl|my_center|LOCUS_22430 12997 13992 gene locus_tag LOCUS_22440 gene egtD 12997 13992 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5M8 protein_id gnl|my_center|LOCUS_22440 14938 14036 gene locus_tag LOCUS_22450 gene argF 14938 14036 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_22450 15718 15089 gene locus_tag LOCUS_22460 15718 15089 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNN7 protein_id gnl|my_center|LOCUS_22460 15876 16211 gene locus_tag LOCUS_22470 15876 16211 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QE8 protein_id gnl|my_center|LOCUS_22470 16276 17043 gene locus_tag LOCUS_22480 16276 17043 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_22480 17837 17040 gene locus_tag LOCUS_22490 17837 17040 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388877.1 protein_id gnl|my_center|LOCUS_22490 20419 18050 gene locus_tag LOCUS_22500 gene ppsA 20419 18050 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_22500 20587 21426 gene locus_tag LOCUS_22510 20587 21426 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZW4 protein_id gnl|my_center|LOCUS_22510 21462 21941 gene locus_tag LOCUS_22520 21462 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 23685 21943 gene locus_tag LOCUS_22530 23685 21943 CDS product K(+)/H(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207451.1 protein_id gnl|my_center|LOCUS_22530 23854 24684 gene locus_tag LOCUS_22540 23854 24684 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN7 protein_id gnl|my_center|LOCUS_22540 25257 24899 gene locus_tag LOCUS_tm00010 25257 24899 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 26078 25596 gene locus_tag LOCUS_22550 gene smpB 26078 25596 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_22550 26116 27480 gene locus_tag LOCUS_22560 26116 27480 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930606.1 protein_id gnl|my_center|LOCUS_22560 27477 27800 gene locus_tag LOCUS_22570 27477 27800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 28438 27785 gene locus_tag LOCUS_22580 28438 27785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 30275 28593 gene locus_tag LOCUS_22590 gene recN 30275 28593 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI9 protein_id gnl|my_center|LOCUS_22590 31616 30657 gene locus_tag LOCUS_22600 gene nadK 31616 30657 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_22600 31793 32395 gene locus_tag LOCUS_22610 gene grpE 31793 32395 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFG6 protein_id gnl|my_center|LOCUS_22610 32507 34453 gene locus_tag LOCUS_22620 gene dnaK 32507 34453 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY3 protein_id gnl|my_center|LOCUS_22620 34590 35729 gene locus_tag LOCUS_22630 gene dnaJ 34590 35729 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD6 protein_id gnl|my_center|LOCUS_22630 35732 36547 gene locus_tag LOCUS_22640 gene dapB 35732 36547 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04036 protein_id gnl|my_center|LOCUS_22640 36646 37782 gene locus_tag LOCUS_22650 gene carA 36646 37782 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ0 protein_id gnl|my_center|LOCUS_22650 >Feature sequence26 2045 1053 gene locus_tag LOCUS_22660 2045 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3211 2228 gene locus_tag LOCUS_22670 3211 2228 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205374.1 protein_id gnl|my_center|LOCUS_22670 3502 4629 gene locus_tag LOCUS_22680 3502 4629 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402615.1 protein_id gnl|my_center|LOCUS_22680 4852 5415 gene locus_tag LOCUS_22690 4852 5415 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533075.1 protein_id gnl|my_center|LOCUS_22690 5412 6941 gene locus_tag LOCUS_22700 5412 6941 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533074.1 protein_id gnl|my_center|LOCUS_22700 6978 8087 gene locus_tag LOCUS_22710 6978 8087 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533073.1 protein_id gnl|my_center|LOCUS_22710 8136 9116 gene locus_tag LOCUS_22720 8136 9116 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533072.1 protein_id gnl|my_center|LOCUS_22720 9180 10925 gene locus_tag LOCUS_22730 9180 10925 CDS product erythrulose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 protein_id gnl|my_center|LOCUS_22730 10922 11404 gene locus_tag LOCUS_22740 10922 11404 CDS product D-erythrulose-4-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027217.1 protein_id gnl|my_center|LOCUS_22740 11385 12158 gene locus_tag LOCUS_22750 11385 12158 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJR2 protein_id gnl|my_center|LOCUS_22750 13083 12166 gene locus_tag LOCUS_22760 gene rbsK 13083 12166 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUH4 protein_id gnl|my_center|LOCUS_22760 13917 13162 gene locus_tag LOCUS_22770 13917 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 protein_id gnl|my_center|LOCUS_22770 14337 13921 gene locus_tag LOCUS_22780 14337 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 15512 14403 gene locus_tag LOCUS_22790 gene ddl 15512 14403 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPI5 protein_id gnl|my_center|LOCUS_22790 15699 17654 gene locus_tag LOCUS_22800 gene htpG 15699 17654 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EL0 protein_id gnl|my_center|LOCUS_22800 17827 18132 gene locus_tag LOCUS_22810 17827 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 18229 18468 gene locus_tag LOCUS_22820 18229 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 19422 18598 gene locus_tag LOCUS_22830 19422 18598 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_22830 19716 20486 gene locus_tag LOCUS_22840 19716 20486 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706532.1 protein_id gnl|my_center|LOCUS_22840 21100 21477 gene locus_tag LOCUS_22850 21100 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 21635 21976 gene locus_tag LOCUS_22860 21635 21976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 22330 22569 gene locus_tag LOCUS_22870 22330 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 22678 23259 gene locus_tag LOCUS_22880 22678 23259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 23394 23690 gene locus_tag LOCUS_22890 23394 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 23821 24417 gene locus_tag LOCUS_22900 23821 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 24940 25527 gene locus_tag LOCUS_22910 24940 25527 CDS product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531899.1 protein_id gnl|my_center|LOCUS_22910 26271 25597 gene locus_tag LOCUS_22920 26271 25597 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_22920 27807 26377 gene locus_tag LOCUS_22930 27807 26377 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_22930 28317 27817 gene locus_tag LOCUS_22940 28317 27817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 29463 28459 gene locus_tag LOCUS_22950 29463 28459 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530708.1 protein_id gnl|my_center|LOCUS_22950 31756 30179 gene locus_tag LOCUS_22960 31756 30179 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037195.1 protein_id gnl|my_center|LOCUS_22960 32178 31753 gene locus_tag LOCUS_22970 32178 31753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037194.1 protein_id gnl|my_center|LOCUS_22970 32618 32977 gene locus_tag LOCUS_22980 32618 32977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 32995 34998 gene locus_tag LOCUS_22990 32995 34998 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829735.1 protein_id gnl|my_center|LOCUS_22990 35169 36293 gene locus_tag LOCUS_23000 35169 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence27 94 1137 gene locus_tag LOCUS_23010 94 1137 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337193.1 protein_id gnl|my_center|LOCUS_23010 1393 1211 gene locus_tag LOCUS_23020 1393 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2446 1592 gene locus_tag LOCUS_23030 gene dsbG 2446 1592 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I106 protein_id gnl|my_center|LOCUS_23030 3984 2521 gene locus_tag LOCUS_23040 3984 2521 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943333.1 protein_id gnl|my_center|LOCUS_23040 7118 4038 gene locus_tag LOCUS_23050 7118 4038 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268045.1 protein_id gnl|my_center|LOCUS_23050 8317 7118 gene locus_tag LOCUS_23060 gene mexA 8317 7118 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037813.1 protein_id gnl|my_center|LOCUS_23060 8440 9222 gene locus_tag LOCUS_23070 gene ubiE 8440 9222 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_23070 9219 9854 gene locus_tag LOCUS_23080 9219 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 9854 11497 gene locus_tag LOCUS_23090 gene ubiB 9854 11497 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF8 protein_id gnl|my_center|LOCUS_23090 11530 12072 gene locus_tag LOCUS_23100 11530 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 13667 12054 gene locus_tag LOCUS_23110 13667 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 14898 13744 gene locus_tag LOCUS_23120 14898 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345157.1 protein_id gnl|my_center|LOCUS_23120 15053 15478 gene locus_tag LOCUS_23130 15053 15478 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_23130 15496 15975 gene locus_tag LOCUS_23140 gene secB 15496 15975 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKP0 protein_id gnl|my_center|LOCUS_23140 15982 16992 gene locus_tag LOCUS_23150 gene gpsA 15982 16992 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF08 protein_id gnl|my_center|LOCUS_23150 17116 17736 gene locus_tag LOCUS_23160 gene pgsA3 17116 17736 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068034.1 protein_id gnl|my_center|LOCUS_23160 17738 18400 gene locus_tag LOCUS_23170 17738 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703190.1 protein_id gnl|my_center|LOCUS_23170 18861 18397 gene locus_tag LOCUS_23180 gene trmL 18861 18397 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ6 protein_id gnl|my_center|LOCUS_23180 19527 19186 gene locus_tag LOCUS_23190 19527 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 19602 19958 gene locus_tag LOCUS_23200 19602 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_23200 20066 21973 gene locus_tag LOCUS_23210 20066 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_23210 21976 22533 gene locus_tag LOCUS_23220 gene ampD 21976 22533 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_23220 22566 23408 gene locus_tag LOCUS_23230 22566 23408 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907861.1 protein_id gnl|my_center|LOCUS_23230 24093 23413 gene locus_tag LOCUS_23240 24093 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_23240 24317 24799 gene locus_tag LOCUS_23250 gene rppH 24317 24799 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_23250 24901 25149 gene locus_tag LOCUS_23260 24901 25149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 25221 25730 gene locus_tag LOCUS_23270 gene bfrB 25221 25730 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_23270 26236 25811 gene locus_tag LOCUS_23280 26236 25811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_23280 28212 26335 gene locus_tag LOCUS_23290 28212 26335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 28287 29333 gene locus_tag LOCUS_23300 gene argC 28287 29333 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_23300 29473 29847 gene locus_tag LOCUS_23310 gene erpA 29473 29847 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUW2 protein_id gnl|my_center|LOCUS_23310 31213 30056 gene locus_tag LOCUS_23320 gene anmK 31213 30056 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_23320 32698 31217 gene locus_tag LOCUS_23330 32698 31217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 33025 34269 gene locus_tag LOCUS_23340 gene tyrS 33025 34269 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_23340 >Feature sequence28 957 1577 gene locus_tag LOCUS_23350 957 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 protein_id gnl|my_center|LOCUS_23350 1692 2579 gene locus_tag LOCUS_23360 1692 2579 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263960.1 protein_id gnl|my_center|LOCUS_23360 3406 5199 gene locus_tag LOCUS_23370 3406 5199 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_23370 6138 6779 gene locus_tag LOCUS_23380 6138 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6912 7427 gene locus_tag LOCUS_23390 6912 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 7420 7629 gene locus_tag LOCUS_23400 7420 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 8085 7696 gene locus_tag LOCUS_23410 8085 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 10257 8173 gene locus_tag LOCUS_23420 10257 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23420 10968 10381 gene locus_tag LOCUS_23430 10968 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23430 11130 11705 gene locus_tag LOCUS_23440 11130 11705 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_23440 11795 12118 gene locus_tag LOCUS_23450 11795 12118 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_23450 12635 12126 gene locus_tag LOCUS_23460 12635 12126 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_23460 13553 12639 gene locus_tag LOCUS_23470 gene xerD 13553 12639 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY5 protein_id gnl|my_center|LOCUS_23470 13598 14692 gene locus_tag LOCUS_23480 gene zapE 13598 14692 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX0 protein_id gnl|my_center|LOCUS_23480 14806 16398 gene locus_tag LOCUS_23490 14806 16398 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889132.1 protein_id gnl|my_center|LOCUS_23490 21258 16459 gene locus_tag LOCUS_23500 21258 16459 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_23500 21999 21337 gene locus_tag LOCUS_23510 gene hmgA 21999 21337 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_23510 22075 22440 gene locus_tag LOCUS_23520 22075 22440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 22538 24517 gene locus_tag LOCUS_23530 22538 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 25829 24603 gene locus_tag LOCUS_23540 25829 24603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 26886 26026 gene locus_tag LOCUS_23550 gene cobB 26886 26026 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM9 protein_id gnl|my_center|LOCUS_23550 27533 26883 gene locus_tag LOCUS_23560 27533 26883 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087592.1 protein_id gnl|my_center|LOCUS_23560 27845 27576 gene locus_tag LOCUS_23570 27845 27576 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_23570 28390 27884 gene locus_tag LOCUS_23580 gene folA 28390 27884 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_23580 29199 28393 gene locus_tag LOCUS_23590 gene thyA 29199 28393 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_23590 30014 29199 gene locus_tag LOCUS_23600 gene lgt 30014 29199 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_23600 30602 30063 gene locus_tag LOCUS_23610 30602 30063 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385055.1 protein_id gnl|my_center|LOCUS_23610 31599 30652 gene locus_tag LOCUS_23620 31599 30652 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_23620 32756 31821 gene locus_tag LOCUS_23630 32756 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527657.1 protein_id gnl|my_center|LOCUS_23630 <33914 32913 gene locus_tag LOCUS_23640 <33914 32913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZZ97:putative glycine dehydrogenase (decarboxylating) subunit 2 >Feature sequence29 1 507 gene locus_tag LOCUS_23650 1 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 692 1330 gene locus_tag LOCUS_23660 692 1330 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_23660 1330 2001 gene locus_tag LOCUS_23670 1330 2001 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_23670 3024 2023 gene locus_tag LOCUS_23680 3024 2023 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_23680 3228 3695 gene locus_tag LOCUS_23690 gene omp 3228 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_23690 3791 4216 gene locus_tag LOCUS_23700 3791 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_23700 5347 4262 gene locus_tag LOCUS_23710 5347 4262 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037275.1 protein_id gnl|my_center|LOCUS_23710 5450 6388 gene locus_tag LOCUS_23720 5450 6388 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_23720 6473 8182 gene locus_tag LOCUS_23730 6473 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 8239 9018 gene locus_tag LOCUS_23740 8239 9018 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_23740 9055 10107 gene locus_tag LOCUS_23750 9055 10107 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_23750 10118 10936 gene locus_tag LOCUS_23760 10118 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 12251 11007 gene locus_tag LOCUS_23770 12251 11007 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_23770 12465 13466 gene locus_tag LOCUS_23780 12465 13466 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_23780 13598 15055 gene locus_tag LOCUS_23790 13598 15055 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970931.1 protein_id gnl|my_center|LOCUS_23790 16012 17022 gene locus_tag LOCUS_23800 16012 17022 CDS product acetylpolyamine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526398.1 protein_id gnl|my_center|LOCUS_23800 17197 17820 gene locus_tag LOCUS_23810 17197 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 18413 18889 gene locus_tag LOCUS_23820 18413 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920550.1 protein_id gnl|my_center|LOCUS_23820 18893 19606 gene locus_tag LOCUS_23830 18893 19606 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920549.1 protein_id gnl|my_center|LOCUS_23830 19742 20125 gene locus_tag LOCUS_23840 19742 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 20248 21204 gene locus_tag LOCUS_23850 20248 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 21321 21656 gene locus_tag LOCUS_23860 21321 21656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 21826 22230 gene locus_tag LOCUS_23870 21826 22230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 22358 22828 gene locus_tag LOCUS_23880 22358 22828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 22943 23587 gene locus_tag LOCUS_23890 22943 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 23580 24173 gene locus_tag LOCUS_23900 23580 24173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 24256 24519 gene locus_tag LOCUS_23910 24256 24519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 26058 25201 gene locus_tag LOCUS_23920 gene purU1 26058 25201 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_23920 26215 27333 gene locus_tag LOCUS_23930 gene rsgA 26215 27333 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5H9 protein_id gnl|my_center|LOCUS_23930 27528 27881 gene locus_tag LOCUS_23940 27528 27881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 28364 27990 gene locus_tag LOCUS_23950 28364 27990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 29972 28587 gene locus_tag LOCUS_23960 gene dbpA 29972 28587 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814910.1 protein_id gnl|my_center|LOCUS_23960 31036 30185 gene locus_tag LOCUS_23970 gene yhiR 31036 30185 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8K5 protein_id gnl|my_center|LOCUS_23970 31195 33420 gene locus_tag LOCUS_23980 31195 33420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence30 1883 2962 gene locus_tag LOCUS_23990 gene aroG 1883 2962 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0I2 protein_id gnl|my_center|LOCUS_23990 5058 3028 gene locus_tag LOCUS_24000 5058 3028 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 protein_id gnl|my_center|LOCUS_24000 5135 5476 gene locus_tag LOCUS_24010 5135 5476 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_24010 5604 6425 gene locus_tag LOCUS_24020 gene folE2 5604 6425 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DU0 protein_id gnl|my_center|LOCUS_24020 6945 7592 gene locus_tag LOCUS_24030 gene lexA 6945 7592 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37452 protein_id gnl|my_center|LOCUS_24030 8650 7679 gene locus_tag LOCUS_24040 8650 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 9108 8653 gene locus_tag LOCUS_24050 9108 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 9934 9275 gene locus_tag LOCUS_24060 9934 9275 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_24060 10935 9940 gene locus_tag LOCUS_24070 10935 9940 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_24070 11092 13440 gene locus_tag LOCUS_24080 gene lptD 11092 13440 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU13 protein_id gnl|my_center|LOCUS_24080 13468 14883 gene locus_tag LOCUS_24090 gene surA 13468 14883 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_24090 14880 15869 gene locus_tag LOCUS_24100 gene pdxA 14880 15869 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58719 protein_id gnl|my_center|LOCUS_24100 15859 16635 gene locus_tag LOCUS_24110 gene rsmA 15859 16635 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_24110 16644 18137 gene locus_tag LOCUS_24120 16644 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089875.1 protein_id gnl|my_center|LOCUS_24120 18183 19004 gene locus_tag LOCUS_24130 gene apaH 18183 19004 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AB7 protein_id gnl|my_center|LOCUS_24130 19760 19371 gene locus_tag LOCUS_24140 gene rplQ 19760 19371 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3E6 protein_id gnl|my_center|LOCUS_24140 20804 19812 gene locus_tag LOCUS_24150 gene rpoA 20804 19812 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0Y1 protein_id gnl|my_center|LOCUS_24150 21462 20839 gene locus_tag LOCUS_24160 gene rpsD 21462 20839 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5V1 protein_id gnl|my_center|LOCUS_24160 21889 21488 gene locus_tag LOCUS_24170 gene rpsK 21889 21488 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0X2 protein_id gnl|my_center|LOCUS_24170 22264 21926 gene locus_tag LOCUS_24180 gene rpsM 22264 21926 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF42 protein_id gnl|my_center|LOCUS_24180 23905 22562 gene locus_tag LOCUS_24190 gene secY 23905 22562 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P78283 protein_id gnl|my_center|LOCUS_24190 24339 23908 gene locus_tag LOCUS_24200 gene rplO 24339 23908 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM4 protein_id gnl|my_center|LOCUS_24200 24526 24341 gene locus_tag LOCUS_24210 gene rpmD 24526 24341 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS9 protein_id gnl|my_center|LOCUS_24210 25048 24539 gene locus_tag LOCUS_24220 gene rpsE 25048 24539 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B48 protein_id gnl|my_center|LOCUS_24220 25417 25061 gene locus_tag LOCUS_24230 gene rplR 25417 25061 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR0 protein_id gnl|my_center|LOCUS_24230 25983 25453 gene locus_tag LOCUS_24240 gene rplF 25983 25453 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I3 protein_id gnl|my_center|LOCUS_24240 26399 26004 gene locus_tag LOCUS_24250 gene rpsH 26399 26004 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK55 protein_id gnl|my_center|LOCUS_24250 26731 26426 gene locus_tag LOCUS_24260 gene rpsN 26731 26426 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5U0 protein_id gnl|my_center|LOCUS_24260 27298 26735 gene locus_tag LOCUS_24270 gene rplE 27298 26735 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYN1 protein_id gnl|my_center|LOCUS_24270 27638 27306 gene locus_tag LOCUS_24280 gene rplX 27638 27306 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER5 protein_id gnl|my_center|LOCUS_24280 28000 27635 gene locus_tag LOCUS_24290 gene rplN 28000 27635 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W1 protein_id gnl|my_center|LOCUS_24290 28306 28007 gene locus_tag LOCUS_24300 gene rpsQ 28306 28007 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBE8 protein_id gnl|my_center|LOCUS_24300 28506 28312 gene locus_tag LOCUS_24310 gene rpmC 28506 28312 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF29 protein_id gnl|my_center|LOCUS_24310 28929 28516 gene locus_tag LOCUS_24320 gene rplP 28929 28516 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYN6 protein_id gnl|my_center|LOCUS_24320 29613 28936 gene locus_tag LOCUS_24330 gene rpsC 29613 28936 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_24330 29971 29639 gene locus_tag LOCUS_24340 gene rplV 29971 29639 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY9 protein_id gnl|my_center|LOCUS_24340 30256 29987 gene locus_tag LOCUS_24350 gene rpsS 30256 29987 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK64 protein_id gnl|my_center|LOCUS_24350 31120 30284 gene locus_tag LOCUS_24360 gene rplB 31120 30284 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY7 protein_id gnl|my_center|LOCUS_24360 31441 31139 gene locus_tag LOCUS_24370 gene rplW 31441 31139 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44361 protein_id gnl|my_center|LOCUS_24370 32046 31438 gene locus_tag LOCUS_24380 gene rplD 32046 31438 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY5 protein_id gnl|my_center|LOCUS_24380 32778 32074 gene locus_tag LOCUS_24390 gene rplC 32778 32074 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF21 protein_id gnl|my_center|LOCUS_24390 33238 32924 gene locus_tag LOCUS_24400 gene rpsJ 33238 32924 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67905 protein_id gnl|my_center|LOCUS_24400 >Feature sequence31 948 88 gene locus_tag LOCUS_24410 948 88 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_24410 2855 948 gene locus_tag LOCUS_24420 gene dsbD2 2855 948 CDS product thiol:disulfide interchange protein DsbD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I104 protein_id gnl|my_center|LOCUS_24420 3007 3693 gene locus_tag LOCUS_24430 3007 3693 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_24430 3690 5024 gene locus_tag LOCUS_24440 3690 5024 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_24440 5544 7190 gene locus_tag LOCUS_24450 5544 7190 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_24450 8441 7497 gene locus_tag LOCUS_24460 gene coaA 8441 7497 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5N6 protein_id gnl|my_center|LOCUS_24460 9022 8552 gene locus_tag LOCUS_24470 9022 8552 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_24470 9064 9558 gene locus_tag LOCUS_24480 9064 9558 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_24480 10134 9559 gene locus_tag LOCUS_24490 10134 9559 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458007.1 protein_id gnl|my_center|LOCUS_24490 10244 10900 gene locus_tag LOCUS_24500 10244 10900 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_24500 10897 11214 gene locus_tag LOCUS_24510 10897 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 11540 13243 gene locus_tag LOCUS_24520 11540 13243 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_24520 13328 13732 gene locus_tag LOCUS_24530 13328 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098332.1 protein_id gnl|my_center|LOCUS_24530 13910 15940 gene locus_tag LOCUS_24540 gene fadH 13910 15940 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 protein_id gnl|my_center|LOCUS_24540 17532 16258 gene locus_tag LOCUS_24550 gene adcK4 17532 16258 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_24550 18943 17519 gene locus_tag LOCUS_24560 18943 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 19124 20092 gene locus_tag LOCUS_24570 19124 20092 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_24570 20185 20850 gene locus_tag LOCUS_24580 20185 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 20855 21403 gene locus_tag LOCUS_24590 gene sprT 20855 21403 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK4 protein_id gnl|my_center|LOCUS_24590 23104 21638 gene locus_tag LOCUS_24600 gene katA 23104 21638 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729105.1 protein_id gnl|my_center|LOCUS_24600 23301 25196 gene locus_tag LOCUS_24610 gene mutL 23301 25196 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_24610 25196 26152 gene locus_tag LOCUS_24620 gene miaA 25196 26152 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_24620 26210 26464 gene locus_tag LOCUS_24630 gene hfq 26210 26464 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X7 protein_id gnl|my_center|LOCUS_24630 26492 27829 gene locus_tag LOCUS_24640 gene hflX 26492 27829 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_24640 28130 29533 gene locus_tag LOCUS_24650 28130 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 29530 30414 gene locus_tag LOCUS_24660 gene hflC 29530 30414 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_24660 30420 30605 gene locus_tag LOCUS_24670 30420 30605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_24670 30801 32000 gene locus_tag LOCUS_24680 gene hisZ 30801 32000 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_24680 31993 33288 gene locus_tag LOCUS_24690 gene purA 31993 33288 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_24690 >Feature sequence32 9 467 gene locus_tag LOCUS_24700 9 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 554 1378 gene locus_tag LOCUS_24710 554 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1538 2617 gene locus_tag LOCUS_24720 1538 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2806 3606 gene locus_tag LOCUS_24730 2806 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 5640 4075 gene locus_tag LOCUS_24740 5640 4075 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_24740 7030 5723 gene locus_tag LOCUS_24750 7030 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_24750 8427 7057 gene locus_tag LOCUS_24760 gene glnA 8427 7057 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970715.1 protein_id gnl|my_center|LOCUS_24760 8864 9577 gene locus_tag LOCUS_24770 8864 9577 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_24770 10363 9584 gene locus_tag LOCUS_24780 10363 9584 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533989.1 protein_id gnl|my_center|LOCUS_24780 11442 10423 gene locus_tag LOCUS_24790 11442 10423 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703279.1 protein_id gnl|my_center|LOCUS_24790 12446 11454 gene locus_tag LOCUS_24800 12446 11454 CDS product hypothetical nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703280.1 protein_id gnl|my_center|LOCUS_24800 12934 12458 gene locus_tag LOCUS_24810 12934 12458 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703278.1 protein_id gnl|my_center|LOCUS_24810 13370 13140 gene locus_tag LOCUS_24820 13370 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 15120 14287 gene locus_tag LOCUS_24830 15120 14287 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 protein_id gnl|my_center|LOCUS_24830 16377 15337 gene locus_tag LOCUS_24840 16377 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24840 16773 16423 gene locus_tag LOCUS_24850 16773 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24850 17979 16954 gene locus_tag LOCUS_24860 17979 16954 CDS product DNA-binding transcriptional regulator FruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406606.1 protein_id gnl|my_center|LOCUS_24860 18175 21048 gene locus_tag LOCUS_24870 gene fruI 18175 21048 CDS product PTS fructose transporter subunit FruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 protein_id gnl|my_center|LOCUS_24870 21045 22019 gene locus_tag LOCUS_24880 21045 22019 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY92 protein_id gnl|my_center|LOCUS_24880 22016 23770 gene locus_tag LOCUS_24890 gene fruA 22016 23770 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706188.1 protein_id gnl|my_center|LOCUS_24890 23824 24609 gene locus_tag LOCUS_24900 23824 24609 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 protein_id gnl|my_center|LOCUS_24900 24695 25528 gene locus_tag LOCUS_24910 24695 25528 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_24910 25598 25945 gene locus_tag LOCUS_24920 25598 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 27276 25957 gene locus_tag LOCUS_24930 gene arsB 27276 25957 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MMG7 protein_id gnl|my_center|LOCUS_24930 27693 27283 gene locus_tag LOCUS_24940 27693 27283 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV3 protein_id gnl|my_center|LOCUS_24940 28073 27690 gene locus_tag LOCUS_24950 28073 27690 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969026.1 protein_id gnl|my_center|LOCUS_24950 29375 28311 gene locus_tag LOCUS_24960 29375 28311 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267370.1 protein_id gnl|my_center|LOCUS_24960 29544 30443 gene locus_tag LOCUS_24970 29544 30443 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769653.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence33 745 203 gene locus_tag LOCUS_24980 745 203 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_24980 851 1969 gene locus_tag LOCUS_24990 gene asd 851 1969 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51344 protein_id gnl|my_center|LOCUS_24990 2087 3163 gene locus_tag LOCUS_25000 2087 3163 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AI0 protein_id gnl|my_center|LOCUS_25000 3875 3489 gene locus_tag LOCUS_25010 3875 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4018 4512 gene locus_tag LOCUS_25020 4018 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 5785 4478 gene locus_tag LOCUS_25030 5785 4478 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267888.1 protein_id gnl|my_center|LOCUS_25030 6722 6027 gene locus_tag LOCUS_25040 6722 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 8444 6723 gene locus_tag LOCUS_25050 8444 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 10371 8518 gene locus_tag LOCUS_25060 gene napA 10371 8518 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 protein_id gnl|my_center|LOCUS_25060 10938 10606 gene locus_tag LOCUS_25070 10938 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 11139 11504 gene locus_tag LOCUS_25080 11139 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 11592 12062 gene locus_tag LOCUS_25090 11592 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13386 12112 gene locus_tag LOCUS_25100 13386 12112 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_25100 13699 14100 gene locus_tag LOCUS_25110 gene ectC 13699 14100 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFR1 protein_id gnl|my_center|LOCUS_25110 15206 14166 gene locus_tag LOCUS_25120 15206 14166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941367.1 protein_id gnl|my_center|LOCUS_25120 18123 16216 gene locus_tag LOCUS_25130 18123 16216 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 protein_id gnl|my_center|LOCUS_25130 18572 18393 gene locus_tag LOCUS_25140 18572 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 18578 18790 gene locus_tag LOCUS_25150 18578 18790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 19011 19322 gene locus_tag LOCUS_25160 19011 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 19319 20467 gene locus_tag LOCUS_25170 19319 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 22050 21070 gene locus_tag LOCUS_25180 22050 21070 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814121.1 protein_id gnl|my_center|LOCUS_25180 23343 22066 gene locus_tag LOCUS_25190 23343 22066 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_25190 24313 23951 gene locus_tag LOCUS_25200 24313 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_25200 25844 24444 gene locus_tag LOCUS_25210 gene hslU 25844 24444 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQI8 protein_id gnl|my_center|LOCUS_25210 26379 25837 gene locus_tag LOCUS_25220 gene hslV 26379 25837 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A95 protein_id gnl|my_center|LOCUS_25220 <27337 26487 gene locus_tag LOCUS_25230 <27337 26487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FUN7:tyrosine recombinase XerC >Feature sequence34 340 426 gene locus_tag LOCUS_t00400 340 426 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1192 449 gene locus_tag LOCUS_25240 gene malR 1192 449 CDS product transcriptional regulatory protein MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05251 protein_id gnl|my_center|LOCUS_25240 2757 1189 gene locus_tag LOCUS_25250 2757 1189 CDS product two-component system sensor histidine kinase DcuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746421.1 protein_id gnl|my_center|LOCUS_25250 3012 4337 gene locus_tag LOCUS_25260 3012 4337 CDS product citrate:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680734.1 protein_id gnl|my_center|LOCUS_25260 5111 4845 gene locus_tag LOCUS_25270 5111 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933583.1 protein_id gnl|my_center|LOCUS_25270 5310 5071 gene locus_tag LOCUS_25280 5310 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_25280 6043 5351 gene locus_tag LOCUS_25290 6043 5351 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 protein_id gnl|my_center|LOCUS_25290 8451 6247 gene locus_tag LOCUS_25300 8451 6247 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267646.1 protein_id gnl|my_center|LOCUS_25300 9450 8467 gene locus_tag LOCUS_25310 9450 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267645.1 protein_id gnl|my_center|LOCUS_25310 10137 9454 gene locus_tag LOCUS_25320 10137 9454 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267644.1 protein_id gnl|my_center|LOCUS_25320 10905 10327 gene locus_tag LOCUS_25330 10905 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 11885 10902 gene locus_tag LOCUS_25340 11885 10902 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037856.1 protein_id gnl|my_center|LOCUS_25340 12583 11882 gene locus_tag LOCUS_25350 gene cbbZ 12583 11882 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYC6 protein_id gnl|my_center|LOCUS_25350 12989 14341 gene locus_tag LOCUS_25360 12989 14341 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882792.1 protein_id gnl|my_center|LOCUS_25360 14338 15039 gene locus_tag LOCUS_25370 14338 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 15104 15688 gene locus_tag LOCUS_25380 15104 15688 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_25380 15688 16464 gene locus_tag LOCUS_25390 15688 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25390 16773 17390 gene locus_tag LOCUS_25400 16773 17390 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_25400 17463 17954 gene locus_tag LOCUS_25410 gene purE 17463 17954 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8M2 protein_id gnl|my_center|LOCUS_25410 17951 19105 gene locus_tag LOCUS_25420 gene purK 17951 19105 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_25420 19127 19996 gene locus_tag LOCUS_25430 19127 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 21092 20226 gene locus_tag LOCUS_25440 21092 20226 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266752.1 protein_id gnl|my_center|LOCUS_25440 21524 21123 gene locus_tag LOCUS_25450 21524 21123 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404521.1 protein_id gnl|my_center|LOCUS_25450 21746 25699 gene locus_tag LOCUS_25460 21746 25699 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence35 <1 849 gene locus_tag LOCUS_25470 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103138.1:alpha/beta hydrolase 855 1925 gene locus_tag LOCUS_25480 855 1925 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_25480 1922 3100 gene locus_tag LOCUS_25490 1922 3100 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_25490 3490 3152 gene locus_tag LOCUS_25500 gene glnK 3490 3152 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073588.1 protein_id gnl|my_center|LOCUS_25500 4755 3562 gene locus_tag LOCUS_25510 4755 3562 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_25510 6414 5131 gene locus_tag LOCUS_25520 gene amtB 6414 5131 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_25520 6795 6457 gene locus_tag LOCUS_25530 6795 6457 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_25530 6979 7221 gene locus_tag LOCUS_25540 6979 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_25540 7224 8738 gene locus_tag LOCUS_25550 gene comM 7224 8738 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_25550 9614 8820 gene locus_tag LOCUS_25560 9614 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_25560 9804 10391 gene locus_tag LOCUS_25570 9804 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 10502 12508 gene locus_tag LOCUS_25580 gene rep 10502 12508 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ8 protein_id gnl|my_center|LOCUS_25580 12620 12696 gene locus_tag LOCUS_t00410 12620 12696 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13622 12972 gene locus_tag LOCUS_25590 13622 12972 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705262.1 protein_id gnl|my_center|LOCUS_25590 14287 13619 gene locus_tag LOCUS_25600 gene pcaI 14287 13619 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_25600 15502 14300 gene locus_tag LOCUS_25610 15502 14300 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_25610 16153 15689 gene locus_tag LOCUS_25620 16153 15689 CDS product putative enoyl-CoA hydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP3 protein_id gnl|my_center|LOCUS_25620 17104 16157 gene locus_tag LOCUS_25630 gene etfA 17104 16157 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_25630 17460 17101 gene locus_tag LOCUS_25640 17460 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25640 17847 17470 gene locus_tag LOCUS_25650 17847 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25650 19502 17877 gene locus_tag LOCUS_25660 gene etf-QO 19502 17877 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_25660 20346 19564 gene locus_tag LOCUS_25670 20346 19564 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_25670 20805 21668 gene locus_tag LOCUS_25680 20805 21668 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 protein_id gnl|my_center|LOCUS_25680 21668 22804 gene locus_tag LOCUS_25690 21668 22804 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886927.1 protein_id gnl|my_center|LOCUS_25690 22797 23561 gene locus_tag LOCUS_25700 22797 23561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886928.1 protein_id gnl|my_center|LOCUS_25700 23548 24255 gene locus_tag LOCUS_25710 23548 24255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886929.1 protein_id gnl|my_center|LOCUS_25710 24317 25495 gene locus_tag LOCUS_25720 24317 25495 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886925.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence36 806 114 gene locus_tag LOCUS_25730 806 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 970 2328 gene locus_tag LOCUS_25740 970 2328 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226337.1 protein_id gnl|my_center|LOCUS_25740 2563 2342 gene locus_tag LOCUS_25750 2563 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3207 2560 gene locus_tag LOCUS_25760 3207 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_25760 3676 3957 gene locus_tag LOCUS_25770 3676 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4675 4148 gene locus_tag LOCUS_25780 gene blc 4675 4148 CDS product outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639462.2 protein_id gnl|my_center|LOCUS_25780 6300 4792 gene locus_tag LOCUS_25790 6300 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 6514 7560 gene locus_tag LOCUS_25800 6514 7560 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974938.1 protein_id gnl|my_center|LOCUS_25800 8674 7829 gene locus_tag LOCUS_25810 8674 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 8800 9543 gene locus_tag LOCUS_25820 8800 9543 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_25820 10232 9525 gene locus_tag LOCUS_25830 10232 9525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_25830 11011 10229 gene locus_tag LOCUS_25840 11011 10229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_25840 11976 11008 gene locus_tag LOCUS_25850 11976 11008 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_25850 12858 11989 gene locus_tag LOCUS_25860 12858 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25860 14154 12928 gene locus_tag LOCUS_25870 14154 12928 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 protein_id gnl|my_center|LOCUS_25870 15825 14221 gene locus_tag LOCUS_25880 15825 14221 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_25880 17030 15822 gene locus_tag LOCUS_25890 gene caiA 17030 15822 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_25890 17805 17038 gene locus_tag LOCUS_25900 17805 17038 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_25900 17970 18161 gene locus_tag LOCUS_25910 17970 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 19655 18195 gene locus_tag LOCUS_25920 19655 18195 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_25920 21249 19678 gene locus_tag LOCUS_25930 21249 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119876.1 protein_id gnl|my_center|LOCUS_25930 21745 21242 gene locus_tag LOCUS_25940 21745 21242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence37 103 1362 gene locus_tag LOCUS_25950 gene wcaG 103 1362 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_25950 1997 2260 gene locus_tag LOCUS_25960 1997 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2262 2417 gene locus_tag LOCUS_25970 2262 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2598 4709 gene locus_tag LOCUS_25980 2598 4709 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037705.1 protein_id gnl|my_center|LOCUS_25980 4819 6189 gene locus_tag LOCUS_25990 4819 6189 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776660.1 protein_id gnl|my_center|LOCUS_25990 6572 6186 gene locus_tag LOCUS_26000 6572 6186 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123181.1 protein_id gnl|my_center|LOCUS_26000 7930 6569 gene locus_tag LOCUS_26010 7930 6569 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 protein_id gnl|my_center|LOCUS_26010 8486 8166 gene locus_tag LOCUS_26020 8486 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 8895 8611 gene locus_tag LOCUS_26030 8895 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 9031 10134 gene locus_tag LOCUS_26040 9031 10134 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404394.1 protein_id gnl|my_center|LOCUS_26040 10160 11008 gene locus_tag LOCUS_26050 10160 11008 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_26050 11081 11974 gene locus_tag LOCUS_26060 gene hslO 11081 11974 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_26060 11614 11526 gene locus_tag LOCUS_t00420 11614 11526 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12051 13496 gene locus_tag LOCUS_26070 12051 13496 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704972.1 protein_id gnl|my_center|LOCUS_26070 13543 14964 gene locus_tag LOCUS_26080 13543 14964 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_26080 15472 15314 gene locus_tag LOCUS_26090 15472 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 16255 17349 gene locus_tag LOCUS_26100 16255 17349 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267094.1 protein_id gnl|my_center|LOCUS_26100 17421 18107 gene locus_tag LOCUS_26110 gene frcK 17421 18107 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_26110 19162 18191 gene locus_tag LOCUS_26120 19162 18191 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 protein_id gnl|my_center|LOCUS_26120 19506 20954 gene locus_tag LOCUS_26130 gene gnd 19506 20954 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAL8 protein_id gnl|my_center|LOCUS_26130 >Feature sequence38 1298 1029 gene locus_tag LOCUS_26140 1298 1029 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 protein_id gnl|my_center|LOCUS_26140 1719 1327 gene locus_tag LOCUS_26150 1719 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2570 1716 gene locus_tag LOCUS_26160 2570 1716 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_26160 3562 2561 gene locus_tag LOCUS_26170 gene hprK 3562 2561 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P709 protein_id gnl|my_center|LOCUS_26170 4092 3562 gene locus_tag LOCUS_26180 4092 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4513 4187 gene locus_tag LOCUS_26190 gene rpoN 4513 4187 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_26190 6032 4590 gene locus_tag LOCUS_26200 gene rpoN 6032 4590 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_26200 6861 6085 gene locus_tag LOCUS_26210 gene yhbG 6861 6085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 protein_id gnl|my_center|LOCUS_26210 7412 6861 gene locus_tag LOCUS_26220 7412 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 7959 7402 gene locus_tag LOCUS_26230 7959 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 8505 7963 gene locus_tag LOCUS_26240 8505 7963 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_26240 9479 8502 gene locus_tag LOCUS_26250 gene kpsF 9479 8502 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P717 protein_id gnl|my_center|LOCUS_26250 9640 10590 gene locus_tag LOCUS_26260 9640 10590 CDS product ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205265.1 protein_id gnl|my_center|LOCUS_26260 10587 11342 gene locus_tag LOCUS_26270 10587 11342 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q82 protein_id gnl|my_center|LOCUS_26270 11383 11634 gene locus_tag LOCUS_26280 11383 11634 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_26280 11647 12939 gene locus_tag LOCUS_26290 gene murA 11647 12939 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_26290 12936 13583 gene locus_tag LOCUS_26300 gene hisG 12936 13583 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV4 protein_id gnl|my_center|LOCUS_26300 13679 14878 gene locus_tag LOCUS_26310 gene hisD 13679 14878 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_26310 15163 15795 gene locus_tag LOCUS_26320 gene sspA 15163 15795 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_26320 15819 16262 gene locus_tag LOCUS_26330 15819 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 17085 16480 gene locus_tag LOCUS_26340 gene gmhA 17085 16480 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_26340 17440 17075 gene locus_tag LOCUS_26350 17440 17075 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY4 protein_id gnl|my_center|LOCUS_26350 19422 17437 gene locus_tag LOCUS_26360 19422 17437 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_26360 19583 20440 gene locus_tag LOCUS_26370 gene rsmI 19583 20440 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 protein_id gnl|my_center|LOCUS_26370 >Feature sequence39 1078 158 gene locus_tag LOCUS_26380 gene lpxC 1078 158 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_26380 2551 1400 gene locus_tag LOCUS_26390 gene ftsZ 2551 1400 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F12 protein_id gnl|my_center|LOCUS_26390 3900 2665 gene locus_tag LOCUS_26400 gene ftsA 3900 2665 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 protein_id gnl|my_center|LOCUS_26400 4634 3897 gene locus_tag LOCUS_26410 gene ftsQ 4634 3897 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6M1 protein_id gnl|my_center|LOCUS_26410 6156 4705 gene locus_tag LOCUS_26420 gene murC 6156 4705 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX1 protein_id gnl|my_center|LOCUS_26420 7247 6153 gene locus_tag LOCUS_26430 gene murG 7247 6153 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_26430 8392 7244 gene locus_tag LOCUS_26440 gene ftsW 8392 7244 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_26440 9717 8389 gene locus_tag LOCUS_26450 gene murD 9717 8389 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_26450 10796 9714 gene locus_tag LOCUS_26460 gene mraY 10796 9714 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_26460 12184 10790 gene locus_tag LOCUS_26470 gene murF 12184 10790 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_26470 13749 12181 gene locus_tag LOCUS_26480 gene murE 13749 12181 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY5 protein_id gnl|my_center|LOCUS_26480 15421 13751 gene locus_tag LOCUS_26490 gene ftsI 15421 13751 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_26490 15748 15479 gene locus_tag LOCUS_26500 15748 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 16692 15745 gene locus_tag LOCUS_26510 gene rsmH 16692 15745 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK7 protein_id gnl|my_center|LOCUS_26510 17192 16731 gene locus_tag LOCUS_26520 gene mraZ 17192 16731 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUP5 protein_id gnl|my_center|LOCUS_26520 >Feature sequence40 541 239 gene locus_tag LOCUS_26530 gene tnp 541 239 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974622.1 protein_id gnl|my_center|LOCUS_26530 1473 793 gene locus_tag LOCUS_26540 1473 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2637 2119 gene locus_tag LOCUS_26550 2637 2119 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094816.1 protein_id gnl|my_center|LOCUS_26550 3002 3460 gene locus_tag LOCUS_26560 3002 3460 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 protein_id gnl|my_center|LOCUS_26560 4168 3476 gene locus_tag LOCUS_26570 4168 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4394 5665 gene locus_tag LOCUS_26580 4394 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5726 6004 gene locus_tag LOCUS_26590 gene ppiC2 5726 6004 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK5 protein_id gnl|my_center|LOCUS_26590 6410 6045 gene locus_tag LOCUS_26600 6410 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 6943 6479 gene locus_tag LOCUS_26610 6943 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 7774 6956 gene locus_tag LOCUS_26620 7774 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 protein_id gnl|my_center|LOCUS_26620 7866 8777 gene locus_tag LOCUS_26630 7866 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 11049 8848 gene locus_tag LOCUS_26640 11049 8848 CDS product dTDP-D-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_26640 11211 12848 gene locus_tag LOCUS_26650 11211 12848 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543612.1 protein_id gnl|my_center|LOCUS_26650 13792 12836 gene locus_tag LOCUS_26660 13792 12836 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_26660 14201 14404 gene locus_tag LOCUS_26670 14201 14404 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 protein_id gnl|my_center|LOCUS_26670 14714 14499 gene locus_tag LOCUS_26680 14714 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_26680 14734 14946 gene locus_tag LOCUS_26690 14734 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 14987 15418 gene locus_tag LOCUS_26700 gene ykgJ 14987 15418 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035473.1 protein_id gnl|my_center|LOCUS_26700 15446 16051 gene locus_tag LOCUS_26710 15446 16051 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084142.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence41 182 1567 gene locus_tag LOCUS_26720 182 1567 CDS product guanine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833082.1 protein_id gnl|my_center|LOCUS_26720 2714 1713 gene locus_tag LOCUS_26730 2714 1713 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWC5 protein_id gnl|my_center|LOCUS_26730 2911 2825 gene locus_tag LOCUS_t00430 2911 2825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3012 5351 gene locus_tag LOCUS_26740 gene rnr 3012 5351 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_26740 5375 6103 gene locus_tag LOCUS_26750 5375 6103 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 protein_id gnl|my_center|LOCUS_26750 6350 7105 gene locus_tag LOCUS_26760 gene rlmB 6350 7105 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z182 protein_id gnl|my_center|LOCUS_26760 7380 7742 gene locus_tag LOCUS_26770 gene rpsF 7380 7742 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV89 protein_id gnl|my_center|LOCUS_26770 7754 7984 gene locus_tag LOCUS_26780 gene rpsR 7754 7984 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_26780 7994 8599 gene locus_tag LOCUS_26790 7994 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 9113 10468 gene locus_tag LOCUS_26800 gene dnaB 9113 10468 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_26800 10468 11541 gene locus_tag LOCUS_26810 gene alr-1 10468 11541 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH11 protein_id gnl|my_center|LOCUS_26810 12566 11613 gene locus_tag LOCUS_26820 12566 11613 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_26820 12650 14026 gene locus_tag LOCUS_26830 gene radA 12650 14026 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB3 protein_id gnl|my_center|LOCUS_26830 15357 14062 gene locus_tag LOCUS_26840 15357 14062 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 protein_id gnl|my_center|LOCUS_26840 16223 15417 gene locus_tag LOCUS_26850 16223 15417 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence42 1735 74 gene locus_tag LOCUS_26860 1735 74 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065098.1 protein_id gnl|my_center|LOCUS_26860 1875 2396 gene locus_tag LOCUS_26870 gene gloA 1875 2396 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880P8 protein_id gnl|my_center|LOCUS_26870 2483 2558 gene locus_tag LOCUS_t00440 2483 2558 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3311 2625 gene locus_tag LOCUS_26880 gene queC 3311 2625 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_26880 4074 3361 gene locus_tag LOCUS_26890 gene queE 4074 3361 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F5 protein_id gnl|my_center|LOCUS_26890 4806 4078 gene locus_tag LOCUS_26900 4806 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 5390 4806 gene locus_tag LOCUS_26910 5390 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 6772 5459 gene locus_tag LOCUS_26920 gene tolB 6772 5459 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP93 protein_id gnl|my_center|LOCUS_26920 8022 6769 gene locus_tag LOCUS_26930 8022 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8477 8022 gene locus_tag LOCUS_26940 gene tolR 8477 8022 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_26940 9245 8487 gene locus_tag LOCUS_26950 gene tolQ 9245 8487 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 protein_id gnl|my_center|LOCUS_26950 9647 9246 gene locus_tag LOCUS_26960 9647 9246 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_26960 10707 9628 gene locus_tag LOCUS_26970 gene ruvB 10707 9628 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA2 protein_id gnl|my_center|LOCUS_26970 11326 10712 gene locus_tag LOCUS_26980 gene ruvA 11326 10712 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIN6 protein_id gnl|my_center|LOCUS_26980 11859 11323 gene locus_tag LOCUS_26990 gene ruvC 11859 11323 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A1 protein_id gnl|my_center|LOCUS_26990 12615 11863 gene locus_tag LOCUS_27000 12615 11863 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F792 protein_id gnl|my_center|LOCUS_27000 14611 12665 gene locus_tag LOCUS_27010 gene kup1 14611 12665 CDS product putative potassium transport system protein kup 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AK4 protein_id gnl|my_center|LOCUS_27010 16327 14912 gene locus_tag LOCUS_27020 16327 14912 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUW8 protein_id gnl|my_center|LOCUS_27020 >Feature sequence43 370 445 gene locus_tag LOCUS_t00450 370 445 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 483 857 gene locus_tag LOCUS_27030 gene secE 483 857 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET6 protein_id gnl|my_center|LOCUS_27030 871 1404 gene locus_tag LOCUS_27040 gene nusG 871 1404 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFG0 protein_id gnl|my_center|LOCUS_27040 1503 1931 gene locus_tag LOCUS_27050 gene rplK 1503 1931 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y2 protein_id gnl|my_center|LOCUS_27050 1935 2630 gene locus_tag LOCUS_27060 gene rplA 1935 2630 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIH7 protein_id gnl|my_center|LOCUS_27060 2899 3426 gene locus_tag LOCUS_27070 gene rplJ 2899 3426 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET2 protein_id gnl|my_center|LOCUS_27070 3497 3874 gene locus_tag LOCUS_27080 gene rplL 3497 3874 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_27080 4118 8200 gene locus_tag LOCUS_27090 gene rpoB 4118 8200 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_27090 8299 12573 gene locus_tag LOCUS_27100 gene rpoC 8299 12573 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_27100 12704 13078 gene locus_tag LOCUS_27110 gene rpsL 12704 13078 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 protein_id gnl|my_center|LOCUS_27110 13121 13594 gene locus_tag LOCUS_27120 gene rpsG 13121 13594 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ97 protein_id gnl|my_center|LOCUS_27120 13643 15757 gene locus_tag LOCUS_27130 gene fusA 13643 15757 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_27130 >Feature sequence44 1826 948 gene locus_tag LOCUS_27140 1826 948 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125164.1 protein_id gnl|my_center|LOCUS_27140 1944 4133 gene locus_tag LOCUS_27150 1944 4133 CDS product outer membrane copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546785.1 protein_id gnl|my_center|LOCUS_27150 4146 5420 gene locus_tag LOCUS_27160 4146 5420 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809216.1 protein_id gnl|my_center|LOCUS_27160 5479 5958 gene locus_tag LOCUS_27170 5479 5958 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203413.1 protein_id gnl|my_center|LOCUS_27170 6058 6573 gene locus_tag LOCUS_27180 6058 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 6809 8050 gene locus_tag LOCUS_27190 gene traB 6809 8050 CDS product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037346.1 protein_id gnl|my_center|LOCUS_27190 8068 9258 gene locus_tag LOCUS_27200 8068 9258 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y94 protein_id gnl|my_center|LOCUS_27200 9308 9529 gene locus_tag LOCUS_27210 9308 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 10952 9582 gene locus_tag LOCUS_27220 gene ragB 10952 9582 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971303.1 protein_id gnl|my_center|LOCUS_27220 11626 10949 gene locus_tag LOCUS_27230 11626 10949 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_27230 13015 11630 gene locus_tag LOCUS_27240 13015 11630 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040021.1 protein_id gnl|my_center|LOCUS_27240 15096 13054 gene locus_tag LOCUS_27250 15096 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence45 298 867 gene locus_tag LOCUS_27260 298 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_27260 901 1506 gene locus_tag LOCUS_27270 gene mobA 901 1506 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMS8 protein_id gnl|my_center|LOCUS_27270 1509 2756 gene locus_tag LOCUS_27280 1509 2756 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_27280 2916 4280 gene locus_tag LOCUS_27290 2916 4280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_27290 4692 7028 gene locus_tag LOCUS_27300 gene fdhF 4692 7028 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971703.1 protein_id gnl|my_center|LOCUS_27300 7025 7306 gene locus_tag LOCUS_27310 7025 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 7692 10700 gene locus_tag LOCUS_27320 gene yjgC 7692 10700 CDS product putative oxidoreductase YjgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34720 protein_id gnl|my_center|LOCUS_27320 10764 11279 gene locus_tag LOCUS_27330 10764 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 12498 11551 gene locus_tag LOCUS_27340 12498 11551 CDS product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268873.1 protein_id gnl|my_center|LOCUS_27340 12632 13477 gene locus_tag LOCUS_27350 gene fdhD 12632 13477 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WG5 protein_id gnl|my_center|LOCUS_27350 13917 14771 gene locus_tag LOCUS_27360 13917 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence46 <1 723 gene locus_tag LOCUS_27370 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63XV0:phosphoenolpyruvate-protein phosphotransferase 882 2234 gene locus_tag LOCUS_27380 gene mgtE 882 2234 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_27380 3632 2262 gene locus_tag LOCUS_27390 gene pmbA 3632 2262 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_27390 3787 5196 gene locus_tag LOCUS_27400 3787 5196 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_27400 5159 5734 gene locus_tag LOCUS_27410 5159 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 5731 7113 gene locus_tag LOCUS_27420 5731 7113 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_27420 9057 7702 gene locus_tag LOCUS_27430 gene mpl 9057 7702 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MN87 protein_id gnl|my_center|LOCUS_27430 9675 9145 gene locus_tag LOCUS_27440 9675 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9692 10852 gene locus_tag LOCUS_27450 gene rnd 9692 10852 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_27450 11470 10913 gene locus_tag LOCUS_27460 gene adk 11470 10913 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD4 protein_id gnl|my_center|LOCUS_27460 11698 12951 gene locus_tag LOCUS_27470 gene pfp 11698 12951 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C58 protein_id gnl|my_center|LOCUS_27470 >Feature sequence47 897 2045 gene locus_tag LOCUS_27480 897 2045 CDS product L-fucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035399.1 protein_id gnl|my_center|LOCUS_27480 2190 2618 gene locus_tag LOCUS_27490 2190 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530134.1 protein_id gnl|my_center|LOCUS_27490 2745 4016 gene locus_tag LOCUS_27500 2745 4016 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889021.1 protein_id gnl|my_center|LOCUS_27500 5211 4021 gene locus_tag LOCUS_27510 5211 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 5534 6274 gene locus_tag LOCUS_27520 5534 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6739 6308 gene locus_tag LOCUS_27530 gene fkpA 6739 6308 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z0 protein_id gnl|my_center|LOCUS_27530 7641 6829 gene locus_tag LOCUS_27540 7641 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_27540 9486 7933 gene locus_tag LOCUS_27550 9486 7933 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_27550 10333 9851 gene locus_tag LOCUS_27560 10333 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 11143 12159 gene locus_tag LOCUS_27570 11143 12159 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707118.1 protein_id gnl|my_center|LOCUS_27570 12425 12958 gene locus_tag LOCUS_27580 12425 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence48 6 704 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcctgcggggatgaacc 849 3542 gene locus_tag LOCUS_27590 gene cas3 849 3542 CDS product CRISPR-associated endonuclease/helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53VY2 protein_id gnl|my_center|LOCUS_27590 3797 5392 gene locus_tag LOCUS_27600 3797 5392 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_27600 5389 6453 gene locus_tag LOCUS_27610 5389 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 6456 7595 gene locus_tag LOCUS_27620 6456 7595 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_27620 7598 8287 gene locus_tag LOCUS_27630 7598 8287 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_27630 8262 8864 gene locus_tag LOCUS_27640 gene cse3 8262 8864 CDS product CRISPR-associated endoribonuclease Cse3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WG9 protein_id gnl|my_center|LOCUS_27640 8870 9790 gene locus_tag LOCUS_27650 gene cas1 8870 9790 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7W3 protein_id gnl|my_center|LOCUS_27650 9790 10086 gene locus_tag LOCUS_27660 9790 10086 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063176.1 protein_id gnl|my_center|LOCUS_27660 10193 >11129 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttccccgcatgcgcggggatgaaccg >Feature sequence49 402 1121 gene locus_tag LOCUS_27670 gene mtnC 402 1121 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P1 protein_id gnl|my_center|LOCUS_27670 2159 1125 gene locus_tag LOCUS_27680 gene mtnA 2159 1125 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CL79 protein_id gnl|my_center|LOCUS_27680 3517 2159 gene locus_tag LOCUS_27690 gene xanA 3517 2159 CDS product phosphohexose mutases inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J2 protein_id gnl|my_center|LOCUS_27690 4983 3547 gene locus_tag LOCUS_27700 gene algA 4983 3547 CDS product alginate biosynthesis protein AlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07874 protein_id gnl|my_center|LOCUS_27700 5685 5098 gene locus_tag LOCUS_27710 gene dsbA 5685 5098 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y08 protein_id gnl|my_center|LOCUS_27710 5894 6517 gene locus_tag LOCUS_27720 gene engB 5894 6517 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLZ6 protein_id gnl|my_center|LOCUS_27720 >Feature sequence50 815 441 gene locus_tag LOCUS_27730 815 441 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613956.1 protein_id gnl|my_center|LOCUS_27730 1669 812 gene locus_tag LOCUS_27740 1669 812 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_27740 1630 1721 gene locus_tag LOCUS_t00460 1630 1721 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1738 3825 gene locus_tag LOCUS_27750 gene ppk 1738 3825 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP6 protein_id gnl|my_center|LOCUS_27750 3971 4930 gene locus_tag LOCUS_27760 3971 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 4967 5662 gene locus_tag LOCUS_27770 gene mtgA 4967 5662 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6V1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence51 93 1043 gene locus_tag LOCUS_27780 93 1043 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008691073.1 protein_id gnl|my_center|LOCUS_27780 1119 3842 gene locus_tag LOCUS_27790 gene polA 1119 3842 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_27790