>Feature sequence01 2243 1107 gene locus_tag LOCUS_00010 gene flhB 2243 1107 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420337.1 protein_id gnl|my_center|LOCUS_00010 3018 2236 gene locus_tag LOCUS_00020 gene fliR 3018 2236 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_00020 3290 3021 gene locus_tag LOCUS_00030 gene fliQ 3290 3021 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947514.1 protein_id gnl|my_center|LOCUS_00030 4033 3296 gene locus_tag LOCUS_00040 gene fliP 4033 3296 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC5 protein_id gnl|my_center|LOCUS_00040 4473 4030 gene locus_tag LOCUS_00050 gene fliO 4473 4030 CDS product flagellar protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51467 protein_id gnl|my_center|LOCUS_00050 4907 4473 gene locus_tag LOCUS_00060 gene fliN 4907 4473 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI11 protein_id gnl|my_center|LOCUS_00060 5923 4910 gene locus_tag LOCUS_00070 gene fliM 5923 4910 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 protein_id gnl|my_center|LOCUS_00070 6429 5929 gene locus_tag LOCUS_00080 gene fliL 6429 5929 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796799.1 protein_id gnl|my_center|LOCUS_00080 6897 6484 gene locus_tag LOCUS_00090 6897 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6984 7874 gene locus_tag LOCUS_00100 gene psd 6984 7874 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW03 protein_id gnl|my_center|LOCUS_00100 7922 10222 gene locus_tag LOCUS_00110 7922 10222 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_00110 10212 10991 gene locus_tag LOCUS_00120 10212 10991 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_00120 10969 12171 gene locus_tag LOCUS_00130 10969 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_00130 12605 12174 gene locus_tag LOCUS_00140 12605 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064295.1 protein_id gnl|my_center|LOCUS_00140 14183 12696 gene locus_tag LOCUS_00150 gene zwf 14183 12696 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 protein_id gnl|my_center|LOCUS_00150 14264 15718 gene locus_tag LOCUS_00160 gene glgA 14264 15718 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CST7 protein_id gnl|my_center|LOCUS_00160 16218 15724 gene locus_tag LOCUS_00170 16218 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17440 16211 gene locus_tag LOCUS_00180 gene srmB 17440 16211 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21507 protein_id gnl|my_center|LOCUS_00180 18472 17600 gene locus_tag LOCUS_00190 18472 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19699 18596 gene locus_tag LOCUS_00200 19699 18596 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_00200 21880 19718 gene locus_tag LOCUS_00210 gene uvrD 21880 19718 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFB5 protein_id gnl|my_center|LOCUS_00210 22350 22024 gene locus_tag LOCUS_00220 gene trxA 22350 22024 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_00220 22453 23739 gene locus_tag LOCUS_00230 gene rhlB 22453 23739 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44922 protein_id gnl|my_center|LOCUS_00230 23753 24109 gene locus_tag LOCUS_00240 23753 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24096 24812 gene locus_tag LOCUS_00250 24096 24812 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814000.1 protein_id gnl|my_center|LOCUS_00250 25462 24866 gene locus_tag LOCUS_00260 25462 24866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25674 25868 gene locus_tag LOCUS_00270 25674 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27067 25862 gene locus_tag LOCUS_00280 27067 25862 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_00280 28266 27064 gene locus_tag LOCUS_00290 28266 27064 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481244.1 protein_id gnl|my_center|LOCUS_00290 29582 28272 gene locus_tag LOCUS_00300 gene pepP 29582 28272 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_00300 30151 29603 gene locus_tag LOCUS_00310 30151 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30260 30469 gene locus_tag LOCUS_00320 30260 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30466 30771 gene locus_tag LOCUS_00330 30466 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31087 31842 gene locus_tag LOCUS_00340 31087 31842 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 protein_id gnl|my_center|LOCUS_00340 31858 33081 gene locus_tag LOCUS_00350 31858 33081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_00350 33078 34316 gene locus_tag LOCUS_00360 33078 34316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_00360 34313 34999 gene locus_tag LOCUS_00370 34313 34999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_00370 35038 36237 gene locus_tag LOCUS_00380 35038 36237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 36531 37256 gene locus_tag LOCUS_00390 36531 37256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123114.1 protein_id gnl|my_center|LOCUS_00390 37338 38036 gene locus_tag LOCUS_00400 37338 38036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39858 38518 gene locus_tag LOCUS_00410 39858 38518 CDS product cytochrome c551 peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_00410 40116 40733 gene locus_tag LOCUS_00420 40116 40733 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018313.1 protein_id gnl|my_center|LOCUS_00420 41233 40730 gene locus_tag LOCUS_00430 41233 40730 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7W3 protein_id gnl|my_center|LOCUS_00430 42587 41265 gene locus_tag LOCUS_00440 42587 41265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42902 43321 gene locus_tag LOCUS_00450 42902 43321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 44003 43602 gene locus_tag LOCUS_00460 44003 43602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44441 44040 gene locus_tag LOCUS_00470 44441 44040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 44885 44481 gene locus_tag LOCUS_00480 44885 44481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 45411 44995 gene locus_tag LOCUS_00490 gene yaeJ 45411 44995 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_00490 45568 47721 gene locus_tag LOCUS_00500 45568 47721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48540 47731 gene locus_tag LOCUS_00510 gene aroE 48540 47731 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE4 protein_id gnl|my_center|LOCUS_00510 49553 48537 gene locus_tag LOCUS_00520 gene hemB 49553 48537 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_00520 49749 50555 gene locus_tag LOCUS_00530 49749 50555 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_00530 50715 51845 gene locus_tag LOCUS_00540 gene carA 50715 51845 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M9 protein_id gnl|my_center|LOCUS_00540 51852 55070 gene locus_tag LOCUS_00550 gene carB 51852 55070 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_00550 55070 55546 gene locus_tag LOCUS_00560 gene greA 55070 55546 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ76 protein_id gnl|my_center|LOCUS_00560 55555 55998 gene locus_tag LOCUS_00570 55555 55998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56004 56621 gene locus_tag LOCUS_00580 gene rlmE 56004 56621 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M3 protein_id gnl|my_center|LOCUS_00580 56711 58570 gene locus_tag LOCUS_00590 gene ftsH 56711 58570 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT2 protein_id gnl|my_center|LOCUS_00590 58577 59416 gene locus_tag LOCUS_00600 gene folP 58577 59416 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X9 protein_id gnl|my_center|LOCUS_00600 59403 60752 gene locus_tag LOCUS_00610 gene glmM 59403 60752 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ71 protein_id gnl|my_center|LOCUS_00610 60860 61645 gene locus_tag LOCUS_00620 gene tpiA 60860 61645 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_00620 61655 62005 gene locus_tag LOCUS_00630 gene secG 61655 62005 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_00630 62014 62099 gene locus_tag LOCUS_t00010 62014 62099 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62624 62980 gene locus_tag LOCUS_00640 gene nuoA 62624 62980 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1C3 protein_id gnl|my_center|LOCUS_00640 62971 63468 gene locus_tag LOCUS_00650 gene nuoB1 62971 63468 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN2 protein_id gnl|my_center|LOCUS_00650 63475 64137 gene locus_tag LOCUS_00660 gene nuoC 63475 64137 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU0 protein_id gnl|my_center|LOCUS_00660 64141 65394 gene locus_tag LOCUS_00670 gene nuoD 64141 65394 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ8 protein_id gnl|my_center|LOCUS_00670 65391 65900 gene locus_tag LOCUS_00680 gene nuoE 65391 65900 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017383.1 protein_id gnl|my_center|LOCUS_00680 65900 67174 gene locus_tag LOCUS_00690 gene nuoF 65900 67174 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948473.1 protein_id gnl|my_center|LOCUS_00690 67202 69571 gene locus_tag LOCUS_00700 gene nuoG 67202 69571 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU4 protein_id gnl|my_center|LOCUS_00700 69564 70652 gene locus_tag LOCUS_00710 gene nuoH 69564 70652 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU5 protein_id gnl|my_center|LOCUS_00710 70649 71140 gene locus_tag LOCUS_00720 gene nuoI 70649 71140 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU6 protein_id gnl|my_center|LOCUS_00720 71157 71783 gene locus_tag LOCUS_00730 gene nuoJ 71157 71783 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769059.1 protein_id gnl|my_center|LOCUS_00730 71780 72085 gene locus_tag LOCUS_00740 gene nuoK 71780 72085 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VM3 protein_id gnl|my_center|LOCUS_00740 72087 74042 gene locus_tag LOCUS_00750 gene nuoL 72087 74042 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_00750 74059 75567 gene locus_tag LOCUS_00760 gene nuoM 74059 75567 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_00760 75584 77020 gene locus_tag LOCUS_00770 gene nuoN 75584 77020 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV1 protein_id gnl|my_center|LOCUS_00770 77030 77329 gene locus_tag LOCUS_00780 77030 77329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 77530 79623 gene locus_tag LOCUS_00790 gene fusA2 77530 79623 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M30 protein_id gnl|my_center|LOCUS_00790 79785 79991 gene locus_tag LOCUS_00800 79785 79991 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 protein_id gnl|my_center|LOCUS_00800 80586 82781 gene locus_tag LOCUS_00810 80586 82781 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_00810 82876 83757 gene locus_tag LOCUS_00820 82876 83757 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_00820 84750 83782 gene locus_tag LOCUS_00830 84750 83782 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH8 protein_id gnl|my_center|LOCUS_00830 85074 85286 gene locus_tag LOCUS_00840 gene cspA 85074 85286 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_00840 86112 85288 gene locus_tag LOCUS_00850 gene mutM 86112 85288 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NPE1 protein_id gnl|my_center|LOCUS_00850 86998 86114 gene locus_tag LOCUS_00860 86998 86114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 88368 86995 gene locus_tag LOCUS_00870 88368 86995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 89122 88370 gene locus_tag LOCUS_00880 89122 88370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 90073 89123 gene locus_tag LOCUS_00890 90073 89123 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_00890 90390 90235 gene locus_tag LOCUS_00900 gene rpmG 90390 90235 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD09 protein_id gnl|my_center|LOCUS_00900 90638 90402 gene locus_tag LOCUS_00910 gene rpmB 90638 90402 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM5 protein_id gnl|my_center|LOCUS_00910 91209 90760 gene locus_tag LOCUS_00920 91209 90760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92903 91272 gene locus_tag LOCUS_00930 gene ilvB 92903 91272 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_00930 94443 92989 gene locus_tag LOCUS_00940 gene gatA 94443 92989 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_00940 94742 94455 gene locus_tag LOCUS_00950 gene gatC 94742 94455 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_00950 94863 95909 gene locus_tag LOCUS_00960 gene mreB 94863 95909 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417472.1 protein_id gnl|my_center|LOCUS_00960 96052 96927 gene locus_tag LOCUS_00970 96052 96927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 96914 97393 gene locus_tag LOCUS_00980 96914 97393 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT1 protein_id gnl|my_center|LOCUS_00980 97401 99269 gene locus_tag LOCUS_00990 97401 99269 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_00990 99262 100392 gene locus_tag LOCUS_01000 99262 100392 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_01000 100389 101366 gene locus_tag LOCUS_01010 gene sltB1 100389 101366 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_01010 101363 102181 gene locus_tag LOCUS_01020 101363 102181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_01020 102201 103346 gene locus_tag LOCUS_01030 gene dacC 102201 103346 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_01030 103350 104195 gene locus_tag LOCUS_01040 103350 104195 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064726.1 protein_id gnl|my_center|LOCUS_01040 104195 104467 gene locus_tag LOCUS_01050 104195 104467 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XX9 protein_id gnl|my_center|LOCUS_01050 104477 105085 gene locus_tag LOCUS_01060 gene lipB 104477 105085 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF8 protein_id gnl|my_center|LOCUS_01060 105128 106084 gene locus_tag LOCUS_01070 gene lipA 105128 106084 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ6 protein_id gnl|my_center|LOCUS_01070 106207 107367 gene locus_tag LOCUS_01080 106207 107367 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCG7 protein_id gnl|my_center|LOCUS_01080 108378 107371 gene locus_tag LOCUS_01090 108378 107371 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_01090 108431 109000 gene locus_tag LOCUS_01100 gene efp 108431 109000 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_01100 109076 110044 gene locus_tag LOCUS_01110 109076 110044 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR3 protein_id gnl|my_center|LOCUS_01110 110075 110572 gene locus_tag LOCUS_01120 110075 110572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 111995 110694 gene locus_tag LOCUS_01130 111995 110694 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_01130 112507 111995 gene locus_tag LOCUS_01140 112507 111995 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_01140 112688 113452 gene locus_tag LOCUS_01150 112688 113452 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXK2 protein_id gnl|my_center|LOCUS_01150 114255 113449 gene locus_tag LOCUS_01160 114255 113449 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957888.1 protein_id gnl|my_center|LOCUS_01160 114629 114390 gene locus_tag LOCUS_01170 114629 114390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 114991 114791 gene locus_tag LOCUS_01180 114991 114791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_01180 116204 115077 gene locus_tag LOCUS_01190 116204 115077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 118501 116204 gene locus_tag LOCUS_01200 118501 116204 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_01200 118815 120725 gene locus_tag LOCUS_01210 gene htpG 118815 120725 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0M8 protein_id gnl|my_center|LOCUS_01210 120825 121748 gene locus_tag LOCUS_01220 gene hslO 120825 121748 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AZ5 protein_id gnl|my_center|LOCUS_01220 121763 123034 gene locus_tag LOCUS_01230 gene sqr 121763 123034 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_01230 123152 123496 gene locus_tag LOCUS_01240 123152 123496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 123516 124136 gene locus_tag LOCUS_01250 123516 124136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 124176 124379 gene locus_tag LOCUS_01260 124176 124379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 124516 124950 gene locus_tag LOCUS_01270 124516 124950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 125057 128287 gene locus_tag LOCUS_01280 gene recC 125057 128287 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY8 protein_id gnl|my_center|LOCUS_01280 128284 131778 gene locus_tag LOCUS_01290 gene recB 128284 131778 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CY7 protein_id gnl|my_center|LOCUS_01290 131771 133528 gene locus_tag LOCUS_01300 gene recD 131771 133528 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR47 protein_id gnl|my_center|LOCUS_01300 133543 133992 gene locus_tag LOCUS_01310 133543 133992 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_01310 134034 134486 gene locus_tag LOCUS_01320 134034 134486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 134839 135654 gene locus_tag LOCUS_01330 134839 135654 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_01330 135930 137984 gene locus_tag LOCUS_01340 135930 137984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_01340 138065 139270 gene locus_tag LOCUS_01350 138065 139270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 139271 139762 gene locus_tag LOCUS_01360 139271 139762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 139860 140111 gene locus_tag LOCUS_01370 139860 140111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 protein_id gnl|my_center|LOCUS_01370 140119 140433 gene locus_tag LOCUS_01380 140119 140433 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 protein_id gnl|my_center|LOCUS_01380 140543 142051 gene locus_tag LOCUS_01390 140543 142051 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_01390 142146 144158 gene locus_tag LOCUS_01400 gene rep 142146 144158 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TM8 protein_id gnl|my_center|LOCUS_01400 144315 144881 gene locus_tag LOCUS_01410 gene ahpC 144315 144881 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_01410 144957 146516 gene locus_tag LOCUS_01420 gene ahpF 144957 146516 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z2 protein_id gnl|my_center|LOCUS_01420 148014 146740 gene locus_tag LOCUS_01430 gene metY 148014 146740 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_01430 148526 148038 gene locus_tag LOCUS_01440 148526 148038 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706473.1 protein_id gnl|my_center|LOCUS_01440 149634 148666 gene locus_tag LOCUS_01450 149634 148666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976394.1 protein_id gnl|my_center|LOCUS_01450 150127 149678 gene locus_tag LOCUS_01460 150127 149678 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_01460 151226 150213 gene locus_tag LOCUS_01470 151226 150213 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_01470 151657 151223 gene locus_tag LOCUS_01480 151657 151223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948587.1 protein_id gnl|my_center|LOCUS_01480 152307 151657 gene locus_tag LOCUS_01490 gene nth 152307 151657 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT92 protein_id gnl|my_center|LOCUS_01490 153046 152348 gene locus_tag LOCUS_01500 gene rnfE 153046 152348 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6C1 protein_id gnl|my_center|LOCUS_01500 153683 153039 gene locus_tag LOCUS_01510 gene rnfG 153683 153039 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE77 protein_id gnl|my_center|LOCUS_01510 154714 153680 gene locus_tag LOCUS_01520 gene rnfD 154714 153680 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B9 protein_id gnl|my_center|LOCUS_01520 156216 154714 gene locus_tag LOCUS_01530 156216 154714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 156773 156213 gene locus_tag LOCUS_01540 156773 156213 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_01540 157358 156777 gene locus_tag LOCUS_01550 157358 156777 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX4 protein_id gnl|my_center|LOCUS_01550 158598 157543 gene locus_tag LOCUS_01560 gene aroG 158598 157543 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_01560 158800 159471 gene locus_tag LOCUS_01570 158800 159471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 159960 159490 gene locus_tag LOCUS_01580 gene ptpA 159960 159490 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_01580 160856 159975 gene locus_tag LOCUS_01590 160856 159975 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_01590 160947 161645 gene locus_tag LOCUS_01600 gene rpiA 160947 161645 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_01600 162180 161674 gene locus_tag LOCUS_01610 162180 161674 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931093.1 protein_id gnl|my_center|LOCUS_01610 162346 163353 gene locus_tag LOCUS_01620 gene socC 162346 163353 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_01620 163592 163368 gene locus_tag LOCUS_01630 163592 163368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 164771 163716 gene locus_tag LOCUS_01640 164771 163716 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_01640 168295 164828 gene locus_tag LOCUS_01650 gene mfd 168295 164828 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_01650 168449 170284 gene locus_tag LOCUS_01660 gene uvrC 168449 170284 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_01660 170335 170886 gene locus_tag LOCUS_01670 gene pgsA 170335 170886 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_01670 170939 171014 gene locus_tag LOCUS_t00020 170939 171014 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 171061 171134 gene locus_tag LOCUS_t00030 171061 171134 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 171782 171195 gene locus_tag LOCUS_01680 171782 171195 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_01680 172733 171909 gene locus_tag LOCUS_01690 gene cyoE1 172733 171909 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_01690 173828 172833 gene locus_tag LOCUS_01700 173828 172833 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_01700 174391 173843 gene locus_tag LOCUS_01710 174391 173843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530955.1 protein_id gnl|my_center|LOCUS_01710 175091 174375 gene locus_tag LOCUS_01720 175091 174375 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_01720 176059 175166 gene locus_tag LOCUS_01730 gene coIII 176059 175166 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_01730 176653 176090 gene locus_tag LOCUS_01740 gene ctaG 176653 176090 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_01740 178243 176660 gene locus_tag LOCUS_01750 gene coxA 178243 176660 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_01750 179376 178258 gene locus_tag LOCUS_01760 gene coxB 179376 178258 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_01760 179887 181242 gene locus_tag LOCUS_01770 179887 181242 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_01770 181425 181610 gene locus_tag LOCUS_01780 181425 181610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 181666 183648 gene locus_tag LOCUS_01790 181666 183648 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073784.1 protein_id gnl|my_center|LOCUS_01790 183776 183701 gene locus_tag LOCUS_t00040 183776 183701 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 186824 183990 gene locus_tag LOCUS_01800 186824 183990 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_01800 187116 187041 gene locus_tag LOCUS_t00050 187116 187041 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 188362 187178 gene locus_tag LOCUS_01810 gene aatA 188362 187178 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZE1 protein_id gnl|my_center|LOCUS_01810 188438 190453 gene locus_tag LOCUS_01820 gene uvrB 188438 190453 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E18 protein_id gnl|my_center|LOCUS_01820 190502 190578 gene locus_tag LOCUS_t00060 190502 190578 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 190878 193064 gene locus_tag LOCUS_01830 gene relA 190878 193064 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073302.1 protein_id gnl|my_center|LOCUS_01830 193312 195237 gene locus_tag LOCUS_01840 gene thrS 193312 195237 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS05 protein_id gnl|my_center|LOCUS_01840 195329 195757 gene locus_tag LOCUS_01850 gene infC 195329 195757 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_01850 195790 195987 gene locus_tag LOCUS_01860 gene rpmI 195790 195987 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D02 protein_id gnl|my_center|LOCUS_01860 196003 196362 gene locus_tag LOCUS_01870 gene rplT 196003 196362 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP6 protein_id gnl|my_center|LOCUS_01870 196459 197496 gene locus_tag LOCUS_01880 gene pheS 196459 197496 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_01880 197512 199890 gene locus_tag LOCUS_01890 gene pheT 197512 199890 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H7 protein_id gnl|my_center|LOCUS_01890 199927 200223 gene locus_tag LOCUS_01900 gene ihfA 199927 200223 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG1 protein_id gnl|my_center|LOCUS_01900 200201 200563 gene locus_tag LOCUS_01910 200201 200563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_01910 200781 200857 gene locus_tag LOCUS_t00070 200781 200857 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 201145 202437 gene locus_tag LOCUS_01920 201145 202437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891829.1 protein_id gnl|my_center|LOCUS_01920 202690 203742 gene locus_tag LOCUS_01930 202690 203742 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS43 protein_id gnl|my_center|LOCUS_01930 203903 204895 gene locus_tag LOCUS_01940 203903 204895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_01940 204936 205364 gene locus_tag LOCUS_01950 204936 205364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 205464 205943 gene locus_tag LOCUS_01960 205464 205943 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_01960 205956 207005 gene locus_tag LOCUS_01970 gene nagZ 205956 207005 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKN0 protein_id gnl|my_center|LOCUS_01970 207002 208741 gene locus_tag LOCUS_01980 207002 208741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 208844 212260 gene locus_tag LOCUS_01990 gene dnaE 208844 212260 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWX2 protein_id gnl|my_center|LOCUS_01990 212331 213431 gene locus_tag LOCUS_02000 gene uptC 212331 213431 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_02000 213493 214449 gene locus_tag LOCUS_02010 gene accA 213493 214449 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63ST0 protein_id gnl|my_center|LOCUS_02010 214459 215772 gene locus_tag LOCUS_02020 gene tilS 214459 215772 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_02020 215875 217512 gene locus_tag LOCUS_02030 gene pyrG 215875 217512 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_02030 217512 218348 gene locus_tag LOCUS_02040 gene kdsA 217512 218348 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z5 protein_id gnl|my_center|LOCUS_02040 >Feature sequence02 699 2789 gene locus_tag LOCUS_02050 699 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2793 3608 gene locus_tag LOCUS_02060 gene nirQ 2793 3608 CDS product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 protein_id gnl|my_center|LOCUS_02060 4229 3615 gene locus_tag LOCUS_02070 4229 3615 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_02070 6175 4238 gene locus_tag LOCUS_02080 6175 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7335 6172 gene locus_tag LOCUS_02090 gene acd 7335 6172 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227551.1 protein_id gnl|my_center|LOCUS_02090 7680 8630 gene locus_tag LOCUS_02100 7680 8630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 protein_id gnl|my_center|LOCUS_02100 10178 8640 gene locus_tag LOCUS_02110 gene murJ 10178 8640 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_02110 10250 10897 gene locus_tag LOCUS_02120 10250 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11805 10885 gene locus_tag LOCUS_02130 11805 10885 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_02130 11976 13064 gene locus_tag LOCUS_02140 gene recF 11976 13064 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TQ5 protein_id gnl|my_center|LOCUS_02140 13151 15568 gene locus_tag LOCUS_02150 gene gyrB 13151 15568 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MME2 protein_id gnl|my_center|LOCUS_02150 15730 16278 gene locus_tag LOCUS_02160 15730 16278 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532041.1 protein_id gnl|my_center|LOCUS_02160 16283 17695 gene locus_tag LOCUS_02170 16283 17695 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 protein_id gnl|my_center|LOCUS_02170 17679 18263 gene locus_tag LOCUS_02180 17679 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 protein_id gnl|my_center|LOCUS_02180 18256 18942 gene locus_tag LOCUS_02190 18256 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 19487 18939 gene locus_tag LOCUS_02200 19487 18939 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_02200 20186 19506 gene locus_tag LOCUS_02210 20186 19506 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_02210 20548 21720 gene locus_tag LOCUS_02220 gene alkB 20548 21720 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_02220 21817 22020 gene locus_tag LOCUS_02230 21817 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 22603 23280 gene locus_tag LOCUS_02240 22603 23280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 23305 24096 gene locus_tag LOCUS_02250 23305 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 24122 24334 gene locus_tag LOCUS_02260 24122 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 25028 24474 gene locus_tag LOCUS_02270 25028 24474 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_02270 26358 25045 gene locus_tag LOCUS_02280 26358 25045 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_02280 27521 26382 gene locus_tag LOCUS_02290 27521 26382 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_02290 29076 27541 gene locus_tag LOCUS_02300 gene gpmI 29076 27541 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_02300 29529 29948 gene locus_tag LOCUS_02310 29529 29948 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948012.1 protein_id gnl|my_center|LOCUS_02310 30046 30303 gene locus_tag LOCUS_02320 gene grxC 30046 30303 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772051.1 protein_id gnl|my_center|LOCUS_02320 30330 30809 gene locus_tag LOCUS_02330 gene secB 30330 30809 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BI9 protein_id gnl|my_center|LOCUS_02330 30817 31851 gene locus_tag LOCUS_02340 gene gpsA 30817 31851 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNT0 protein_id gnl|my_center|LOCUS_02340 31868 32722 gene locus_tag LOCUS_02350 31868 32722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 33916 32744 gene locus_tag LOCUS_02360 33916 32744 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_02360 33915 34649 gene locus_tag LOCUS_02370 33915 34649 CDS product pteridine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707726.1 protein_id gnl|my_center|LOCUS_02370 35114 34581 gene locus_tag LOCUS_02380 35114 34581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 35464 35111 gene locus_tag LOCUS_02390 gene folB 35464 35111 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_02390 35509 36135 gene locus_tag LOCUS_02400 gene plsY 35509 36135 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59251 protein_id gnl|my_center|LOCUS_02400 37154 36147 gene locus_tag LOCUS_02410 gene ygjD 37154 36147 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 protein_id gnl|my_center|LOCUS_02410 37292 37507 gene locus_tag LOCUS_02420 gene rpsU 37292 37507 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGI4 protein_id gnl|my_center|LOCUS_02420 37520 37981 gene locus_tag LOCUS_02430 37520 37981 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_02430 38054 39778 gene locus_tag LOCUS_02440 gene dnaG 38054 39778 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLI2 protein_id gnl|my_center|LOCUS_02440 39873 41675 gene locus_tag LOCUS_02450 gene rpoD 39873 41675 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHE1 protein_id gnl|my_center|LOCUS_02450 41683 41759 gene locus_tag LOCUS_t00080 41683 41759 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41944 43584 gene locus_tag LOCUS_02460 41944 43584 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525042.1 protein_id gnl|my_center|LOCUS_02460 43593 45047 gene locus_tag LOCUS_02470 43593 45047 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_02470 45229 46212 gene locus_tag LOCUS_02480 45229 46212 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_02480 46386 46994 gene locus_tag LOCUS_02490 gene lexA 46386 46994 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2R7 protein_id gnl|my_center|LOCUS_02490 47005 48240 gene locus_tag LOCUS_02500 gene dinB 47005 48240 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H50 protein_id gnl|my_center|LOCUS_02500 48314 49918 gene locus_tag LOCUS_02510 48314 49918 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_02510 50403 49939 gene locus_tag LOCUS_02520 gene trmL 50403 49939 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8X2 protein_id gnl|my_center|LOCUS_02520 50590 52155 gene locus_tag LOCUS_02530 50590 52155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 52284 52208 gene locus_tag LOCUS_t00090 52284 52208 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 53304 52333 gene locus_tag LOCUS_02540 gene pldA 53304 52333 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_02540 54418 53327 gene locus_tag LOCUS_02550 gene ychF 54418 53327 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_02550 55021 54446 gene locus_tag LOCUS_02560 gene pth 55021 54446 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AP0 protein_id gnl|my_center|LOCUS_02560 55749 55054 gene locus_tag LOCUS_02570 55749 55054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 56804 55872 gene locus_tag LOCUS_02580 gene prs 56804 55872 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_02580 56972 56898 gene locus_tag LOCUS_t00100 56972 56898 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 57863 57024 gene locus_tag LOCUS_02590 gene ispE 57863 57024 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN01 protein_id gnl|my_center|LOCUS_02590 58468 57860 gene locus_tag LOCUS_02600 gene lolB 58468 57860 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX0 protein_id gnl|my_center|LOCUS_02600 60262 58469 gene locus_tag LOCUS_02610 60262 58469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266732.1 protein_id gnl|my_center|LOCUS_02610 60565 61821 gene locus_tag LOCUS_02620 gene hemA 60565 61821 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_02620 61825 62913 gene locus_tag LOCUS_02630 gene prfA 61825 62913 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_02630 62999 63235 gene locus_tag LOCUS_02640 62999 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 64187 63255 gene locus_tag LOCUS_02650 gene hemF 64187 63255 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX7 protein_id gnl|my_center|LOCUS_02650 64732 64184 gene locus_tag LOCUS_02660 gene tsaC 64732 64184 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX6 protein_id gnl|my_center|LOCUS_02660 65709 64837 gene locus_tag LOCUS_02670 65709 64837 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRP1 protein_id gnl|my_center|LOCUS_02670 67033 65753 gene locus_tag LOCUS_02680 gene purD 67033 65753 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV81 protein_id gnl|my_center|LOCUS_02680 67225 67896 gene locus_tag LOCUS_02690 67225 67896 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHG2 protein_id gnl|my_center|LOCUS_02690 68077 68232 gene locus_tag LOCUS_02700 68077 68232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 68293 68379 gene locus_tag LOCUS_t00110 68293 68379 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 68535 68801 gene locus_tag LOCUS_02710 68535 68801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 68990 70519 gene locus_tag LOCUS_02720 68990 70519 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QK7 protein_id gnl|my_center|LOCUS_02720 70512 71408 gene locus_tag LOCUS_02730 70512 71408 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085900.1 protein_id gnl|my_center|LOCUS_02730 72182 71664 gene locus_tag LOCUS_02740 72182 71664 CDS product starvation lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478780.1 protein_id gnl|my_center|LOCUS_02740 72620 73543 gene locus_tag LOCUS_02750 72620 73543 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_02750 73766 73993 gene locus_tag LOCUS_02760 73766 73993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 74213 75073 gene locus_tag LOCUS_02770 74213 75073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 75084 77405 gene locus_tag LOCUS_02780 75084 77405 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 protein_id gnl|my_center|LOCUS_02780 77402 78715 gene locus_tag LOCUS_02790 77402 78715 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947326.1 protein_id gnl|my_center|LOCUS_02790 78720 80759 gene locus_tag LOCUS_02800 gene yfcX 78720 80759 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_02800 80756 82561 gene locus_tag LOCUS_02810 80756 82561 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084106.1 protein_id gnl|my_center|LOCUS_02810 82564 82938 gene locus_tag LOCUS_02820 82564 82938 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_02820 83317 83838 gene locus_tag LOCUS_02830 83317 83838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 83855 85201 gene locus_tag LOCUS_02840 83855 85201 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_02840 85621 86457 gene locus_tag LOCUS_02850 85621 86457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_02850 86457 87488 gene locus_tag LOCUS_02860 gene pyrD 86457 87488 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5B6 protein_id gnl|my_center|LOCUS_02860 87481 88275 gene locus_tag LOCUS_02870 87481 88275 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_02870 89056 88289 gene locus_tag LOCUS_02880 gene gloB 89056 88289 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EK5 protein_id gnl|my_center|LOCUS_02880 89184 89924 gene locus_tag LOCUS_02890 89184 89924 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_02890 89911 90351 gene locus_tag LOCUS_02900 gene rnhA 89911 90351 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YT0 protein_id gnl|my_center|LOCUS_02900 90364 91107 gene locus_tag LOCUS_02910 90364 91107 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_02910 91210 91758 gene locus_tag LOCUS_02920 91210 91758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 91866 93779 gene locus_tag LOCUS_02930 gene dnaK 91866 93779 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 protein_id gnl|my_center|LOCUS_02930 93866 94981 gene locus_tag LOCUS_02940 gene dnaJ 93866 94981 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_02940 94994 95803 gene locus_tag LOCUS_02950 gene dapB 94994 95803 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38103 protein_id gnl|my_center|LOCUS_02950 96295 95831 gene locus_tag LOCUS_02960 96295 95831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 98772 96433 gene locus_tag LOCUS_02970 gene mrcB 98772 96433 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_02970 99040 99597 gene locus_tag LOCUS_02980 99040 99597 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_02980 99624 101609 gene locus_tag LOCUS_02990 gene tkt1 99624 101609 CDS product transketolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7R1 protein_id gnl|my_center|LOCUS_02990 101775 102773 gene locus_tag LOCUS_03000 gene gapA 101775 102773 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FXX2 protein_id gnl|my_center|LOCUS_03000 102932 104107 gene locus_tag LOCUS_03010 gene pgk 102932 104107 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_03010 104125 105567 gene locus_tag LOCUS_03020 gene pyk-2 104125 105567 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHY7 protein_id gnl|my_center|LOCUS_03020 105607 106668 gene locus_tag LOCUS_03030 105607 106668 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_03030 106803 107177 gene locus_tag LOCUS_03040 gene crcB 106803 107177 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_03040 107174 107479 gene locus_tag LOCUS_03050 107174 107479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_03050 107481 108755 gene locus_tag LOCUS_03060 gene serS 107481 108755 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67564 protein_id gnl|my_center|LOCUS_03060 108748 109404 gene locus_tag LOCUS_03070 108748 109404 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_03070 109440 110657 gene locus_tag LOCUS_03080 gene trpS 109440 110657 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_03080 110693 111577 gene locus_tag LOCUS_03090 110693 111577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 112513 111590 gene locus_tag LOCUS_03100 112513 111590 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_03100 113359 112628 gene locus_tag LOCUS_03110 113359 112628 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 protein_id gnl|my_center|LOCUS_03110 113565 113359 gene locus_tag LOCUS_03120 113565 113359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 114861 113578 gene locus_tag LOCUS_03130 114861 113578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_03130 115715 114858 gene locus_tag LOCUS_03140 115715 114858 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_03140 116014 115712 gene locus_tag LOCUS_03150 116014 115712 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_03150 117046 116078 gene locus_tag LOCUS_03160 gene ispB 117046 116078 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_03160 117218 117529 gene locus_tag LOCUS_03170 gene rplU 117218 117529 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUT0 protein_id gnl|my_center|LOCUS_03170 117556 117813 gene locus_tag LOCUS_03180 gene rpmA 117556 117813 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU3 protein_id gnl|my_center|LOCUS_03180 117935 119011 gene locus_tag LOCUS_03190 gene obg 117935 119011 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_03190 119015 120145 gene locus_tag LOCUS_03200 gene proB 119015 120145 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_03200 120689 120210 gene locus_tag LOCUS_03210 120689 120210 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_03210 121030 120839 gene locus_tag LOCUS_03220 121030 120839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 122290 121208 gene locus_tag LOCUS_03230 122290 121208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 protein_id gnl|my_center|LOCUS_03230 122727 122467 gene locus_tag LOCUS_03240 gene rpsT 122727 122467 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_03240 122895 123704 gene locus_tag LOCUS_03250 gene xth-1 122895 123704 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_03250 123705 125264 gene locus_tag LOCUS_03260 123705 125264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_03260 125261 125851 gene locus_tag LOCUS_03270 125261 125851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 126413 125943 gene locus_tag LOCUS_03280 126413 125943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 127810 126455 gene locus_tag LOCUS_03290 127810 126455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_03290 127895 130714 gene locus_tag LOCUS_03300 gene uvrA 127895 130714 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_03300 130718 131332 gene locus_tag LOCUS_03310 130718 131332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 132259 131339 gene locus_tag LOCUS_03320 gene tonB3 132259 131339 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_03320 133311 132262 gene locus_tag LOCUS_03330 133311 132262 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UJ2 protein_id gnl|my_center|LOCUS_03330 134255 133308 gene locus_tag LOCUS_03340 gene gshB 134255 133308 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_03340 134420 135358 gene locus_tag LOCUS_03350 gene glyQ 134420 135358 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_03350 135355 137430 gene locus_tag LOCUS_03360 gene glyS 135355 137430 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_03360 137493 138035 gene locus_tag LOCUS_03370 137493 138035 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X71 protein_id gnl|my_center|LOCUS_03370 138035 138784 gene locus_tag LOCUS_03380 gene lptA 138035 138784 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_03380 138786 140873 gene locus_tag LOCUS_03390 gene fimX 138786 140873 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_03390 142146 141046 gene locus_tag LOCUS_03400 142146 141046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_03400 143065 142160 gene locus_tag LOCUS_03410 143065 142160 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_03410 144139 143111 gene locus_tag LOCUS_03420 144139 143111 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_03420 145002 144139 gene locus_tag LOCUS_03430 gene mtdA 145002 144139 CDS product MtdA bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_03430 145204 146619 gene locus_tag LOCUS_03440 gene gltX 145204 146619 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XBN2 protein_id gnl|my_center|LOCUS_03440 147018 146635 gene locus_tag LOCUS_03450 147018 146635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 147623 147024 gene locus_tag LOCUS_03460 gene sspA 147623 147024 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_03460 148481 147735 gene locus_tag LOCUS_03470 gene petC 148481 147735 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981022.1 protein_id gnl|my_center|LOCUS_03470 149689 148478 gene locus_tag LOCUS_03480 149689 148478 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_03480 150285 149689 gene locus_tag LOCUS_03490 gene petA 150285 149689 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD50 protein_id gnl|my_center|LOCUS_03490 150563 150811 gene locus_tag LOCUS_03500 150563 150811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 150847 151479 gene locus_tag LOCUS_03510 150847 151479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_03510 151549 153351 gene locus_tag LOCUS_03520 gene aspS 151549 153351 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_03520 153368 153568 gene locus_tag LOCUS_03530 153368 153568 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_03530 153576 153974 gene locus_tag LOCUS_03540 153576 153974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 153998 155074 gene locus_tag LOCUS_03550 gene nadA 153998 155074 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E686 protein_id gnl|my_center|LOCUS_03550 155288 155088 gene locus_tag LOCUS_03560 gene yacG 155288 155088 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_03560 156073 155303 gene locus_tag LOCUS_03570 gene zapD 156073 155303 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F03 protein_id gnl|my_center|LOCUS_03570 156745 156110 gene locus_tag LOCUS_03580 gene coaE 156745 156110 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F01 protein_id gnl|my_center|LOCUS_03580 157623 156754 gene locus_tag LOCUS_03590 157623 156754 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_03590 159056 157821 gene locus_tag LOCUS_03600 gene pilC 159056 157821 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_03600 160778 159060 gene locus_tag LOCUS_03610 gene pilB 160778 159060 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_03610 161072 162322 gene locus_tag LOCUS_03620 gene lysA 161072 162322 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_03620 162325 163173 gene locus_tag LOCUS_03630 gene dapF 162325 163173 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL93 protein_id gnl|my_center|LOCUS_03630 163149 163853 gene locus_tag LOCUS_03640 163149 163853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038590.1 protein_id gnl|my_center|LOCUS_03640 163846 164745 gene locus_tag LOCUS_03650 gene xerC 163846 164745 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_03650 164813 165748 gene locus_tag LOCUS_03660 164813 165748 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460932.1 protein_id gnl|my_center|LOCUS_03660 168509 165771 gene locus_tag LOCUS_03670 gene polA 168509 165771 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_03670 168601 168930 gene locus_tag LOCUS_03680 168601 168930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 168957 169904 gene locus_tag LOCUS_03690 gene thrB 168957 169904 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4W557 protein_id gnl|my_center|LOCUS_03690 169913 170950 gene locus_tag LOCUS_03700 gene waaC 169913 170950 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_03700 170986 172437 gene locus_tag LOCUS_03710 gene hldE 170986 172437 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG9 protein_id gnl|my_center|LOCUS_03710 173825 172773 gene locus_tag LOCUS_03720 173825 172773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 174808 173822 gene locus_tag LOCUS_03730 174808 173822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 175026 174805 gene locus_tag LOCUS_03740 175026 174805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 176714 175392 gene locus_tag LOCUS_03750 176714 175392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence03 <1 1611 gene locus_tag LOCUS_03760 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105014.1:TIGR02099 family protein 1681 3123 gene locus_tag LOCUS_03770 gene tldD 1681 3123 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105013.1 protein_id gnl|my_center|LOCUS_03770 3123 4175 gene locus_tag LOCUS_03780 3123 4175 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947976.1 protein_id gnl|my_center|LOCUS_03780 4175 4399 gene locus_tag LOCUS_03790 4175 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4580 5989 gene locus_tag LOCUS_03800 4580 5989 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_03800 6179 6700 gene locus_tag LOCUS_03810 6179 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_03810 6920 7972 gene locus_tag LOCUS_03820 6920 7972 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_03820 7965 9362 gene locus_tag LOCUS_03830 gene ntrC 7965 9362 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_03830 9408 9484 gene locus_tag LOCUS_t00120 9408 9484 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9565 10011 gene locus_tag LOCUS_03840 gene rimP 9565 10011 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_03840 10088 11602 gene locus_tag LOCUS_03850 gene nusA 10088 11602 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_03850 11605 14418 gene locus_tag LOCUS_03860 gene infB 11605 14418 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE3 protein_id gnl|my_center|LOCUS_03860 14418 14789 gene locus_tag LOCUS_03870 gene rbfA 14418 14789 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_03870 14799 15725 gene locus_tag LOCUS_03880 gene truB 14799 15725 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU78 protein_id gnl|my_center|LOCUS_03880 15870 16139 gene locus_tag LOCUS_03890 gene rpsO 15870 16139 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XU44 protein_id gnl|my_center|LOCUS_03890 16319 18412 gene locus_tag LOCUS_03900 gene pnp 16319 18412 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL1 protein_id gnl|my_center|LOCUS_03900 18567 18824 gene locus_tag LOCUS_03910 18567 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 18963 20537 gene locus_tag LOCUS_03920 gene prfC 18963 20537 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DC7 protein_id gnl|my_center|LOCUS_03920 20617 21075 gene locus_tag LOCUS_03930 20617 21075 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_03930 21395 21117 gene locus_tag LOCUS_03940 21395 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 21558 24371 gene locus_tag LOCUS_03950 gene ileS 21558 24371 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7N4 protein_id gnl|my_center|LOCUS_03950 24384 24857 gene locus_tag LOCUS_03960 gene lspA 24384 24857 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_03960 24857 25957 gene locus_tag LOCUS_03970 gene hisC2 24857 25957 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_03970 25950 26837 gene locus_tag LOCUS_03980 25950 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 26868 28187 gene locus_tag LOCUS_03990 26868 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03990 28171 28845 gene locus_tag LOCUS_04000 gene cmk 28171 28845 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_04000 28953 30629 gene locus_tag LOCUS_04010 gene rpsA 28953 30629 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P5 protein_id gnl|my_center|LOCUS_04010 30765 31055 gene locus_tag LOCUS_04020 gene ihfB 30765 31055 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T0 protein_id gnl|my_center|LOCUS_04020 31068 31463 gene locus_tag LOCUS_04030 31068 31463 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_04030 31567 32991 gene locus_tag LOCUS_04040 gene ccoN2 31567 32991 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_04040 33002 33682 gene locus_tag LOCUS_04050 gene ccoO2 33002 33682 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_04050 33675 33887 gene locus_tag LOCUS_04060 33675 33887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 33877 34863 gene locus_tag LOCUS_04070 gene fixP 33877 34863 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIY8 protein_id gnl|my_center|LOCUS_04070 35016 36434 gene locus_tag LOCUS_04080 gene ccoG 35016 36434 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_04080 36441 36941 gene locus_tag LOCUS_04090 36441 36941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 37012 39441 gene locus_tag LOCUS_04100 37012 39441 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361687.1 protein_id gnl|my_center|LOCUS_04100 39447 39656 gene locus_tag LOCUS_04110 39447 39656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 39712 42135 gene locus_tag LOCUS_04120 39712 42135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 42737 42132 gene locus_tag LOCUS_04130 42737 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 43203 42751 gene locus_tag LOCUS_04140 gene dtd 43203 42751 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX9 protein_id gnl|my_center|LOCUS_04140 43420 44592 gene locus_tag LOCUS_04150 gene sucC 43420 44592 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53592 protein_id gnl|my_center|LOCUS_04150 44589 45464 gene locus_tag LOCUS_04160 gene sucD 44589 45464 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY38 protein_id gnl|my_center|LOCUS_04160 45464 47104 gene locus_tag LOCUS_04170 gene nadE 45464 47104 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_04170 47113 47451 gene locus_tag LOCUS_04180 47113 47451 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106041.1 protein_id gnl|my_center|LOCUS_04180 48198 47473 gene locus_tag LOCUS_04190 48198 47473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 48403 49557 gene locus_tag LOCUS_04200 48403 49557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 49910 49629 gene locus_tag LOCUS_04210 49910 49629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 50138 50935 gene locus_tag LOCUS_04220 50138 50935 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705600.1 protein_id gnl|my_center|LOCUS_04220 50997 52829 gene locus_tag LOCUS_04230 gene typA 50997 52829 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_04230 52912 53133 gene locus_tag LOCUS_04240 52912 53133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 53133 54731 gene locus_tag LOCUS_04250 gene pilS 53133 54731 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_04250 54728 56095 gene locus_tag LOCUS_04260 gene pilR 54728 56095 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_04260 56210 56135 gene locus_tag LOCUS_t00130 56210 56135 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 58473 56308 gene locus_tag LOCUS_04270 gene rnr 58473 56308 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2D7 protein_id gnl|my_center|LOCUS_04270 58437 58667 gene locus_tag LOCUS_04280 58437 58667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 58801 59436 gene locus_tag LOCUS_04290 gene coq7 58801 59436 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML8 protein_id gnl|my_center|LOCUS_04290 59650 62043 gene locus_tag LOCUS_04300 59650 62043 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478132.1 protein_id gnl|my_center|LOCUS_04300 62088 62504 gene locus_tag LOCUS_04310 62088 62504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 62619 63749 gene locus_tag LOCUS_04320 62619 63749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 63915 64544 gene locus_tag LOCUS_04330 gene can-2 63915 64544 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AP5 protein_id gnl|my_center|LOCUS_04330 65259 64591 gene locus_tag LOCUS_04340 65259 64591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 65339 65758 gene locus_tag LOCUS_04350 gene fur 65339 65758 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_04350 67437 65755 gene locus_tag LOCUS_04360 gene recN 67437 65755 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_04360 68296 67427 gene locus_tag LOCUS_04370 gene nadK 68296 67427 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_04370 68471 68902 gene locus_tag LOCUS_04380 gene ndk 68471 68902 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_04380 68923 70020 gene locus_tag LOCUS_04390 gene rlmN 68923 70020 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_04390 70017 70775 gene locus_tag LOCUS_04400 gene pilF 70017 70775 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_04400 70777 71298 gene locus_tag LOCUS_04410 70777 71298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 71314 72441 gene locus_tag LOCUS_04420 gene ispG 71314 72441 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_04420 72444 73700 gene locus_tag LOCUS_04430 gene hisS 72444 73700 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_04430 73716 75356 gene locus_tag LOCUS_04440 gene pgi 73716 75356 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRV9 protein_id gnl|my_center|LOCUS_04440 77590 75416 gene locus_tag LOCUS_04450 gene glgB 77590 75416 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 protein_id gnl|my_center|LOCUS_04450 77685 78953 gene locus_tag LOCUS_04460 gene glgC 77685 78953 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_04460 78943 80625 gene locus_tag LOCUS_04470 78943 80625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 80626 82083 gene locus_tag LOCUS_04480 80626 82083 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_04480 82087 82470 gene locus_tag LOCUS_04490 gene gcvH 82087 82470 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_04490 83549 82446 gene locus_tag LOCUS_04500 gene anmK 83549 82446 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_04500 85081 83576 gene locus_tag LOCUS_04510 85081 83576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_04510 85211 86410 gene locus_tag LOCUS_04520 gene tyrS 85211 86410 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_04520 86834 86466 gene locus_tag LOCUS_04530 86834 86466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 87144 88403 gene locus_tag LOCUS_04540 gene rho 87144 88403 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_04540 88453 89373 gene locus_tag LOCUS_04550 gene miaA 88453 89373 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV12 protein_id gnl|my_center|LOCUS_04550 89460 89687 gene locus_tag LOCUS_04560 gene hfq 89460 89687 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV11 protein_id gnl|my_center|LOCUS_04560 89699 90844 gene locus_tag LOCUS_04570 gene hflX 89699 90844 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ08 protein_id gnl|my_center|LOCUS_04570 91040 92227 gene locus_tag LOCUS_04580 gene hflK 91040 92227 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_04580 92229 93092 gene locus_tag LOCUS_04590 gene hflC 92229 93092 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_04590 93298 94485 gene locus_tag LOCUS_04600 gene hisZ 93298 94485 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_04600 94478 95773 gene locus_tag LOCUS_04610 gene purA 94478 95773 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65883 protein_id gnl|my_center|LOCUS_04610 96630 95770 gene locus_tag LOCUS_04620 96630 95770 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088835.1 protein_id gnl|my_center|LOCUS_04620 96766 98004 gene locus_tag LOCUS_04630 gene glyA 96766 98004 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_04630 98048 98521 gene locus_tag LOCUS_04640 gene nrdR 98048 98521 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_04640 98537 99634 gene locus_tag LOCUS_04650 gene ribD 98537 99634 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MI15 protein_id gnl|my_center|LOCUS_04650 99672 100313 gene locus_tag LOCUS_04660 gene ribC 99672 100313 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_04660 100310 101422 gene locus_tag LOCUS_04670 gene ribB 100310 101422 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG9 protein_id gnl|my_center|LOCUS_04670 101426 102559 gene locus_tag LOCUS_04680 gene lpxB 101426 102559 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_04680 102568 103143 gene locus_tag LOCUS_04690 gene rnhB 102568 103143 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83MN1 protein_id gnl|my_center|LOCUS_04690 103211 104557 gene locus_tag LOCUS_04700 gene pcnB 103211 104557 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_04700 104557 105045 gene locus_tag LOCUS_04710 104557 105045 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 protein_id gnl|my_center|LOCUS_04710 105042 105701 gene locus_tag LOCUS_04720 105042 105701 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_04720 105698 106492 gene locus_tag LOCUS_04730 gene panB 105698 106492 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_04730 106492 107343 gene locus_tag LOCUS_04740 gene panC 106492 107343 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_04740 107395 107775 gene locus_tag LOCUS_04750 gene panD 107395 107775 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_04750 108298 107885 gene locus_tag LOCUS_04760 108298 107885 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQB6 protein_id gnl|my_center|LOCUS_04760 109183 108389 gene locus_tag LOCUS_04770 gene yeeZ 109183 108389 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_04770 110064 109180 gene locus_tag LOCUS_04780 110064 109180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 110282 111325 gene locus_tag LOCUS_04790 110282 111325 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105677.1 protein_id gnl|my_center|LOCUS_04790 112260 111322 gene locus_tag LOCUS_04800 112260 111322 CDS product folate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_04800 112341 112781 gene locus_tag LOCUS_04810 112341 112781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 114366 112762 gene locus_tag LOCUS_04820 gene nadB 114366 112762 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 protein_id gnl|my_center|LOCUS_04820 114708 115289 gene locus_tag LOCUS_04830 gene algU 114708 115289 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_04830 115286 115864 gene locus_tag LOCUS_04840 115286 115864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 115871 116842 gene locus_tag LOCUS_04850 gene mucB 115871 116842 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813793.1 protein_id gnl|my_center|LOCUS_04850 116845 117270 gene locus_tag LOCUS_04860 116845 117270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 117267 118703 gene locus_tag LOCUS_04870 gene mucD 117267 118703 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_04870 118846 120639 gene locus_tag LOCUS_04880 gene lepA 118846 120639 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43729 protein_id gnl|my_center|LOCUS_04880 120657 121424 gene locus_tag LOCUS_04890 gene lepB-1 120657 121424 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_04890 121438 121815 gene locus_tag LOCUS_04900 121438 121815 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 protein_id gnl|my_center|LOCUS_04900 121816 122499 gene locus_tag LOCUS_04910 gene rnc 121816 122499 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN9 protein_id gnl|my_center|LOCUS_04910 122496 123407 gene locus_tag LOCUS_04920 gene era 122496 123407 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 protein_id gnl|my_center|LOCUS_04920 123419 124138 gene locus_tag LOCUS_04930 gene recO 123419 124138 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51838 protein_id gnl|my_center|LOCUS_04930 124156 124884 gene locus_tag LOCUS_04940 gene pdxJ 124156 124884 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A794 protein_id gnl|my_center|LOCUS_04940 124881 125273 gene locus_tag LOCUS_04950 gene acpS 124881 125273 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIF7 protein_id gnl|my_center|LOCUS_04950 125263 126147 gene locus_tag LOCUS_04960 125263 126147 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_04960 126149 128200 gene locus_tag LOCUS_04970 126149 128200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 128215 128811 gene locus_tag LOCUS_04980 128215 128811 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_04980 128906 130237 gene locus_tag LOCUS_04990 gene rlmD 128906 130237 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX1 protein_id gnl|my_center|LOCUS_04990 132732 130321 gene locus_tag LOCUS_05000 gene ppsA 132732 130321 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_05000 133255 133171 gene locus_tag LOCUS_t00140 133255 133171 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 133336 134439 gene locus_tag LOCUS_05010 gene queA 133336 134439 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM2 protein_id gnl|my_center|LOCUS_05010 134436 135167 gene locus_tag LOCUS_05020 gene trmJ 134436 135167 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CI4 protein_id gnl|my_center|LOCUS_05020 135167 135967 gene locus_tag LOCUS_05030 gene cysE 135167 135967 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_05030 136047 136496 gene locus_tag LOCUS_05040 gene iscR 136047 136496 CDS product HTH-type transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIJ8 protein_id gnl|my_center|LOCUS_05040 136575 136901 gene locus_tag LOCUS_05050 gene iscA 136575 136901 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ34 protein_id gnl|my_center|LOCUS_05050 137910 136894 gene locus_tag LOCUS_05060 137910 136894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 139340 137907 gene locus_tag LOCUS_05070 139340 137907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933534.1 protein_id gnl|my_center|LOCUS_05070 139490 140806 gene locus_tag LOCUS_05080 gene bioA 139490 140806 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WHP9 protein_id gnl|my_center|LOCUS_05080 141612 140989 gene locus_tag LOCUS_05090 141612 140989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 142839 141640 gene locus_tag LOCUS_05100 142839 141640 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_05100 143641 142931 gene locus_tag LOCUS_05110 143641 142931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_05110 143949 143677 gene locus_tag LOCUS_05120 143949 143677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 144635 143952 gene locus_tag LOCUS_05130 144635 143952 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074254.1 protein_id gnl|my_center|LOCUS_05130 145097 144645 gene locus_tag LOCUS_05140 145097 144645 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619982.1 protein_id gnl|my_center|LOCUS_05140 146639 145122 gene locus_tag LOCUS_05150 146639 145122 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAC6 protein_id gnl|my_center|LOCUS_05150 148374 146659 gene locus_tag LOCUS_05160 gene proS 148374 146659 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 protein_id gnl|my_center|LOCUS_05160 148790 148458 gene locus_tag LOCUS_05170 148790 148458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 149214 148804 gene locus_tag LOCUS_05180 149214 148804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_05180 149308 150156 gene locus_tag LOCUS_05190 149308 150156 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X038 protein_id gnl|my_center|LOCUS_05190 150218 150418 gene locus_tag LOCUS_05200 150218 150418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 152242 150455 gene locus_tag LOCUS_05210 gene feoB 152242 150455 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIY3 protein_id gnl|my_center|LOCUS_05210 152472 152239 gene locus_tag LOCUS_05220 152472 152239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 153795 152536 gene locus_tag LOCUS_05230 gene dinF 153795 152536 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262808.1 protein_id gnl|my_center|LOCUS_05230 155925 153913 gene locus_tag LOCUS_05240 gene hppA1 155925 153913 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_05240 156079 156870 gene locus_tag LOCUS_05250 156079 156870 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727S2 protein_id gnl|my_center|LOCUS_05250 156877 157056 gene locus_tag LOCUS_05260 156877 157056 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA5 protein_id gnl|my_center|LOCUS_05260 157150 157689 gene locus_tag LOCUS_05270 gene ppa 157150 157689 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSS7 protein_id gnl|my_center|LOCUS_05270 157772 158617 gene locus_tag LOCUS_05280 157772 158617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 158693 159007 gene locus_tag LOCUS_05290 158693 159007 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW4 protein_id gnl|my_center|LOCUS_05290 159013 159339 gene locus_tag LOCUS_05300 gene clpS1 159013 159339 CDS product ATP-dependent Clp protease adapter protein ClpS 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFN4 protein_id gnl|my_center|LOCUS_05300 159370 161628 gene locus_tag LOCUS_05310 gene cl 159370 161628 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946554.1 protein_id gnl|my_center|LOCUS_05310 162561 161962 gene locus_tag LOCUS_05320 gene cobO 162561 161962 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_05320 164688 162649 gene locus_tag LOCUS_05330 164688 162649 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_05330 164825 164643 gene locus_tag LOCUS_05340 164825 164643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 165118 166356 gene locus_tag LOCUS_05350 gene metZ 165118 166356 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_05350 166575 168374 gene locus_tag LOCUS_05360 166575 168374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence04 2368 2075 gene locus_tag LOCUS_05370 2368 2075 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71376 protein_id gnl|my_center|LOCUS_05370 2418 4613 gene locus_tag LOCUS_05380 gene rlmL 2418 4613 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_05380 6731 4638 gene locus_tag LOCUS_05390 gene ppk 6731 4638 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP6 protein_id gnl|my_center|LOCUS_05390 7263 6802 gene locus_tag LOCUS_05400 7263 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268705.1 protein_id gnl|my_center|LOCUS_05400 7274 7753 gene locus_tag LOCUS_05410 7274 7753 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHE8 protein_id gnl|my_center|LOCUS_05410 7743 8165 gene locus_tag LOCUS_05420 7743 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 8234 9523 gene locus_tag LOCUS_05430 gene apeB 8234 9523 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC5 protein_id gnl|my_center|LOCUS_05430 9545 9829 gene locus_tag LOCUS_05440 9545 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768280.1 protein_id gnl|my_center|LOCUS_05440 9822 10544 gene locus_tag LOCUS_05450 9822 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 protein_id gnl|my_center|LOCUS_05450 10693 10950 gene locus_tag LOCUS_05460 10693 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 11549 10968 gene locus_tag LOCUS_05470 11549 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114344.1 protein_id gnl|my_center|LOCUS_05470 11683 13065 gene locus_tag LOCUS_05480 gene dbpA 11683 13065 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_05480 13089 15929 gene locus_tag LOCUS_05490 gene hepA 13089 15929 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT66 protein_id gnl|my_center|LOCUS_05490 15932 16489 gene locus_tag LOCUS_05500 15932 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113272.1 protein_id gnl|my_center|LOCUS_05500 16504 18051 gene locus_tag LOCUS_05510 16504 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 protein_id gnl|my_center|LOCUS_05510 18058 19077 gene locus_tag LOCUS_05520 18058 19077 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406757.1 protein_id gnl|my_center|LOCUS_05520 19268 20503 gene locus_tag LOCUS_05530 19268 20503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 20496 23618 gene locus_tag LOCUS_05540 20496 23618 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_05540 24242 23640 gene locus_tag LOCUS_05550 24242 23640 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_05550 26207 24315 gene locus_tag LOCUS_05560 26207 24315 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946565.1 protein_id gnl|my_center|LOCUS_05560 26414 27331 gene locus_tag LOCUS_05570 26414 27331 CDS product malate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035429.1 protein_id gnl|my_center|LOCUS_05570 28062 27313 gene locus_tag LOCUS_05580 28062 27313 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_05580 28488 28102 gene locus_tag LOCUS_05590 28488 28102 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 protein_id gnl|my_center|LOCUS_05590 28681 29226 gene locus_tag LOCUS_05600 gene fae 28681 29226 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_05600 29387 29929 gene locus_tag LOCUS_05610 29387 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 29937 30512 gene locus_tag LOCUS_05620 29937 30512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_05620 30516 31427 gene locus_tag LOCUS_05630 30516 31427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_05630 31429 33342 gene locus_tag LOCUS_05640 gene yoaA 31429 33342 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_05640 33761 33339 gene locus_tag LOCUS_05650 33761 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263360.1 protein_id gnl|my_center|LOCUS_05650 34213 33842 gene locus_tag LOCUS_05660 34213 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_05660 34422 34216 gene locus_tag LOCUS_05670 34422 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 34835 34452 gene locus_tag LOCUS_05680 34835 34452 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE73 protein_id gnl|my_center|LOCUS_05680 35167 36249 gene locus_tag LOCUS_05690 35167 36249 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU9 protein_id gnl|my_center|LOCUS_05690 36252 39131 gene locus_tag LOCUS_05700 gene gcvP 36252 39131 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887L5 protein_id gnl|my_center|LOCUS_05700 39521 40093 gene locus_tag LOCUS_05710 39521 40093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 40099 41160 gene locus_tag LOCUS_05720 40099 41160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 41165 44968 gene locus_tag LOCUS_05730 41165 44968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 44965 45393 gene locus_tag LOCUS_05740 44965 45393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 45417 45797 gene locus_tag LOCUS_05750 45417 45797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 45874 46320 gene locus_tag LOCUS_05760 45874 46320 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832895.1 protein_id gnl|my_center|LOCUS_05760 46848 47672 gene locus_tag LOCUS_05770 46848 47672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 47766 49151 gene locus_tag LOCUS_05780 47766 49151 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958257.1 protein_id gnl|my_center|LOCUS_05780 49166 49918 gene locus_tag LOCUS_05790 49166 49918 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_05790 50833 51420 gene locus_tag LOCUS_05800 50833 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 51868 51467 gene locus_tag LOCUS_05810 51868 51467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 52259 51906 gene locus_tag LOCUS_05820 52259 51906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 54510 52300 gene locus_tag LOCUS_05830 gene plpD 54510 52300 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_05830 55233 54562 gene locus_tag LOCUS_05840 55233 54562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 56979 55396 gene locus_tag LOCUS_05850 gene ymdC 56979 55396 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261533.1 protein_id gnl|my_center|LOCUS_05850 58752 57076 gene locus_tag LOCUS_05860 58752 57076 CDS product putative transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL13 protein_id gnl|my_center|LOCUS_05860 60252 58912 gene locus_tag LOCUS_05870 60252 58912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087838.1 protein_id gnl|my_center|LOCUS_05870 60910 60257 gene locus_tag LOCUS_05880 60910 60257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106538.1 protein_id gnl|my_center|LOCUS_05880 64082 60972 gene locus_tag LOCUS_05890 64082 60972 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_05890 65225 64086 gene locus_tag LOCUS_05900 65225 64086 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_05900 66786 65266 gene locus_tag LOCUS_05910 66786 65266 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462727.1 protein_id gnl|my_center|LOCUS_05910 67933 67304 gene locus_tag LOCUS_05920 67933 67304 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_05920 68227 68436 gene locus_tag LOCUS_05930 68227 68436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 69097 68474 gene locus_tag LOCUS_05940 69097 68474 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_05940 69885 69115 gene locus_tag LOCUS_05950 69885 69115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_05950 70264 69911 gene locus_tag LOCUS_05960 gene pilZ 70264 69911 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_05960 71221 70277 gene locus_tag LOCUS_05970 gene holB 71221 70277 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_05970 71845 71225 gene locus_tag LOCUS_05980 gene tmk 71845 71225 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_05980 72846 71845 gene locus_tag LOCUS_05990 72846 71845 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_05990 73664 72846 gene locus_tag LOCUS_06000 gene pabC 73664 72846 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_06000 74921 73683 gene locus_tag LOCUS_06010 gene fabF 74921 73683 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH5 protein_id gnl|my_center|LOCUS_06010 75257 75021 gene locus_tag LOCUS_06020 gene acpP 75257 75021 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_06020 76141 75398 gene locus_tag LOCUS_06030 gene fabG 76141 75398 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770626.1 protein_id gnl|my_center|LOCUS_06030 77079 76144 gene locus_tag LOCUS_06040 77079 76144 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_06040 78060 77098 gene locus_tag LOCUS_06050 gene fabH 78060 77098 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_06050 79076 78057 gene locus_tag LOCUS_06060 gene plsX 79076 78057 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_06060 79268 79083 gene locus_tag LOCUS_06070 gene rpmF 79268 79083 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E407 protein_id gnl|my_center|LOCUS_06070 79844 79320 gene locus_tag LOCUS_06080 79844 79320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706102.1 protein_id gnl|my_center|LOCUS_06080 81449 79938 gene locus_tag LOCUS_06090 gene purF 81449 79938 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_06090 81962 81471 gene locus_tag LOCUS_06100 81962 81471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_06100 82725 82054 gene locus_tag LOCUS_06110 82725 82054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 85168 82742 gene locus_tag LOCUS_06120 gene lon 85168 82742 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG17 protein_id gnl|my_center|LOCUS_06120 86593 85322 gene locus_tag LOCUS_06130 gene clpX 86593 85322 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG18 protein_id gnl|my_center|LOCUS_06130 87274 86633 gene locus_tag LOCUS_06140 gene clpP 87274 86633 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR6 protein_id gnl|my_center|LOCUS_06140 88663 87362 gene locus_tag LOCUS_06150 gene tig 88663 87362 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS5 protein_id gnl|my_center|LOCUS_06150 88811 88727 gene locus_tag LOCUS_t00150 88811 88727 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 89862 88957 gene locus_tag LOCUS_06160 89862 88957 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_06160 90326 89859 gene locus_tag LOCUS_06170 90326 89859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 91300 90512 gene locus_tag LOCUS_06180 gene fieF 91300 90512 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 protein_id gnl|my_center|LOCUS_06180 91490 93124 gene locus_tag LOCUS_06190 91490 93124 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_06190 93151 93735 gene locus_tag LOCUS_06200 93151 93735 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG7 protein_id gnl|my_center|LOCUS_06200 93785 94771 gene locus_tag LOCUS_06210 93785 94771 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946057.1 protein_id gnl|my_center|LOCUS_06210 94768 95442 gene locus_tag LOCUS_06220 94768 95442 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_06220 96334 95432 gene locus_tag LOCUS_06230 gene argF 96334 95432 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_06230 97533 96337 gene locus_tag LOCUS_06240 gene argD 97533 96337 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_06240 98296 97715 gene locus_tag LOCUS_06250 98296 97715 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKP1 protein_id gnl|my_center|LOCUS_06250 98888 98376 gene locus_tag LOCUS_06260 98888 98376 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY57 protein_id gnl|my_center|LOCUS_06260 99423 98890 gene locus_tag LOCUS_06270 99423 98890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 100955 99423 gene locus_tag LOCUS_06280 gene leuA 100955 99423 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_06280 101936 101196 gene locus_tag LOCUS_06290 gene pssA 101936 101196 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_06290 103059 102043 gene locus_tag LOCUS_06300 gene ilvC 103059 102043 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 protein_id gnl|my_center|LOCUS_06300 103596 103102 gene locus_tag LOCUS_06310 gene ilvH 103596 103102 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_06310 105338 103596 gene locus_tag LOCUS_06320 gene ilvI 105338 103596 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_06320 105511 106566 gene locus_tag LOCUS_06330 gene pyrC 105511 106566 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J46 protein_id gnl|my_center|LOCUS_06330 107281 106571 gene locus_tag LOCUS_06340 gene purC 107281 106571 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_06340 108089 107319 gene locus_tag LOCUS_06350 108089 107319 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_06350 109024 108089 gene locus_tag LOCUS_06360 109024 108089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 110054 109176 gene locus_tag LOCUS_06370 gene dapA 110054 109176 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_06370 110175 110642 gene locus_tag LOCUS_06380 110175 110642 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_06380 110889 113726 gene locus_tag LOCUS_06390 gene nrdA 110889 113726 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL9 protein_id gnl|my_center|LOCUS_06390 113726 114937 gene locus_tag LOCUS_06400 gene nrdB 113726 114937 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MN89 protein_id gnl|my_center|LOCUS_06400 115252 115491 gene locus_tag LOCUS_06410 115252 115491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence05 1638 235 gene locus_tag LOCUS_06420 gene gltD 1638 235 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_06420 6135 1660 gene locus_tag LOCUS_06430 gene gltB 6135 1660 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_06430 6369 6860 gene locus_tag LOCUS_06440 gene purE 6369 6860 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8M2 protein_id gnl|my_center|LOCUS_06440 6875 8005 gene locus_tag LOCUS_06450 gene purK 6875 8005 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WU0 protein_id gnl|my_center|LOCUS_06450 8006 8458 gene locus_tag LOCUS_06460 8006 8458 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7A0 protein_id gnl|my_center|LOCUS_06460 10737 8455 gene locus_tag LOCUS_06470 gene topA 10737 8455 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA5 protein_id gnl|my_center|LOCUS_06470 11292 10810 gene locus_tag LOCUS_06480 gene smg 11292 10810 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F6 protein_id gnl|my_center|LOCUS_06480 12361 11315 gene locus_tag LOCUS_06490 12361 11315 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190020.1 protein_id gnl|my_center|LOCUS_06490 13453 12446 gene locus_tag LOCUS_06500 13453 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_06500 13697 14014 gene locus_tag LOCUS_06510 13697 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 14171 14674 gene locus_tag LOCUS_06520 gene def1 14171 14674 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B43 protein_id gnl|my_center|LOCUS_06520 14682 15611 gene locus_tag LOCUS_06530 gene fmt 14682 15611 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU4 protein_id gnl|my_center|LOCUS_06530 15604 16905 gene locus_tag LOCUS_06540 gene rsmB 15604 16905 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B41 protein_id gnl|my_center|LOCUS_06540 16871 17458 gene locus_tag LOCUS_06550 16871 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 17892 19622 gene locus_tag LOCUS_06560 17892 19622 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_06560 19619 20893 gene locus_tag LOCUS_06570 19619 20893 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_06570 20899 22272 gene locus_tag LOCUS_06580 gene trkA 20899 22272 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_06580 22284 22844 gene locus_tag LOCUS_06590 gene yqgE 22284 22844 CDS product UPF0301 protein YqgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3V2 protein_id gnl|my_center|LOCUS_06590 22841 23260 gene locus_tag LOCUS_06600 22841 23260 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY0 protein_id gnl|my_center|LOCUS_06600 23257 23784 gene locus_tag LOCUS_06610 gene pyrR 23257 23784 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6W6 protein_id gnl|my_center|LOCUS_06610 23777 24751 gene locus_tag LOCUS_06620 gene pyrB 23777 24751 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I89 protein_id gnl|my_center|LOCUS_06620 24748 26025 gene locus_tag LOCUS_06630 gene pyrC' 24748 26025 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_06630 26079 26543 gene locus_tag LOCUS_06640 26079 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_06640 26567 26737 gene locus_tag LOCUS_06650 26567 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 26745 27494 gene locus_tag LOCUS_06660 26745 27494 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_06660 28860 27505 gene locus_tag LOCUS_06670 gene manB 28860 27505 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 protein_id gnl|my_center|LOCUS_06670 30330 28912 gene locus_tag LOCUS_06680 gene xanB 30330 28912 CDS product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 protein_id gnl|my_center|LOCUS_06680 31825 30389 gene locus_tag LOCUS_06690 gene algD 31825 30389 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_06690 32194 33867 gene locus_tag LOCUS_06700 32194 33867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 33851 35437 gene locus_tag LOCUS_06710 33851 35437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 35456 37306 gene locus_tag LOCUS_06720 35456 37306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 37433 37942 gene locus_tag LOCUS_06730 37433 37942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 39328 37946 gene locus_tag LOCUS_06740 39328 37946 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_06740 40644 39340 gene locus_tag LOCUS_06750 40644 39340 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_06750 41681 40668 gene locus_tag LOCUS_06760 41681 40668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 42237 41674 gene locus_tag LOCUS_06770 42237 41674 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_06770 44404 42374 gene locus_tag LOCUS_06780 44404 42374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 44831 44475 gene locus_tag LOCUS_06790 44831 44475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 45111 45035 gene locus_tag LOCUS_t00160 45111 45035 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 45445 45939 gene locus_tag LOCUS_06800 45445 45939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 46488 46093 gene locus_tag LOCUS_06810 46488 46093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 47083 46577 gene locus_tag LOCUS_06820 gene ftn 47083 46577 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK9 protein_id gnl|my_center|LOCUS_06820 47889 47497 gene locus_tag LOCUS_06830 47889 47497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 48393 49259 gene locus_tag LOCUS_06840 gene cpdA 48393 49259 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123166.1 protein_id gnl|my_center|LOCUS_06840 49256 50014 gene locus_tag LOCUS_06850 49256 50014 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123163.1 protein_id gnl|my_center|LOCUS_06850 50263 51000 gene locus_tag LOCUS_06860 50263 51000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 51300 51620 gene locus_tag LOCUS_06870 51300 51620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 52634 52002 gene locus_tag LOCUS_06880 52634 52002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 53188 52718 gene locus_tag LOCUS_06890 53188 52718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 55095 53320 gene locus_tag LOCUS_06900 gene ycaO 55095 53320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005051051.1 protein_id gnl|my_center|LOCUS_06900 55161 55736 gene locus_tag LOCUS_06910 55161 55736 CDS product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_06910 56703 55774 gene locus_tag LOCUS_06920 gene ars 56703 55774 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_06920 56876 58171 gene locus_tag LOCUS_06930 gene rhlE 56876 58171 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 protein_id gnl|my_center|LOCUS_06930 58309 58842 gene locus_tag LOCUS_06940 58309 58842 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_06940 58866 59522 gene locus_tag LOCUS_06950 58866 59522 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_06950 59569 60675 gene locus_tag LOCUS_06960 59569 60675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_06960 63213 60697 gene locus_tag LOCUS_06970 63213 60697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_06970 63557 63321 gene locus_tag LOCUS_06980 63557 63321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 64622 63609 gene locus_tag LOCUS_06990 gene fbp 64622 63609 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P237 protein_id gnl|my_center|LOCUS_06990 65354 64827 gene locus_tag LOCUS_07000 65354 64827 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123279.1 protein_id gnl|my_center|LOCUS_07000 65774 65358 gene locus_tag LOCUS_07010 65774 65358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 66419 65946 gene locus_tag LOCUS_07020 66419 65946 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 protein_id gnl|my_center|LOCUS_07020 67296 66481 gene locus_tag LOCUS_07030 67296 66481 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_07030 68189 67293 gene locus_tag LOCUS_07040 gene ffsA 68189 67293 CDS product formylmethanofuran--tetrahydromethanopterin formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE70 protein_id gnl|my_center|LOCUS_07040 69853 68186 gene locus_tag LOCUS_07050 gene fwdA 69853 68186 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122492.1 protein_id gnl|my_center|LOCUS_07050 71142 69868 gene locus_tag LOCUS_07060 71142 69868 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_07060 71787 71284 gene locus_tag LOCUS_07070 71787 71284 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_07070 73605 71845 gene locus_tag LOCUS_07080 gene argS 73605 71845 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 protein_id gnl|my_center|LOCUS_07080 73751 75040 gene locus_tag LOCUS_07090 73751 75040 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_07090 77235 75046 gene locus_tag LOCUS_07100 gene priA 77235 75046 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CL19 protein_id gnl|my_center|LOCUS_07100 79116 77467 gene locus_tag LOCUS_07110 79116 77467 CDS product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_07110 79220 79705 gene locus_tag LOCUS_07120 gene dfrA 79220 79705 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC6 protein_id gnl|my_center|LOCUS_07120 79957 79724 gene locus_tag LOCUS_07130 79957 79724 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768492.1 protein_id gnl|my_center|LOCUS_07130 80164 80412 gene locus_tag LOCUS_07140 80164 80412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 80430 80774 gene locus_tag LOCUS_07150 80430 80774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_07150 81525 80779 gene locus_tag LOCUS_07160 gene tatC 81525 80779 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V0 protein_id gnl|my_center|LOCUS_07160 81817 81512 gene locus_tag LOCUS_07170 81817 81512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 82142 81903 gene locus_tag LOCUS_07180 82142 81903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 82490 82152 gene locus_tag LOCUS_07190 gene hitA 82490 82152 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_07190 82807 82487 gene locus_tag LOCUS_07200 gene hisE 82807 82487 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UY8 protein_id gnl|my_center|LOCUS_07200 83184 82804 gene locus_tag LOCUS_07210 gene hisI 83184 82804 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_07210 83959 83186 gene locus_tag LOCUS_07220 gene hisF 83959 83186 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_07220 84726 83974 gene locus_tag LOCUS_07230 gene hisA 84726 83974 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_07230 85391 84750 gene locus_tag LOCUS_07240 gene hisH 85391 84750 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_07240 86040 85447 gene locus_tag LOCUS_07250 gene hisB 86040 85447 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_07250 86140 86889 gene locus_tag LOCUS_07260 gene anr 86140 86889 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_07260 87015 87701 gene locus_tag LOCUS_07270 87015 87701 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064801.1 protein_id gnl|my_center|LOCUS_07270 88567 87875 gene locus_tag LOCUS_07280 88567 87875 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_07280 89762 88569 gene locus_tag LOCUS_07290 89762 88569 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_07290 90368 89874 gene locus_tag LOCUS_07300 90368 89874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 91697 90411 gene locus_tag LOCUS_07310 91697 90411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 93773 91740 gene locus_tag LOCUS_07320 93773 91740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 95228 93822 gene locus_tag LOCUS_07330 95228 93822 CDS product selenium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_07330 96462 95515 gene locus_tag LOCUS_07340 96462 95515 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 protein_id gnl|my_center|LOCUS_07340 97205 96669 gene locus_tag LOCUS_07350 97205 96669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_07350 99167 97410 gene locus_tag LOCUS_07360 gene soxB 99167 97410 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932700.1 protein_id gnl|my_center|LOCUS_07360 99924 99274 gene locus_tag LOCUS_07370 99924 99274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 100317 99973 gene locus_tag LOCUS_07380 100317 99973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 101158 100322 gene locus_tag LOCUS_07390 gene soxA 101158 100322 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDM7 protein_id gnl|my_center|LOCUS_07390 101481 101179 gene locus_tag LOCUS_07400 gene soxZ 101481 101179 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_07400 101963 101505 gene locus_tag LOCUS_07410 gene soxY 101963 101505 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_07410 102349 102005 gene locus_tag LOCUS_07420 102349 102005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 103321 102383 gene locus_tag LOCUS_07430 103321 102383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 104627 103305 gene locus_tag LOCUS_07440 gene soxC 104627 103305 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_07440 106489 105227 gene locus_tag LOCUS_07450 106489 105227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 107200 106712 gene locus_tag LOCUS_07460 107200 106712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 108657 107329 gene locus_tag LOCUS_07470 108657 107329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 109196 108993 gene locus_tag LOCUS_07480 109196 108993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 110331 109249 gene locus_tag LOCUS_07490 110331 109249 CDS product methane monooxygenase component C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728054.1 protein_id gnl|my_center|LOCUS_07490 111053 110373 gene locus_tag LOCUS_07500 111053 110373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 111279 111100 gene locus_tag LOCUS_07510 111279 111100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence06 116 40 gene locus_tag LOCUS_t00170 116 40 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2767 263 gene locus_tag LOCUS_07520 gene glgP 2767 263 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_07520 3546 2935 gene locus_tag LOCUS_07530 gene engB 3546 2935 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32A36 protein_id gnl|my_center|LOCUS_07530 3795 4412 gene locus_tag LOCUS_07540 gene cc4 3795 4412 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_07540 4511 6508 gene locus_tag LOCUS_07550 4511 6508 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806942.1 protein_id gnl|my_center|LOCUS_07550 6559 7716 gene locus_tag LOCUS_07560 6559 7716 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554622.1 protein_id gnl|my_center|LOCUS_07560 7754 8383 gene locus_tag LOCUS_07570 gene dsbA 7754 8383 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_07570 10086 8389 gene locus_tag LOCUS_07580 10086 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11504 10107 gene locus_tag LOCUS_07590 gene mltF 11504 10107 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_07590 12094 11645 gene locus_tag LOCUS_07600 gene tadA 12094 11645 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 protein_id gnl|my_center|LOCUS_07600 13362 12097 gene locus_tag LOCUS_07610 gene kdtA 13362 12097 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105256.1 protein_id gnl|my_center|LOCUS_07610 13571 14362 gene locus_tag LOCUS_07620 gene lpxL 13571 14362 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW10 protein_id gnl|my_center|LOCUS_07620 14857 14465 gene locus_tag LOCUS_07630 gene rpsI 14857 14465 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32BA9 protein_id gnl|my_center|LOCUS_07630 15305 14871 gene locus_tag LOCUS_07640 gene rplM 15305 14871 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQB9 protein_id gnl|my_center|LOCUS_07640 16191 15391 gene locus_tag LOCUS_07650 gene uppP 16191 15391 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_07650 16392 20162 gene locus_tag LOCUS_07660 16392 20162 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244102.1 protein_id gnl|my_center|LOCUS_07660 20581 20237 gene locus_tag LOCUS_07670 20581 20237 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_07670 21259 20594 gene locus_tag LOCUS_07680 21259 20594 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_07680 21642 21256 gene locus_tag LOCUS_07690 21642 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 22223 21657 gene locus_tag LOCUS_07700 22223 21657 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_07700 22366 23199 gene locus_tag LOCUS_07710 22366 23199 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769324.1 protein_id gnl|my_center|LOCUS_07710 23202 24122 gene locus_tag LOCUS_07720 23202 24122 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I94 protein_id gnl|my_center|LOCUS_07720 24223 24411 gene locus_tag LOCUS_07730 24223 24411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 24408 24698 gene locus_tag LOCUS_07740 24408 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 24716 24949 gene locus_tag LOCUS_07750 24716 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 25103 26395 gene locus_tag LOCUS_07760 25103 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_07760 26479 26958 gene locus_tag LOCUS_07770 26479 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 26973 27692 gene locus_tag LOCUS_07780 26973 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 27720 28673 gene locus_tag LOCUS_07790 27720 28673 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_07790 28680 30149 gene locus_tag LOCUS_07800 28680 30149 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL50 protein_id gnl|my_center|LOCUS_07800 30301 31794 gene locus_tag LOCUS_07810 gene yjgR 30301 31794 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_07810 32612 31884 gene locus_tag LOCUS_07820 32612 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 33247 32753 gene locus_tag LOCUS_07830 33247 32753 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_07830 33689 33270 gene locus_tag LOCUS_07840 33689 33270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 34176 33769 gene locus_tag LOCUS_07850 34176 33769 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_07850 34757 34353 gene locus_tag LOCUS_07860 34757 34353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 35295 34903 gene locus_tag LOCUS_07870 35295 34903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_07870 35719 35288 gene locus_tag LOCUS_07880 35719 35288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 36017 35742 gene locus_tag LOCUS_07890 gene acyP 36017 35742 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62A02 protein_id gnl|my_center|LOCUS_07890 37924 36347 gene locus_tag LOCUS_07900 gene guaA 37924 36347 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN87 protein_id gnl|my_center|LOCUS_07900 39459 37996 gene locus_tag LOCUS_07910 gene guaB 39459 37996 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_07910 39657 41165 gene locus_tag LOCUS_07920 gene xseA 39657 41165 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32D53 protein_id gnl|my_center|LOCUS_07920 41158 42021 gene locus_tag LOCUS_07930 41158 42021 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_07930 42772 42047 gene locus_tag LOCUS_07940 42772 42047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_07940 43653 42802 gene locus_tag LOCUS_07950 43653 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 44218 43634 gene locus_tag LOCUS_07960 44218 43634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 44723 44202 gene locus_tag LOCUS_07970 44723 44202 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 protein_id gnl|my_center|LOCUS_07970 45710 44733 gene locus_tag LOCUS_07980 gene kdsD 45710 44733 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_07980 46693 45707 gene locus_tag LOCUS_07990 gene yrbG 46693 45707 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_07990 47513 46788 gene locus_tag LOCUS_08000 47513 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 47761 49800 gene locus_tag LOCUS_08010 gene prlC 47761 49800 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_08010 49816 51285 gene locus_tag LOCUS_08020 gene ubiD 49816 51285 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 protein_id gnl|my_center|LOCUS_08020 51666 52049 gene locus_tag LOCUS_08030 gene gloA 51666 52049 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T3 protein_id gnl|my_center|LOCUS_08030 52659 52054 gene locus_tag LOCUS_08040 gene yjdF 52659 52054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_08040 53130 52693 gene locus_tag LOCUS_08050 gene moaE 53130 52693 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_08050 53362 53135 gene locus_tag LOCUS_08060 gene moaD 53362 53135 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A9 protein_id gnl|my_center|LOCUS_08060 53546 54025 gene locus_tag LOCUS_08070 gene moaC 53546 54025 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_08070 55119 54031 gene locus_tag LOCUS_08080 55119 54031 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 protein_id gnl|my_center|LOCUS_08080 55241 56584 gene locus_tag LOCUS_08090 gene oprP 55241 56584 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119574.1 protein_id gnl|my_center|LOCUS_08090 56572 57408 gene locus_tag LOCUS_08100 gene tupA 56572 57408 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_08100 57946 57518 gene locus_tag LOCUS_08110 57946 57518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 59075 58014 gene locus_tag LOCUS_08120 59075 58014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_08120 59418 60047 gene locus_tag LOCUS_08130 59418 60047 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYP6 protein_id gnl|my_center|LOCUS_08130 60128 60436 gene locus_tag LOCUS_08140 gene flgM 60128 60436 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_08140 60451 60933 gene locus_tag LOCUS_08150 60451 60933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 62038 60956 gene locus_tag LOCUS_08160 gene hemH 62038 60956 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXU9 protein_id gnl|my_center|LOCUS_08160 62105 64303 gene locus_tag LOCUS_08170 62105 64303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 64697 64846 gene locus_tag LOCUS_08180 64697 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 65495 65100 gene locus_tag LOCUS_08190 65495 65100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 66942 65899 gene locus_tag LOCUS_08200 66942 65899 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_08200 67077 67153 gene locus_tag LOCUS_t00180 67077 67153 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67647 67183 gene locus_tag LOCUS_08210 67647 67183 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_08210 67883 67647 gene locus_tag LOCUS_08220 67883 67647 CDS product response regulator SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920728.1 protein_id gnl|my_center|LOCUS_08220 68040 69437 gene locus_tag LOCUS_08230 68040 69437 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_08230 69437 69925 gene locus_tag LOCUS_08240 69437 69925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 69925 70242 gene locus_tag LOCUS_08250 69925 70242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 70704 70246 gene locus_tag LOCUS_08260 70704 70246 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_08260 70802 71452 gene locus_tag LOCUS_08270 70802 71452 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185654.1 protein_id gnl|my_center|LOCUS_08270 71469 71792 gene locus_tag LOCUS_08280 71469 71792 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_08280 71802 73118 gene locus_tag LOCUS_08290 gene tolC 71802 73118 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_08290 73130 73678 gene locus_tag LOCUS_08300 73130 73678 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_08300 75201 73675 gene locus_tag LOCUS_08310 75201 73675 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_08310 75306 75788 gene locus_tag LOCUS_08320 gene bsaA 75306 75788 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT3 protein_id gnl|my_center|LOCUS_08320 75907 76965 gene locus_tag LOCUS_08330 gene sbnB 75907 76965 CDS product N-[(2S)-2-amino-2-carboxyethyl]-L-glutamate dehydrogenase SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078461.1 protein_id gnl|my_center|LOCUS_08330 77275 78669 gene locus_tag LOCUS_08340 77275 78669 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 protein_id gnl|my_center|LOCUS_08340 78666 79781 gene locus_tag LOCUS_08350 gene soxB 78666 79781 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 protein_id gnl|my_center|LOCUS_08350 81335 79905 gene locus_tag LOCUS_08360 81335 79905 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705774.1 protein_id gnl|my_center|LOCUS_08360 82623 81343 gene locus_tag LOCUS_08370 gene hemL 82623 81343 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_08370 82918 83640 gene locus_tag LOCUS_08380 82918 83640 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_08380 83637 84995 gene locus_tag LOCUS_08390 83637 84995 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_08390 84979 85503 gene locus_tag LOCUS_08400 gene exbB 84979 85503 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_08400 85546 85953 gene locus_tag LOCUS_08410 85546 85953 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_08410 85962 86585 gene locus_tag LOCUS_08420 85962 86585 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TA7 protein_id gnl|my_center|LOCUS_08420 86590 87843 gene locus_tag LOCUS_08430 86590 87843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_08430 87854 88411 gene locus_tag LOCUS_08440 87854 88411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 88471 90582 gene locus_tag LOCUS_08450 88471 90582 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_08450 90579 91739 gene locus_tag LOCUS_08460 90579 91739 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_08460 91921 92118 gene locus_tag LOCUS_08470 91921 92118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 92485 94377 gene locus_tag LOCUS_08480 gene parE 92485 94377 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2I6 protein_id gnl|my_center|LOCUS_08480 94403 96643 gene locus_tag LOCUS_08490 gene parC 94403 96643 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPK2 protein_id gnl|my_center|LOCUS_08490 96668 97423 gene locus_tag LOCUS_08500 96668 97423 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087856.1 protein_id gnl|my_center|LOCUS_08500 97611 97982 gene locus_tag LOCUS_08510 97611 97982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 98205 98603 gene locus_tag LOCUS_08520 98205 98603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 98785 100473 gene locus_tag LOCUS_08530 gene glnS 98785 100473 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLU5 protein_id gnl|my_center|LOCUS_08530 >Feature sequence07 53 340 gene locus_tag LOCUS_08540 gene ftsB 53 340 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_08540 330 1037 gene locus_tag LOCUS_08550 gene ispD 330 1037 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ2 protein_id gnl|my_center|LOCUS_08550 1037 1513 gene locus_tag LOCUS_08560 gene ispF 1037 1513 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_08560 1515 2576 gene locus_tag LOCUS_08570 gene truD 1515 2576 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Y9 protein_id gnl|my_center|LOCUS_08570 2598 3995 gene locus_tag LOCUS_08580 gene cysG 2598 3995 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 protein_id gnl|my_center|LOCUS_08580 4838 3996 gene locus_tag LOCUS_08590 4838 3996 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_08590 4995 5480 gene locus_tag LOCUS_08600 gene ampD 4995 5480 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 6121 6711 gene locus_tag LOCUS_08610 6121 6711 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_08610 6782 8221 gene locus_tag LOCUS_08620 gene ccoN2 6782 8221 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_08620 8218 8856 gene locus_tag LOCUS_08630 gene ccoO2 8218 8856 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_08630 8856 8999 gene locus_tag LOCUS_08640 8856 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 8992 9873 gene locus_tag LOCUS_08650 8992 9873 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P319 protein_id gnl|my_center|LOCUS_08650 10760 10017 gene locus_tag LOCUS_08660 10760 10017 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478741.1 protein_id gnl|my_center|LOCUS_08660 11068 11955 gene locus_tag LOCUS_08670 gene htpX 11068 11955 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 protein_id gnl|my_center|LOCUS_08670 12101 13675 gene locus_tag LOCUS_08680 12101 13675 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_08680 13949 16486 gene locus_tag LOCUS_08690 gene nirB 13949 16486 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 protein_id gnl|my_center|LOCUS_08690 16483 16827 gene locus_tag LOCUS_08700 16483 16827 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 protein_id gnl|my_center|LOCUS_08700 16824 17738 gene locus_tag LOCUS_08710 16824 17738 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312586.1 protein_id gnl|my_center|LOCUS_08710 17803 18996 gene locus_tag LOCUS_08720 17803 18996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 18996 21671 gene locus_tag LOCUS_08730 18996 21671 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_08730 21914 23155 gene locus_tag LOCUS_08740 21914 23155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_08740 23445 24029 gene locus_tag LOCUS_08750 23445 24029 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_08750 24351 25733 gene locus_tag LOCUS_08760 24351 25733 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_08760 25816 26838 gene locus_tag LOCUS_08770 25816 26838 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_08770 26848 27639 gene locus_tag LOCUS_08780 26848 27639 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_08780 27858 29324 gene locus_tag LOCUS_08790 gene crnA 27858 29324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_08790 29374 31101 gene locus_tag LOCUS_08800 29374 31101 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_08800 31830 31150 gene locus_tag LOCUS_08810 gene mip 31830 31150 CDS product peptidyl-prolyl cis-trans isomerase Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51752 protein_id gnl|my_center|LOCUS_08810 32039 32533 gene locus_tag LOCUS_08820 32039 32533 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_08820 32526 33974 gene locus_tag LOCUS_08830 gene ycf24 32526 33974 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_08830 34041 34802 gene locus_tag LOCUS_08840 34041 34802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_08840 34799 36103 gene locus_tag LOCUS_08850 34799 36103 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_08850 36106 37329 gene locus_tag LOCUS_08860 36106 37329 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_08860 37329 37781 gene locus_tag LOCUS_08870 37329 37781 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_08870 37791 38123 gene locus_tag LOCUS_08880 37791 38123 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946343.1 protein_id gnl|my_center|LOCUS_08880 38158 40494 gene locus_tag LOCUS_08890 38158 40494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_08890 40494 42191 gene locus_tag LOCUS_08900 gene maeA 40494 42191 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHR8 protein_id gnl|my_center|LOCUS_08900 42215 42598 gene locus_tag LOCUS_08910 42215 42598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 42626 42862 gene locus_tag LOCUS_08920 42626 42862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 43565 42999 gene locus_tag LOCUS_08930 43565 42999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 43730 44437 gene locus_tag LOCUS_08940 43730 44437 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408486.1 protein_id gnl|my_center|LOCUS_08940 44466 44831 gene locus_tag LOCUS_08950 44466 44831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 46557 44929 gene locus_tag LOCUS_08960 46557 44929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 46730 46996 gene locus_tag LOCUS_08970 46730 46996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_08970 47041 47316 gene locus_tag LOCUS_08980 47041 47316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 47369 47746 gene locus_tag LOCUS_08990 47369 47746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 47902 48201 gene locus_tag LOCUS_09000 47902 48201 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N13 protein_id gnl|my_center|LOCUS_09000 48372 48809 gene locus_tag LOCUS_09010 gene hspC 48372 48809 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_09010 51609 48856 gene locus_tag LOCUS_09020 gene valS 51609 48856 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_09020 52153 51728 gene locus_tag LOCUS_09030 gene holC 52153 51728 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_09030 53659 52169 gene locus_tag LOCUS_09040 gene pepA 53659 52169 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_09040 53813 54949 gene locus_tag LOCUS_09050 53813 54949 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_09050 54946 56010 gene locus_tag LOCUS_09060 54946 56010 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948329.1 protein_id gnl|my_center|LOCUS_09060 56108 56509 gene locus_tag LOCUS_09070 56108 56509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 56656 56832 gene locus_tag LOCUS_09080 56656 56832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 56991 56916 gene locus_tag LOCUS_t00190 56991 56916 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 57086 57011 gene locus_tag LOCUS_t00200 57086 57011 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 57369 59603 gene locus_tag LOCUS_09090 gene lptD 57369 59603 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_09090 59697 60962 gene locus_tag LOCUS_09100 gene surA 59697 60962 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_09100 60959 61954 gene locus_tag LOCUS_09110 gene pdxA 60959 61954 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19624 protein_id gnl|my_center|LOCUS_09110 61958 62755 gene locus_tag LOCUS_09120 gene rsmA 61958 62755 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_09120 62968 63240 gene locus_tag LOCUS_09130 gene hupB 62968 63240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_09130 63257 63332 gene locus_tag LOCUS_t00210 63257 63332 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63342 63418 gene locus_tag LOCUS_t00220 63342 63418 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 63502 65388 gene locus_tag LOCUS_09140 gene ppiD 63502 65388 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_09140 66245 65457 gene locus_tag LOCUS_09150 66245 65457 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_09150 66369 68519 gene locus_tag LOCUS_09160 gene hbpA 66369 68519 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_09160 68611 69396 gene locus_tag LOCUS_09170 68611 69396 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362406.1 protein_id gnl|my_center|LOCUS_09170 69409 70308 gene locus_tag LOCUS_09180 gene motB 69409 70308 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_09180 70462 71118 gene locus_tag LOCUS_09190 gene leuD 70462 71118 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_09190 71146 72216 gene locus_tag LOCUS_09200 gene leuB 71146 72216 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_09200 72241 73263 gene locus_tag LOCUS_09210 gene asd 72241 73263 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT63 protein_id gnl|my_center|LOCUS_09210 73301 75877 gene locus_tag LOCUS_09220 gene fimV 73301 75877 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_09220 75881 76660 gene locus_tag LOCUS_09230 gene truA 75881 76660 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW2 protein_id gnl|my_center|LOCUS_09230 76696 77316 gene locus_tag LOCUS_09240 gene trpF 76696 77316 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW1 protein_id gnl|my_center|LOCUS_09240 77309 78529 gene locus_tag LOCUS_09250 gene trpB 77309 78529 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_09250 78540 79361 gene locus_tag LOCUS_09260 gene trpA 78540 79361 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_09260 79385 80239 gene locus_tag LOCUS_09270 gene accD 79385 80239 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_09270 80258 81538 gene locus_tag LOCUS_09280 gene folC 80258 81538 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225490.1 protein_id gnl|my_center|LOCUS_09280 83339 81546 gene locus_tag LOCUS_09290 83339 81546 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084106.1 protein_id gnl|my_center|LOCUS_09290 84647 83346 gene locus_tag LOCUS_09300 84647 83346 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_09300 85403 84720 gene locus_tag LOCUS_09310 gene trmB 85403 84720 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJK1 protein_id gnl|my_center|LOCUS_09310 85496 86581 gene locus_tag LOCUS_09320 85496 86581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 86758 88590 gene locus_tag LOCUS_09330 gene edd 86758 88590 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_09330 88615 89247 gene locus_tag LOCUS_09340 gene eda 88615 89247 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704295.1 protein_id gnl|my_center|LOCUS_09340 90044 89298 gene locus_tag LOCUS_09350 90044 89298 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_09350 90897 90046 gene locus_tag LOCUS_09360 90897 90046 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_09360 91410 91069 gene locus_tag LOCUS_09370 91410 91069 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947495.1 protein_id gnl|my_center|LOCUS_09370 91603 92586 gene locus_tag LOCUS_09380 gene oppB 91603 92586 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_09380 92596 93402 gene locus_tag LOCUS_09390 92596 93402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036168.1 protein_id gnl|my_center|LOCUS_09390 93752 93417 gene locus_tag LOCUS_09400 gene yfjF 93752 93417 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3A1 protein_id gnl|my_center|LOCUS_09400 94179 93739 gene locus_tag LOCUS_09410 94179 93739 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_09410 95574 94210 gene locus_tag LOCUS_09420 95574 94210 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_09420 95708 96235 gene locus_tag LOCUS_09430 gene smpB 95708 96235 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_09430 >Feature sequence08 2321 459 gene locus_tag LOCUS_09440 2321 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3677 2511 gene locus_tag LOCUS_09450 3677 2511 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_09450 4120 3947 gene locus_tag LOCUS_09460 4120 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4326 4138 gene locus_tag LOCUS_09470 4326 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4895 4819 gene locus_tag LOCUS_t00230 4895 4819 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5038 5895 gene locus_tag LOCUS_09480 gene folD 5038 5895 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG21 protein_id gnl|my_center|LOCUS_09480 7284 5902 gene locus_tag LOCUS_09490 gene cysS 7284 5902 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXE6 protein_id gnl|my_center|LOCUS_09490 7601 8101 gene locus_tag LOCUS_09500 gene ppiB 7601 8101 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_09500 8164 8907 gene locus_tag LOCUS_09510 gene lpxH 8164 8907 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQZ7 protein_id gnl|my_center|LOCUS_09510 9615 8893 gene locus_tag LOCUS_09520 gene dsbC 9615 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_09520 10108 9623 gene locus_tag LOCUS_09530 10108 9623 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_09530 11036 10152 gene locus_tag LOCUS_09540 gene xerD 11036 10152 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_09540 11523 11041 gene locus_tag LOCUS_09550 gene ogt 11523 11041 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_09550 11987 11640 gene locus_tag LOCUS_09560 gene rplS 11987 11640 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF7 protein_id gnl|my_center|LOCUS_09560 12755 12006 gene locus_tag LOCUS_09570 gene trmD 12755 12006 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG25 protein_id gnl|my_center|LOCUS_09570 13286 12768 gene locus_tag LOCUS_09580 gene rimM 13286 12768 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH71 protein_id gnl|my_center|LOCUS_09580 13557 13309 gene locus_tag LOCUS_09590 gene rpsP 13557 13309 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_09590 15012 13645 gene locus_tag LOCUS_09600 gene ffh 15012 13645 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG22 protein_id gnl|my_center|LOCUS_09600 15158 15958 gene locus_tag LOCUS_09610 15158 15958 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_09610 16071 17255 gene locus_tag LOCUS_09620 16071 17255 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_09620 17255 19246 gene locus_tag LOCUS_09630 17255 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 19308 21554 gene locus_tag LOCUS_09640 19308 21554 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732543.1 protein_id gnl|my_center|LOCUS_09640 21695 22627 gene locus_tag LOCUS_09650 gene mutY 21695 22627 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228057.1 protein_id gnl|my_center|LOCUS_09650 22634 22900 gene locus_tag LOCUS_09660 22634 22900 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SJ4 protein_id gnl|my_center|LOCUS_09660 22890 23150 gene locus_tag LOCUS_09670 22890 23150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 23239 24027 gene locus_tag LOCUS_09680 23239 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_09680 24201 24034 gene locus_tag LOCUS_09690 24201 24034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 24627 24319 gene locus_tag LOCUS_09700 24627 24319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 26106 24754 gene locus_tag LOCUS_09710 26106 24754 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_09710 26912 26139 gene locus_tag LOCUS_09720 26912 26139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 28801 26912 gene locus_tag LOCUS_09730 gene uup 28801 26912 CDS product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_09730 30726 28837 gene locus_tag LOCUS_09740 30726 28837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 protein_id gnl|my_center|LOCUS_09740 31728 31051 gene locus_tag LOCUS_09750 gene ung 31728 31051 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_09750 31939 32499 gene locus_tag LOCUS_09760 31939 32499 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_09760 32632 33957 gene locus_tag LOCUS_09770 32632 33957 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943292.1 protein_id gnl|my_center|LOCUS_09770 34059 34574 gene locus_tag LOCUS_09780 34059 34574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187158.1 protein_id gnl|my_center|LOCUS_09780 35519 34602 gene locus_tag LOCUS_09790 35519 34602 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479770.1 protein_id gnl|my_center|LOCUS_09790 36199 35516 gene locus_tag LOCUS_09800 gene ybgJ 36199 35516 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261967.1 protein_id gnl|my_center|LOCUS_09800 36882 36199 gene locus_tag LOCUS_09810 36882 36199 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLG8 protein_id gnl|my_center|LOCUS_09810 38157 36940 gene locus_tag LOCUS_09820 38157 36940 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_09820 39123 38173 gene locus_tag LOCUS_09830 39123 38173 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_09830 39332 39724 gene locus_tag LOCUS_09840 gene msrB 39332 39724 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS5 protein_id gnl|my_center|LOCUS_09840 39727 39987 gene locus_tag LOCUS_09850 39727 39987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 40061 41656 gene locus_tag LOCUS_09860 gene ybiT 40061 41656 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961457.1 protein_id gnl|my_center|LOCUS_09860 41832 42401 gene locus_tag LOCUS_09870 41832 42401 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_09870 42404 42742 gene locus_tag LOCUS_09880 42404 42742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 42953 42747 gene locus_tag LOCUS_09890 42953 42747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_09890 43799 42957 gene locus_tag LOCUS_09900 43799 42957 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705812.1 protein_id gnl|my_center|LOCUS_09900 43992 45815 gene locus_tag LOCUS_09910 gene deaD-1 43992 45815 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_09910 46092 45871 gene locus_tag LOCUS_09920 46092 45871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 47367 46285 gene locus_tag LOCUS_09930 47367 46285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 48642 47545 gene locus_tag LOCUS_09940 48642 47545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 49003 48644 gene locus_tag LOCUS_09950 49003 48644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 49719 49000 gene locus_tag LOCUS_09960 49719 49000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 50689 49742 gene locus_tag LOCUS_09970 50689 49742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 50915 51343 gene locus_tag LOCUS_09980 gene nsrR 50915 51343 CDS product HTH-type transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z183 protein_id gnl|my_center|LOCUS_09980 51738 51352 gene locus_tag LOCUS_09990 51738 51352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 51950 53179 gene locus_tag LOCUS_10000 51950 53179 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_10000 53185 53721 gene locus_tag LOCUS_10010 gene def2 53185 53721 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHZ2 protein_id gnl|my_center|LOCUS_10010 54793 53738 gene locus_tag LOCUS_10020 54793 53738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705084.1 protein_id gnl|my_center|LOCUS_10020 56041 54815 gene locus_tag LOCUS_10030 gene argJ 56041 54815 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_10030 58755 56041 gene locus_tag LOCUS_10040 gene secA 58755 56041 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q5 protein_id gnl|my_center|LOCUS_10040 59787 58888 gene locus_tag LOCUS_10050 59787 58888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_10050 59823 60251 gene locus_tag LOCUS_10060 59823 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 61171 60254 gene locus_tag LOCUS_10070 gene lpxC 61171 60254 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_10070 62409 61252 gene locus_tag LOCUS_10080 gene ftsZ 62409 61252 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSB0 protein_id gnl|my_center|LOCUS_10080 63708 62455 gene locus_tag LOCUS_10090 gene ftsA 63708 62455 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_10090 64484 63705 gene locus_tag LOCUS_10100 gene ftsQ 64484 63705 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA7 protein_id gnl|my_center|LOCUS_10100 65406 64477 gene locus_tag LOCUS_10110 gene ddlB 65406 64477 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_10110 66296 65406 gene locus_tag LOCUS_10120 gene murB 66296 65406 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_10120 67714 66296 gene locus_tag LOCUS_10130 gene murC 67714 66296 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_10130 68771 67707 gene locus_tag LOCUS_10140 gene murG 68771 67707 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_10140 69916 68771 gene locus_tag LOCUS_10150 gene ftsW 69916 68771 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCY0 protein_id gnl|my_center|LOCUS_10150 71265 69913 gene locus_tag LOCUS_10160 gene murD 71265 69913 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_10160 72349 71267 gene locus_tag LOCUS_10170 gene mraY 72349 71267 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_10170 73704 72349 gene locus_tag LOCUS_10180 gene murF 73704 72349 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_10180 75248 73701 gene locus_tag LOCUS_10190 gene murE 75248 73701 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK4 protein_id gnl|my_center|LOCUS_10190 <76774 75248 gene locus_tag LOCUS_10200 <76774 75248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094139.1:penicillin-binding protein 3 >Feature sequence09 1372 224 gene locus_tag LOCUS_10210 1372 224 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_10210 2466 1369 gene locus_tag LOCUS_10220 gene aroC 2466 1369 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I344 protein_id gnl|my_center|LOCUS_10220 3867 2509 gene locus_tag LOCUS_10230 gene mgtE 3867 2509 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_10230 5703 3964 gene locus_tag LOCUS_10240 5703 3964 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XV0 protein_id gnl|my_center|LOCUS_10240 5969 5700 gene locus_tag LOCUS_10250 5969 5700 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_10250 6370 5966 gene locus_tag LOCUS_10260 6370 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_10260 6939 6424 gene locus_tag LOCUS_10270 6939 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 7411 6947 gene locus_tag LOCUS_10280 gene ptsN 7411 6947 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_10280 7751 7425 gene locus_tag LOCUS_10290 gene yfiA-2 7751 7425 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_10290 9248 7785 gene locus_tag LOCUS_10300 gene rpoN 9248 7785 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ11 protein_id gnl|my_center|LOCUS_10300 10332 9343 gene locus_tag LOCUS_10310 10332 9343 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_10310 11021 10329 gene locus_tag LOCUS_10320 gene tupB 11021 10329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_10320 11888 11037 gene locus_tag LOCUS_10330 gene metF 11888 11037 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGJ7 protein_id gnl|my_center|LOCUS_10330 13241 11931 gene locus_tag LOCUS_10340 gene ahcY 13241 11931 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_10340 14422 13265 gene locus_tag LOCUS_10350 gene metK 14422 13265 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 protein_id gnl|my_center|LOCUS_10350 15344 14646 gene locus_tag LOCUS_10360 15344 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_10360 15425 16432 gene locus_tag LOCUS_10370 gene dusA 15425 16432 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_10370 17179 16400 gene locus_tag LOCUS_10380 17179 16400 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_10380 18048 17176 gene locus_tag LOCUS_10390 18048 17176 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150638.1 protein_id gnl|my_center|LOCUS_10390 18192 18848 gene locus_tag LOCUS_10400 gene mutH 18192 18848 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPE3 protein_id gnl|my_center|LOCUS_10400 18904 20214 gene locus_tag LOCUS_10410 18904 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 21637 20234 gene locus_tag LOCUS_10420 gene leuC 21637 20234 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_10420 22322 21789 gene locus_tag LOCUS_10430 22322 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10430 22969 22334 gene locus_tag LOCUS_10440 gene hxlA 22969 22334 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422861.1 protein_id gnl|my_center|LOCUS_10440 24121 23138 gene locus_tag LOCUS_10450 gene tal 24121 23138 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK81 protein_id gnl|my_center|LOCUS_10450 24801 24238 gene locus_tag LOCUS_10460 24801 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 25687 25046 gene locus_tag LOCUS_10470 gene hxlA 25687 25046 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422861.1 protein_id gnl|my_center|LOCUS_10470 25905 26747 gene locus_tag LOCUS_10480 25905 26747 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEH9 protein_id gnl|my_center|LOCUS_10480 26747 27727 gene locus_tag LOCUS_10490 26747 27727 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 protein_id gnl|my_center|LOCUS_10490 28364 27735 gene locus_tag LOCUS_10500 28364 27735 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015866.1 protein_id gnl|my_center|LOCUS_10500 28568 28493 gene locus_tag LOCUS_t00240 28568 28493 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30418 28769 gene locus_tag LOCUS_10510 30418 28769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 31795 30455 gene locus_tag LOCUS_10520 gene amiB 31795 30455 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_10520 32351 31896 gene locus_tag LOCUS_10530 gene yjeE 32351 31896 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981984.1 protein_id gnl|my_center|LOCUS_10530 33848 32361 gene locus_tag LOCUS_10540 gene nnr 33848 32361 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_10540 34024 35106 gene locus_tag LOCUS_10550 gene queG 34024 35106 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_10550 35106 37022 gene locus_tag LOCUS_10560 35106 37022 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_10560 37576 37019 gene locus_tag LOCUS_10570 gene orn 37576 37019 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_10570 37675 38919 gene locus_tag LOCUS_10580 37675 38919 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_10580 38916 39194 gene locus_tag LOCUS_10590 38916 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 40241 39207 gene locus_tag LOCUS_10600 40241 39207 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_10600 41019 40357 gene locus_tag LOCUS_10610 41019 40357 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_10610 44505 41044 gene locus_tag LOCUS_10620 gene aas 44505 41044 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_10620 44665 45405 gene locus_tag LOCUS_10630 44665 45405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 45861 45421 gene locus_tag LOCUS_10640 gene uspA1 45861 45421 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AC1 protein_id gnl|my_center|LOCUS_10640 46872 45934 gene locus_tag LOCUS_10650 46872 45934 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q99 protein_id gnl|my_center|LOCUS_10650 47049 49301 gene locus_tag LOCUS_10660 gene ftsK 47049 49301 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 protein_id gnl|my_center|LOCUS_10660 49398 50039 gene locus_tag LOCUS_10670 gene lolA 49398 50039 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P991 protein_id gnl|my_center|LOCUS_10670 50036 51361 gene locus_tag LOCUS_10680 50036 51361 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_10680 52137 51382 gene locus_tag LOCUS_10690 gene rsmJ 52137 51382 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG6 protein_id gnl|my_center|LOCUS_10690 52460 52738 gene locus_tag LOCUS_10700 52460 52738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 52765 53406 gene locus_tag LOCUS_10710 52765 53406 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_10710 53544 53765 gene locus_tag LOCUS_10720 53544 53765 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_10720 53794 55068 gene locus_tag LOCUS_10730 gene murA 53794 55068 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV2 protein_id gnl|my_center|LOCUS_10730 55070 55714 gene locus_tag LOCUS_10740 gene hisG 55070 55714 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV8 protein_id gnl|my_center|LOCUS_10740 55707 57008 gene locus_tag LOCUS_10750 gene hisD 55707 57008 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_10750 57013 58071 gene locus_tag LOCUS_10760 gene hisC 57013 58071 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNW0 protein_id gnl|my_center|LOCUS_10760 58738 58073 gene locus_tag LOCUS_10770 58738 58073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 58774 59529 gene locus_tag LOCUS_10780 58774 59529 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCM0 protein_id gnl|my_center|LOCUS_10780 60178 59534 gene locus_tag LOCUS_10790 gene pyrE 60178 59534 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2H5 protein_id gnl|my_center|LOCUS_10790 60780 60175 gene locus_tag LOCUS_10800 60780 60175 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_10800 61928 60777 gene locus_tag LOCUS_10810 gene metX 61928 60777 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 protein_id gnl|my_center|LOCUS_10810 62566 62000 gene locus_tag LOCUS_10820 62566 62000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_10820 63353 62559 gene locus_tag LOCUS_10830 gene proC 63353 62559 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_10830 64134 63424 gene locus_tag LOCUS_10840 gene yggS 64134 63424 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261215.1 protein_id gnl|my_center|LOCUS_10840 64227 65264 gene locus_tag LOCUS_10850 gene pilT 64227 65264 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_10850 65274 66416 gene locus_tag LOCUS_10860 gene pilU 65274 66416 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence10 239 454 gene locus_tag LOCUS_10870 239 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 584 1366 gene locus_tag LOCUS_10880 584 1366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_10880 2029 1373 gene locus_tag LOCUS_10890 2029 1373 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_10890 2144 2425 gene locus_tag LOCUS_10900 2144 2425 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_10900 4335 2581 gene locus_tag LOCUS_10910 gene recJ 4335 2581 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_10910 5261 4335 gene locus_tag LOCUS_10920 5261 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5946 5254 gene locus_tag LOCUS_10930 5946 5254 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_10930 7044 5959 gene locus_tag LOCUS_10940 7044 5959 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_10940 7526 7017 gene locus_tag LOCUS_10950 7526 7017 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_10950 7838 8893 gene locus_tag LOCUS_10960 gene purM 7838 8893 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH0 protein_id gnl|my_center|LOCUS_10960 8897 9481 gene locus_tag LOCUS_10970 gene purN 8897 9481 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM25 protein_id gnl|my_center|LOCUS_10970 9494 10276 gene locus_tag LOCUS_10980 9494 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 10273 10872 gene locus_tag LOCUS_10990 10273 10872 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 protein_id gnl|my_center|LOCUS_10990 11779 10880 gene locus_tag LOCUS_11000 11779 10880 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_11000 12354 11872 gene locus_tag LOCUS_11010 gene slyD 12354 11872 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_11010 12527 12351 gene locus_tag LOCUS_11020 12527 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 12569 13267 gene locus_tag LOCUS_11030 12569 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 13188 13568 gene locus_tag LOCUS_11040 13188 13568 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_11040 13571 14674 gene locus_tag LOCUS_11050 gene mnmA 13571 14674 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEF9 protein_id gnl|my_center|LOCUS_11050 14671 15303 gene locus_tag LOCUS_11060 gene hflD 14671 15303 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV9 protein_id gnl|my_center|LOCUS_11060 16019 15300 gene locus_tag LOCUS_11070 16019 15300 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 protein_id gnl|my_center|LOCUS_11070 18642 16075 gene locus_tag LOCUS_11080 gene acnB 18642 16075 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPU4 protein_id gnl|my_center|LOCUS_11080 18737 20104 gene locus_tag LOCUS_11090 18737 20104 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_11090 20104 20610 gene locus_tag LOCUS_11100 20104 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 20607 21404 gene locus_tag LOCUS_11110 20607 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946322.1 protein_id gnl|my_center|LOCUS_11110 21418 22023 gene locus_tag LOCUS_11120 gene drgA 21418 22023 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118380.1 protein_id gnl|my_center|LOCUS_11120 23053 22016 gene locus_tag LOCUS_11130 23053 22016 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_11130 24305 23085 gene locus_tag LOCUS_11140 gene argG 24305 23085 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_11140 25147 24356 gene locus_tag LOCUS_11150 25147 24356 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN26 protein_id gnl|my_center|LOCUS_11150 27333 25237 gene locus_tag LOCUS_11160 gene lpd 27333 25237 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NW1 protein_id gnl|my_center|LOCUS_11160 28676 27330 gene locus_tag LOCUS_11170 28676 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 31333 28679 gene locus_tag LOCUS_11180 gene aceE 31333 28679 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_11180 32121 31495 gene locus_tag LOCUS_11190 gene msrQ 32121 31495 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU7 protein_id gnl|my_center|LOCUS_11190 33099 32140 gene locus_tag LOCUS_11200 gene msrP 33099 32140 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_11200 33695 33105 gene locus_tag LOCUS_11210 33695 33105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_11210 33836 34179 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catttaccttcgccacattt 34424 35035 gene locus_tag LOCUS_11220 34424 35035 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_11220 35036 35284 gene locus_tag LOCUS_11230 35036 35284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 35533 35288 gene locus_tag LOCUS_11240 35533 35288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_11240 37564 35555 gene locus_tag LOCUS_11250 gene dppF 37564 35555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946429.1 protein_id gnl|my_center|LOCUS_11250 38985 37564 gene locus_tag LOCUS_11260 gene oppC 38985 37564 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958494.1 protein_id gnl|my_center|LOCUS_11260 39942 38989 gene locus_tag LOCUS_11270 gene ispH 39942 38989 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_11270 41031 39946 gene locus_tag LOCUS_11280 41031 39946 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_11280 43665 41098 gene locus_tag LOCUS_11290 gene gyrA 43665 41098 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3Q9 protein_id gnl|my_center|LOCUS_11290 44412 43774 gene locus_tag LOCUS_11300 44412 43774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 44498 45013 gene locus_tag LOCUS_11310 gene apt 44498 45013 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 protein_id gnl|my_center|LOCUS_11310 45013 45864 gene locus_tag LOCUS_11320 45013 45864 CDS product sodium-type flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462797.1 protein_id gnl|my_center|LOCUS_11320 45911 47731 gene locus_tag LOCUS_11330 45911 47731 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_11330 47863 48372 gene locus_tag LOCUS_11340 47863 48372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 48422 48967 gene locus_tag LOCUS_11350 48422 48967 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 protein_id gnl|my_center|LOCUS_11350 52853 48969 gene locus_tag LOCUS_11360 gene purL 52853 48969 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_11360 52932 53390 gene locus_tag LOCUS_11370 52932 53390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 55179 53401 gene locus_tag LOCUS_11380 55179 53401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268570.1 protein_id gnl|my_center|LOCUS_11380 55889 55275 gene locus_tag LOCUS_11390 55889 55275 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856975.1 protein_id gnl|my_center|LOCUS_11390 56155 56571 gene locus_tag LOCUS_11400 56155 56571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 57057 56836 gene locus_tag LOCUS_11410 57057 56836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 57469 57035 gene locus_tag LOCUS_11420 57469 57035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 60126 57469 gene locus_tag LOCUS_11430 gene pepN 60126 57469 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 protein_id gnl|my_center|LOCUS_11430 60483 60145 gene locus_tag LOCUS_11440 60483 60145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_11440 61502 60468 gene locus_tag LOCUS_11450 61502 60468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704937.1 protein_id gnl|my_center|LOCUS_11450 62081 61515 gene locus_tag LOCUS_11460 gene dcd 62081 61515 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRC6 protein_id gnl|my_center|LOCUS_11460 63206 62121 gene locus_tag LOCUS_11470 63206 62121 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY87 protein_id gnl|my_center|LOCUS_11470 63501 63307 gene locus_tag LOCUS_11480 63501 63307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 64381 63647 gene locus_tag LOCUS_11490 64381 63647 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_11490 <65715 64378 gene locus_tag LOCUS_11500 <65715 64378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence11 <1 771 gene locus_tag LOCUS_11510 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGG5:UDP-3-O-acylglucosamine N-acyltransferase 842 1294 gene locus_tag LOCUS_11520 gene fabZ 842 1294 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_11520 1291 2058 gene locus_tag LOCUS_11530 gene lpxA 1291 2058 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHD2 protein_id gnl|my_center|LOCUS_11530 3315 2131 gene locus_tag LOCUS_11540 3315 2131 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_11540 3601 4233 gene locus_tag LOCUS_11550 3601 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4240 5412 gene locus_tag LOCUS_11560 gene bamB 4240 5412 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 protein_id gnl|my_center|LOCUS_11560 5416 6819 gene locus_tag LOCUS_11570 gene engA 5416 6819 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_11570 7162 6824 gene locus_tag LOCUS_11580 7162 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7293 9452 gene locus_tag LOCUS_11590 7293 9452 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_11590 9458 10789 gene locus_tag LOCUS_11600 9458 10789 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_11600 10817 11452 gene locus_tag LOCUS_11610 10817 11452 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_11610 11581 12924 gene locus_tag LOCUS_11620 11581 12924 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_11620 13082 13597 gene locus_tag LOCUS_11630 gene fabA 13082 13597 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_11630 13607 14824 gene locus_tag LOCUS_11640 gene fabB 13607 14824 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_11640 15050 14877 gene locus_tag LOCUS_11650 15050 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 15113 15877 gene locus_tag LOCUS_11660 15113 15877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_11660 15870 16217 gene locus_tag LOCUS_11670 15870 16217 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321975.1 protein_id gnl|my_center|LOCUS_11670 16460 17179 gene locus_tag LOCUS_11680 gene purU 16460 17179 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJT8 protein_id gnl|my_center|LOCUS_11680 17986 17210 gene locus_tag LOCUS_11690 17986 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 20436 18262 gene locus_tag LOCUS_11700 20436 18262 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 protein_id gnl|my_center|LOCUS_11700 20915 20619 gene locus_tag LOCUS_11710 20915 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 22049 20922 gene locus_tag LOCUS_11720 gene dapE 22049 20922 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB6 protein_id gnl|my_center|LOCUS_11720 22395 22051 gene locus_tag LOCUS_11730 gene yffB 22395 22051 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262396.1 protein_id gnl|my_center|LOCUS_11730 23219 22398 gene locus_tag LOCUS_11740 gene dapD 23219 22398 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS36 protein_id gnl|my_center|LOCUS_11740 24444 23251 gene locus_tag LOCUS_11750 24444 23251 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_11750 24516 25400 gene locus_tag LOCUS_11760 24516 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_11760 25431 25820 gene locus_tag LOCUS_11770 25431 25820 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_11770 26390 26602 gene locus_tag LOCUS_11780 26390 26602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 27523 26660 gene locus_tag LOCUS_11790 gene ttcA 27523 26660 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM4 protein_id gnl|my_center|LOCUS_11790 28783 27524 gene locus_tag LOCUS_11800 28783 27524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 29834 28788 gene locus_tag LOCUS_11810 29834 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11810 29949 30593 gene locus_tag LOCUS_11820 29949 30593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_11820 31216 30677 gene locus_tag LOCUS_11830 31216 30677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_11830 32383 31574 gene locus_tag LOCUS_11840 gene folE2 32383 31574 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DU0 protein_id gnl|my_center|LOCUS_11840 32770 32390 gene locus_tag LOCUS_11850 gene queD 32770 32390 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CF4 protein_id gnl|my_center|LOCUS_11850 34636 32813 gene locus_tag LOCUS_11860 gene dxs 34636 32813 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_11860 35552 34650 gene locus_tag LOCUS_11870 35552 34650 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_11870 35791 35549 gene locus_tag LOCUS_11880 gene xseB 35791 35549 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU6 protein_id gnl|my_center|LOCUS_11880 35921 36868 gene locus_tag LOCUS_11890 35921 36868 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNS3 protein_id gnl|my_center|LOCUS_11890 37176 36874 gene locus_tag LOCUS_11900 37176 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 37526 37209 gene locus_tag LOCUS_11910 37526 37209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 38182 37676 gene locus_tag LOCUS_11920 38182 37676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 38912 38175 gene locus_tag LOCUS_11930 38912 38175 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_11930 39296 38952 gene locus_tag LOCUS_11940 39296 38952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 41150 39297 gene locus_tag LOCUS_11950 41150 39297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 42255 41281 gene locus_tag LOCUS_11960 42255 41281 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947616.1 protein_id gnl|my_center|LOCUS_11960 43177 42266 gene locus_tag LOCUS_11970 43177 42266 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_11970 44032 43262 gene locus_tag LOCUS_11980 44032 43262 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704323.1 protein_id gnl|my_center|LOCUS_11980 45779 44103 gene locus_tag LOCUS_11990 45779 44103 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_11990 46784 45786 gene locus_tag LOCUS_12000 46784 45786 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_12000 46960 47355 gene locus_tag LOCUS_12010 46960 47355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 47955 47362 gene locus_tag LOCUS_12020 47955 47362 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390267.1 protein_id gnl|my_center|LOCUS_12020 49599 48019 gene locus_tag LOCUS_12030 49599 48019 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_12030 50627 49659 gene locus_tag LOCUS_12040 50627 49659 CDS product corrinoid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_12040 51412 50624 gene locus_tag LOCUS_12050 51412 50624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025766.1 protein_id gnl|my_center|LOCUS_12050 52328 51429 gene locus_tag LOCUS_12060 52328 51429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870248.1 protein_id gnl|my_center|LOCUS_12060 52414 52956 gene locus_tag LOCUS_12070 52414 52956 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_12070 52971 53711 gene locus_tag LOCUS_12080 52971 53711 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_12080 54309 53695 gene locus_tag LOCUS_12090 54309 53695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 54439 55359 gene locus_tag LOCUS_12100 54439 55359 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_12100 55361 55804 gene locus_tag LOCUS_12110 55361 55804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709362.1 protein_id gnl|my_center|LOCUS_12110 55857 57026 gene locus_tag LOCUS_12120 55857 57026 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_12120 57545 57030 gene locus_tag LOCUS_12130 57545 57030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 57984 57766 gene locus_tag LOCUS_12140 gene infA 57984 57766 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_12140 58761 58054 gene locus_tag LOCUS_12150 gene ate 58761 58054 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 protein_id gnl|my_center|LOCUS_12150 59477 58758 gene locus_tag LOCUS_12160 gene aat 59477 58758 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 protein_id gnl|my_center|LOCUS_12160 60664 59480 gene locus_tag LOCUS_12170 60664 59480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 61296 60697 gene locus_tag LOCUS_12180 gene recR 61296 60697 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ4 protein_id gnl|my_center|LOCUS_12180 61617 61309 gene locus_tag LOCUS_12190 61617 61309 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_12190 63304 61628 gene locus_tag LOCUS_12200 63304 61628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 63770 63681 gene locus_tag LOCUS_t00250 63770 63681 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 598 125 gene locus_tag LOCUS_12210 598 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1254 595 gene locus_tag LOCUS_12220 1254 595 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_12220 1851 1573 gene locus_tag LOCUS_12230 1851 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2252 1857 gene locus_tag LOCUS_12240 2252 1857 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_12240 2709 2290 gene locus_tag LOCUS_12250 2709 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_12250 2839 3513 gene locus_tag LOCUS_12260 gene vfr 2839 3513 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_12260 4319 3522 gene locus_tag LOCUS_12270 gene trpC 4319 3522 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_12270 5359 4334 gene locus_tag LOCUS_12280 gene trpD 5359 4334 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_12280 5930 5352 gene locus_tag LOCUS_12290 gene trpG 5930 5352 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_12290 7439 5943 gene locus_tag LOCUS_12300 7439 5943 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_12300 8211 7519 gene locus_tag LOCUS_12310 gene rpe 8211 7519 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A31 protein_id gnl|my_center|LOCUS_12310 8362 9225 gene locus_tag LOCUS_12320 8362 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9227 10033 gene locus_tag LOCUS_12330 gene speE 9227 10033 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60594 protein_id gnl|my_center|LOCUS_12330 10086 10676 gene locus_tag LOCUS_12340 10086 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 10750 12918 gene locus_tag LOCUS_12350 10750 12918 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_12350 12931 13503 gene locus_tag LOCUS_12360 gene yceJ 12931 13503 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_12360 13524 14090 gene locus_tag LOCUS_12370 13524 14090 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX5 protein_id gnl|my_center|LOCUS_12370 14296 14895 gene locus_tag LOCUS_12380 gene tsaB 14296 14895 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RD1 protein_id gnl|my_center|LOCUS_12380 14895 15629 gene locus_tag LOCUS_12390 gene cmoA 14895 15629 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_12390 15626 16600 gene locus_tag LOCUS_12400 gene cmoB 15626 16600 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 protein_id gnl|my_center|LOCUS_12400 17508 18659 gene locus_tag LOCUS_12410 17508 18659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 18956 18867 gene locus_tag LOCUS_t00260 18956 18867 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19110 19775 gene locus_tag LOCUS_12420 19110 19775 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_12420 20053 20958 gene locus_tag LOCUS_12430 gene moaA 20053 20958 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 protein_id gnl|my_center|LOCUS_12430 20951 21763 gene locus_tag LOCUS_12440 gene fdhD 20951 21763 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Z7 protein_id gnl|my_center|LOCUS_12440 22040 23179 gene locus_tag LOCUS_12450 gene rpfG 22040 23179 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_12450 23210 25774 gene locus_tag LOCUS_12460 23210 25774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 26671 25793 gene locus_tag LOCUS_12470 gene rpfF 26671 25793 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_12470 27281 26868 gene locus_tag LOCUS_12480 27281 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 27691 27290 gene locus_tag LOCUS_12490 gene hslR 27691 27290 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_12490 29661 27697 gene locus_tag LOCUS_12500 gene acsA 29661 27697 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML37 protein_id gnl|my_center|LOCUS_12500 30266 29844 gene locus_tag LOCUS_12510 gene dksA 30266 29844 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_12510 30376 31143 gene locus_tag LOCUS_12520 30376 31143 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_12520 31130 32311 gene locus_tag LOCUS_12530 31130 32311 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P7 protein_id gnl|my_center|LOCUS_12530 32350 34584 gene locus_tag LOCUS_12540 32350 34584 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_12540 35295 34546 gene locus_tag LOCUS_12550 gene cysZ 35295 34546 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXQ1 protein_id gnl|my_center|LOCUS_12550 36615 35311 gene locus_tag LOCUS_12560 36615 35311 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887818.1 protein_id gnl|my_center|LOCUS_12560 37025 36636 gene locus_tag LOCUS_12570 gene queF 37025 36636 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_12570 37087 37878 gene locus_tag LOCUS_12580 37087 37878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 37880 39895 gene locus_tag LOCUS_12590 gene ligA 37880 39895 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTD1 protein_id gnl|my_center|LOCUS_12590 39896 40945 gene locus_tag LOCUS_12600 39896 40945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 40954 41370 gene locus_tag LOCUS_12610 40954 41370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_12610 41379 41978 gene locus_tag LOCUS_12620 41379 41978 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930124.1 protein_id gnl|my_center|LOCUS_12620 41996 42337 gene locus_tag LOCUS_12630 41996 42337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 42369 42695 gene locus_tag LOCUS_12640 42369 42695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 42731 43474 gene locus_tag LOCUS_12650 42731 43474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 43635 44006 gene locus_tag LOCUS_12660 43635 44006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 45048 44014 gene locus_tag LOCUS_12670 45048 44014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_12670 45186 45878 gene locus_tag LOCUS_12680 45186 45878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_12680 45865 46779 gene locus_tag LOCUS_12690 45865 46779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 46800 47438 gene locus_tag LOCUS_12700 gene tpm 46800 47438 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I011 protein_id gnl|my_center|LOCUS_12700 47485 48681 gene locus_tag LOCUS_12710 gene nhaA 47485 48681 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH93 protein_id gnl|my_center|LOCUS_12710 48721 49590 gene locus_tag LOCUS_12720 48721 49590 CDS product PPK2 family polyphosphate--nucleotide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_12720 49692 50081 gene locus_tag LOCUS_12730 49692 50081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_12730 50476 51477 gene locus_tag LOCUS_12740 gene yjgB 50476 51477 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_12740 51564 51989 gene locus_tag LOCUS_12750 51564 51989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 51997 52473 gene locus_tag LOCUS_12760 51997 52473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 53067 54557 gene locus_tag LOCUS_12770 53067 54557 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_12770 54560 55429 gene locus_tag LOCUS_12780 54560 55429 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_12780 55542 56978 gene locus_tag LOCUS_12790 55542 56978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 56978 57667 gene locus_tag LOCUS_12800 56978 57667 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_12800 57687 58643 gene locus_tag LOCUS_12810 57687 58643 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_12810 58669 59796 gene locus_tag LOCUS_12820 58669 59796 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_12820 59753 60481 gene locus_tag LOCUS_12830 59753 60481 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_12830 60469 61254 gene locus_tag LOCUS_12840 60469 61254 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_12840 61329 61877 gene locus_tag LOCUS_12850 61329 61877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 61944 62435 gene locus_tag LOCUS_12860 61944 62435 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFZ2 protein_id gnl|my_center|LOCUS_12860 <63200 62445 gene locus_tag LOCUS_12870 <63200 62445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039015.1:two-component sensor histidine kinase >Feature sequence13 <1 1024 gene locus_tag LOCUS_12880 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FMF2:uroporphyrinogen decarboxylase 1523 1053 gene locus_tag LOCUS_12890 1523 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2927 1659 gene locus_tag LOCUS_12900 gene amtB 2927 1659 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_12900 3285 2947 gene locus_tag LOCUS_12910 3285 2947 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_12910 4074 3349 gene locus_tag LOCUS_12920 4074 3349 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_12920 5180 4467 gene locus_tag LOCUS_12930 5180 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5341 6111 gene locus_tag LOCUS_12940 gene lgt 5341 6111 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_12940 6464 6108 gene locus_tag LOCUS_12950 6464 6108 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLM9 protein_id gnl|my_center|LOCUS_12950 6651 8534 gene locus_tag LOCUS_12960 gene mnmG 6651 8534 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9R8 protein_id gnl|my_center|LOCUS_12960 8534 9172 gene locus_tag LOCUS_12970 gene rsmG 8534 9172 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS4 protein_id gnl|my_center|LOCUS_12970 9190 9957 gene locus_tag LOCUS_12980 gene parA 9190 9957 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_12980 9990 10847 gene locus_tag LOCUS_12990 gene parB 9990 10847 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_12990 10924 11304 gene locus_tag LOCUS_13000 10924 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 11313 12212 gene locus_tag LOCUS_13010 gene atpB 11313 12212 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT14 protein_id gnl|my_center|LOCUS_13010 12270 12503 gene locus_tag LOCUS_13020 gene atpE 12270 12503 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY3 protein_id gnl|my_center|LOCUS_13020 12544 13014 gene locus_tag LOCUS_13030 gene atpF 12544 13014 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_13030 13025 13558 gene locus_tag LOCUS_13040 gene atpH 13025 13558 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCZ8 protein_id gnl|my_center|LOCUS_13040 13581 15122 gene locus_tag LOCUS_13050 gene atpA2 13581 15122 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_13050 15137 16003 gene locus_tag LOCUS_13060 gene atpG 15137 16003 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_13060 16054 17430 gene locus_tag LOCUS_13070 gene atpD 16054 17430 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_13070 17450 17872 gene locus_tag LOCUS_13080 gene atpC 17450 17872 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AF4 protein_id gnl|my_center|LOCUS_13080 18005 19369 gene locus_tag LOCUS_13090 gene glmU 18005 19369 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL26 protein_id gnl|my_center|LOCUS_13090 20042 19596 gene locus_tag LOCUS_13100 20042 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 20867 20070 gene locus_tag LOCUS_13110 20867 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 22432 21047 gene locus_tag LOCUS_13120 gene degQ 22432 21047 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 protein_id gnl|my_center|LOCUS_13120 23351 22443 gene locus_tag LOCUS_13130 gene cbpA 23351 22443 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VN8 protein_id gnl|my_center|LOCUS_13130 23620 25140 gene locus_tag LOCUS_13140 23620 25140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 25260 25754 gene locus_tag LOCUS_13150 25260 25754 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_13150 27132 25747 gene locus_tag LOCUS_13160 gene argH 27132 25747 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_13160 27341 28219 gene locus_tag LOCUS_13170 gene hemC 27341 28219 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329Y0 protein_id gnl|my_center|LOCUS_13170 28221 28967 gene locus_tag LOCUS_13180 gene hemD 28221 28967 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889975.1 protein_id gnl|my_center|LOCUS_13180 28951 30012 gene locus_tag LOCUS_13190 28951 30012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 30009 31211 gene locus_tag LOCUS_13200 gene hemY 30009 31211 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_13200 31232 32965 gene locus_tag LOCUS_13210 gene kefB 31232 32965 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJC4 protein_id gnl|my_center|LOCUS_13210 34069 32966 gene locus_tag LOCUS_13220 gene dnaN 34069 32966 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_13220 35427 34084 gene locus_tag LOCUS_13230 gene dnaA 35427 34084 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK8 protein_id gnl|my_center|LOCUS_13230 35677 35811 gene locus_tag LOCUS_13240 gene rpmH 35677 35811 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI53 protein_id gnl|my_center|LOCUS_13240 35869 36195 gene locus_tag LOCUS_13250 gene rnpA 35869 36195 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_13250 36180 36416 gene locus_tag LOCUS_13260 36180 36416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 36409 38043 gene locus_tag LOCUS_13270 gene yidC 36409 38043 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_13270 38059 39399 gene locus_tag LOCUS_13280 gene mnmE 38059 39399 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_13280 39789 39445 gene locus_tag LOCUS_13290 gene erpA 39789 39445 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW5 protein_id gnl|my_center|LOCUS_13290 40295 39846 gene locus_tag LOCUS_13300 40295 39846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 40838 40308 gene locus_tag LOCUS_13310 40838 40308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 42038 41010 gene locus_tag LOCUS_13320 gene argC 42038 41010 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_13320 43788 42220 gene locus_tag LOCUS_13330 gene purH 43788 42220 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KT0 protein_id gnl|my_center|LOCUS_13330 44114 43824 gene locus_tag LOCUS_13340 44114 43824 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_13340 45115 44111 gene locus_tag LOCUS_13350 gene dusB 45115 44111 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 protein_id gnl|my_center|LOCUS_13350 45983 45105 gene locus_tag LOCUS_13360 gene prmA 45983 45105 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_13360 47331 45991 gene locus_tag LOCUS_13370 gene accC 47331 45991 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24182 protein_id gnl|my_center|LOCUS_13370 47855 47391 gene locus_tag LOCUS_13380 gene accB 47855 47391 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABE1 protein_id gnl|my_center|LOCUS_13380 48308 47871 gene locus_tag LOCUS_13390 gene aroQ1 48308 47871 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_13390 50157 48436 gene locus_tag LOCUS_13400 gene dsbD 50157 48436 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH5 protein_id gnl|my_center|LOCUS_13400 50421 52070 gene locus_tag LOCUS_13410 50421 52070 CDS product putative phosphate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26024 protein_id gnl|my_center|LOCUS_13410 52120 54234 gene locus_tag LOCUS_13420 gene recQ 52120 54234 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_13420 54357 55049 gene locus_tag LOCUS_13430 gene phoB 54357 55049 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 protein_id gnl|my_center|LOCUS_13430 55057 56349 gene locus_tag LOCUS_13440 gene phoR 55057 56349 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262452.1 protein_id gnl|my_center|LOCUS_13440 56484 57437 gene locus_tag LOCUS_13450 gene pstS 56484 57437 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_13450 57600 59873 gene locus_tag LOCUS_13460 57600 59873 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence14 <1 1597 gene locus_tag LOCUS_13470 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I553:alanine--tRNA ligase 1601 2818 gene locus_tag LOCUS_13480 1601 2818 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 protein_id gnl|my_center|LOCUS_13480 2973 3161 gene locus_tag LOCUS_13490 gene csrA 2973 3161 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LR5 protein_id gnl|my_center|LOCUS_13490 3219 3308 gene locus_tag LOCUS_t00270 3219 3308 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3352 3428 gene locus_tag LOCUS_t00280 3352 3428 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3753 3511 gene locus_tag LOCUS_13500 3753 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3979 3785 gene locus_tag LOCUS_13510 3979 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5579 4359 gene locus_tag LOCUS_13520 5579 4359 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_13520 5741 6223 gene locus_tag LOCUS_13530 5741 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6837 6313 gene locus_tag LOCUS_13540 6837 6313 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE18 protein_id gnl|my_center|LOCUS_13540 7601 6840 gene locus_tag LOCUS_13550 7601 6840 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888133.1 protein_id gnl|my_center|LOCUS_13550 8757 7660 gene locus_tag LOCUS_13560 8757 7660 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 protein_id gnl|my_center|LOCUS_13560 8854 9660 gene locus_tag LOCUS_13570 8854 9660 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX92 protein_id gnl|my_center|LOCUS_13570 9654 10205 gene locus_tag LOCUS_13580 9654 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10295 10906 gene locus_tag LOCUS_13590 10295 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085577.1 protein_id gnl|my_center|LOCUS_13590 12637 10940 gene locus_tag LOCUS_13600 12637 10940 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_13600 13564 12722 gene locus_tag LOCUS_13610 gene galU 13564 12722 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880P1 protein_id gnl|my_center|LOCUS_13610 14480 13557 gene locus_tag LOCUS_13620 14480 13557 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_13620 14619 15299 gene locus_tag LOCUS_13630 14619 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 15355 16104 gene locus_tag LOCUS_13640 15355 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 16233 19226 gene locus_tag LOCUS_13650 16233 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19771 19244 gene locus_tag LOCUS_13660 19771 19244 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_13660 20452 19880 gene locus_tag LOCUS_13670 20452 19880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 21182 20598 gene locus_tag LOCUS_13680 gene mtgA 21182 20598 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B7 protein_id gnl|my_center|LOCUS_13680 22061 21573 gene locus_tag LOCUS_13690 22061 21573 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLT0 protein_id gnl|my_center|LOCUS_13690 22176 22715 gene locus_tag LOCUS_13700 22176 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 22738 23160 gene locus_tag LOCUS_13710 22738 23160 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767420.1 protein_id gnl|my_center|LOCUS_13710 23240 24415 gene locus_tag LOCUS_13720 23240 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 25461 24481 gene locus_tag LOCUS_13730 25461 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 26072 25578 gene locus_tag LOCUS_13740 26072 25578 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML0 protein_id gnl|my_center|LOCUS_13740 26292 27950 gene locus_tag LOCUS_13750 26292 27950 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_13750 28082 29059 gene locus_tag LOCUS_13760 gene rlmF 28082 29059 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_13760 30164 29199 gene locus_tag LOCUS_13770 30164 29199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 30369 30926 gene locus_tag LOCUS_13780 30369 30926 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_13780 31725 31096 gene locus_tag LOCUS_13790 31725 31096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_13790 32708 32058 gene locus_tag LOCUS_13800 32708 32058 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_13800 33401 32766 gene locus_tag LOCUS_13810 33401 32766 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_13810 33429 34109 gene locus_tag LOCUS_13820 gene ybbA 33429 34109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_13820 34106 36568 gene locus_tag LOCUS_13830 34106 36568 CDS product inner membrane transport permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_13830 36700 37455 gene locus_tag LOCUS_13840 36700 37455 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_13840 37456 37878 gene locus_tag LOCUS_13850 37456 37878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_13850 38428 37880 gene locus_tag LOCUS_13860 38428 37880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 38952 38431 gene locus_tag LOCUS_13870 38952 38431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_13870 40259 38964 gene locus_tag LOCUS_13880 40259 38964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_13880 41476 40259 gene locus_tag LOCUS_13890 gene ufaM 41476 40259 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_13890 42234 41452 gene locus_tag LOCUS_13900 42234 41452 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_13900 43521 42238 gene locus_tag LOCUS_13910 43521 42238 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_13910 44490 43591 gene locus_tag LOCUS_13920 44490 43591 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_13920 44754 44551 gene locus_tag LOCUS_13930 44754 44551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 45128 44817 gene locus_tag LOCUS_13940 45128 44817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence15 <1 1800 gene locus_tag LOCUS_13950 <1 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071290.1:methionine synthase 1801 2013 gene locus_tag LOCUS_13960 1801 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2031 4067 gene locus_tag LOCUS_13970 gene tmcA 2031 4067 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS8 protein_id gnl|my_center|LOCUS_13970 4446 4105 gene locus_tag LOCUS_13980 4446 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5319 4447 gene locus_tag LOCUS_13990 5319 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 6002 5355 gene locus_tag LOCUS_14000 gene adk 6002 5355 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP1 protein_id gnl|my_center|LOCUS_14000 6902 6054 gene locus_tag LOCUS_14010 6902 6054 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_14010 7048 6905 gene locus_tag LOCUS_14020 7048 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8021 7050 gene locus_tag LOCUS_14030 8021 7050 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_14030 8735 8088 gene locus_tag LOCUS_14040 8735 8088 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_14040 9691 8732 gene locus_tag LOCUS_14050 9691 8732 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_14050 10256 12613 gene locus_tag LOCUS_14060 10256 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12600 12875 gene locus_tag LOCUS_14070 12600 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 13624 12872 gene locus_tag LOCUS_14080 gene kdsB 13624 12872 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0E9 protein_id gnl|my_center|LOCUS_14080 13804 13628 gene locus_tag LOCUS_14090 13804 13628 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEX7 protein_id gnl|my_center|LOCUS_14090 14783 13797 gene locus_tag LOCUS_14100 gene lpxK 14783 13797 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CK58 protein_id gnl|my_center|LOCUS_14100 16544 14790 gene locus_tag LOCUS_14110 gene msbA 16544 14790 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D84 protein_id gnl|my_center|LOCUS_14110 16963 16541 gene locus_tag LOCUS_14120 16963 16541 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_14120 17595 16960 gene locus_tag LOCUS_14130 17595 16960 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_14130 19924 17651 gene locus_tag LOCUS_14140 19924 17651 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946363.1 protein_id gnl|my_center|LOCUS_14140 19970 20494 gene locus_tag LOCUS_14150 19970 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_14150 21168 20491 gene locus_tag LOCUS_14160 gene lolD 21168 20491 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R20 protein_id gnl|my_center|LOCUS_14160 22408 21161 gene locus_tag LOCUS_14170 gene lolC 22408 21161 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244213.1 protein_id gnl|my_center|LOCUS_14170 23133 22471 gene locus_tag LOCUS_14180 gene rpiA 23133 22471 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z6 protein_id gnl|my_center|LOCUS_14180 23262 24776 gene locus_tag LOCUS_14190 gene ilvA2 23262 24776 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I418 protein_id gnl|my_center|LOCUS_14190 24915 26432 gene locus_tag LOCUS_14200 gene glsF 24915 26432 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_14200 26434 27663 gene locus_tag LOCUS_14210 26434 27663 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_14210 28379 27687 gene locus_tag LOCUS_14220 28379 27687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192801.1 protein_id gnl|my_center|LOCUS_14220 28626 29336 gene locus_tag LOCUS_14230 28626 29336 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_14230 29361 30344 gene locus_tag LOCUS_14240 gene glk 29361 30344 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 protein_id gnl|my_center|LOCUS_14240 30353 30739 gene locus_tag LOCUS_14250 gene apaG 30353 30739 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECS1 protein_id gnl|my_center|LOCUS_14250 31520 30741 gene locus_tag LOCUS_14260 31520 30741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 31698 33575 gene locus_tag LOCUS_14270 31698 33575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 33572 33862 gene locus_tag LOCUS_14280 33572 33862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370273.1 protein_id gnl|my_center|LOCUS_14280 34027 35862 gene locus_tag LOCUS_14290 34027 35862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 36249 35854 gene locus_tag LOCUS_14300 36249 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 36450 36280 gene locus_tag LOCUS_14310 36450 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 37502 36675 gene locus_tag LOCUS_14320 gene motD 37502 36675 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_14320 38254 37514 gene locus_tag LOCUS_14330 gene motC 38254 37514 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_14330 38487 38269 gene locus_tag LOCUS_14340 38487 38269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 39242 38511 gene locus_tag LOCUS_14350 gene fliA 39242 38511 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29248 protein_id gnl|my_center|LOCUS_14350 40114 39242 gene locus_tag LOCUS_14360 gene flhG 40114 39242 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3R6 protein_id gnl|my_center|LOCUS_14360 41315 40107 gene locus_tag LOCUS_14370 41315 40107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 <42458 41333 gene locus_tag LOCUS_14380 <42458 41333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083059.1:flagellar biosynthesis protein FlhA >Feature sequence16 864 736 gene locus_tag LOCUS_14390 864 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1621 935 gene locus_tag LOCUS_14400 1621 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2283 1621 gene locus_tag LOCUS_14410 gene bioD 2283 1621 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A94 protein_id gnl|my_center|LOCUS_14410 3187 2291 gene locus_tag LOCUS_14420 gene bioC 3187 2291 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT34 protein_id gnl|my_center|LOCUS_14420 3953 3180 gene locus_tag LOCUS_14430 gene bioH 3953 3180 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF11 protein_id gnl|my_center|LOCUS_14430 5119 3944 gene locus_tag LOCUS_14440 gene bioF 5119 3944 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_14440 6124 5120 gene locus_tag LOCUS_14450 gene bioB 6124 5120 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_14450 6349 6894 gene locus_tag LOCUS_14460 6349 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6899 7999 gene locus_tag LOCUS_14470 6899 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8014 8439 gene locus_tag LOCUS_14480 8014 8439 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_14480 8439 9062 gene locus_tag LOCUS_14490 8439 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_14490 9926 9069 gene locus_tag LOCUS_14500 gene ubiA 9926 9069 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E207 protein_id gnl|my_center|LOCUS_14500 10465 9929 gene locus_tag LOCUS_14510 gene ubiC 10465 9929 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_14510 12573 10483 gene locus_tag LOCUS_14520 gene recG 12573 10483 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ6 protein_id gnl|my_center|LOCUS_14520 12989 12603 gene locus_tag LOCUS_14530 12989 12603 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_14530 15203 13041 gene locus_tag LOCUS_14540 gene spoT 15203 13041 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_14540 15470 15210 gene locus_tag LOCUS_14550 gene rpoZ 15470 15210 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_14550 16130 15519 gene locus_tag LOCUS_14560 gene gmk 16130 15519 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_14560 17021 16155 gene locus_tag LOCUS_14570 17021 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175963.1 protein_id gnl|my_center|LOCUS_14570 17143 17859 gene locus_tag LOCUS_14580 gene rph 17143 17859 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_14580 17868 18467 gene locus_tag LOCUS_14590 17868 18467 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUQ9 protein_id gnl|my_center|LOCUS_14590 18480 19640 gene locus_tag LOCUS_14600 18480 19640 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_14600 20165 19647 gene locus_tag LOCUS_14610 20165 19647 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_14610 21018 20203 gene locus_tag LOCUS_14620 21018 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 21464 21021 gene locus_tag LOCUS_14630 21464 21021 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_14630 21782 21468 gene locus_tag LOCUS_14640 21782 21468 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_14640 22350 22078 gene locus_tag LOCUS_14650 22350 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 22568 23650 gene locus_tag LOCUS_14660 gene serC 22568 23650 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_14660 23705 24874 gene locus_tag LOCUS_14670 23705 24874 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_14670 24979 25278 gene locus_tag LOCUS_14680 24979 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 26696 25551 gene locus_tag LOCUS_14690 gene thrC 26696 25551 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_14690 28053 26743 gene locus_tag LOCUS_14700 gene hom 28053 26743 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_14700 29243 28065 gene locus_tag LOCUS_14710 29243 28065 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813076.1 protein_id gnl|my_center|LOCUS_14710 29338 30183 gene locus_tag LOCUS_14720 29338 30183 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_14720 31724 30228 gene locus_tag LOCUS_14730 gene lysS 31724 30228 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK7 protein_id gnl|my_center|LOCUS_14730 32780 31737 gene locus_tag LOCUS_14740 gene prfB 32780 31737 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSP3 protein_id gnl|my_center|LOCUS_14740 33670 32918 gene locus_tag LOCUS_14750 33670 32918 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_14750 34396 33821 gene locus_tag LOCUS_14760 34396 33821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_14760 35090 34431 gene locus_tag LOCUS_14770 gene pcm 35090 34431 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_14770 35839 35087 gene locus_tag LOCUS_14780 gene surE 35839 35087 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S4T3 protein_id gnl|my_center|LOCUS_14780 38764 35966 gene locus_tag LOCUS_14790 38764 35966 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_14790 40476 38764 gene locus_tag LOCUS_14800 40476 38764 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence17 171 1634 gene locus_tag LOCUS_14810 gene fleQ 171 1634 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382141.1 protein_id gnl|my_center|LOCUS_14810 1763 2944 gene locus_tag LOCUS_14820 1763 2944 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 protein_id gnl|my_center|LOCUS_14820 2941 4311 gene locus_tag LOCUS_14830 2941 4311 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_14830 4337 4669 gene locus_tag LOCUS_14840 gene fliE 4337 4669 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51462 protein_id gnl|my_center|LOCUS_14840 4719 6380 gene locus_tag LOCUS_14850 4719 6380 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT3 protein_id gnl|my_center|LOCUS_14850 6380 7393 gene locus_tag LOCUS_14860 6380 7393 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT4 protein_id gnl|my_center|LOCUS_14860 7380 8072 gene locus_tag LOCUS_14870 7380 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 8062 9495 gene locus_tag LOCUS_14880 gene fliI 8062 9495 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 protein_id gnl|my_center|LOCUS_14880 9576 10019 gene locus_tag LOCUS_14890 9576 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10065 11804 gene locus_tag LOCUS_14900 10065 11804 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_14900 11816 12313 gene locus_tag LOCUS_14910 gene cheW 11816 12313 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_14910 12499 14250 gene locus_tag LOCUS_14920 12499 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 14352 15998 gene locus_tag LOCUS_14930 14352 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 16726 16034 gene locus_tag LOCUS_14940 gene pyrF 16726 16034 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ97 protein_id gnl|my_center|LOCUS_14940 16878 17978 gene locus_tag LOCUS_14950 gene tgt 16878 17978 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_14950 18066 18389 gene locus_tag LOCUS_14960 gene yajC 18066 18389 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_14960 18442 20289 gene locus_tag LOCUS_14970 gene secD 18442 20289 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_14970 20299 21249 gene locus_tag LOCUS_14980 gene secF 20299 21249 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D5 protein_id gnl|my_center|LOCUS_14980 21551 21300 gene locus_tag LOCUS_14990 21551 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 21784 22302 gene locus_tag LOCUS_15000 21784 22302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 22303 23658 gene locus_tag LOCUS_15010 gene mpl 22303 23658 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E886 protein_id gnl|my_center|LOCUS_15010 23655 24266 gene locus_tag LOCUS_15020 gene ubiX 23655 24266 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP17 protein_id gnl|my_center|LOCUS_15020 24331 26001 gene locus_tag LOCUS_15030 gene fhs 24331 26001 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_15030 26015 26293 gene locus_tag LOCUS_15040 26015 26293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 27073 26294 gene locus_tag LOCUS_15050 gene djlA 27073 26294 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_15050 28766 27102 gene locus_tag LOCUS_15060 gene ubiB 28766 27102 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A88 protein_id gnl|my_center|LOCUS_15060 29356 28763 gene locus_tag LOCUS_15070 29356 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948589.1 protein_id gnl|my_center|LOCUS_15070 30115 29369 gene locus_tag LOCUS_15080 gene ubiE 30115 29369 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V5 protein_id gnl|my_center|LOCUS_15080 30398 30126 gene locus_tag LOCUS_15090 30398 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 31822 30497 gene locus_tag LOCUS_15100 gene hslU 31822 30497 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_15100 32377 31829 gene locus_tag LOCUS_15110 gene hslV 32377 31829 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_15110 32569 32653 gene locus_tag LOCUS_t00290 32569 32653 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 32682 32755 gene locus_tag LOCUS_t00300 32682 32755 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32775 32850 gene locus_tag LOCUS_t00310 32775 32850 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 <1 579 gene locus_tag LOCUS_15120 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNS6:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B 2084 810 gene locus_tag LOCUS_15130 2084 810 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958508.1 protein_id gnl|my_center|LOCUS_15130 2313 2717 gene locus_tag LOCUS_15140 gene pilG 2313 2717 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_15140 2723 3094 gene locus_tag LOCUS_15150 gene pilH 2723 3094 CDS product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 protein_id gnl|my_center|LOCUS_15150 3091 3639 gene locus_tag LOCUS_15160 3091 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266433.1 protein_id gnl|my_center|LOCUS_15160 3664 4926 gene locus_tag LOCUS_15170 3664 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4988 10744 gene locus_tag LOCUS_15180 4988 10744 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105280.1 protein_id gnl|my_center|LOCUS_15180 10772 11233 gene locus_tag LOCUS_15190 10772 11233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 11305 13209 gene locus_tag LOCUS_15200 11305 13209 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_15200 13226 14455 gene locus_tag LOCUS_15210 gene cca 13226 14455 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ELM1 protein_id gnl|my_center|LOCUS_15210 14539 15519 gene locus_tag LOCUS_15220 gene mch 14539 15519 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE77 protein_id gnl|my_center|LOCUS_15220 15567 16490 gene locus_tag LOCUS_15230 15567 16490 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 protein_id gnl|my_center|LOCUS_15230 16477 17325 gene locus_tag LOCUS_15240 16477 17325 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532035.1 protein_id gnl|my_center|LOCUS_15240 17466 17984 gene locus_tag LOCUS_15250 17466 17984 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_15250 18712 18026 gene locus_tag LOCUS_15260 18712 18026 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532037.1 protein_id gnl|my_center|LOCUS_15260 18735 19760 gene locus_tag LOCUS_15270 18735 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_15270 19757 20800 gene locus_tag LOCUS_15280 19757 20800 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 protein_id gnl|my_center|LOCUS_15280 20813 22201 gene locus_tag LOCUS_15290 20813 22201 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 protein_id gnl|my_center|LOCUS_15290 22205 22795 gene locus_tag LOCUS_15300 22205 22795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 22792 24000 gene locus_tag LOCUS_15310 22792 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 25393 23972 gene locus_tag LOCUS_15320 25393 23972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 26488 25403 gene locus_tag LOCUS_15330 gene aroB 26488 25403 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG10 protein_id gnl|my_center|LOCUS_15330 27019 26498 gene locus_tag LOCUS_15340 gene aroK 27019 26498 CDS product shikimate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJF7 protein_id gnl|my_center|LOCUS_15340 29126 27108 gene locus_tag LOCUS_15350 gene pilQ 29126 27108 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_15350 29816 29256 gene locus_tag LOCUS_15360 gene pilP 29816 29256 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_15360 30409 29816 gene locus_tag LOCUS_15370 gene pilO 30409 29816 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_15370 30960 30409 gene locus_tag LOCUS_15380 gene pilN 30960 30409 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_15380 <31753 30960 gene locus_tag LOCUS_15390 <31753 30960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403040.1:pilus assembly protein PilM >Feature sequence19 208 283 gene locus_tag LOCUS_t00320 208 283 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 323 661 gene locus_tag LOCUS_15400 gene secE 323 661 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y4 protein_id gnl|my_center|LOCUS_15400 676 1209 gene locus_tag LOCUS_15410 gene nusG 676 1209 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_15410 1280 1714 gene locus_tag LOCUS_15420 gene rplK 1280 1714 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 protein_id gnl|my_center|LOCUS_15420 1714 2406 gene locus_tag LOCUS_15430 gene rplA 1714 2406 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66088 protein_id gnl|my_center|LOCUS_15430 2615 3142 gene locus_tag LOCUS_15440 gene rplJ 2615 3142 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NRR3 protein_id gnl|my_center|LOCUS_15440 3202 3582 gene locus_tag LOCUS_15450 gene rplL 3202 3582 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 protein_id gnl|my_center|LOCUS_15450 3762 7838 gene locus_tag LOCUS_15460 gene rpoB 3762 7838 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_15460 7906 12114 gene locus_tag LOCUS_15470 gene rpoC 7906 12114 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_15470 12253 12627 gene locus_tag LOCUS_15480 gene rpsL 12253 12627 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYP8 protein_id gnl|my_center|LOCUS_15480 12675 13145 gene locus_tag LOCUS_15490 gene rpsG 12675 13145 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK72 protein_id gnl|my_center|LOCUS_15490 13255 15348 gene locus_tag LOCUS_15500 gene fusA 13255 15348 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_15500 15374 16564 gene locus_tag LOCUS_15510 gene tuf2 15374 16564 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_094359.1 protein_id gnl|my_center|LOCUS_15510 16572 16886 gene locus_tag LOCUS_15520 16572 16886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 16902 17534 gene locus_tag LOCUS_15530 gene rplC 16902 17534 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD5 protein_id gnl|my_center|LOCUS_15530 17556 18173 gene locus_tag LOCUS_15540 gene rplD 17556 18173 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T12 protein_id gnl|my_center|LOCUS_15540 18170 18466 gene locus_tag LOCUS_15550 gene rplW 18170 18466 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_15550 18495 19322 gene locus_tag LOCUS_15560 gene rplB 18495 19322 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD8 protein_id gnl|my_center|LOCUS_15560 19339 19611 gene locus_tag LOCUS_15570 gene rpsS 19339 19611 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK64 protein_id gnl|my_center|LOCUS_15570 19627 19959 gene locus_tag LOCUS_15580 gene rplV 19627 19959 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHW3 protein_id gnl|my_center|LOCUS_15580 19972 20634 gene locus_tag LOCUS_15590 gene rpsC 19972 20634 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_15590 20646 21059 gene locus_tag LOCUS_15600 gene rplP 20646 21059 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_15600 21059 21244 gene locus_tag LOCUS_15610 gene rpmC 21059 21244 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5T5 protein_id gnl|my_center|LOCUS_15610 21254 21514 gene locus_tag LOCUS_15620 gene rpsQ 21254 21514 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_15620 21543 21911 gene locus_tag LOCUS_15630 gene rplN 21543 21911 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF31 protein_id gnl|my_center|LOCUS_15630 21928 22245 gene locus_tag LOCUS_15640 gene rplX 21928 22245 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV7 protein_id gnl|my_center|LOCUS_15640 22268 22807 gene locus_tag LOCUS_15650 gene rplE 22268 22807 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I4 protein_id gnl|my_center|LOCUS_15650 22831 23136 gene locus_tag LOCUS_15660 gene rpsN 22831 23136 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ19 protein_id gnl|my_center|LOCUS_15660 23168 23563 gene locus_tag LOCUS_15670 gene rpsH 23168 23563 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7V2 protein_id gnl|my_center|LOCUS_15670 23587 24123 gene locus_tag LOCUS_15680 gene rplF 23587 24123 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_15680 24136 24489 gene locus_tag LOCUS_15690 gene rplR 24136 24489 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ7 protein_id gnl|my_center|LOCUS_15690 24507 25019 gene locus_tag LOCUS_15700 gene rpsE 24507 25019 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_15700 25024 25212 gene locus_tag LOCUS_15710 gene rpmD 25024 25212 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS9 protein_id gnl|my_center|LOCUS_15710 25215 25649 gene locus_tag LOCUS_15720 gene rplO 25215 25649 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I2 protein_id gnl|my_center|LOCUS_15720 25655 26998 gene locus_tag LOCUS_15730 gene secY 25655 26998 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E894 protein_id gnl|my_center|LOCUS_15730 27227 27580 gene locus_tag LOCUS_15740 gene rpsM 27227 27580 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF42 protein_id gnl|my_center|LOCUS_15740 27593 27982 gene locus_tag LOCUS_15750 gene rpsK 27593 27982 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF43 protein_id gnl|my_center|LOCUS_15750 27998 28624 gene locus_tag LOCUS_15760 gene rpsD 27998 28624 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_15760 28664 29647 gene locus_tag LOCUS_15770 gene rpoA 28664 29647 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_15770 29692 30057 gene locus_tag LOCUS_15780 gene rplQ 29692 30057 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E888 protein_id gnl|my_center|LOCUS_15780 >Feature sequence20 3786 2320 gene locus_tag LOCUS_15790 gene cafA 3786 2320 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377531.1 protein_id gnl|my_center|LOCUS_15790 4371 3787 gene locus_tag LOCUS_15800 4371 3787 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_15800 4838 4368 gene locus_tag LOCUS_15810 gene rlmH 4838 4368 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_15810 5191 4838 gene locus_tag LOCUS_15820 gene rsfS 5191 4838 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_15820 6057 5239 gene locus_tag LOCUS_15830 6057 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_15830 7178 6090 gene locus_tag LOCUS_15840 gene dinB2 7178 6090 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92XH8 protein_id gnl|my_center|LOCUS_15840 7866 7234 gene locus_tag LOCUS_15850 gene nadD 7866 7234 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VV7 protein_id gnl|my_center|LOCUS_15850 9130 7868 gene locus_tag LOCUS_15860 gene proA 9130 7868 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_15860 10167 9139 gene locus_tag LOCUS_15870 gene holA 10167 9139 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_15870 10671 10177 gene locus_tag LOCUS_15880 10671 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 13147 10691 gene locus_tag LOCUS_15890 gene leuS 13147 10691 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG64 protein_id gnl|my_center|LOCUS_15890 13353 14120 gene locus_tag LOCUS_15900 13353 14120 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 protein_id gnl|my_center|LOCUS_15900 14597 14178 gene locus_tag LOCUS_15910 14597 14178 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481510.1 protein_id gnl|my_center|LOCUS_15910 15285 14728 gene locus_tag LOCUS_15920 15285 14728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 15593 15339 gene locus_tag LOCUS_15930 15593 15339 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_15930 16150 15668 gene locus_tag LOCUS_15940 gene coaD 16150 15668 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_15940 16737 16153 gene locus_tag LOCUS_15950 gene rsmD 16737 16153 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Z7 protein_id gnl|my_center|LOCUS_15950 18025 16715 gene locus_tag LOCUS_15960 18025 16715 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_15960 19385 18015 gene locus_tag LOCUS_15970 19385 18015 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_15970 19443 20468 gene locus_tag LOCUS_15980 19443 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 20469 21134 gene locus_tag LOCUS_15990 gene ftsE 20469 21134 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_15990 21131 22066 gene locus_tag LOCUS_16000 gene ftsX 21131 22066 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_16000 22163 23023 gene locus_tag LOCUS_16010 gene rpoH 22163 23023 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF81 protein_id gnl|my_center|LOCUS_16010 23399 23076 gene locus_tag LOCUS_16020 gene fdxA 23399 23076 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_16020 23545 23838 gene locus_tag LOCUS_16030 23545 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 23853 25028 gene locus_tag LOCUS_16040 gene lapB 23853 25028 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_16040 25028 25372 gene locus_tag LOCUS_16050 gene yfgD 25028 25372 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCJ8 protein_id gnl|my_center|LOCUS_16050 25379 25972 gene locus_tag LOCUS_16060 25379 25972 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 protein_id gnl|my_center|LOCUS_16060 25938 26333 gene locus_tag LOCUS_16070 25938 26333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213731.1 protein_id gnl|my_center|LOCUS_16070 26387 26617 gene locus_tag LOCUS_16080 26387 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 26706 27503 gene locus_tag LOCUS_16090 26706 27503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence21 403 711 gene locus_tag LOCUS_16100 403 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1845 712 gene locus_tag LOCUS_16110 1845 712 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_16110 3657 1855 gene locus_tag LOCUS_16120 3657 1855 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_16120 3997 3704 gene locus_tag LOCUS_16130 3997 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4188 5561 gene locus_tag LOCUS_16140 4188 5561 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_16140 5684 6781 gene locus_tag LOCUS_16150 5684 6781 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_16150 6788 7210 gene locus_tag LOCUS_16160 6788 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 7542 7240 gene locus_tag LOCUS_16170 7542 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7668 8201 gene locus_tag LOCUS_16180 7668 8201 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_16180 8814 8203 gene locus_tag LOCUS_16190 8814 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 9296 8826 gene locus_tag LOCUS_16200 9296 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9775 9362 gene locus_tag LOCUS_16210 9775 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10281 9904 gene locus_tag LOCUS_16220 10281 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 11333 10419 gene locus_tag LOCUS_16230 11333 10419 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_16230 11812 11387 gene locus_tag LOCUS_16240 11812 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 12449 11976 gene locus_tag LOCUS_16250 12449 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 13394 12645 gene locus_tag LOCUS_16260 gene fpr 13394 12645 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175876.1 protein_id gnl|my_center|LOCUS_16260 14101 13478 gene locus_tag LOCUS_16270 14101 13478 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_16270 14955 14122 gene locus_tag LOCUS_16280 14955 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15231 15560 gene locus_tag LOCUS_16290 15231 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 16633 15599 gene locus_tag LOCUS_16300 16633 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_16300 17434 16691 gene locus_tag LOCUS_16310 17434 16691 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121775.1 protein_id gnl|my_center|LOCUS_16310 17649 18077 gene locus_tag LOCUS_16320 17649 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 18764 18162 gene locus_tag LOCUS_16330 18764 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 protein_id gnl|my_center|LOCUS_16330 18862 19683 gene locus_tag LOCUS_16340 18862 19683 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067593.1 protein_id gnl|my_center|LOCUS_16340 20025 19690 gene locus_tag LOCUS_16350 20025 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 20579 20109 gene locus_tag LOCUS_16360 20579 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103775.1 protein_id gnl|my_center|LOCUS_16360 21908 20625 gene locus_tag LOCUS_16370 21908 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 22512 21967 gene locus_tag LOCUS_16380 gene mip 22512 21967 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_16380 22637 23536 gene locus_tag LOCUS_16390 22637 23536 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886753.1 protein_id gnl|my_center|LOCUS_16390 23961 23608 gene locus_tag LOCUS_16400 23961 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 24693 23986 gene locus_tag LOCUS_16410 24693 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence22 1596 310 gene locus_tag LOCUS_16420 1596 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3352 1706 gene locus_tag LOCUS_16430 gene groL1 3352 1706 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_16430 3695 3405 gene locus_tag LOCUS_16440 gene groS 3695 3405 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_16440 4242 3787 gene locus_tag LOCUS_16450 4242 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 4473 5705 gene locus_tag LOCUS_16460 4473 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932573.1 protein_id gnl|my_center|LOCUS_16460 6248 5826 gene locus_tag LOCUS_16470 6248 5826 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675012.1 protein_id gnl|my_center|LOCUS_16470 6412 7086 gene locus_tag LOCUS_16480 6412 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 7249 7599 gene locus_tag LOCUS_16490 gene arsR 7249 7599 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_16490 7617 8630 gene locus_tag LOCUS_16500 7617 8630 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAP0 protein_id gnl|my_center|LOCUS_16500 8720 9865 gene locus_tag LOCUS_16510 8720 9865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880869.1 protein_id gnl|my_center|LOCUS_16510 10307 10570 gene locus_tag LOCUS_16520 10307 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 10647 11948 gene locus_tag LOCUS_16530 gene czcC 10647 11948 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_16530 11963 13222 gene locus_tag LOCUS_16540 11963 13222 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_16540 13234 16362 gene locus_tag LOCUS_16550 13234 16362 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_16550 18570 16717 gene locus_tag LOCUS_16560 gene ilvD 18570 16717 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_16560 18689 20005 gene locus_tag LOCUS_16570 gene argA 18689 20005 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU5 protein_id gnl|my_center|LOCUS_16570 20511 20002 gene locus_tag LOCUS_16580 gene rppH 20511 20002 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLV2 protein_id gnl|my_center|LOCUS_16580 20660 21313 gene locus_tag LOCUS_16590 20660 21313 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence23 1370 1092 gene locus_tag LOCUS_16600 1370 1092 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193652.1 protein_id gnl|my_center|LOCUS_16600 1666 1367 gene locus_tag LOCUS_16610 1666 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_16610 2278 1667 gene locus_tag LOCUS_16620 2278 1667 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVZ5 protein_id gnl|my_center|LOCUS_16620 2323 3165 gene locus_tag LOCUS_16630 2323 3165 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_16630 3245 3868 gene locus_tag LOCUS_16640 3245 3868 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706721.1 protein_id gnl|my_center|LOCUS_16640 3871 4554 gene locus_tag LOCUS_16650 3871 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4625 7198 gene locus_tag LOCUS_16660 gene clpB 4625 7198 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_16660 9370 7190 gene locus_tag LOCUS_16670 9370 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10286 9441 gene locus_tag LOCUS_16680 gene ybbO 10286 9441 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_16680 11004 10345 gene locus_tag LOCUS_16690 11004 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_16690 11149 11820 gene locus_tag LOCUS_16700 11149 11820 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_16700 11841 13163 gene locus_tag LOCUS_16710 11841 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_16710 13166 14386 gene locus_tag LOCUS_16720 gene coaBC 13166 14386 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_16720 14358 14813 gene locus_tag LOCUS_16730 gene dut 14358 14813 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU09 protein_id gnl|my_center|LOCUS_16730 14835 17333 gene locus_tag LOCUS_16740 14835 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 17346 18254 gene locus_tag LOCUS_16750 gene argB 17346 18254 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_16750 18258 18875 gene locus_tag LOCUS_16760 gene slmA 18258 18875 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_16760 18836 19324 gene locus_tag LOCUS_16770 18836 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence24 1 375 gene locus_tag LOCUS_16780 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 625 1878 gene locus_tag LOCUS_16790 625 1878 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_16790 1955 3685 gene locus_tag LOCUS_16800 1955 3685 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_16800 3936 6008 gene locus_tag LOCUS_16810 3936 6008 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_16810 6071 6331 gene locus_tag LOCUS_16820 6071 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 6328 6945 gene locus_tag LOCUS_16830 gene pnuT 6328 6945 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_16830 7836 6952 gene locus_tag LOCUS_16840 7836 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8504 7830 gene locus_tag LOCUS_16850 gene fabG 8504 7830 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_16850 9576 8530 gene locus_tag LOCUS_16860 gene mtnA 9576 8530 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_16860 9613 10935 gene locus_tag LOCUS_16870 gene mtaD 9613 10935 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E15 protein_id gnl|my_center|LOCUS_16870 10932 11642 gene locus_tag LOCUS_16880 gene ubiG 10932 11642 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ90 protein_id gnl|my_center|LOCUS_16880 11642 12295 gene locus_tag LOCUS_16890 11642 12295 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207368.1 protein_id gnl|my_center|LOCUS_16890 12286 13587 gene locus_tag LOCUS_16900 12286 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_16900 13580 14500 gene locus_tag LOCUS_16910 13580 14500 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_16910 14618 15193 gene locus_tag LOCUS_16920 14618 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 15261 15803 gene locus_tag LOCUS_16930 15261 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 16161 15871 gene locus_tag LOCUS_16940 16161 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence25 376 92 gene locus_tag LOCUS_16950 376 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 829 422 gene locus_tag LOCUS_16960 gene fliS 829 422 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_16960 2376 1000 gene locus_tag LOCUS_16970 gene fliD 2376 1000 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 protein_id gnl|my_center|LOCUS_16970 2797 2411 gene locus_tag LOCUS_16980 2797 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4376 2868 gene locus_tag LOCUS_16990 gene fliC 4376 2868 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV0 protein_id gnl|my_center|LOCUS_16990 5745 4564 gene locus_tag LOCUS_17000 gene flgL 5745 4564 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_17000 7434 5755 gene locus_tag LOCUS_17010 gene flgK 7434 5755 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MHG2 protein_id gnl|my_center|LOCUS_17010 8450 7431 gene locus_tag LOCUS_17020 gene flgJ 8450 7431 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_17020 9550 8453 gene locus_tag LOCUS_17030 gene flgI 9550 8453 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 protein_id gnl|my_center|LOCUS_17030 10269 9562 gene locus_tag LOCUS_17040 gene flgH 10269 9562 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW65 protein_id gnl|my_center|LOCUS_17040 11086 10301 gene locus_tag LOCUS_17050 gene flgG 11086 10301 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B8 protein_id gnl|my_center|LOCUS_17050 11867 11124 gene locus_tag LOCUS_17060 gene flgF 11867 11124 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P8 protein_id gnl|my_center|LOCUS_17060 13190 11904 gene locus_tag LOCUS_17070 gene flgE 13190 11904 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 protein_id gnl|my_center|LOCUS_17070 13878 13201 gene locus_tag LOCUS_17080 gene flgD 13878 13201 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_17080 14307 13894 gene locus_tag LOCUS_17090 14307 13894 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YZ0 protein_id gnl|my_center|LOCUS_17090 14712 14311 gene locus_tag LOCUS_17100 gene flgB 14712 14311 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM45 protein_id gnl|my_center|LOCUS_17100 15013 15777 gene locus_tag LOCUS_17110 15013 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070879.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence26 281 1417 gene locus_tag LOCUS_17120 281 1417 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105263.1 protein_id gnl|my_center|LOCUS_17120 1513 3237 gene locus_tag LOCUS_17130 1513 3237 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377131.1 protein_id gnl|my_center|LOCUS_17130 3687 4868 gene locus_tag LOCUS_17140 gene alkB1 3687 4868 CDS product alkane 1-monooxygenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0R2 protein_id gnl|my_center|LOCUS_17140 5528 4917 gene locus_tag LOCUS_17150 5528 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6573 5521 gene locus_tag LOCUS_17160 gene galE 6573 5521 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55180 protein_id gnl|my_center|LOCUS_17160 7675 6542 gene locus_tag LOCUS_17170 7675 6542 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266461.1 protein_id gnl|my_center|LOCUS_17170 9911 7686 gene locus_tag LOCUS_17180 9911 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 10044 10607 gene locus_tag LOCUS_17190 gene gmhA 10044 10607 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67054 protein_id gnl|my_center|LOCUS_17190 10617 11816 gene locus_tag LOCUS_17200 10617 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_17200 11813 12619 gene locus_tag LOCUS_17210 11813 12619 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_17210 14760 12616 gene locus_tag LOCUS_17220 14760 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 15158 15508 gene locus_tag LOCUS_17230 15158 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence27 863 303 gene locus_tag LOCUS_17240 863 303 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_17240 1815 847 gene locus_tag LOCUS_17250 1815 847 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_17250 2701 1817 gene locus_tag LOCUS_17260 2701 1817 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244127.1 protein_id gnl|my_center|LOCUS_17260 3758 2694 gene locus_tag LOCUS_17270 gene rffG 3758 2694 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 protein_id gnl|my_center|LOCUS_17270 4650 3760 gene locus_tag LOCUS_17280 gene rfbD 4650 3760 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 protein_id gnl|my_center|LOCUS_17280 5218 4643 gene locus_tag LOCUS_17290 gene rfbC 5218 4643 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931998.1 protein_id gnl|my_center|LOCUS_17290 6102 5221 gene locus_tag LOCUS_17300 6102 5221 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAK1 protein_id gnl|my_center|LOCUS_17300 7015 6128 gene locus_tag LOCUS_17310 gene rfbQ 7015 6128 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_17310 8155 7112 gene locus_tag LOCUS_17320 8155 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 9674 8172 gene locus_tag LOCUS_17330 gene rfbE 9674 8172 CDS product putative O-antigen transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37781 protein_id gnl|my_center|LOCUS_17330 11565 9679 gene locus_tag LOCUS_17340 gene glmS 11565 9679 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX0 protein_id gnl|my_center|LOCUS_17340 13200 11653 gene locus_tag LOCUS_17350 gene wbpM 13200 11653 CDS product nucleotide sugar epimerase/dehydratase WbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence28 908 399 gene locus_tag LOCUS_17360 908 399 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_17360 3207 931 gene locus_tag LOCUS_17370 gene bamA 3207 931 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_17370 4615 3272 gene locus_tag LOCUS_17380 gene yaeL 4615 3272 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MHW5 protein_id gnl|my_center|LOCUS_17380 5792 4617 gene locus_tag LOCUS_17390 gene dxr 5792 4617 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N7 protein_id gnl|my_center|LOCUS_17390 6617 5793 gene locus_tag LOCUS_17400 gene cdsA 6617 5793 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BV6 protein_id gnl|my_center|LOCUS_17400 7353 6610 gene locus_tag LOCUS_17410 gene uppS 7353 6610 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E3 protein_id gnl|my_center|LOCUS_17410 7940 7383 gene locus_tag LOCUS_17420 gene frr 7940 7383 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E2 protein_id gnl|my_center|LOCUS_17420 8692 7967 gene locus_tag LOCUS_17430 gene pyrH 8692 7967 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59009 protein_id gnl|my_center|LOCUS_17430 9569 8694 gene locus_tag LOCUS_17440 gene tsf 9569 8694 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_17440 10434 9685 gene locus_tag LOCUS_17450 gene rpsB 10434 9685 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG3 protein_id gnl|my_center|LOCUS_17450 10749 11516 gene locus_tag LOCUS_17460 gene map 10749 11516 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_17460 11523 14144 gene locus_tag LOCUS_17470 gene glnD 11523 14144 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT0 protein_id gnl|my_center|LOCUS_17470 >Feature sequence29 <1 1056 gene locus_tag LOCUS_17480 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CZV4:ribonuclease D 1059 1982 gene locus_tag LOCUS_17490 1059 1982 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_17490 4355 2064 gene locus_tag LOCUS_17500 4355 2064 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704657.1 protein_id gnl|my_center|LOCUS_17500 5642 4392 gene locus_tag LOCUS_17510 5642 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6335 5664 gene locus_tag LOCUS_17520 6335 5664 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704655.1 protein_id gnl|my_center|LOCUS_17520 6883 6332 gene locus_tag LOCUS_17530 6883 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 7152 6871 gene locus_tag LOCUS_17540 7152 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 7067 7480 gene locus_tag LOCUS_17550 gene pilE 7067 7480 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_17550 7942 7484 gene locus_tag LOCUS_17560 gene pgpA 7942 7484 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_17560 8924 7953 gene locus_tag LOCUS_17570 gene thiL 8924 7953 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EFU4 protein_id gnl|my_center|LOCUS_17570 9393 8938 gene locus_tag LOCUS_17580 gene nusB 9393 8938 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HV3 protein_id gnl|my_center|LOCUS_17580 9876 9394 gene locus_tag LOCUS_17590 gene ribH 9876 9394 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_17590 10823 9975 gene locus_tag LOCUS_17600 gene apaH 10823 9975 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_17600 >Feature sequence30 <1 1501 gene locus_tag LOCUS_17610 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZLA6:phosphate transport system permease protein PstA 1503 2348 gene locus_tag LOCUS_17620 gene pstB 1503 2348 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_17620 2376 3095 gene locus_tag LOCUS_17630 gene phoU 2376 3095 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_17630 3254 4759 gene locus_tag LOCUS_17640 gene ppx 3254 4759 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_17640 5797 4778 gene locus_tag LOCUS_17650 5797 4778 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726820.1 protein_id gnl|my_center|LOCUS_17650 8063 6006 gene locus_tag LOCUS_17660 gene oprC 8063 6006 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_17660 8219 8956 gene locus_tag LOCUS_17670 8219 8956 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence31 71 790 gene locus_tag LOCUS_17680 gene phoU 71 790 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_17680 949 2457 gene locus_tag LOCUS_17690 gene ppx 949 2457 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_17690 3494 2475 gene locus_tag LOCUS_17700 3494 2475 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726820.1 protein_id gnl|my_center|LOCUS_17700 5762 3705 gene locus_tag LOCUS_17710 gene oprC 5762 3705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_17710 5919 6656 gene locus_tag LOCUS_17720 5919 6656 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_17720 6656 7582 gene locus_tag LOCUS_17730 6656 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7627 8460 gene locus_tag LOCUS_17740 gene thyA 7627 8460 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ5 protein_id gnl|my_center|LOCUS_17740 8491 8889 gene locus_tag LOCUS_17750 8491 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence32 181 1263 gene locus_tag LOCUS_17760 gene ald 181 1263 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_17760 1385 3139 gene locus_tag LOCUS_17770 1385 3139 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261143.1 protein_id gnl|my_center|LOCUS_17770 3308 3751 gene locus_tag LOCUS_17780 gene pilE 3308 3751 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_17780 5493 3865 gene locus_tag LOCUS_17790 gene metG 5493 3865 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z7 protein_id gnl|my_center|LOCUS_17790 5654 6157 gene locus_tag LOCUS_17800 5654 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 6163 6753 gene locus_tag LOCUS_17810 6163 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence33 <1 2125 gene locus_tag LOCUS_17820 <1 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939279.1:ATPase 2783 2136 gene locus_tag LOCUS_17830 2783 2136 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_17830 3408 2797 gene locus_tag LOCUS_17840 3408 2797 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947643.1 protein_id gnl|my_center|LOCUS_17840 4998 3586 gene locus_tag LOCUS_17850 4998 3586 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931133.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence34 1489 98 gene locus_tag LOCUS_17860 gene radA 1489 98 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96963 protein_id gnl|my_center|LOCUS_17860 2570 1482 gene locus_tag LOCUS_17870 gene alr-1 2570 1482 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH11 protein_id gnl|my_center|LOCUS_17870 4024 2570 gene locus_tag LOCUS_17880 gene dnaB 4024 2570 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_17880 4681 4133 gene locus_tag LOCUS_17890 gene rplI 4681 4133 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L75 protein_id gnl|my_center|LOCUS_17890 5640 4732 gene locus_tag LOCUS_17900 5640 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5918 5691 gene locus_tag LOCUS_17910 gene rpsR 5918 5691 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57626 protein_id gnl|my_center|LOCUS_17910 6290 5937 gene locus_tag LOCUS_17920 gene rpsF 6290 5937 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFV4 protein_id gnl|my_center|LOCUS_17920 <7001 6394 gene locus_tag LOCUS_17930 <7001 6394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KG60:23S rRNA (guanosine-2'-O-)-methyltransferase RlmB >Feature sequence35 418 1209 gene locus_tag LOCUS_17940 418 1209 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_17940 1217 1957 gene locus_tag LOCUS_17950 gene yfiH 1217 1957 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6I1 protein_id gnl|my_center|LOCUS_17950 2021 2818 gene locus_tag LOCUS_17960 2021 2818 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_17960 2884 3849 gene locus_tag LOCUS_17970 gene rfaF 2884 3849 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_17970 3863 5428 gene locus_tag LOCUS_17980 3863 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 5432 6190 gene locus_tag LOCUS_17990 5432 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence36 196 1026 gene locus_tag LOCUS_18000 196 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1338 2435 gene locus_tag LOCUS_18010 1338 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2509 3417 gene locus_tag LOCUS_18020 2509 3417 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813722.1 protein_id gnl|my_center|LOCUS_18020 3523 6594 gene locus_tag LOCUS_18030 3523 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 6762 6686 gene locus_tag LOCUS_t00330 6762 6686 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 3122 552 gene locus_tag LOCUS_18040 gene mutS 3122 552 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBQ3 protein_id gnl|my_center|LOCUS_18040 3133 3636 gene locus_tag LOCUS_18050 3133 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_18050 3695 4726 gene locus_tag LOCUS_18060 gene recA 3695 4726 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_18060 4723 5160 gene locus_tag LOCUS_18070 gene recX 4723 5160 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ5 protein_id gnl|my_center|LOCUS_18070 >Feature sequence38 2620 1292 gene locus_tag LOCUS_18080 gene pmbA 2620 1292 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_18080 3403 2657 gene locus_tag LOCUS_18090 gene moeB 3403 2657 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_18090 4266 3433 gene locus_tag LOCUS_18100 gene prmC 4266 3433 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T2 protein_id gnl|my_center|LOCUS_18100 5302 4274 gene locus_tag LOCUS_18110 5302 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5631 5320 gene locus_tag LOCUS_18120 5631 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 <6171 5628 gene locus_tag LOCUS_18130 <6171 5628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JXQ8:ribosomal RNA small subunit methyltransferase E >Feature sequence39 56 919 gene locus_tag LOCUS_18140 56 919 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_18140 919 2436 gene locus_tag LOCUS_18150 gene lnt 919 2436 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZI86 protein_id gnl|my_center|LOCUS_18150 2436 3887 gene locus_tag LOCUS_18160 gene trkH 2436 3887 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_18160 3891 4469 gene locus_tag LOCUS_18170 3891 4469 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_18170 4585 4785 gene locus_tag LOCUS_18180 gene rpmE 4585 4785 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF3 protein_id gnl|my_center|LOCUS_18180 >Feature sequence40 <1 2005 gene locus_tag LOCUS_18190 <1 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_797832.2:ATP-dependent RNA helicase HrpA 4384 2009 gene locus_tag LOCUS_18200 4384 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence41 <1 2125 gene locus_tag LOCUS_18210 <1 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939279.1:ATPase 2780 2136 gene locus_tag LOCUS_18220 2780 2136 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_18220 3405 2794 gene locus_tag LOCUS_18230 3405 2794 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947643.1 protein_id gnl|my_center|LOCUS_18230 <4682 3583 gene locus_tag LOCUS_18240 <4682 3583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931133.1:phosphate starvation protein PhoH >Feature sequence42 918 64 gene locus_tag LOCUS_18250 gene rsmI 918 64 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY0 protein_id gnl|my_center|LOCUS_18250 1010 2896 gene locus_tag LOCUS_18260 1010 2896 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_18260 2893 3255 gene locus_tag LOCUS_18270 2893 3255 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX8 protein_id gnl|my_center|LOCUS_18270 3317 3892 gene locus_tag LOCUS_18280 3317 3892 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_18280 4321 3896 gene locus_tag LOCUS_18290 4321 3896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence43 1311 640 gene locus_tag LOCUS_18300 1311 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2020 2472 gene locus_tag LOCUS_18310 gene mraZ 2020 2472 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 protein_id gnl|my_center|LOCUS_18310 >Feature sequence44 508 1473 gene locus_tag LOCUS_18320 508 1473 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_18320 1473 2900 gene locus_tag LOCUS_18330 gene phr 1473 2900 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence45 3 506 gene locus_tag LOCUS_18340 3 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <2886 515 gene locus_tag LOCUS_18350 <2886 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946660.1:peptidase >Feature sequence46 74 1414 gene locus_tag LOCUS_18360 gene miaB 74 1414 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57163 protein_id gnl|my_center|LOCUS_18360 1433 2404 gene locus_tag LOCUS_18370 1433 2404 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence47 525 1274 gene locus_tag LOCUS_18380 525 1274 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_18380 1959 1285 gene locus_tag LOCUS_18390 1959 1285 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_18390 2417 2010 gene locus_tag LOCUS_18400 2417 2010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107744.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence48 521 1273 gene locus_tag LOCUS_18410 521 1273 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_18410 1959 1285 gene locus_tag LOCUS_18420 1959 1285 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_18420 2417 2010 gene locus_tag LOCUS_18430 2417 2010 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence49 473 868 gene locus_tag LOCUS_18440 473 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 880 1143 gene locus_tag LOCUS_18450 880 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1153 1848 gene locus_tag LOCUS_18460 gene phoP 1153 1848 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence50 >Feature sequence51 <1 1710 gene locus_tag LOCUS_18470 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377131.1:carbamoyltransferase