>Feature sequence001 269 1834 gene locus_tag LOCUS_00010 269 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2552 1842 gene locus_tag LOCUS_00020 2552 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4362 2701 gene locus_tag LOCUS_00030 4362 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4781 6058 gene locus_tag LOCUS_00040 gene serS 4781 6058 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_00040 6128 6823 gene locus_tag LOCUS_00050 6128 6823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_00050 6924 7484 gene locus_tag LOCUS_00060 gene frr 6924 7484 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_00060 7796 7957 gene locus_tag LOCUS_00070 gene rpmH 7796 7957 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_00070 9906 8107 gene locus_tag LOCUS_00080 9906 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_00080 11000 10086 gene locus_tag LOCUS_00090 11000 10086 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU3 protein_id gnl|my_center|LOCUS_00090 11842 11462 gene locus_tag LOCUS_00100 gene gcvH 11842 11462 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_00100 13394 12084 gene locus_tag LOCUS_00110 gene gltA 13394 12084 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_00110 14186 13761 gene locus_tag LOCUS_00120 14186 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14321 14908 gene locus_tag LOCUS_00130 14321 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_00130 15365 15619 gene locus_tag LOCUS_00140 15365 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17219 15657 gene locus_tag LOCUS_00150 17219 15657 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 protein_id gnl|my_center|LOCUS_00150 18505 17363 gene locus_tag LOCUS_00160 18505 17363 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_00160 18718 18536 gene locus_tag LOCUS_00170 18718 18536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19062 18814 gene locus_tag LOCUS_00180 19062 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20260 19157 gene locus_tag LOCUS_00190 20260 19157 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_00190 20402 21895 gene locus_tag LOCUS_00200 20402 21895 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_00200 23311 21902 gene locus_tag LOCUS_00210 23311 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24734 23334 gene locus_tag LOCUS_00220 24734 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25060 25860 gene locus_tag LOCUS_00230 25060 25860 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_00230 25954 26556 gene locus_tag LOCUS_00240 25954 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27660 26881 gene locus_tag LOCUS_00250 27660 26881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27773 28831 gene locus_tag LOCUS_00260 27773 28831 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_00260 29550 28849 gene locus_tag LOCUS_00270 29550 28849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29705 29911 gene locus_tag LOCUS_00280 29705 29911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29951 30946 gene locus_tag LOCUS_00290 29951 30946 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_00290 30956 31825 gene locus_tag LOCUS_00300 30956 31825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_00300 31827 33212 gene locus_tag LOCUS_00310 31827 33212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33219 34226 gene locus_tag LOCUS_00320 gene batA 33219 34226 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_00320 34311 35342 gene locus_tag LOCUS_00330 34311 35342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_00330 35354 36097 gene locus_tag LOCUS_00340 35354 36097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36114 36647 gene locus_tag LOCUS_00350 36114 36647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36654 38399 gene locus_tag LOCUS_00360 36654 38399 CDS product aerotolerance-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993033.1 protein_id gnl|my_center|LOCUS_00360 39601 38516 gene locus_tag LOCUS_00370 39601 38516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41132 39639 gene locus_tag LOCUS_00380 gene hutH1 41132 39639 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_00380 41608 42141 gene locus_tag LOCUS_00390 41608 42141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42451 42957 gene locus_tag LOCUS_00400 42451 42957 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_00400 42961 43788 gene locus_tag LOCUS_00410 gene murI 42961 43788 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_00410 44462 43737 gene locus_tag LOCUS_00420 gene trmB 44462 43737 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_00420 44592 45698 gene locus_tag LOCUS_00430 44592 45698 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_00430 45814 47295 gene locus_tag LOCUS_00440 gene pepA 45814 47295 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD74 protein_id gnl|my_center|LOCUS_00440 47414 48631 gene locus_tag LOCUS_00450 47414 48631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49396 48734 gene locus_tag LOCUS_00460 gene sigW 49396 48734 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_00460 50493 49387 gene locus_tag LOCUS_00470 50493 49387 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_00470 51803 50493 gene locus_tag LOCUS_00480 51803 50493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52884 51817 gene locus_tag LOCUS_00490 gene lpxK 52884 51817 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN6 protein_id gnl|my_center|LOCUS_00490 53611 52910 gene locus_tag LOCUS_00500 53611 52910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53772 55214 gene locus_tag LOCUS_00510 53772 55214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57009 55327 gene locus_tag LOCUS_00520 gene rny 57009 55327 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_00520 57379 57089 gene locus_tag LOCUS_00530 57379 57089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 57679 57383 gene locus_tag LOCUS_00540 57679 57383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60171 57721 gene locus_tag LOCUS_00550 gene pheT 60171 57721 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_00550 61220 60378 gene locus_tag LOCUS_00560 61220 60378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62969 61245 gene locus_tag LOCUS_00570 62969 61245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63259 63759 gene locus_tag LOCUS_00580 63259 63759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 <66341 64372 gene locus_tag LOCUS_00590 <66341 64372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2P1:peptidylprolyl isomerase >Feature sequence002 477 268 gene locus_tag LOCUS_00600 477 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 2319 793 gene locus_tag LOCUS_00610 gene pcd 2319 793 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_00610 2900 2454 gene locus_tag LOCUS_00620 2900 2454 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_00620 3754 2975 gene locus_tag LOCUS_00630 gene rsmA 3754 2975 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_00630 3903 4997 gene locus_tag LOCUS_00640 gene pdxA 3903 4997 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZK3 protein_id gnl|my_center|LOCUS_00640 5153 5797 gene locus_tag LOCUS_00650 5153 5797 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9K7 protein_id gnl|my_center|LOCUS_00650 6164 5856 gene locus_tag LOCUS_00660 6164 5856 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_00660 6678 6340 gene locus_tag LOCUS_00670 6678 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 7573 6899 gene locus_tag LOCUS_00680 7573 6899 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_00680 7984 9057 gene locus_tag LOCUS_00690 gene prfA 7984 9057 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47849 protein_id gnl|my_center|LOCUS_00690 9369 10268 gene locus_tag LOCUS_00700 gene yyaM 9369 10268 CDS product putative transporter YyaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37511 protein_id gnl|my_center|LOCUS_00700 13820 10323 gene locus_tag LOCUS_00710 13820 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 14074 14718 gene locus_tag LOCUS_00720 14074 14718 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_00720 14921 15283 gene locus_tag LOCUS_00730 14921 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15291 15779 gene locus_tag LOCUS_00740 15291 15779 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 protein_id gnl|my_center|LOCUS_00740 16109 17605 gene locus_tag LOCUS_00750 16109 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 18423 17602 gene locus_tag LOCUS_00760 gene deoD 18423 17602 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM2 protein_id gnl|my_center|LOCUS_00760 19630 18488 gene locus_tag LOCUS_00770 gene mqnC 19630 18488 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH46 protein_id gnl|my_center|LOCUS_00770 20153 20632 gene locus_tag LOCUS_00780 20153 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 20644 21903 gene locus_tag LOCUS_00790 gene nusA 20644 21903 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_00790 22211 25495 gene locus_tag LOCUS_00800 22211 25495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 25773 26426 gene locus_tag LOCUS_00810 gene deoC 25773 26426 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I237 protein_id gnl|my_center|LOCUS_00810 26674 27084 gene locus_tag LOCUS_00820 26674 27084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 27106 28515 gene locus_tag LOCUS_00830 27106 28515 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_00830 28527 29660 gene locus_tag LOCUS_00840 gene tgt 28527 29660 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_00840 29839 30852 gene locus_tag LOCUS_00850 29839 30852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_00850 31201 31737 gene locus_tag LOCUS_00860 31201 31737 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_00860 31761 32906 gene locus_tag LOCUS_00870 gene mutY 31761 32906 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_00870 33042 33506 gene locus_tag LOCUS_00880 33042 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 33536 34972 gene locus_tag LOCUS_00890 33536 34972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 34959 35564 gene locus_tag LOCUS_00900 34959 35564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 36781 35708 gene locus_tag LOCUS_00910 gene recA 36781 35708 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_00910 37663 37427 gene locus_tag LOCUS_00920 37663 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 38782 37997 gene locus_tag LOCUS_00930 38782 37997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_00930 39648 38782 gene locus_tag LOCUS_00940 39648 38782 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_00940 39887 40462 gene locus_tag LOCUS_00950 39887 40462 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973659.1 protein_id gnl|my_center|LOCUS_00950 40553 41830 gene locus_tag LOCUS_00960 40553 41830 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_00960 41827 42363 gene locus_tag LOCUS_00970 41827 42363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 43549 44034 gene locus_tag LOCUS_00980 43549 44034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 44475 44284 gene locus_tag LOCUS_00990 44475 44284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 44640 44491 gene locus_tag LOCUS_01000 44640 44491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 45304 44654 gene locus_tag LOCUS_01010 45304 44654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 45450 45779 gene locus_tag LOCUS_01020 gene ogt2 45450 45779 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_01020 45802 46233 gene locus_tag LOCUS_01030 45802 46233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_01030 47198 46296 gene locus_tag LOCUS_01040 47198 46296 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_01040 55382 47301 gene locus_tag LOCUS_01050 55382 47301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 55947 55750 gene locus_tag LOCUS_01060 55947 55750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 57558 56017 gene locus_tag LOCUS_01070 gene gltX 57558 56017 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_01070 57933 58586 gene locus_tag LOCUS_01080 57933 58586 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_01080 <59336 58717 gene locus_tag LOCUS_01090 <59336 58717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066488.1:ATP-binding protein >Feature sequence003 1228 233 gene locus_tag LOCUS_01100 1228 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 1843 1238 gene locus_tag LOCUS_01110 1843 1238 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_01110 2586 2131 gene locus_tag LOCUS_01120 2586 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3296 3000 gene locus_tag LOCUS_01130 3296 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3957 5663 gene locus_tag LOCUS_01140 3957 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 6191 5760 gene locus_tag LOCUS_01150 gene aroQ 6191 5760 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_01150 8440 6242 gene locus_tag LOCUS_01160 8440 6242 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_01160 8699 9667 gene locus_tag LOCUS_01170 gene kdsD 8699 9667 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_01170 9714 10691 gene locus_tag LOCUS_01180 9714 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_01180 10729 12963 gene locus_tag LOCUS_01190 10729 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767376.1 protein_id gnl|my_center|LOCUS_01190 12983 13411 gene locus_tag LOCUS_01200 12983 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 13820 14518 gene locus_tag LOCUS_01210 13820 14518 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_01210 14731 15765 gene locus_tag LOCUS_01220 gene pheS 14731 15765 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_01220 15856 17217 gene locus_tag LOCUS_01230 gene hisS 15856 17217 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_01230 17280 18713 gene locus_tag LOCUS_01240 gene gatA 17280 18713 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_01240 18807 20240 gene locus_tag LOCUS_01250 18807 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 20960 21565 gene locus_tag LOCUS_01260 20960 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_01260 21839 21636 gene locus_tag LOCUS_01270 21839 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 22980 22021 gene locus_tag LOCUS_01280 22980 22021 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_01280 24110 23070 gene locus_tag LOCUS_01290 gene gldB 24110 23070 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_01290 24387 25151 gene locus_tag LOCUS_01300 24387 25151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 25256 26122 gene locus_tag LOCUS_01310 25256 26122 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_01310 26569 27615 gene locus_tag LOCUS_01320 26569 27615 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDV4 protein_id gnl|my_center|LOCUS_01320 27878 28795 gene locus_tag LOCUS_01330 27878 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01330 28874 32227 gene locus_tag LOCUS_01340 28874 32227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 32230 33201 gene locus_tag LOCUS_01350 32230 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_01350 34677 33343 gene locus_tag LOCUS_01360 34677 33343 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_01360 35119 34679 gene locus_tag LOCUS_01370 35119 34679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 35662 35123 gene locus_tag LOCUS_01380 35662 35123 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_01380 38807 35688 gene locus_tag LOCUS_01390 38807 35688 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_01390 40029 38878 gene locus_tag LOCUS_01400 40029 38878 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_01400 40521 40135 gene locus_tag LOCUS_01410 40521 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 41019 42770 gene locus_tag LOCUS_01420 41019 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 49236 43258 gene locus_tag LOCUS_01430 49236 43258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 49671 50069 gene locus_tag LOCUS_01440 49671 50069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence004 906 175 gene locus_tag LOCUS_01450 906 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1248 1865 gene locus_tag LOCUS_01460 gene tdk 1248 1865 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_01460 1984 3513 gene locus_tag LOCUS_01470 gene purH 1984 3513 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_01470 3661 3834 gene locus_tag LOCUS_01480 3661 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3853 4188 gene locus_tag LOCUS_01490 3853 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4192 4566 gene locus_tag LOCUS_01500 4192 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 5072 5812 gene locus_tag LOCUS_01510 gene coaX 5072 5812 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_01510 5793 7151 gene locus_tag LOCUS_01520 5793 7151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_01520 7154 8614 gene locus_tag LOCUS_01530 7154 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8842 10224 gene locus_tag LOCUS_01540 8842 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10298 10726 gene locus_tag LOCUS_01550 10298 10726 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088625.1 protein_id gnl|my_center|LOCUS_01550 11383 10733 gene locus_tag LOCUS_01560 11383 10733 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_01560 13079 11754 gene locus_tag LOCUS_01570 13079 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13374 14186 gene locus_tag LOCUS_01580 13374 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 14452 15330 gene locus_tag LOCUS_01590 gene lipA 14452 15330 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_01590 18404 15627 gene locus_tag LOCUS_01600 18404 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 19801 22659 gene locus_tag LOCUS_01610 19801 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 23357 22656 gene locus_tag LOCUS_01620 23357 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 23480 25252 gene locus_tag LOCUS_01630 23480 25252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 25314 26195 gene locus_tag LOCUS_01640 25314 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 27333 26200 gene locus_tag LOCUS_01650 27333 26200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 27792 27337 gene locus_tag LOCUS_01660 27792 27337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28628 28464 gene locus_tag LOCUS_01670 28628 28464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 28724 29566 gene locus_tag LOCUS_01680 28724 29566 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_01680 29578 31035 gene locus_tag LOCUS_01690 29578 31035 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_01690 31294 31623 gene locus_tag LOCUS_01700 31294 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 32080 32697 gene locus_tag LOCUS_01710 32080 32697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 32787 33344 gene locus_tag LOCUS_01720 32787 33344 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_01720 34554 33580 gene locus_tag LOCUS_01730 34554 33580 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_01730 35332 34556 gene locus_tag LOCUS_01740 35332 34556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_01740 35704 35874 gene locus_tag LOCUS_01750 35704 35874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35829 36167 gene locus_tag LOCUS_01760 35829 36167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 37475 36234 gene locus_tag LOCUS_01770 37475 36234 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_01770 37790 38809 gene locus_tag LOCUS_01780 37790 38809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 39789 38812 gene locus_tag LOCUS_01790 39789 38812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 39900 41363 gene locus_tag LOCUS_01800 39900 41363 CDS product exo-poly-alpha-D-galacturonosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_01800 41370 44339 gene locus_tag LOCUS_01810 gene ramA 41370 44339 CDS product alfa-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_01810 44816 44538 gene locus_tag LOCUS_01820 44816 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_01820 45201 46271 gene locus_tag LOCUS_01830 45201 46271 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_01830 46953 46408 gene locus_tag LOCUS_01840 46953 46408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_01840 47618 46950 gene locus_tag LOCUS_01850 47618 46950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 <48172 47623 gene locus_tag LOCUS_01860 <48172 47623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963272.1:glucose-1-phosphate thymidylyltransferase >Feature sequence005 2950 620 gene locus_tag LOCUS_01870 2950 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3215 3760 gene locus_tag LOCUS_01880 3215 3760 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_01880 3961 4800 gene locus_tag LOCUS_01890 3961 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5017 7161 gene locus_tag LOCUS_01900 gene ligA 5017 7161 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66880 protein_id gnl|my_center|LOCUS_01900 7283 9400 gene locus_tag LOCUS_01910 7283 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 9491 10318 gene locus_tag LOCUS_01920 9491 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 10457 11071 gene locus_tag LOCUS_01930 10457 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_01930 11083 11571 gene locus_tag LOCUS_01940 11083 11571 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085522.1 protein_id gnl|my_center|LOCUS_01940 11590 13755 gene locus_tag LOCUS_01950 11590 13755 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_01950 14073 14726 gene locus_tag LOCUS_01960 14073 14726 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705346.1 protein_id gnl|my_center|LOCUS_01960 14763 15497 gene locus_tag LOCUS_01970 14763 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 15535 17040 gene locus_tag LOCUS_01980 15535 17040 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_01980 17052 18383 gene locus_tag LOCUS_01990 gene xylA 17052 18383 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_01990 18705 18869 gene locus_tag LOCUS_02000 18705 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 18902 20446 gene locus_tag LOCUS_02010 18902 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 20443 22038 gene locus_tag LOCUS_02020 gene xynB 20443 22038 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94489 protein_id gnl|my_center|LOCUS_02020 22547 22134 gene locus_tag LOCUS_02030 gene mscL 22547 22134 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG6 protein_id gnl|my_center|LOCUS_02030 23322 22678 gene locus_tag LOCUS_02040 23322 22678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 26049 23650 gene locus_tag LOCUS_02050 gene lon 26049 23650 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_02050 28314 26398 gene locus_tag LOCUS_02060 gene parE 28314 26398 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_02060 28457 29002 gene locus_tag LOCUS_02070 28457 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 29054 30436 gene locus_tag LOCUS_02080 29054 30436 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_02080 30492 30953 gene locus_tag LOCUS_02090 30492 30953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 30987 32000 gene locus_tag LOCUS_02100 30987 32000 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920217.1 protein_id gnl|my_center|LOCUS_02100 32009 32962 gene locus_tag LOCUS_02110 32009 32962 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_02110 34290 33142 gene locus_tag LOCUS_02120 34290 33142 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_02120 35403 34444 gene locus_tag LOCUS_02130 35403 34444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 36023 36211 gene locus_tag LOCUS_02140 36023 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 36398 37534 gene locus_tag LOCUS_02150 36398 37534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 37592 43282 gene locus_tag LOCUS_02160 37592 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence006 238 1449 gene locus_tag LOCUS_02170 238 1449 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_02170 1446 3395 gene locus_tag LOCUS_02180 1446 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3989 4471 gene locus_tag LOCUS_02190 3989 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7245 4537 gene locus_tag LOCUS_02200 7245 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_02200 7751 10786 gene locus_tag LOCUS_02210 7751 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 10806 13265 gene locus_tag LOCUS_02220 10806 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 13482 14342 gene locus_tag LOCUS_02230 13482 14342 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_02230 14410 15717 gene locus_tag LOCUS_02240 14410 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 15740 17251 gene locus_tag LOCUS_02250 gene srfJ 15740 17251 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_02250 17241 19631 gene locus_tag LOCUS_02260 17241 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 19673 20560 gene locus_tag LOCUS_02270 19673 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 20567 21499 gene locus_tag LOCUS_02280 20567 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 21845 21507 gene locus_tag LOCUS_02290 21845 21507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 23189 21864 gene locus_tag LOCUS_02300 gene lldA 23189 21864 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972226.1 protein_id gnl|my_center|LOCUS_02300 23431 23907 gene locus_tag LOCUS_02310 23431 23907 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_02310 24615 24172 gene locus_tag LOCUS_02320 24615 24172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 26014 25394 gene locus_tag LOCUS_02330 26014 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 28434 26374 gene locus_tag LOCUS_02340 28434 26374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 29465 31021 gene locus_tag LOCUS_02350 gene glyQS 29465 31021 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZB5 protein_id gnl|my_center|LOCUS_02350 31702 31121 gene locus_tag LOCUS_02360 31702 31121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 32273 34222 gene locus_tag LOCUS_02370 32273 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 35443 34217 gene locus_tag LOCUS_02380 gene ald 35443 34217 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_02380 35867 35448 gene locus_tag LOCUS_02390 35867 35448 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_02390 36639 35884 gene locus_tag LOCUS_02400 36639 35884 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_02400 39953 37092 gene locus_tag LOCUS_02410 39953 37092 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_02410 40244 42217 gene locus_tag LOCUS_02420 gene gyrB 40244 42217 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_02420 43312 42278 gene locus_tag LOCUS_02430 43312 42278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 43810 43322 gene locus_tag LOCUS_02440 43810 43322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 44179 43874 gene locus_tag LOCUS_02450 44179 43874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence007 3175 2663 gene locus_tag LOCUS_02460 3175 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3358 3852 gene locus_tag LOCUS_02470 gene folA 3358 3852 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E3 protein_id gnl|my_center|LOCUS_02470 3849 4598 gene locus_tag LOCUS_02480 3849 4598 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_02480 4894 5142 gene locus_tag LOCUS_02490 4894 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5139 5468 gene locus_tag LOCUS_02500 5139 5468 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_02500 8974 5690 gene locus_tag LOCUS_02510 gene ileS 8974 5690 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_02510 9409 12309 gene locus_tag LOCUS_02520 9409 12309 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_02520 13054 12716 gene locus_tag LOCUS_02530 13054 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13406 14164 gene locus_tag LOCUS_02540 gene lytR 13406 14164 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921829.1 protein_id gnl|my_center|LOCUS_02540 16035 14215 gene locus_tag LOCUS_02550 16035 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 17403 16057 gene locus_tag LOCUS_02560 17403 16057 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_02560 17851 19677 gene locus_tag LOCUS_02570 17851 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 19801 20274 gene locus_tag LOCUS_02580 19801 20274 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_02580 20357 21478 gene locus_tag LOCUS_02590 20357 21478 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_02590 21608 22969 gene locus_tag LOCUS_02600 gene fjo17 21608 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_02600 23184 24587 gene locus_tag LOCUS_02610 gene lpdA1 23184 24587 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_02610 26046 24622 gene locus_tag LOCUS_02620 26046 24622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26243 27979 gene locus_tag LOCUS_02630 26243 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 28138 30066 gene locus_tag LOCUS_02640 gene thrS 28138 30066 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP2 protein_id gnl|my_center|LOCUS_02640 30336 30674 gene locus_tag LOCUS_02650 30336 30674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 32520 30736 gene locus_tag LOCUS_02660 gene fadD 32520 30736 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_02660 33431 32769 gene locus_tag LOCUS_02670 gene yceI 33431 32769 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_02670 34380 33493 gene locus_tag LOCUS_02680 34380 33493 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_02680 34712 37558 gene locus_tag LOCUS_02690 34712 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 37917 39080 gene locus_tag LOCUS_02700 37917 39080 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_02700 41446 39077 gene locus_tag LOCUS_02710 41446 39077 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_02710 42241 41660 gene locus_tag LOCUS_02720 gene nadD 42241 41660 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_02720 42712 42248 gene locus_tag LOCUS_02730 42712 42248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 43827 42712 gene locus_tag LOCUS_02740 gene dnaN 43827 42712 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_02740 >Feature sequence008 <1 1655 gene locus_tag LOCUS_02750 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001087135.1:solute:sodium symporter family transporter 1747 2592 gene locus_tag LOCUS_02760 1747 2592 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_02760 3086 2589 gene locus_tag LOCUS_02770 3086 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705686.1 protein_id gnl|my_center|LOCUS_02770 3564 3145 gene locus_tag LOCUS_02780 3564 3145 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204525.1 protein_id gnl|my_center|LOCUS_02780 5266 3707 gene locus_tag LOCUS_02790 5266 3707 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_02790 5716 5270 gene locus_tag LOCUS_02800 5716 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6512 6075 gene locus_tag LOCUS_02810 6512 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7451 6624 gene locus_tag LOCUS_02820 7451 6624 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_02820 8059 7481 gene locus_tag LOCUS_02830 8059 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8890 10122 gene locus_tag LOCUS_02840 8890 10122 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_02840 11476 10160 gene locus_tag LOCUS_02850 11476 10160 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_02850 11931 11491 gene locus_tag LOCUS_02860 11931 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 12306 13964 gene locus_tag LOCUS_02870 12306 13964 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64S05 protein_id gnl|my_center|LOCUS_02870 14026 14835 gene locus_tag LOCUS_02880 14026 14835 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_02880 15011 16954 gene locus_tag LOCUS_02890 15011 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 16968 17507 gene locus_tag LOCUS_02900 gene lspA 16968 17507 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA3 protein_id gnl|my_center|LOCUS_02900 19310 17523 gene locus_tag LOCUS_02910 19310 17523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_02910 19563 20612 gene locus_tag LOCUS_02920 gene pip3 19563 20612 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_02920 22175 20823 gene locus_tag LOCUS_02930 gene accC 22175 20823 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_02930 22777 22253 gene locus_tag LOCUS_02940 gene accB 22777 22253 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_02940 23355 22786 gene locus_tag LOCUS_02950 gene efp 23355 22786 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_02950 24534 23539 gene locus_tag LOCUS_02960 gene fabH 24534 23539 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RC8 protein_id gnl|my_center|LOCUS_02960 26176 24659 gene locus_tag LOCUS_02970 26176 24659 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_02970 26640 26335 gene locus_tag LOCUS_02980 26640 26335 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_02980 26715 27329 gene locus_tag LOCUS_02990 26715 27329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 27984 27313 gene locus_tag LOCUS_03000 27984 27313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 29222 28020 gene locus_tag LOCUS_03010 29222 28020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 30123 29404 gene locus_tag LOCUS_03020 30123 29404 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_03020 30373 31524 gene locus_tag LOCUS_03030 30373 31524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 31741 32316 gene locus_tag LOCUS_03040 31741 32316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 32504 32674 gene locus_tag LOCUS_03050 32504 32674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 32754 33506 gene locus_tag LOCUS_03060 32754 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 33638 34582 gene locus_tag LOCUS_03070 33638 34582 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_03070 35128 34592 gene locus_tag LOCUS_03080 35128 34592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 36678 35209 gene locus_tag LOCUS_03090 36678 35209 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_03090 38215 36782 gene locus_tag LOCUS_03100 38215 36782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 38453 41314 gene locus_tag LOCUS_03110 38453 41314 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_03110 41421 42380 gene locus_tag LOCUS_03120 gene acdS 41421 42380 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_03120 <43346 42375 gene locus_tag LOCUS_03130 <43346 42375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338226.1:ABC transporter ATP-binding protein >Feature sequence009 499 1530 gene locus_tag LOCUS_03140 gene mreB 499 1530 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_03140 1874 2614 gene locus_tag LOCUS_03150 gene mreC 1874 2614 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_03150 2607 3128 gene locus_tag LOCUS_03160 2607 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3140 5005 gene locus_tag LOCUS_03170 3140 5005 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_03170 5008 5505 gene locus_tag LOCUS_03180 gene dfrA 5008 5505 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11045 protein_id gnl|my_center|LOCUS_03180 6516 6181 gene locus_tag LOCUS_03190 6516 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6573 7895 gene locus_tag LOCUS_03200 6573 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_03200 8621 7905 gene locus_tag LOCUS_03210 8621 7905 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_03210 9351 8623 gene locus_tag LOCUS_03220 9351 8623 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107904.1 protein_id gnl|my_center|LOCUS_03220 9493 9915 gene locus_tag LOCUS_03230 9493 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 9993 11393 gene locus_tag LOCUS_03240 9993 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 11557 11482 gene locus_tag LOCUS_t00010 11557 11482 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11887 14436 gene locus_tag LOCUS_03250 11887 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 15831 14560 gene locus_tag LOCUS_03260 15831 14560 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_03260 16482 15838 gene locus_tag LOCUS_03270 16482 15838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_03270 20583 16570 gene locus_tag LOCUS_03280 20583 16570 CDS product adenylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257283.1 protein_id gnl|my_center|LOCUS_03280 21147 23633 gene locus_tag LOCUS_03290 21147 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 24968 23745 gene locus_tag LOCUS_03300 24968 23745 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_03300 28037 25068 gene locus_tag LOCUS_03310 28037 25068 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_03310 28472 29638 gene locus_tag LOCUS_03320 28472 29638 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_03320 30893 29661 gene locus_tag LOCUS_03330 gene hemA 30893 29661 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67314 protein_id gnl|my_center|LOCUS_03330 33488 31092 gene locus_tag LOCUS_03340 33488 31092 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_03340 33750 35522 gene locus_tag LOCUS_03350 gene aspS 33750 35522 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_03350 35826 36476 gene locus_tag LOCUS_03360 35826 36476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_03360 37667 36594 gene locus_tag LOCUS_03370 37667 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 37774 38721 gene locus_tag LOCUS_03380 37774 38721 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_03380 38777 39595 gene locus_tag LOCUS_03390 gene dapD 38777 39595 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_03390 39595 40212 gene locus_tag LOCUS_03400 gene pth 39595 40212 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_03400 >Feature sequence010 3265 2621 gene locus_tag LOCUS_03410 gene queE 3265 2621 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YK9 protein_id gnl|my_center|LOCUS_03410 3421 5451 gene locus_tag LOCUS_03420 3421 5451 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_03420 5476 7797 gene locus_tag LOCUS_03430 5476 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7828 9078 gene locus_tag LOCUS_03440 gene pyrC2 7828 9078 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_03440 9294 9857 gene locus_tag LOCUS_03450 9294 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 9908 10411 gene locus_tag LOCUS_03460 9908 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10415 11353 gene locus_tag LOCUS_03470 10415 11353 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_03470 11346 12488 gene locus_tag LOCUS_03480 11346 12488 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_03480 12485 12973 gene locus_tag LOCUS_03490 12485 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 12980 13561 gene locus_tag LOCUS_03500 gene gmhA 12980 13561 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93UJ2 protein_id gnl|my_center|LOCUS_03500 13638 14195 gene locus_tag LOCUS_03510 gene gmhB 13638 14195 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAI7 protein_id gnl|my_center|LOCUS_03510 15310 14192 gene locus_tag LOCUS_03520 15310 14192 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_03520 15768 15391 gene locus_tag LOCUS_03530 15768 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 16207 16539 gene locus_tag LOCUS_03540 16207 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 16578 18701 gene locus_tag LOCUS_03550 16578 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 20495 18729 gene locus_tag LOCUS_03560 20495 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 20977 22083 gene locus_tag LOCUS_03570 20977 22083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_03570 22080 23045 gene locus_tag LOCUS_03580 gene sua5 22080 23045 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAV8 protein_id gnl|my_center|LOCUS_03580 23358 24293 gene locus_tag LOCUS_03590 gene purC 23358 24293 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV7 protein_id gnl|my_center|LOCUS_03590 24296 24781 gene locus_tag LOCUS_03600 24296 24781 CDS product acetyltransferase CD1211 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B70 protein_id gnl|my_center|LOCUS_03600 25980 24763 gene locus_tag LOCUS_03610 25980 24763 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_03610 27401 27144 gene locus_tag LOCUS_03620 27401 27144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 27819 27388 gene locus_tag LOCUS_03630 27819 27388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 28346 30217 gene locus_tag LOCUS_03640 28346 30217 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_03640 31196 32314 gene locus_tag LOCUS_03650 gene nos 31196 32314 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34453 protein_id gnl|my_center|LOCUS_03650 32865 32464 gene locus_tag LOCUS_03660 32865 32464 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_03660 33111 33353 gene locus_tag LOCUS_03670 33111 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 33371 34264 gene locus_tag LOCUS_03680 33371 34264 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_03680 34403 35470 gene locus_tag LOCUS_03690 34403 35470 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969778.1 protein_id gnl|my_center|LOCUS_03690 35513 36472 gene locus_tag LOCUS_03700 gene paaA 35513 36472 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 protein_id gnl|my_center|LOCUS_03700 36485 36769 gene locus_tag LOCUS_03710 gene paaB 36485 36769 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_03710 36771 37520 gene locus_tag LOCUS_03720 36771 37520 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072831.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence011 228 3554 gene locus_tag LOCUS_03730 gene treS 228 3554 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933743.1 protein_id gnl|my_center|LOCUS_03730 3799 4338 gene locus_tag LOCUS_03740 3799 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4464 6281 gene locus_tag LOCUS_03750 4464 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7557 6322 gene locus_tag LOCUS_03760 7557 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 8442 9161 gene locus_tag LOCUS_03770 8442 9161 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_03770 9174 10391 gene locus_tag LOCUS_03780 9174 10391 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_03780 10405 11643 gene locus_tag LOCUS_03790 10405 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11648 12328 gene locus_tag LOCUS_03800 11648 12328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_03800 12366 13478 gene locus_tag LOCUS_03810 12366 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_03810 14093 13665 gene locus_tag LOCUS_03820 14093 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 14476 15351 gene locus_tag LOCUS_03830 14476 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 15341 15739 gene locus_tag LOCUS_03840 15341 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 17803 15836 gene locus_tag LOCUS_03850 gene glgE 17803 15836 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 protein_id gnl|my_center|LOCUS_03850 18700 19959 gene locus_tag LOCUS_03860 18700 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 19978 20667 gene locus_tag LOCUS_03870 gene rprY 19978 20667 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_03870 23482 20705 gene locus_tag LOCUS_03880 23482 20705 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920434.1 protein_id gnl|my_center|LOCUS_03880 23733 23921 gene locus_tag LOCUS_03890 23733 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 23977 24825 gene locus_tag LOCUS_03900 23977 24825 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404720.1 protein_id gnl|my_center|LOCUS_03900 25926 24817 gene locus_tag LOCUS_03910 25926 24817 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104643.1 protein_id gnl|my_center|LOCUS_03910 26143 26739 gene locus_tag LOCUS_03920 26143 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 28482 26917 gene locus_tag LOCUS_03930 28482 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 28880 29185 gene locus_tag LOCUS_03940 28880 29185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 32401 29315 gene locus_tag LOCUS_03950 32401 29315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 <35310 33180 gene locus_tag LOCUS_03960 <35310 33180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816615.1:peptidase S8 >Feature sequence012 1483 2592 gene locus_tag LOCUS_03970 1483 2592 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_03970 2746 3804 gene locus_tag LOCUS_03980 2746 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3844 5169 gene locus_tag LOCUS_03990 3844 5169 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_03990 5175 7616 gene locus_tag LOCUS_04000 gene fecA 5175 7616 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_04000 9210 7852 gene locus_tag LOCUS_04010 9210 7852 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_04010 11380 9323 gene locus_tag LOCUS_04020 11380 9323 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_04020 11555 11400 gene locus_tag LOCUS_04030 11555 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 12660 11650 gene locus_tag LOCUS_04040 12660 11650 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142105.1 protein_id gnl|my_center|LOCUS_04040 13203 12805 gene locus_tag LOCUS_04050 13203 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_04050 14671 13520 gene locus_tag LOCUS_04060 14671 13520 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_04060 15310 14699 gene locus_tag LOCUS_04070 15310 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 16056 15307 gene locus_tag LOCUS_04080 16056 15307 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_04080 17444 16074 gene locus_tag LOCUS_04090 17444 16074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 19610 17706 gene locus_tag LOCUS_04100 19610 17706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 20064 19873 gene locus_tag LOCUS_04110 20064 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 20078 20392 gene locus_tag LOCUS_04120 20078 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 21336 20545 gene locus_tag LOCUS_04130 21336 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 22772 21411 gene locus_tag LOCUS_04140 22772 21411 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_04140 22962 24662 gene locus_tag LOCUS_04150 22962 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 24731 25636 gene locus_tag LOCUS_04160 24731 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 25706 26620 gene locus_tag LOCUS_04170 25706 26620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 26982 28256 gene locus_tag LOCUS_04180 26982 28256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 28268 28663 gene locus_tag LOCUS_04190 28268 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_04190 29935 28715 gene locus_tag LOCUS_04200 29935 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 33725 30006 gene locus_tag LOCUS_04210 33725 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 34464 33952 gene locus_tag LOCUS_04220 34464 33952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence013 25 513 gene locus_tag LOCUS_04230 gene ogt 25 513 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I209 protein_id gnl|my_center|LOCUS_04230 1145 510 gene locus_tag LOCUS_04240 1145 510 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_04240 3369 1216 gene locus_tag LOCUS_04250 3369 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4126 5439 gene locus_tag LOCUS_04260 4126 5439 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_04260 5643 6185 gene locus_tag LOCUS_04270 5643 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6254 7429 gene locus_tag LOCUS_04280 gene porQ 6254 7429 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_04280 8613 7651 gene locus_tag LOCUS_04290 8613 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10521 9073 gene locus_tag LOCUS_04300 10521 9073 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_04300 12090 10621 gene locus_tag LOCUS_04310 12090 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_04310 15187 12173 gene locus_tag LOCUS_04320 15187 12173 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_04320 15585 18845 gene locus_tag LOCUS_04330 15585 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 18852 20978 gene locus_tag LOCUS_04340 18852 20978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 21203 22111 gene locus_tag LOCUS_04350 21203 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 24322 22433 gene locus_tag LOCUS_04360 24322 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107266.1 protein_id gnl|my_center|LOCUS_04360 24538 27741 gene locus_tag LOCUS_04370 24538 27741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 27860 29650 gene locus_tag LOCUS_04380 27860 29650 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_04380 29909 30607 gene locus_tag LOCUS_04390 29909 30607 CDS product putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703241.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence014 12 623 gene locus_tag LOCUS_04400 12 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 964 3975 gene locus_tag LOCUS_04410 964 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4752 4036 gene locus_tag LOCUS_04420 4752 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5061 5501 gene locus_tag LOCUS_04430 5061 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6737 5547 gene locus_tag LOCUS_04440 6737 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8560 6947 gene locus_tag LOCUS_04450 gene pckA1 8560 6947 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_04450 8825 10333 gene locus_tag LOCUS_04460 8825 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 10572 11843 gene locus_tag LOCUS_04470 10572 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 12174 12461 gene locus_tag LOCUS_04480 12174 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 12471 12815 gene locus_tag LOCUS_04490 12471 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04490 12906 13733 gene locus_tag LOCUS_04500 gene dhmA2 12906 13733 CDS product haloalkane dehalogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS1 protein_id gnl|my_center|LOCUS_04500 17187 13735 gene locus_tag LOCUS_04510 gene pyc 17187 13735 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEL7 protein_id gnl|my_center|LOCUS_04510 19587 17869 gene locus_tag LOCUS_04520 19587 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19966 21678 gene locus_tag LOCUS_04530 19966 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 24641 21681 gene locus_tag LOCUS_04540 24641 21681 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_04540 27903 24739 gene locus_tag LOCUS_04550 27903 24739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 28895 27942 gene locus_tag LOCUS_04560 28895 27942 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_04560 30124 29018 gene locus_tag LOCUS_04570 gene metX 30124 29018 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_04570 31621 30299 gene locus_tag LOCUS_04580 gene cysD 31621 30299 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_04580 32248 32661 gene locus_tag LOCUS_04590 32248 32661 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403972.1 protein_id gnl|my_center|LOCUS_04590 32676 33152 gene locus_tag LOCUS_04600 32676 33152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence015 589 2379 gene locus_tag LOCUS_04610 gene sglT 589 2379 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_04610 2756 2445 gene locus_tag LOCUS_04620 2756 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_04620 4078 2768 gene locus_tag LOCUS_04630 gene murA 4078 2768 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_04630 5019 4327 gene locus_tag LOCUS_04640 5019 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_04640 7229 5391 gene locus_tag LOCUS_04650 gene glmS 7229 5391 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_04650 8833 7478 gene locus_tag LOCUS_04660 8833 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 9720 8908 gene locus_tag LOCUS_04670 9720 8908 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_04670 10183 11040 gene locus_tag LOCUS_04680 gene panC 10183 11040 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_04680 11214 11561 gene locus_tag LOCUS_04690 gene panD 11214 11561 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM2 protein_id gnl|my_center|LOCUS_04690 11805 12860 gene locus_tag LOCUS_04700 11805 12860 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_04700 12860 13357 gene locus_tag LOCUS_04710 12860 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 13362 14414 gene locus_tag LOCUS_04720 13362 14414 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_04720 14455 15210 gene locus_tag LOCUS_04730 14455 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_04730 15343 16821 gene locus_tag LOCUS_04740 15343 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 17507 16842 gene locus_tag LOCUS_04750 gene sirR 17507 16842 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_04750 18337 17642 gene locus_tag LOCUS_04760 18337 17642 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_04760 20503 18356 gene locus_tag LOCUS_04770 20503 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21138 20599 gene locus_tag LOCUS_04780 21138 20599 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_04780 22245 21352 gene locus_tag LOCUS_04790 22245 21352 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_04790 23575 22247 gene locus_tag LOCUS_04800 23575 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 24763 23597 gene locus_tag LOCUS_04810 24763 23597 CDS product group 1 glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393353.1 protein_id gnl|my_center|LOCUS_04810 26205 25036 gene locus_tag LOCUS_04820 26205 25036 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_04820 27322 26945 gene locus_tag LOCUS_04830 27322 26945 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_04830 27666 28241 gene locus_tag LOCUS_04840 27666 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 28501 30663 gene locus_tag LOCUS_04850 gene hppA1 28501 30663 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_04850 30960 33032 gene locus_tag LOCUS_04860 30960 33032 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence016 620 1855 gene locus_tag LOCUS_04870 620 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 1860 2549 gene locus_tag LOCUS_04880 1860 2549 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_04880 2675 3709 gene locus_tag LOCUS_04890 2675 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6039 3922 gene locus_tag LOCUS_04900 6039 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7899 6118 gene locus_tag LOCUS_04910 7899 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 8973 8041 gene locus_tag LOCUS_04920 8973 8041 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_04920 10481 9006 gene locus_tag LOCUS_04930 gene gltD 10481 9006 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480842.1 protein_id gnl|my_center|LOCUS_04930 15059 10512 gene locus_tag LOCUS_04940 15059 10512 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105670.1 protein_id gnl|my_center|LOCUS_04940 18016 15494 gene locus_tag LOCUS_04950 18016 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 19174 18020 gene locus_tag LOCUS_04960 19174 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19611 19333 gene locus_tag LOCUS_04970 19611 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 20184 21680 gene locus_tag LOCUS_04980 20184 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 21843 23900 gene locus_tag LOCUS_04990 21843 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 24033 26528 gene locus_tag LOCUS_05000 24033 26528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 26620 29886 gene locus_tag LOCUS_05010 26620 29886 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_05010 29908 31491 gene locus_tag LOCUS_05020 29908 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 32156 31587 gene locus_tag LOCUS_05030 32156 31587 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence017 670 1854 gene locus_tag LOCUS_05040 670 1854 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_05040 1960 3096 gene locus_tag LOCUS_05050 1960 3096 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887644.1 protein_id gnl|my_center|LOCUS_05050 3752 3222 gene locus_tag LOCUS_05060 3752 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4029 4790 gene locus_tag LOCUS_05070 4029 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5399 4803 gene locus_tag LOCUS_05080 5399 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6923 5400 gene locus_tag LOCUS_05090 gene gpmI 6923 5400 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_05090 7297 7632 gene locus_tag LOCUS_05100 7297 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8444 7659 gene locus_tag LOCUS_05110 8444 7659 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_05110 8498 8719 gene locus_tag LOCUS_05120 8498 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 9712 8942 gene locus_tag LOCUS_05130 9712 8942 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_05130 10452 11060 gene locus_tag LOCUS_05140 10452 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 12851 11052 gene locus_tag LOCUS_05150 12851 11052 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_05150 13383 12934 gene locus_tag LOCUS_05160 13383 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15860 13833 gene locus_tag LOCUS_05170 gene bfmBA 15860 13833 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_05170 16178 16915 gene locus_tag LOCUS_05180 16178 16915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 18930 17029 gene locus_tag LOCUS_05190 gene purF 18930 17029 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_05190 19460 19786 gene locus_tag LOCUS_05200 19460 19786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 19826 21748 gene locus_tag LOCUS_05210 gene mutL 19826 21748 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_05210 21884 22516 gene locus_tag LOCUS_05220 21884 22516 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_05220 22783 23742 gene locus_tag LOCUS_05230 22783 23742 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_05230 24087 24803 gene locus_tag LOCUS_05240 24087 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 25001 26215 gene locus_tag LOCUS_05250 25001 26215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 26406 27911 gene locus_tag LOCUS_05260 gene cysS 26406 27911 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_05260 28517 27975 gene locus_tag LOCUS_05270 28517 27975 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 protein_id gnl|my_center|LOCUS_05270 30655 28781 gene locus_tag LOCUS_05280 30655 28781 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence018 416 1147 gene locus_tag LOCUS_05290 416 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 1150 2427 gene locus_tag LOCUS_05300 1150 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 protein_id gnl|my_center|LOCUS_05300 2437 3345 gene locus_tag LOCUS_05310 2437 3345 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_05310 3420 3839 gene locus_tag LOCUS_05320 3420 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3911 4243 gene locus_tag LOCUS_05330 3911 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4412 4828 gene locus_tag LOCUS_05340 4412 4828 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_05340 5325 6158 gene locus_tag LOCUS_05350 5325 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6201 6611 gene locus_tag LOCUS_05360 6201 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121852.1 protein_id gnl|my_center|LOCUS_05360 7361 6618 gene locus_tag LOCUS_05370 7361 6618 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGE2 protein_id gnl|my_center|LOCUS_05370 7559 8797 gene locus_tag LOCUS_05380 7559 8797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_05380 8790 9023 gene locus_tag LOCUS_05390 8790 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9124 9948 gene locus_tag LOCUS_05400 gene blaA 9124 9948 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_05400 12877 9938 gene locus_tag LOCUS_05410 12877 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 16000 13337 gene locus_tag LOCUS_05420 16000 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 18229 16091 gene locus_tag LOCUS_05430 18229 16091 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_05430 19776 18586 gene locus_tag LOCUS_05440 19776 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 20749 19868 gene locus_tag LOCUS_05450 20749 19868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 22285 20771 gene locus_tag LOCUS_05460 22285 20771 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_05460 25341 22306 gene locus_tag LOCUS_05470 25341 22306 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_05470 27406 25538 gene locus_tag LOCUS_05480 27406 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 28991 28197 gene locus_tag LOCUS_05490 28991 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 31021 29723 gene locus_tag LOCUS_05500 31021 29723 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence019 1431 1195 gene locus_tag LOCUS_05510 gene acpP 1431 1195 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_05510 1778 3256 gene locus_tag LOCUS_05520 gene pykA 1778 3256 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_05520 3601 4602 gene locus_tag LOCUS_05530 3601 4602 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_05530 4652 6358 gene locus_tag LOCUS_05540 4652 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6351 7133 gene locus_tag LOCUS_05550 6351 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 7168 8346 gene locus_tag LOCUS_05560 7168 8346 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_05560 8543 9757 gene locus_tag LOCUS_05570 gene hflX 8543 9757 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_05570 9883 10983 gene locus_tag LOCUS_05580 9883 10983 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228989.1 protein_id gnl|my_center|LOCUS_05580 11273 12001 gene locus_tag LOCUS_05590 11273 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 13636 12236 gene locus_tag LOCUS_05600 13636 12236 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_05600 15007 13883 gene locus_tag LOCUS_05610 15007 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 15545 14991 gene locus_tag LOCUS_05620 15545 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 16061 15612 gene locus_tag LOCUS_05630 16061 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 17787 16435 gene locus_tag LOCUS_05640 17787 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_05640 18454 18068 gene locus_tag LOCUS_05650 18454 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19647 20852 gene locus_tag LOCUS_05660 19647 20852 CDS product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104498.1 protein_id gnl|my_center|LOCUS_05660 21046 21825 gene locus_tag LOCUS_05670 21046 21825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_05670 21815 22198 gene locus_tag LOCUS_05680 21815 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_05680 23325 22243 gene locus_tag LOCUS_05690 23325 22243 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_05690 24349 23330 gene locus_tag LOCUS_05700 24349 23330 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_05700 25316 24354 gene locus_tag LOCUS_05710 25316 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 26289 25408 gene locus_tag LOCUS_05720 26289 25408 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047532.1 protein_id gnl|my_center|LOCUS_05720 26684 26322 gene locus_tag LOCUS_05730 26684 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_05730 27695 28486 gene locus_tag LOCUS_05740 27695 28486 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_05740 28532 28777 gene locus_tag LOCUS_05750 28532 28777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 30092 29028 gene locus_tag LOCUS_05760 30092 29028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence020 754 2304 gene locus_tag LOCUS_05770 754 2304 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_05770 2323 3792 gene locus_tag LOCUS_05780 2323 3792 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_05780 7619 4182 gene locus_tag LOCUS_05790 gene mfd 7619 4182 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_05790 8041 8310 gene locus_tag LOCUS_05800 8041 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 8313 9734 gene locus_tag LOCUS_05810 gene putA 8313 9734 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_05810 10184 11971 gene locus_tag LOCUS_05820 10184 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 12322 12110 gene locus_tag LOCUS_05830 12322 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 12812 12516 gene locus_tag LOCUS_05840 12812 12516 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_05840 14062 12911 gene locus_tag LOCUS_05850 14062 12911 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405516.1 protein_id gnl|my_center|LOCUS_05850 16324 14099 gene locus_tag LOCUS_05860 16324 14099 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_05860 16928 18349 gene locus_tag LOCUS_05870 16928 18349 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_05870 18354 19568 gene locus_tag LOCUS_05880 18354 19568 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_05880 20035 19565 gene locus_tag LOCUS_05890 20035 19565 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y8V2 protein_id gnl|my_center|LOCUS_05890 20641 20714 gene locus_tag LOCUS_t00020 20641 20714 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21245 20904 gene locus_tag LOCUS_05900 21245 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22365 21238 gene locus_tag LOCUS_05910 22365 21238 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_05910 22598 24199 gene locus_tag LOCUS_05920 22598 24199 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q3 protein_id gnl|my_center|LOCUS_05920 24505 26142 gene locus_tag LOCUS_05930 24505 26142 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_05930 27216 26662 gene locus_tag LOCUS_05940 27216 26662 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_05940 28283 27279 gene locus_tag LOCUS_05950 28283 27279 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_05950 <30614 28482 gene locus_tag LOCUS_05960 <30614 28482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:multidrug transporter AcrB >Feature sequence021 1340 1570 gene locus_tag LOCUS_05970 1340 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2578 3993 gene locus_tag LOCUS_05980 2578 3993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_05980 4145 5770 gene locus_tag LOCUS_05990 4145 5770 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_05990 5870 6241 gene locus_tag LOCUS_06000 5870 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 6319 9174 gene locus_tag LOCUS_06010 6319 9174 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_06010 9340 10131 gene locus_tag LOCUS_06020 9340 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10405 10842 gene locus_tag LOCUS_06030 10405 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 11580 11957 gene locus_tag LOCUS_06040 11580 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 11974 15450 gene locus_tag LOCUS_06050 11974 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 15624 16076 gene locus_tag LOCUS_06060 15624 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 16557 16096 gene locus_tag LOCUS_06070 16557 16096 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_06070 16709 17986 gene locus_tag LOCUS_06080 16709 17986 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_06080 18569 18075 gene locus_tag LOCUS_06090 18569 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 19213 18614 gene locus_tag LOCUS_06100 19213 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 19730 19257 gene locus_tag LOCUS_06110 19730 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 19865 20224 gene locus_tag LOCUS_06120 19865 20224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 20217 20792 gene locus_tag LOCUS_06130 20217 20792 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_06130 21522 20779 gene locus_tag LOCUS_06140 21522 20779 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_06140 21777 21950 gene locus_tag LOCUS_06150 21777 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 22893 22033 gene locus_tag LOCUS_06160 22893 22033 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_06160 24269 23559 gene locus_tag LOCUS_06170 gene lytT 24269 23559 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 protein_id gnl|my_center|LOCUS_06170 24901 24611 gene locus_tag LOCUS_06180 24901 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 25852 27030 gene locus_tag LOCUS_06190 gene hisC 25852 27030 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Y8 protein_id gnl|my_center|LOCUS_06190 27192 28289 gene locus_tag LOCUS_06200 27192 28289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 28849 28421 gene locus_tag LOCUS_06210 28849 28421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence022 124 831 gene locus_tag LOCUS_06220 124 831 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580891.1 protein_id gnl|my_center|LOCUS_06220 934 2337 gene locus_tag LOCUS_06230 934 2337 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_06230 2627 3385 gene locus_tag LOCUS_06240 2627 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3382 4086 gene locus_tag LOCUS_06250 gene algR 3382 4086 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_06250 4183 5271 gene locus_tag LOCUS_06260 4183 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 8477 5277 gene locus_tag LOCUS_06270 8477 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 8951 8655 gene locus_tag LOCUS_06280 8951 8655 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_06280 9040 9492 gene locus_tag LOCUS_06290 9040 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 10292 9753 gene locus_tag LOCUS_06300 10292 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_06300 11971 10289 gene locus_tag LOCUS_06310 11971 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_06310 12753 12109 gene locus_tag LOCUS_06320 12753 12109 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_06320 13150 14805 gene locus_tag LOCUS_06330 13150 14805 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_06330 14855 16171 gene locus_tag LOCUS_06340 gene tldD 14855 16171 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_06340 16351 17016 gene locus_tag LOCUS_06350 16351 17016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635487.2 protein_id gnl|my_center|LOCUS_06350 17027 17416 gene locus_tag LOCUS_06360 17027 17416 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_06360 17422 18396 gene locus_tag LOCUS_06370 gene moxR 17422 18396 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_06370 18400 19296 gene locus_tag LOCUS_06380 18400 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_06380 19300 20544 gene locus_tag LOCUS_06390 19300 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 20989 22914 gene locus_tag LOCUS_06400 20989 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 22968 24737 gene locus_tag LOCUS_06410 22968 24737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 24760 25104 gene locus_tag LOCUS_06420 24760 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 25177 25653 gene locus_tag LOCUS_06430 25177 25653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 26896 25703 gene locus_tag LOCUS_06440 26896 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 27793 26969 gene locus_tag LOCUS_06450 27793 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 28157 27963 gene locus_tag LOCUS_06460 28157 27963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 29115 28087 gene locus_tag LOCUS_06470 29115 28087 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence023 3764 1827 gene locus_tag LOCUS_06480 3764 1827 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_06480 4794 3793 gene locus_tag LOCUS_06490 4794 3793 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_06490 5220 6308 gene locus_tag LOCUS_06500 5220 6308 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_06500 6911 6273 gene locus_tag LOCUS_06510 6911 6273 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_06510 7943 7218 gene locus_tag LOCUS_06520 7943 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 8296 8508 gene locus_tag LOCUS_06530 8296 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9786 8683 gene locus_tag LOCUS_06540 9786 8683 CDS product polysaccharide chain length determinant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_06540 11361 9919 gene locus_tag LOCUS_06550 11361 9919 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250663.1 protein_id gnl|my_center|LOCUS_06550 11969 11376 gene locus_tag LOCUS_06560 gene tpm 11969 11376 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_06560 12084 12653 gene locus_tag LOCUS_06570 12084 12653 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 protein_id gnl|my_center|LOCUS_06570 13104 12736 gene locus_tag LOCUS_06580 13104 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 13506 13189 gene locus_tag LOCUS_06590 13506 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 14103 13519 gene locus_tag LOCUS_06600 14103 13519 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_06600 18830 14325 gene locus_tag LOCUS_06610 18830 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 21897 19405 gene locus_tag LOCUS_06620 21897 19405 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_06620 22801 22046 gene locus_tag LOCUS_06630 gene uppS 22801 22046 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_06630 23199 24758 gene locus_tag LOCUS_06640 23199 24758 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_06640 24919 25983 gene locus_tag LOCUS_06650 24919 25983 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_06650 25984 26346 gene locus_tag LOCUS_06660 gene crcB2 25984 26346 CDS product putative fluoride ion transporter CrcB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FC37 protein_id gnl|my_center|LOCUS_06660 26836 26510 gene locus_tag LOCUS_06670 26836 26510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 28263 27469 gene locus_tag LOCUS_06680 28263 27469 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_06680 28829 28263 gene locus_tag LOCUS_06690 28829 28263 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence024 907 26 gene locus_tag LOCUS_06700 907 26 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368434.1 protein_id gnl|my_center|LOCUS_06700 1041 3593 gene locus_tag LOCUS_06710 1041 3593 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_06710 3692 3952 gene locus_tag LOCUS_06720 3692 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4176 4012 gene locus_tag LOCUS_06730 4176 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6889 4265 gene locus_tag LOCUS_06740 gene alaS 6889 4265 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0M6 protein_id gnl|my_center|LOCUS_06740 7530 8435 gene locus_tag LOCUS_06750 7530 8435 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_06750 8519 9697 gene locus_tag LOCUS_06760 8519 9697 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250026.1 protein_id gnl|my_center|LOCUS_06760 9812 10843 gene locus_tag LOCUS_06770 9812 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 11188 12636 gene locus_tag LOCUS_06780 gene gatB 11188 12636 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_06780 12662 12997 gene locus_tag LOCUS_06790 12662 12997 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_06790 13397 13552 gene locus_tag LOCUS_06800 13397 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 15046 13541 gene locus_tag LOCUS_06810 gene pilR 15046 13541 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_06810 15809 15039 gene locus_tag LOCUS_06820 15809 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 16765 15809 gene locus_tag LOCUS_06830 16765 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 20143 16820 gene locus_tag LOCUS_06840 20143 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 21952 20519 gene locus_tag LOCUS_06850 21952 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 22155 21973 gene locus_tag LOCUS_06860 22155 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 23839 23216 gene locus_tag LOCUS_06870 23839 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 24641 23823 gene locus_tag LOCUS_06880 gene lpxA 24641 23823 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_06880 26073 24643 gene locus_tag LOCUS_06890 gene fabZ 26073 24643 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_06890 27195 26137 gene locus_tag LOCUS_06900 gene lpxD 27195 26137 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_06900 27731 28105 gene locus_tag LOCUS_06910 27731 28105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 28142 28831 gene locus_tag LOCUS_06920 28142 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence025 2671 116 gene locus_tag LOCUS_06930 2671 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3758 4330 gene locus_tag LOCUS_06940 3758 4330 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_06940 4388 5383 gene locus_tag LOCUS_06950 4388 5383 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_06950 5703 8279 gene locus_tag LOCUS_06960 5703 8279 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_06960 8323 9276 gene locus_tag LOCUS_06970 8323 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9542 10621 gene locus_tag LOCUS_06980 9542 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11253 10642 gene locus_tag LOCUS_06990 11253 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12254 11547 gene locus_tag LOCUS_07000 12254 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 13294 12365 gene locus_tag LOCUS_07010 13294 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_07010 14633 13287 gene locus_tag LOCUS_07020 gene mvaA 14633 13287 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_07020 15763 14702 gene locus_tag LOCUS_07030 gene fni 15763 14702 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD90 protein_id gnl|my_center|LOCUS_07030 16961 16149 gene locus_tag LOCUS_07040 16961 16149 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_07040 17031 17357 gene locus_tag LOCUS_07050 17031 17357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 18768 17281 gene locus_tag LOCUS_07060 18768 17281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_07060 19653 18889 gene locus_tag LOCUS_07070 gene phnP 19653 18889 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_07070 19943 19650 gene locus_tag LOCUS_07080 19943 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 20350 20973 gene locus_tag LOCUS_07090 20350 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 21045 21482 gene locus_tag LOCUS_07100 21045 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 21484 22392 gene locus_tag LOCUS_07110 21484 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 22777 22394 gene locus_tag LOCUS_07120 gene rbfA 22777 22394 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 protein_id gnl|my_center|LOCUS_07120 24009 22975 gene locus_tag LOCUS_07130 24009 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 26585 24258 gene locus_tag LOCUS_07140 26585 24258 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence026 2484 1789 gene locus_tag LOCUS_07150 gene radC 2484 1789 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_07150 2937 2629 gene locus_tag LOCUS_07160 2937 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3102 3539 gene locus_tag LOCUS_07170 3102 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3576 4091 gene locus_tag LOCUS_07180 3576 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6532 4160 gene locus_tag LOCUS_07190 6532 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7292 6744 gene locus_tag LOCUS_07200 7292 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7586 9520 gene locus_tag LOCUS_07210 7586 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_07210 10259 10498 gene locus_tag LOCUS_07220 10259 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10888 12900 gene locus_tag LOCUS_07230 10888 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_07230 14369 13329 gene locus_tag LOCUS_07240 gene pyrD 14369 13329 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_07240 15267 14548 gene locus_tag LOCUS_07250 gene rprY 15267 14548 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_07250 16887 15412 gene locus_tag LOCUS_07260 16887 15412 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_07260 24617 17175 gene locus_tag LOCUS_07270 gene sprA 24617 17175 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_07270 25388 24798 gene locus_tag LOCUS_07280 gene ruvA 25388 24798 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_07280 25695 26963 gene locus_tag LOCUS_07290 gene purD 25695 26963 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_07290 >Feature sequence027 722 1264 gene locus_tag LOCUS_07300 722 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1300 2058 gene locus_tag LOCUS_07310 1300 2058 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_07310 4490 2205 gene locus_tag LOCUS_07320 4490 2205 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_07320 7223 4701 gene locus_tag LOCUS_07330 7223 4701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_07330 7567 8175 gene locus_tag LOCUS_07340 gene rnhB 7567 8175 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_07340 10098 8182 gene locus_tag LOCUS_07350 10098 8182 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_07350 11232 10285 gene locus_tag LOCUS_07360 11232 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12895 11870 gene locus_tag LOCUS_07370 12895 11870 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_07370 14848 12905 gene locus_tag LOCUS_07380 14848 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 15838 15767 gene locus_tag LOCUS_t00030 15838 15767 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16726 16037 gene locus_tag LOCUS_07390 16726 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 17079 20390 gene locus_tag LOCUS_07400 gene secA 17079 20390 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_07400 20695 21300 gene locus_tag LOCUS_07410 20695 21300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 21431 21297 gene locus_tag LOCUS_07420 21431 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 21449 22918 gene locus_tag LOCUS_07430 21449 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 24008 23145 gene locus_tag LOCUS_07440 gene rfbA 24008 23145 CDS product glucose-1-phosphate thymidylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37779 protein_id gnl|my_center|LOCUS_07440 24621 24253 gene locus_tag LOCUS_07450 24621 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 25059 24703 gene locus_tag LOCUS_07460 25059 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 <26819 25104 gene locus_tag LOCUS_07470 <26819 25104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence028 1422 655 gene locus_tag LOCUS_07480 1422 655 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_07480 1657 1893 gene locus_tag LOCUS_07490 1657 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2051 3349 gene locus_tag LOCUS_07500 2051 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3444 4073 gene locus_tag LOCUS_07510 3444 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4153 5061 gene locus_tag LOCUS_07520 4153 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6417 5062 gene locus_tag LOCUS_07530 6417 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8311 6854 gene locus_tag LOCUS_07540 gene asnS 8311 6854 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_07540 9587 8562 gene locus_tag LOCUS_07550 9587 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10275 12368 gene locus_tag LOCUS_07560 10275 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12456 13004 gene locus_tag LOCUS_07570 12456 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 13642 13001 gene locus_tag LOCUS_07580 13642 13001 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_07580 15917 13635 gene locus_tag LOCUS_07590 15917 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 17156 15921 gene locus_tag LOCUS_07600 17156 15921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17835 17158 gene locus_tag LOCUS_07610 17835 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 19196 18192 gene locus_tag LOCUS_07620 19196 18192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141310.1 protein_id gnl|my_center|LOCUS_07620 19861 19274 gene locus_tag LOCUS_07630 19861 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 20034 19858 gene locus_tag LOCUS_07640 20034 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 20594 19965 gene locus_tag LOCUS_07650 20594 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 21047 23251 gene locus_tag LOCUS_07660 21047 23251 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_07660 25673 23355 gene locus_tag LOCUS_07670 25673 23355 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709186.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence029 <1 907 gene locus_tag LOCUS_07680 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC2:phosphoserine aminotransferase 900 1661 gene locus_tag LOCUS_07690 900 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2170 1724 gene locus_tag LOCUS_07700 gene rplI 2170 1724 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM68 protein_id gnl|my_center|LOCUS_07700 2481 2215 gene locus_tag LOCUS_07710 gene rpsR 2481 2215 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_07710 3012 2509 gene locus_tag LOCUS_07720 3012 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5198 3201 gene locus_tag LOCUS_07730 5198 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6891 5248 gene locus_tag LOCUS_07740 6891 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7149 7673 gene locus_tag LOCUS_07750 7149 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8682 7885 gene locus_tag LOCUS_07760 8682 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8959 9837 gene locus_tag LOCUS_07770 8959 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 10935 10294 gene locus_tag LOCUS_07780 gene sodA 10935 10294 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_07780 11344 12738 gene locus_tag LOCUS_07790 gene fumC 11344 12738 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_07790 12945 14918 gene locus_tag LOCUS_07800 12945 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 14978 15751 gene locus_tag LOCUS_07810 14978 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 15763 17847 gene locus_tag LOCUS_07820 15763 17847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 18607 17819 gene locus_tag LOCUS_07830 18607 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 19406 18828 gene locus_tag LOCUS_07840 19406 18828 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038746.1 protein_id gnl|my_center|LOCUS_07840 19848 20423 gene locus_tag LOCUS_07850 19848 20423 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_07850 20534 21310 gene locus_tag LOCUS_07860 20534 21310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 23196 22357 gene locus_tag LOCUS_07870 23196 22357 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_07870 23810 23217 gene locus_tag LOCUS_07880 23810 23217 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC87 protein_id gnl|my_center|LOCUS_07880 24323 23838 gene locus_tag LOCUS_07890 24323 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 24741 24409 gene locus_tag LOCUS_07900 24741 24409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 25116 25544 gene locus_tag LOCUS_07910 25116 25544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07910 25841 26140 gene locus_tag LOCUS_07920 25841 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence030 1442 690 gene locus_tag LOCUS_07930 1442 690 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_07930 1489 1626 gene locus_tag LOCUS_07940 1489 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1750 4134 gene locus_tag LOCUS_07950 1750 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4566 6017 gene locus_tag LOCUS_07960 4566 6017 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_07960 6144 6587 gene locus_tag LOCUS_07970 6144 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6600 7055 gene locus_tag LOCUS_07980 6600 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7605 7087 gene locus_tag LOCUS_07990 7605 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8952 7693 gene locus_tag LOCUS_08000 gene sucB 8952 7693 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7J7 protein_id gnl|my_center|LOCUS_08000 9886 9083 gene locus_tag LOCUS_08010 9886 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10468 10001 gene locus_tag LOCUS_08020 10468 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10968 10465 gene locus_tag LOCUS_08030 10968 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 11849 11103 gene locus_tag LOCUS_08040 11849 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 12122 12574 gene locus_tag LOCUS_08050 gene dtd 12122 12574 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_08050 12574 12912 gene locus_tag LOCUS_08060 12574 12912 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_08060 13984 13436 gene locus_tag LOCUS_08070 13984 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 14318 14863 gene locus_tag LOCUS_08080 14318 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 15046 15894 gene locus_tag LOCUS_08090 15046 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 15949 17001 gene locus_tag LOCUS_08100 15949 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_08100 18048 16987 gene locus_tag LOCUS_08110 18048 16987 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_08110 18082 18318 gene locus_tag LOCUS_08120 18082 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 19931 18375 gene locus_tag LOCUS_08130 19931 18375 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_08130 21265 20480 gene locus_tag LOCUS_08140 21265 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21594 21277 gene locus_tag LOCUS_08150 gene hupA 21594 21277 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_08150 22171 23034 gene locus_tag LOCUS_08160 22171 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_08160 23039 23602 gene locus_tag LOCUS_08170 gene gmk 23039 23602 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_08170 23712 24098 gene locus_tag LOCUS_08180 gene apaG 23712 24098 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_08180 24242 25120 gene locus_tag LOCUS_08190 24242 25120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 25080 25781 gene locus_tag LOCUS_08200 25080 25781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 26192 25833 gene locus_tag LOCUS_08210 26192 25833 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428185.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence031 520 2451 gene locus_tag LOCUS_08220 520 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4215 2515 gene locus_tag LOCUS_08230 4215 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4641 5402 gene locus_tag LOCUS_08240 4641 5402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_08240 5508 7145 gene locus_tag LOCUS_08250 5508 7145 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_08250 7505 9355 gene locus_tag LOCUS_08260 7505 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 9499 11508 gene locus_tag LOCUS_08270 9499 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11530 13434 gene locus_tag LOCUS_08280 11530 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 14278 13493 gene locus_tag LOCUS_08290 14278 13493 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_08290 14530 14922 gene locus_tag LOCUS_08300 gene recX 14530 14922 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_08300 15095 15295 gene locus_tag LOCUS_08310 15095 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 16876 15305 gene locus_tag LOCUS_08320 16876 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 17132 17554 gene locus_tag LOCUS_08330 17132 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 17900 17535 gene locus_tag LOCUS_08340 17900 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 19145 18084 gene locus_tag LOCUS_08350 19145 18084 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_08350 19498 19160 gene locus_tag LOCUS_08360 19498 19160 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_08360 20373 19738 gene locus_tag LOCUS_08370 20373 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 21921 20374 gene locus_tag LOCUS_08380 21921 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_08380 22470 22060 gene locus_tag LOCUS_08390 22470 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202918.1 protein_id gnl|my_center|LOCUS_08390 22716 24230 gene locus_tag LOCUS_08400 22716 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_08400 25099 24317 gene locus_tag LOCUS_08410 25099 24317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 25484 25260 gene locus_tag LOCUS_08420 25484 25260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08420 25766 25554 gene locus_tag LOCUS_08430 25766 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence032 1434 2651 gene locus_tag LOCUS_08440 1434 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2745 4295 gene locus_tag LOCUS_08450 2745 4295 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 protein_id gnl|my_center|LOCUS_08450 4310 5113 gene locus_tag LOCUS_08460 4310 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5318 5707 gene locus_tag LOCUS_08470 5318 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5709 6257 gene locus_tag LOCUS_08480 5709 6257 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7E1 protein_id gnl|my_center|LOCUS_08480 6362 7804 gene locus_tag LOCUS_08490 6362 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 9328 8309 gene locus_tag LOCUS_08500 gene fbp 9328 8309 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT2 protein_id gnl|my_center|LOCUS_08500 10044 11726 gene locus_tag LOCUS_08510 10044 11726 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_08510 11753 12229 gene locus_tag LOCUS_08520 11753 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 12975 12409 gene locus_tag LOCUS_08530 12975 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 15894 13843 gene locus_tag LOCUS_08540 15894 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_08540 16418 17620 gene locus_tag LOCUS_08550 16418 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_08550 17758 19038 gene locus_tag LOCUS_08560 17758 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_08560 19404 20558 gene locus_tag LOCUS_08570 gene degP 19404 20558 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_08570 22077 22646 gene locus_tag LOCUS_08580 22077 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08580 23805 22636 gene locus_tag LOCUS_08590 23805 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_08590 24001 24630 gene locus_tag LOCUS_08600 24001 24630 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_08600 <26180 24711 gene locus_tag LOCUS_08610 <26180 24711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence033 1213 1911 gene locus_tag LOCUS_08620 1213 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2390 3748 gene locus_tag LOCUS_08630 2390 3748 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_08630 4558 3881 gene locus_tag LOCUS_08640 4558 3881 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_08640 5807 4914 gene locus_tag LOCUS_08650 5807 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 8471 5925 gene locus_tag LOCUS_08660 8471 5925 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_08660 9713 8727 gene locus_tag LOCUS_08670 9713 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10335 9790 gene locus_tag LOCUS_08680 10335 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10680 12215 gene locus_tag LOCUS_08690 gene dagA 10680 12215 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_08690 12818 12288 gene locus_tag LOCUS_08700 12818 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13367 12846 gene locus_tag LOCUS_08710 13367 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 14375 13839 gene locus_tag LOCUS_08720 14375 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 14852 14466 gene locus_tag LOCUS_08730 gene rplT 14852 14466 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_08730 15099 14902 gene locus_tag LOCUS_08740 gene rpmI 15099 14902 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS76 protein_id gnl|my_center|LOCUS_08740 15783 15196 gene locus_tag LOCUS_08750 gene infC 15783 15196 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_08750 18406 15974 gene locus_tag LOCUS_08760 gene clpA 18406 15974 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_08760 19028 19414 gene locus_tag LOCUS_08770 19028 19414 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE11 protein_id gnl|my_center|LOCUS_08770 19484 20452 gene locus_tag LOCUS_08780 gene rnz 19484 20452 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_08780 21094 20423 gene locus_tag LOCUS_08790 21094 20423 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_08790 21412 22488 gene locus_tag LOCUS_08800 gene dinB2 21412 22488 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_08800 22505 23197 gene locus_tag LOCUS_08810 22505 23197 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_08810 23397 23470 gene locus_tag LOCUS_t00040 23397 23470 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23687 24598 gene locus_tag LOCUS_08820 23687 24598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence034 343 140 gene locus_tag LOCUS_08830 343 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1450 1007 gene locus_tag LOCUS_08840 1450 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1723 2388 gene locus_tag LOCUS_08850 1723 2388 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_08850 2819 2385 gene locus_tag LOCUS_08860 2819 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5500 3188 gene locus_tag LOCUS_08870 gene pepN 5500 3188 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_08870 7249 6080 gene locus_tag LOCUS_08880 gene mauG 7249 6080 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_08880 8610 7549 gene locus_tag LOCUS_08890 8610 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 9697 8600 gene locus_tag LOCUS_08900 9697 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 10084 11163 gene locus_tag LOCUS_08910 10084 11163 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_08910 12491 11208 gene locus_tag LOCUS_08920 12491 11208 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_08920 15133 12542 gene locus_tag LOCUS_08930 15133 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 15681 15310 gene locus_tag LOCUS_08940 15681 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 16280 18385 gene locus_tag LOCUS_08950 16280 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 18834 18496 gene locus_tag LOCUS_08960 18834 18496 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_08960 19118 18834 gene locus_tag LOCUS_08970 19118 18834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 19331 20536 gene locus_tag LOCUS_08980 gene fadA 19331 20536 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_08980 20566 22686 gene locus_tag LOCUS_08990 20566 22686 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_08990 22857 24065 gene locus_tag LOCUS_09000 22857 24065 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_09000 24062 24997 gene locus_tag LOCUS_09010 24062 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence035 1490 537 gene locus_tag LOCUS_09020 1490 537 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_09020 1975 2337 gene locus_tag LOCUS_09030 1975 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2530 3000 gene locus_tag LOCUS_09040 2530 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5025 4423 gene locus_tag LOCUS_09050 5025 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_09050 6743 5025 gene locus_tag LOCUS_09060 6743 5025 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_09060 9309 7780 gene locus_tag LOCUS_09070 9309 7780 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_09070 10864 9317 gene locus_tag LOCUS_09080 10864 9317 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_09080 11729 10857 gene locus_tag LOCUS_09090 11729 10857 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036050.1 protein_id gnl|my_center|LOCUS_09090 13335 11761 gene locus_tag LOCUS_09100 13335 11761 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_09100 14821 13343 gene locus_tag LOCUS_09110 14821 13343 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803769.1 protein_id gnl|my_center|LOCUS_09110 15316 14921 gene locus_tag LOCUS_09120 15316 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15359 15520 gene locus_tag LOCUS_09130 15359 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 17942 15666 gene locus_tag LOCUS_09140 gene acn 17942 15666 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_09140 19005 18370 gene locus_tag LOCUS_09150 19005 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 20074 19016 gene locus_tag LOCUS_09160 20074 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 20884 20120 gene locus_tag LOCUS_09170 20884 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 20994 21752 gene locus_tag LOCUS_09180 20994 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 22043 23077 gene locus_tag LOCUS_09190 22043 23077 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_09190 23317 24126 gene locus_tag LOCUS_09200 23317 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 <25567 24277 gene locus_tag LOCUS_09210 <25567 24277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828556.1:methylmalonyl-CoA mutase >Feature sequence036 918 1547 gene locus_tag LOCUS_09220 918 1547 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692786.1 protein_id gnl|my_center|LOCUS_09220 1613 1969 gene locus_tag LOCUS_09230 1613 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1999 2646 gene locus_tag LOCUS_09240 1999 2646 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692786.1 protein_id gnl|my_center|LOCUS_09240 2865 3731 gene locus_tag LOCUS_09250 gene hybA 2865 3731 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_09250 4098 5063 gene locus_tag LOCUS_09260 4098 5063 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_09260 5090 6685 gene locus_tag LOCUS_09270 5090 6685 CDS product cytochrome-c3 hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_09270 6783 7265 gene locus_tag LOCUS_09280 6783 7265 CDS product HybD peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939205.1 protein_id gnl|my_center|LOCUS_09280 7284 7652 gene locus_tag LOCUS_09290 7284 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7662 7985 gene locus_tag LOCUS_09300 7662 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7960 9471 gene locus_tag LOCUS_09310 7960 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9479 9826 gene locus_tag LOCUS_09320 gene hypA 9479 9826 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675609.1 protein_id gnl|my_center|LOCUS_09320 10005 10847 gene locus_tag LOCUS_09330 10005 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 protein_id gnl|my_center|LOCUS_09330 11122 11844 gene locus_tag LOCUS_09340 11122 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 11844 14180 gene locus_tag LOCUS_09350 gene hypF 11844 14180 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 protein_id gnl|my_center|LOCUS_09350 14158 14445 gene locus_tag LOCUS_09360 14158 14445 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_09360 14456 15568 gene locus_tag LOCUS_09370 14456 15568 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_09370 15572 16645 gene locus_tag LOCUS_09380 gene hypE 15572 16645 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_09380 16639 17055 gene locus_tag LOCUS_09390 16639 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 17057 18154 gene locus_tag LOCUS_09400 17057 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728269.1 protein_id gnl|my_center|LOCUS_09400 18164 18784 gene locus_tag LOCUS_09410 18164 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 18785 19018 gene locus_tag LOCUS_09420 18785 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 19005 19562 gene locus_tag LOCUS_09430 19005 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_09430 19947 19612 gene locus_tag LOCUS_09440 19947 19612 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_09440 21572 20187 gene locus_tag LOCUS_09450 21572 20187 CDS product pyrroloquinoline-quinone glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_09450 22375 21632 gene locus_tag LOCUS_09460 22375 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 23580 22960 gene locus_tag LOCUS_09470 23580 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09470 24982 23603 gene locus_tag LOCUS_09480 24982 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence037 1684 422 gene locus_tag LOCUS_09490 gene nqrB 1684 422 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_09490 3312 1729 gene locus_tag LOCUS_09500 gene nqrA 3312 1729 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_09500 4167 3556 gene locus_tag LOCUS_09510 gene pnuT 4167 3556 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_09510 4267 5106 gene locus_tag LOCUS_09520 4267 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_09520 7755 5212 gene locus_tag LOCUS_09530 7755 5212 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_09530 8868 7894 gene locus_tag LOCUS_09540 8868 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10664 9621 gene locus_tag LOCUS_09550 10664 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 11313 11062 gene locus_tag LOCUS_09560 11313 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11788 11594 gene locus_tag LOCUS_09570 11788 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12284 13219 gene locus_tag LOCUS_09580 12284 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 16393 13595 gene locus_tag LOCUS_09590 16393 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 16913 17953 gene locus_tag LOCUS_09600 16913 17953 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104034.1 protein_id gnl|my_center|LOCUS_09600 18175 23097 gene locus_tag LOCUS_09610 18175 23097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 24126 23071 gene locus_tag LOCUS_09620 24126 23071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089044.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence038 3958 5 gene locus_tag LOCUS_09630 3958 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5377 4214 gene locus_tag LOCUS_09640 5377 4214 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_09640 5542 6021 gene locus_tag LOCUS_09650 5542 6021 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_09650 6987 6031 gene locus_tag LOCUS_09660 gene queG 6987 6031 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_09660 7129 10731 gene locus_tag LOCUS_09670 7129 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 10731 11108 gene locus_tag LOCUS_09680 10731 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 12607 11105 gene locus_tag LOCUS_09690 12607 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13157 12597 gene locus_tag LOCUS_09700 13157 12597 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_09700 13796 13278 gene locus_tag LOCUS_09710 13796 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 14220 15356 gene locus_tag LOCUS_09720 14220 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801181.1 protein_id gnl|my_center|LOCUS_09720 15596 18820 gene locus_tag LOCUS_09730 15596 18820 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_09730 18872 20335 gene locus_tag LOCUS_09740 18872 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_09740 20418 21521 gene locus_tag LOCUS_09750 20418 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 21526 22677 gene locus_tag LOCUS_09760 21526 22677 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_09760 22798 23457 gene locus_tag LOCUS_09770 22798 23457 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_09770 24035 23460 gene locus_tag LOCUS_09780 24035 23460 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067504.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence039 1575 976 gene locus_tag LOCUS_09790 1575 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2953 1631 gene locus_tag LOCUS_09800 gene xylE 2953 1631 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_09800 2886 3044 gene locus_tag LOCUS_09810 2886 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4198 3074 gene locus_tag LOCUS_09820 gene speA 4198 3074 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_09820 4680 5150 gene locus_tag LOCUS_09830 4680 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_09830 5875 5183 gene locus_tag LOCUS_09840 5875 5183 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V2 protein_id gnl|my_center|LOCUS_09840 6187 7332 gene locus_tag LOCUS_09850 6187 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861789.1 protein_id gnl|my_center|LOCUS_09850 7333 8442 gene locus_tag LOCUS_09860 7333 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 8516 10024 gene locus_tag LOCUS_09870 8516 10024 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_09870 11470 10076 gene locus_tag LOCUS_09880 11470 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 11925 15326 gene locus_tag LOCUS_09890 11925 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 15429 15617 gene locus_tag LOCUS_09900 15429 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 18266 15735 gene locus_tag LOCUS_09910 18266 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 18530 19777 gene locus_tag LOCUS_09920 18530 19777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 20597 21997 gene locus_tag LOCUS_09930 20597 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 23453 22146 gene locus_tag LOCUS_09940 23453 22146 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_09940 24303 23650 gene locus_tag LOCUS_09950 24303 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence040 2506 6228 gene locus_tag LOCUS_09960 2506 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8195 6849 gene locus_tag LOCUS_09970 8195 6849 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_09970 8368 12180 gene locus_tag LOCUS_09980 8368 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 12268 12567 gene locus_tag LOCUS_09990 12268 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 13264 12605 gene locus_tag LOCUS_10000 13264 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14769 13360 gene locus_tag LOCUS_10010 14769 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 15342 16040 gene locus_tag LOCUS_10020 15342 16040 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_10020 16159 17754 gene locus_tag LOCUS_10030 16159 17754 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_10030 19379 19071 gene locus_tag LOCUS_10040 19379 19071 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_10040 21488 19443 gene locus_tag LOCUS_10050 21488 19443 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_10050 22156 21584 gene locus_tag LOCUS_10060 gene purN 22156 21584 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_10060 23985 22432 gene locus_tag LOCUS_10070 23985 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence041 910 290 gene locus_tag LOCUS_10080 910 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1439 3061 gene locus_tag LOCUS_10090 1439 3061 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_10090 3065 4204 gene locus_tag LOCUS_10100 3065 4204 CDS product dimethylaniline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_10100 4337 5734 gene locus_tag LOCUS_10110 4337 5734 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_10110 5820 6440 gene locus_tag LOCUS_10120 5820 6440 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_10120 6444 7340 gene locus_tag LOCUS_10130 6444 7340 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_10130 7446 8570 gene locus_tag LOCUS_10140 7446 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10637 8613 gene locus_tag LOCUS_10150 10637 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 11064 10723 gene locus_tag LOCUS_10160 11064 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 15083 11241 gene locus_tag LOCUS_10170 15083 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 15698 15534 gene locus_tag LOCUS_10180 15698 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 16235 15723 gene locus_tag LOCUS_10190 16235 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 16365 17162 gene locus_tag LOCUS_10200 16365 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 17174 18568 gene locus_tag LOCUS_10210 17174 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 18920 19513 gene locus_tag LOCUS_10220 18920 19513 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_10220 20085 20627 gene locus_tag LOCUS_10230 20085 20627 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760954.1 protein_id gnl|my_center|LOCUS_10230 20701 21741 gene locus_tag LOCUS_10240 20701 21741 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 protein_id gnl|my_center|LOCUS_10240 21880 23469 gene locus_tag LOCUS_10250 21880 23469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 23610 24197 gene locus_tag LOCUS_10260 23610 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402939.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence042 1089 412 gene locus_tag LOCUS_10270 1089 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1325 2353 gene locus_tag LOCUS_10280 1325 2353 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_10280 2350 3066 gene locus_tag LOCUS_10290 2350 3066 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_10290 4061 3150 gene locus_tag LOCUS_10300 4061 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4687 4082 gene locus_tag LOCUS_10310 4687 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_10310 5710 4817 gene locus_tag LOCUS_10320 5710 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6327 5776 gene locus_tag LOCUS_10330 6327 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_10330 6459 6845 gene locus_tag LOCUS_10340 6459 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6968 8170 gene locus_tag LOCUS_10350 6968 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 8220 9587 gene locus_tag LOCUS_10360 8220 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9675 10229 gene locus_tag LOCUS_10370 9675 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_10370 13525 10376 gene locus_tag LOCUS_10380 13525 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 14238 13957 gene locus_tag LOCUS_10390 14238 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15581 14238 gene locus_tag LOCUS_10400 15581 14238 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_10400 16259 16023 gene locus_tag LOCUS_10410 16259 16023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 16521 17150 gene locus_tag LOCUS_10420 16521 17150 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417082.1 protein_id gnl|my_center|LOCUS_10420 17378 17154 gene locus_tag LOCUS_10430 17378 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 18418 17381 gene locus_tag LOCUS_10440 18418 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 19662 18466 gene locus_tag LOCUS_10450 19662 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 20195 21127 gene locus_tag LOCUS_10460 20195 21127 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_10460 21233 22411 gene locus_tag LOCUS_10470 21233 22411 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0T6 protein_id gnl|my_center|LOCUS_10470 22416 23255 gene locus_tag LOCUS_10480 22416 23255 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875617.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence043 <1 1582 gene locus_tag LOCUS_10490 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator 2245 3594 gene locus_tag LOCUS_10500 2245 3594 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_10500 5329 3848 gene locus_tag LOCUS_10510 5329 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5652 6194 gene locus_tag LOCUS_10520 5652 6194 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_10520 6178 6930 gene locus_tag LOCUS_10530 6178 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 6967 7740 gene locus_tag LOCUS_10540 6967 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7781 8605 gene locus_tag LOCUS_10550 7781 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 9204 8713 gene locus_tag LOCUS_10560 9204 8713 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797917.1 protein_id gnl|my_center|LOCUS_10560 10774 9215 gene locus_tag LOCUS_10570 10774 9215 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_10570 12100 10967 gene locus_tag LOCUS_10580 gene yhdB 12100 10967 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CHK4 protein_id gnl|my_center|LOCUS_10580 12247 12972 gene locus_tag LOCUS_10590 gene truC 12247 12972 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD4 protein_id gnl|my_center|LOCUS_10590 13013 13369 gene locus_tag LOCUS_10600 13013 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_10600 13503 14540 gene locus_tag LOCUS_10610 gene fjo30 13503 14540 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_10610 14692 20700 gene locus_tag LOCUS_10620 14692 20700 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_10620 20852 21574 gene locus_tag LOCUS_10630 20852 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 22344 21619 gene locus_tag LOCUS_10640 gene truB 22344 21619 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_10640 23193 22399 gene locus_tag LOCUS_10650 gene uppP 23193 22399 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_10650 23622 23206 gene locus_tag LOCUS_10660 23622 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence044 1332 829 gene locus_tag LOCUS_10670 1332 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1624 3216 gene locus_tag LOCUS_10680 1624 3216 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_10680 4392 3265 gene locus_tag LOCUS_10690 4392 3265 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_10690 5883 4429 gene locus_tag LOCUS_10700 gene mocR 5883 4429 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_10700 5965 6621 gene locus_tag LOCUS_10710 5965 6621 CDS product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530752.1 protein_id gnl|my_center|LOCUS_10710 7095 7670 gene locus_tag LOCUS_10720 gene adk 7095 7670 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_10720 7674 8672 gene locus_tag LOCUS_10730 gene obg 7674 8672 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_10730 8765 10216 gene locus_tag LOCUS_10740 8765 10216 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_10740 13908 10213 gene locus_tag LOCUS_10750 13908 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 21784 14051 gene locus_tag LOCUS_10760 21784 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 22604 22530 gene locus_tag LOCUS_t00050 22604 22530 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 22775 23683 gene locus_tag LOCUS_10770 gene natA 22775 23683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence045 2083 305 gene locus_tag LOCUS_10780 2083 305 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_10780 2470 3993 gene locus_tag LOCUS_10790 gene rpoN 2470 3993 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_10790 5172 3988 gene locus_tag LOCUS_10800 gene argD 5172 3988 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_10800 7281 5173 gene locus_tag LOCUS_10810 7281 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8760 7435 gene locus_tag LOCUS_10820 gene bfmBB 8760 7435 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_10820 10243 8978 gene locus_tag LOCUS_10830 10243 8978 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_10830 11035 10274 gene locus_tag LOCUS_10840 11035 10274 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108184.1 protein_id gnl|my_center|LOCUS_10840 11153 11539 gene locus_tag LOCUS_10850 gene rsfS 11153 11539 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_10850 11693 13651 gene locus_tag LOCUS_10860 gene ftsH 11693 13651 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_10860 13869 14315 gene locus_tag LOCUS_10870 13869 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 15217 14330 gene locus_tag LOCUS_10880 15217 14330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_10880 15528 15998 gene locus_tag LOCUS_10890 15528 15998 CDS product anti-oxidant AhpCTSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404264.1 protein_id gnl|my_center|LOCUS_10890 16029 16334 gene locus_tag LOCUS_10900 16029 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16359 17096 gene locus_tag LOCUS_10910 gene aat 16359 17096 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M1 protein_id gnl|my_center|LOCUS_10910 17204 17653 gene locus_tag LOCUS_10920 17204 17653 CDS product riboflavin-specific deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_10920 18123 19835 gene locus_tag LOCUS_10930 18123 19835 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_10930 19973 20194 gene locus_tag LOCUS_10940 19973 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 20379 21554 gene locus_tag LOCUS_10950 20379 21554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 21830 22300 gene locus_tag LOCUS_10960 21830 22300 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence046 2328 514 gene locus_tag LOCUS_10970 gene uvrC 2328 514 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_10970 2529 2981 gene locus_tag LOCUS_10980 2529 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4565 3168 gene locus_tag LOCUS_10990 4565 3168 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_10990 5960 4701 gene locus_tag LOCUS_11000 5960 4701 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_11000 7838 6075 gene locus_tag LOCUS_11010 7838 6075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_11010 8787 8254 gene locus_tag LOCUS_11020 8787 8254 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_11020 9281 10150 gene locus_tag LOCUS_11030 gene xerC 9281 10150 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_11030 11209 10163 gene locus_tag LOCUS_11040 11209 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_11040 11760 13004 gene locus_tag LOCUS_11050 11760 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 13189 13887 gene locus_tag LOCUS_11060 13189 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 14119 16089 gene locus_tag LOCUS_11070 14119 16089 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_11070 16189 17046 gene locus_tag LOCUS_11080 16189 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760774.1 protein_id gnl|my_center|LOCUS_11080 17088 18449 gene locus_tag LOCUS_11090 17088 18449 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_11090 19812 18502 gene locus_tag LOCUS_11100 19812 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 20712 19846 gene locus_tag LOCUS_11110 20712 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence047 2126 3715 gene locus_tag LOCUS_11120 2126 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3952 4206 gene locus_tag LOCUS_11130 3952 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5020 4274 gene locus_tag LOCUS_11140 5020 4274 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_11140 7336 5315 gene locus_tag LOCUS_11150 7336 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10252 7394 gene locus_tag LOCUS_11160 10252 7394 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_11160 10543 11064 gene locus_tag LOCUS_11170 gene blc 10543 11064 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 protein_id gnl|my_center|LOCUS_11170 11148 12182 gene locus_tag LOCUS_11180 11148 12182 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_11180 12184 13473 gene locus_tag LOCUS_11190 12184 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 13548 13715 gene locus_tag LOCUS_11200 13548 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 14396 13788 gene locus_tag LOCUS_11210 14396 13788 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_11210 14987 14430 gene locus_tag LOCUS_11220 14987 14430 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_11220 16426 14996 gene locus_tag LOCUS_11230 16426 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 18153 16675 gene locus_tag LOCUS_11240 18153 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 19992 18334 gene locus_tag LOCUS_11250 19992 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 20696 20121 gene locus_tag LOCUS_11260 20696 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 20935 20747 gene locus_tag LOCUS_11270 20935 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 21230 21063 gene locus_tag LOCUS_11280 21230 21063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence048 535 1200 gene locus_tag LOCUS_11290 535 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1901 1311 gene locus_tag LOCUS_11300 1901 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_11300 2176 1997 gene locus_tag LOCUS_11310 2176 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3791 2586 gene locus_tag LOCUS_11320 gene sucC 3791 2586 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_11320 9376 4034 gene locus_tag LOCUS_11330 9376 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 9896 11605 gene locus_tag LOCUS_11340 9896 11605 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_11340 11663 12802 gene locus_tag LOCUS_11350 11663 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 13530 14363 gene locus_tag LOCUS_11360 13530 14363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 14440 15168 gene locus_tag LOCUS_11370 14440 15168 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_11370 15237 15312 gene locus_tag LOCUS_t00060 15237 15312 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15807 16133 gene locus_tag LOCUS_11380 15807 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16509 16961 gene locus_tag LOCUS_11390 16509 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 17009 18370 gene locus_tag LOCUS_11400 17009 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 18434 19570 gene locus_tag LOCUS_11410 18434 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 19713 20879 gene locus_tag LOCUS_11420 19713 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 21294 20881 gene locus_tag LOCUS_11430 21294 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence049 1796 672 gene locus_tag LOCUS_11440 1796 672 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_11440 2974 1841 gene locus_tag LOCUS_11450 gene smf 2974 1841 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_11450 3095 3574 gene locus_tag LOCUS_11460 3095 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3865 5043 gene locus_tag LOCUS_11470 3865 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6293 5139 gene locus_tag LOCUS_11480 6293 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6806 6453 gene locus_tag LOCUS_11490 6806 6453 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEA9 protein_id gnl|my_center|LOCUS_11490 7815 6994 gene locus_tag LOCUS_11500 7815 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 9153 8221 gene locus_tag LOCUS_11510 9153 8221 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_11510 10549 9302 gene locus_tag LOCUS_11520 10549 9302 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_11520 12696 10783 gene locus_tag LOCUS_11530 12696 10783 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_11530 14893 12842 gene locus_tag LOCUS_11540 14893 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14974 15573 gene locus_tag LOCUS_11550 14974 15573 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119068.1 protein_id gnl|my_center|LOCUS_11550 16579 15680 gene locus_tag LOCUS_11560 16579 15680 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_11560 16884 17609 gene locus_tag LOCUS_11570 16884 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 17634 17897 gene locus_tag LOCUS_11580 17634 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 18054 18254 gene locus_tag LOCUS_11590 18054 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 18263 18712 gene locus_tag LOCUS_11600 18263 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 18845 19720 gene locus_tag LOCUS_11610 18845 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 <21768 19810 gene locus_tag LOCUS_11620 <21768 19810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence050 <1 949 gene locus_tag LOCUS_11630 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209166.1:ATP-binding protein 930 2102 gene locus_tag LOCUS_11640 930 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2106 2906 gene locus_tag LOCUS_11650 2106 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2928 3329 gene locus_tag LOCUS_11660 2928 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5063 3297 gene locus_tag LOCUS_11670 5063 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5762 6676 gene locus_tag LOCUS_11680 gene gldA 5762 6676 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_11680 6681 7364 gene locus_tag LOCUS_11690 6681 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7377 8108 gene locus_tag LOCUS_11700 gene gldF 7377 8108 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_11700 8136 9878 gene locus_tag LOCUS_11710 gene gldG 8136 9878 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_11710 9977 10927 gene locus_tag LOCUS_11720 9977 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 10979 12196 gene locus_tag LOCUS_11730 10979 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12469 13365 gene locus_tag LOCUS_11740 12469 13365 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_11740 13378 14151 gene locus_tag LOCUS_11750 13378 14151 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_11750 14250 15509 gene locus_tag LOCUS_11760 gene putA 14250 15509 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence051 2394 196 gene locus_tag LOCUS_11770 2394 196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_11770 2667 5846 gene locus_tag LOCUS_11780 2667 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6793 6065 gene locus_tag LOCUS_11790 gene cpdA 6793 6065 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0J3 protein_id gnl|my_center|LOCUS_11790 7385 6930 gene locus_tag LOCUS_11800 7385 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_11800 8376 7480 gene locus_tag LOCUS_11810 8376 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_11810 10705 8429 gene locus_tag LOCUS_11820 10705 8429 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_11820 13759 10982 gene locus_tag LOCUS_11830 13759 10982 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_11830 14608 13853 gene locus_tag LOCUS_11840 14608 13853 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_11840 14781 16205 gene locus_tag LOCUS_11850 14781 16205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 16216 16917 gene locus_tag LOCUS_11860 16216 16917 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_11860 17760 17071 gene locus_tag LOCUS_11870 17760 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 18129 17821 gene locus_tag LOCUS_11880 18129 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 20351 18240 gene locus_tag LOCUS_11890 gene recG 20351 18240 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_11890 <21340 20403 gene locus_tag LOCUS_11900 <21340 20403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JMH5:mannose-6-phosphate isomerase >Feature sequence052 2586 100 gene locus_tag LOCUS_11910 2586 100 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_11910 2879 4996 gene locus_tag LOCUS_11920 gene metG 2879 4996 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_11920 5229 6947 gene locus_tag LOCUS_11930 gene lnt 5229 6947 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_11930 8605 7052 gene locus_tag LOCUS_11940 gene porX 8605 7052 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_11940 8791 10026 gene locus_tag LOCUS_11950 8791 10026 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_11950 10142 11329 gene locus_tag LOCUS_11960 10142 11329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_11960 11481 11777 gene locus_tag LOCUS_11970 11481 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 11802 12665 gene locus_tag LOCUS_11980 11802 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 13079 13801 gene locus_tag LOCUS_11990 13079 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 14036 13821 gene locus_tag LOCUS_12000 14036 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 13987 14697 gene locus_tag LOCUS_12010 gene purQ 13987 14697 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU4 protein_id gnl|my_center|LOCUS_12010 14901 15299 gene locus_tag LOCUS_12020 14901 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15680 18256 gene locus_tag LOCUS_12030 15680 18256 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_12030 18409 19785 gene locus_tag LOCUS_12040 18409 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 20324 19854 gene locus_tag LOCUS_12050 gene pycA 20324 19854 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_12050 20665 20429 gene locus_tag LOCUS_12060 20665 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence053 <1 1495 gene locus_tag LOCUS_12070 <1 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976285.1:gamma-glutamyltranspeptidase 2195 1599 gene locus_tag LOCUS_12080 gene aqpZ 2195 1599 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4S2 protein_id gnl|my_center|LOCUS_12080 3205 2462 gene locus_tag LOCUS_12090 3205 2462 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_12090 4268 3198 gene locus_tag LOCUS_12100 4268 3198 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_12100 5202 4399 gene locus_tag LOCUS_12110 5202 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7542 5221 gene locus_tag LOCUS_12120 7542 5221 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_12120 8506 7691 gene locus_tag LOCUS_12130 8506 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 11244 8524 gene locus_tag LOCUS_12140 11244 8524 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_12140 12773 11415 gene locus_tag LOCUS_12150 12773 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 13046 12855 gene locus_tag LOCUS_12160 13046 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13663 13271 gene locus_tag LOCUS_12170 13663 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 14398 13670 gene locus_tag LOCUS_12180 14398 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 14827 16461 gene locus_tag LOCUS_12190 14827 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 16616 18046 gene locus_tag LOCUS_12200 16616 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 18339 18722 gene locus_tag LOCUS_12210 18339 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 19411 18953 gene locus_tag LOCUS_12220 19411 18953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 <20889 19581 gene locus_tag LOCUS_12230 <20889 19581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640554.1:Xaa-Pro dipeptidase >Feature sequence054 1482 88 gene locus_tag LOCUS_12240 gene mnmE 1482 88 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_12240 1784 1536 gene locus_tag LOCUS_12250 1784 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1944 2828 gene locus_tag LOCUS_12260 1944 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_12260 2868 4199 gene locus_tag LOCUS_12270 2868 4199 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_12270 4314 5156 gene locus_tag LOCUS_12280 4314 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5167 6078 gene locus_tag LOCUS_12290 5167 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6232 8451 gene locus_tag LOCUS_12300 6232 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8456 9373 gene locus_tag LOCUS_12310 8456 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9381 9605 gene locus_tag LOCUS_12320 9381 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9804 10478 gene locus_tag LOCUS_12330 9804 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12921 10558 gene locus_tag LOCUS_12340 12921 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 14460 13063 gene locus_tag LOCUS_12350 14460 13063 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_12350 14925 16034 gene locus_tag LOCUS_12360 gene mtnA 14925 16034 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULQ4 protein_id gnl|my_center|LOCUS_12360 17278 16286 gene locus_tag LOCUS_12370 17278 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 19140 17275 gene locus_tag LOCUS_12380 19140 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 19863 19459 gene locus_tag LOCUS_12390 19863 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 20496 20131 gene locus_tag LOCUS_12400 20496 20131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence055 171 1520 gene locus_tag LOCUS_12410 gene murC 171 1520 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_12410 1564 2340 gene locus_tag LOCUS_12420 1564 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2516 3844 gene locus_tag LOCUS_12430 gene ftsA 2516 3844 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_12430 4092 5573 gene locus_tag LOCUS_12440 4092 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6257 6529 gene locus_tag LOCUS_12450 6257 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 6930 8741 gene locus_tag LOCUS_12460 6930 8741 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_12460 9128 10552 gene locus_tag LOCUS_12470 9128 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10659 11618 gene locus_tag LOCUS_12480 10659 11618 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253092.1 protein_id gnl|my_center|LOCUS_12480 13143 11716 gene locus_tag LOCUS_12490 13143 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 14265 13258 gene locus_tag LOCUS_12500 gene tsaD 14265 13258 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_12500 14517 15104 gene locus_tag LOCUS_12510 14517 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_12510 15092 15949 gene locus_tag LOCUS_12520 15092 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_12520 19405 16331 gene locus_tag LOCUS_12530 19405 16331 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence056 381 133 gene locus_tag LOCUS_12540 381 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1282 482 gene locus_tag LOCUS_12550 1282 482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_12550 2259 1279 gene locus_tag LOCUS_12560 2259 1279 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_12560 2621 3886 gene locus_tag LOCUS_12570 2621 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4325 5161 gene locus_tag LOCUS_12580 4325 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5225 5884 gene locus_tag LOCUS_12590 5225 5884 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_12590 6148 7566 gene locus_tag LOCUS_12600 6148 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 7566 8450 gene locus_tag LOCUS_12610 gene nadK 7566 8450 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_12610 8808 8485 gene locus_tag LOCUS_12620 8808 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 9479 8979 gene locus_tag LOCUS_12630 9479 8979 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_12630 10375 11766 gene locus_tag LOCUS_12640 10375 11766 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_12640 12168 13049 gene locus_tag LOCUS_12650 12168 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 14706 13054 gene locus_tag LOCUS_12660 14706 13054 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_12660 15945 14947 gene locus_tag LOCUS_12670 15945 14947 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_12670 17125 16067 gene locus_tag LOCUS_12680 gene thiL 17125 16067 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6J9 protein_id gnl|my_center|LOCUS_12680 20217 17290 gene locus_tag LOCUS_12690 20217 17290 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence057 744 10 gene locus_tag LOCUS_12700 gene ptmA 744 10 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_12700 1741 818 gene locus_tag LOCUS_12710 1741 818 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_12710 2454 1738 gene locus_tag LOCUS_12720 gene legF 2454 1738 CDS product CMP-N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8S7 protein_id gnl|my_center|LOCUS_12720 3506 2451 gene locus_tag LOCUS_12730 3506 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4611 3490 gene locus_tag LOCUS_12740 4611 3490 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_12740 5609 4593 gene locus_tag LOCUS_12750 gene spsE 5609 4593 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_12750 6252 5602 gene locus_tag LOCUS_12760 6252 5602 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516588.1 protein_id gnl|my_center|LOCUS_12760 7393 6245 gene locus_tag LOCUS_12770 7393 6245 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_12770 9491 7500 gene locus_tag LOCUS_12780 9491 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 13307 9624 gene locus_tag LOCUS_12790 gene metH 13307 9624 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_12790 13840 15141 gene locus_tag LOCUS_12800 13840 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 15503 16111 gene locus_tag LOCUS_12810 gene cysC 15503 16111 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_12810 16123 17025 gene locus_tag LOCUS_12820 gene cysD 16123 17025 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_12820 17067 18323 gene locus_tag LOCUS_12830 gene cysN 17067 18323 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_12830 19440 18412 gene locus_tag LOCUS_12840 19440 18412 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence058 314 895 gene locus_tag LOCUS_12850 314 895 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ03 protein_id gnl|my_center|LOCUS_12850 903 1550 gene locus_tag LOCUS_12860 903 1550 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_12860 1668 2453 gene locus_tag LOCUS_12870 1668 2453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_12870 2562 4133 gene locus_tag LOCUS_12880 2562 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 protein_id gnl|my_center|LOCUS_12880 4253 5563 gene locus_tag LOCUS_12890 gene ahcY 4253 5563 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_12890 5881 5657 gene locus_tag LOCUS_12900 5881 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 6065 6676 gene locus_tag LOCUS_12910 6065 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_12910 6907 7401 gene locus_tag LOCUS_12920 6907 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 7414 7665 gene locus_tag LOCUS_12930 7414 7665 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL10 protein_id gnl|my_center|LOCUS_12930 7655 8629 gene locus_tag LOCUS_12940 gene hemB 7655 8629 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_12940 9368 8787 gene locus_tag LOCUS_12950 9368 8787 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_12950 9926 12778 gene locus_tag LOCUS_12960 gene uvrA1 9926 12778 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_12960 14019 12832 gene locus_tag LOCUS_12970 gene mauG 14019 12832 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_12970 14247 14993 gene locus_tag LOCUS_12980 14247 14993 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_12980 15311 18451 gene locus_tag LOCUS_12990 15311 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence059 2168 516 gene locus_tag LOCUS_13000 2168 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2938 8442 gene locus_tag LOCUS_13010 2938 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 8471 9526 gene locus_tag LOCUS_13020 8471 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10910 9657 gene locus_tag LOCUS_13030 10910 9657 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_13030 11100 11693 gene locus_tag LOCUS_13040 11100 11693 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13040 11705 12115 gene locus_tag LOCUS_13050 11705 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 12437 13165 gene locus_tag LOCUS_13060 12437 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14536 13235 gene locus_tag LOCUS_13070 14536 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_13070 15116 14619 gene locus_tag LOCUS_13080 15116 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 15678 15154 gene locus_tag LOCUS_13090 15678 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 15993 16712 gene locus_tag LOCUS_13100 15993 16712 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_13100 16828 17331 gene locus_tag LOCUS_13110 16828 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence060 <1 1824 gene locus_tag LOCUS_13120 <1 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 2047 2496 gene locus_tag LOCUS_13130 2047 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2874 3956 gene locus_tag LOCUS_13140 2874 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4009 4938 gene locus_tag LOCUS_13150 4009 4938 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_13150 4970 5638 gene locus_tag LOCUS_13160 4970 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 5988 8807 gene locus_tag LOCUS_13170 gene dnaB 5988 8807 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59966 protein_id gnl|my_center|LOCUS_13170 8948 8715 gene locus_tag LOCUS_13180 8948 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 8947 9654 gene locus_tag LOCUS_13190 gene clpP 8947 9654 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_13190 9815 11065 gene locus_tag LOCUS_13200 gene clpX 9815 11065 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_13200 11153 11923 gene locus_tag LOCUS_13210 gene truA 11153 11923 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_13210 12814 11915 gene locus_tag LOCUS_13220 12814 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 13536 13766 gene locus_tag LOCUS_13230 13536 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 13767 14303 gene locus_tag LOCUS_13240 13767 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 14354 14680 gene locus_tag LOCUS_13250 14354 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 14750 14989 gene locus_tag LOCUS_13260 14750 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13260 16396 15110 gene locus_tag LOCUS_13270 gene glyA 16396 15110 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_13270 16750 18306 gene locus_tag LOCUS_13280 16750 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 18636 19610 gene locus_tag LOCUS_13290 18636 19610 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence061 629 2347 gene locus_tag LOCUS_13300 629 2347 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_13300 2379 3092 gene locus_tag LOCUS_13310 2379 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3640 3146 gene locus_tag LOCUS_13320 3640 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3854 3780 gene locus_tag LOCUS_t00070 3854 3780 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4846 3965 gene locus_tag LOCUS_13330 4846 3965 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_13330 5671 5126 gene locus_tag LOCUS_13340 5671 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7364 5790 gene locus_tag LOCUS_13350 7364 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 8716 7682 gene locus_tag LOCUS_13360 8716 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9491 8823 gene locus_tag LOCUS_13370 9491 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 10775 9609 gene locus_tag LOCUS_13380 10775 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 10982 11698 gene locus_tag LOCUS_13390 10982 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 11698 12609 gene locus_tag LOCUS_13400 11698 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 12596 13729 gene locus_tag LOCUS_13410 12596 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 13743 15005 gene locus_tag LOCUS_13420 13743 15005 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_13420 15083 15499 gene locus_tag LOCUS_13430 15083 15499 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13430 15486 16481 gene locus_tag LOCUS_13440 gene yfkH 15486 16481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_13440 17163 16633 gene locus_tag LOCUS_13450 17163 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 17421 18947 gene locus_tag LOCUS_13460 17421 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence062 1907 861 gene locus_tag LOCUS_13470 gene hisC 1907 861 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_13470 3193 1910 gene locus_tag LOCUS_13480 gene hisD 3193 1910 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_13480 4248 3388 gene locus_tag LOCUS_13490 gene hisG 4248 3388 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_13490 4490 4417 gene locus_tag LOCUS_t00080 4490 4417 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4871 5734 gene locus_tag LOCUS_13500 4871 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 8698 5891 gene locus_tag LOCUS_13510 gene acnB 8698 5891 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_13510 10146 8908 gene locus_tag LOCUS_13520 10146 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 12541 10196 gene locus_tag LOCUS_13530 12541 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 13007 12567 gene locus_tag LOCUS_13540 13007 12567 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_13540 13358 14305 gene locus_tag LOCUS_13550 13358 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 14545 14991 gene locus_tag LOCUS_13560 14545 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 15838 15092 gene locus_tag LOCUS_13570 gene nnrE 15838 15092 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX4 protein_id gnl|my_center|LOCUS_13570 16646 16209 gene locus_tag LOCUS_13580 16646 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_13580 17787 16708 gene locus_tag LOCUS_13590 17787 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 19139 18126 gene locus_tag LOCUS_13600 19139 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107601.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence063 2597 4057 gene locus_tag LOCUS_13610 2597 4057 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759762.1 protein_id gnl|my_center|LOCUS_13610 4355 5434 gene locus_tag LOCUS_13620 4355 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5406 5969 gene locus_tag LOCUS_13630 5406 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 6982 5966 gene locus_tag LOCUS_13640 gene murB 6982 5966 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_13640 7545 6994 gene locus_tag LOCUS_13650 7545 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 9354 7549 gene locus_tag LOCUS_13660 9354 7549 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_13660 9898 10692 gene locus_tag LOCUS_13670 9898 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 11058 11504 gene locus_tag LOCUS_13680 11058 11504 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_13680 11846 14059 gene locus_tag LOCUS_13690 11846 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence064 1001 99 gene locus_tag LOCUS_13700 1001 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3651 1336 gene locus_tag LOCUS_13710 3651 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7510 3788 gene locus_tag LOCUS_13720 7510 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 9526 8684 gene locus_tag LOCUS_13730 9526 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9802 9596 gene locus_tag LOCUS_13740 9802 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 11029 10109 gene locus_tag LOCUS_13750 11029 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 12738 11404 gene locus_tag LOCUS_13760 12738 11404 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_13760 13204 14241 gene locus_tag LOCUS_13770 13204 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_13770 14254 15405 gene locus_tag LOCUS_13780 gene porY 14254 15405 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_13780 15633 18173 gene locus_tag LOCUS_13790 15633 18173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_13790 <19375 18234 gene locus_tag LOCUS_13800 <19375 18234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962828.1:ABC transporter permease >Feature sequence065 1024 44 gene locus_tag LOCUS_13810 1024 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1567 1025 gene locus_tag LOCUS_13820 1567 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3304 1871 gene locus_tag LOCUS_13830 3304 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_13830 4826 3312 gene locus_tag LOCUS_13840 4826 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5681 6394 gene locus_tag LOCUS_13850 5681 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7043 6402 gene locus_tag LOCUS_13860 7043 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10422 7240 gene locus_tag LOCUS_13870 10422 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_13870 14147 10566 gene locus_tag LOCUS_13880 14147 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 15130 14594 gene locus_tag LOCUS_13890 gene msrB 15130 14594 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_13890 15591 15130 gene locus_tag LOCUS_13900 15591 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 15649 17598 gene locus_tag LOCUS_13910 15649 17598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 17768 17595 gene locus_tag LOCUS_13920 17768 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence066 287 838 gene locus_tag LOCUS_13930 287 838 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_13930 843 1136 gene locus_tag LOCUS_13940 843 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1159 1995 gene locus_tag LOCUS_13950 1159 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_13950 2135 3103 gene locus_tag LOCUS_13960 2135 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_13960 3261 6065 gene locus_tag LOCUS_13970 gene polA 3261 6065 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_13970 6480 6136 gene locus_tag LOCUS_13980 6480 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6508 7494 gene locus_tag LOCUS_13990 6508 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_13990 7657 8043 gene locus_tag LOCUS_14000 7657 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_14000 10668 8107 gene locus_tag LOCUS_14010 10668 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10849 12150 gene locus_tag LOCUS_14020 gene pepP 10849 12150 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_14020 12478 14034 gene locus_tag LOCUS_14030 12478 14034 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_14030 15006 15770 gene locus_tag LOCUS_14040 15006 15770 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_14040 15777 16217 gene locus_tag LOCUS_14050 15777 16217 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979180.1 protein_id gnl|my_center|LOCUS_14050 16278 17090 gene locus_tag LOCUS_14060 16278 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 17326 17138 gene locus_tag LOCUS_14070 17326 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 18908 17508 gene locus_tag LOCUS_14080 18908 17508 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117895.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence067 1653 3038 gene locus_tag LOCUS_14090 1653 3038 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_14090 3543 3073 gene locus_tag LOCUS_14100 3543 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_14100 4057 4848 gene locus_tag LOCUS_14110 4057 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5741 5475 gene locus_tag LOCUS_14120 5741 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5622 7667 gene locus_tag LOCUS_14130 5622 7667 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_14130 8873 7824 gene locus_tag LOCUS_14140 gene lysl 8873 7824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_14140 9647 8874 gene locus_tag LOCUS_14150 9647 8874 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729009.1 protein_id gnl|my_center|LOCUS_14150 11540 9717 gene locus_tag LOCUS_14160 gene fadD 11540 9717 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_14160 12578 11604 gene locus_tag LOCUS_14170 12578 11604 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_14170 12821 13678 gene locus_tag LOCUS_14180 12821 13678 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 protein_id gnl|my_center|LOCUS_14180 14840 13713 gene locus_tag LOCUS_14190 14840 13713 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_14190 16348 14849 gene locus_tag LOCUS_14200 16348 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 17023 16697 gene locus_tag LOCUS_14210 gene sufA 17023 16697 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_14210 18389 17184 gene locus_tag LOCUS_14220 gene iscS 18389 17184 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_14220 >Feature sequence068 566 1390 gene locus_tag LOCUS_14230 gene mntB 566 1390 CDS product manganese transport system ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34338 protein_id gnl|my_center|LOCUS_14230 1472 2761 gene locus_tag LOCUS_14240 gene mntB 1472 2761 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_14240 2761 3630 gene locus_tag LOCUS_14250 gene mntD 2761 3630 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_14250 3752 6034 gene locus_tag LOCUS_14260 3752 6034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_14260 6034 6507 gene locus_tag LOCUS_14270 6034 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6731 6949 gene locus_tag LOCUS_14280 6731 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 10152 7039 gene locus_tag LOCUS_14290 10152 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 11004 10237 gene locus_tag LOCUS_14300 11004 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 11471 13216 gene locus_tag LOCUS_14310 11471 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 13754 14635 gene locus_tag LOCUS_14320 13754 14635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_14320 15020 16264 gene locus_tag LOCUS_14330 15020 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 16657 17265 gene locus_tag LOCUS_14340 gene gldL 16657 17265 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence069 7097 2340 gene locus_tag LOCUS_14350 7097 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7363 10635 gene locus_tag LOCUS_14360 7363 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 10724 11227 gene locus_tag LOCUS_14370 gene kdsC 10724 11227 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_14370 11235 12161 gene locus_tag LOCUS_14380 11235 12161 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_14380 12163 12735 gene locus_tag LOCUS_14390 12163 12735 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R56 protein_id gnl|my_center|LOCUS_14390 14192 12732 gene locus_tag LOCUS_14400 14192 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 15189 14293 gene locus_tag LOCUS_14410 15189 14293 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJY4 protein_id gnl|my_center|LOCUS_14410 >Feature sequence070 971 2347 gene locus_tag LOCUS_14420 gene atpB 971 2347 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_14420 2350 2580 gene locus_tag LOCUS_14430 2350 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2824 3237 gene locus_tag LOCUS_14440 gene atpF 2824 3237 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_14440 3299 3868 gene locus_tag LOCUS_14450 gene atpH 3299 3868 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA62 protein_id gnl|my_center|LOCUS_14450 3941 5548 gene locus_tag LOCUS_14460 gene atpA 3941 5548 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_14460 5638 6534 gene locus_tag LOCUS_14470 gene atpG 5638 6534 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_14470 7232 6651 gene locus_tag LOCUS_14480 7232 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7370 7522 gene locus_tag LOCUS_14490 7370 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8410 7616 gene locus_tag LOCUS_14500 8410 7616 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206941.1 protein_id gnl|my_center|LOCUS_14500 11560 8489 gene locus_tag LOCUS_14510 11560 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14510 14748 11926 gene locus_tag LOCUS_14520 14748 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 15727 16911 gene locus_tag LOCUS_14530 15727 16911 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_14530 16923 17513 gene locus_tag LOCUS_14540 16923 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence071 1251 232 gene locus_tag LOCUS_14550 gene asd 1251 232 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_14550 1451 4048 gene locus_tag LOCUS_14560 1451 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4851 5756 gene locus_tag LOCUS_14570 4851 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5728 6099 gene locus_tag LOCUS_14580 5728 6099 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460856.1 protein_id gnl|my_center|LOCUS_14580 6254 7726 gene locus_tag LOCUS_14590 6254 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7973 8368 gene locus_tag LOCUS_14600 7973 8368 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_14600 8371 9018 gene locus_tag LOCUS_14610 gene pcm 8371 9018 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_14610 9516 9040 gene locus_tag LOCUS_14620 9516 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 10245 9796 gene locus_tag LOCUS_14630 gene tadA 10245 9796 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_14630 10343 11827 gene locus_tag LOCUS_14640 gene guaB 10343 11827 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G2 protein_id gnl|my_center|LOCUS_14640 11842 12456 gene locus_tag LOCUS_14650 11842 12456 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z847 protein_id gnl|my_center|LOCUS_14650 12538 13812 gene locus_tag LOCUS_14660 12538 13812 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_14660 14044 15489 gene locus_tag LOCUS_14670 14044 15489 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_14670 15516 16910 gene locus_tag LOCUS_14680 15516 16910 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_14680 17058 17654 gene locus_tag LOCUS_14690 17058 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence072 2086 482 gene locus_tag LOCUS_14700 2086 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2302 3330 gene locus_tag LOCUS_14710 2302 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3346 4179 gene locus_tag LOCUS_14720 3346 4179 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_14720 5005 8328 gene locus_tag LOCUS_14730 5005 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 8977 8495 gene locus_tag LOCUS_14740 8977 8495 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964982.1 protein_id gnl|my_center|LOCUS_14740 9367 9053 gene locus_tag LOCUS_14750 9367 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108936.1 protein_id gnl|my_center|LOCUS_14750 9799 9380 gene locus_tag LOCUS_14760 gene sufE 9799 9380 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_14760 11056 9809 gene locus_tag LOCUS_14770 11056 9809 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_14770 12673 11336 gene locus_tag LOCUS_14780 gene sufD 12673 11336 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_14780 13513 12752 gene locus_tag LOCUS_14790 gene sufC 13513 12752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_14790 15014 13569 gene locus_tag LOCUS_14800 gene ycf24 15014 13569 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_14800 <18034 15369 gene locus_tag LOCUS_14810 <18034 15369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence073 428 2929 gene locus_tag LOCUS_14820 428 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945803.1 protein_id gnl|my_center|LOCUS_14820 2984 3946 gene locus_tag LOCUS_14830 2984 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4191 5879 gene locus_tag LOCUS_14840 4191 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 5974 7263 gene locus_tag LOCUS_14850 gene phrB3 5974 7263 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_14850 7921 7574 gene locus_tag LOCUS_14860 7921 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 11167 8156 gene locus_tag LOCUS_14870 11167 8156 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_14870 12473 11265 gene locus_tag LOCUS_14880 12473 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 14013 12487 gene locus_tag LOCUS_14890 14013 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 14269 14024 gene locus_tag LOCUS_14900 14269 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14740 14339 gene locus_tag LOCUS_14910 14740 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 15263 16690 gene locus_tag LOCUS_14920 gene panF 15263 16690 CDS product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence074 225 413 gene locus_tag LOCUS_14930 gene rpsU 225 413 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_14930 1131 469 gene locus_tag LOCUS_14940 1131 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3855 1264 gene locus_tag LOCUS_14950 3855 1264 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_14950 4744 3845 gene locus_tag LOCUS_14960 4744 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5281 4778 gene locus_tag LOCUS_14970 5281 4778 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_14970 5503 5781 gene locus_tag LOCUS_14980 5503 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5753 5893 gene locus_tag LOCUS_14990 5753 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6247 7056 gene locus_tag LOCUS_15000 6247 7056 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_15000 7345 8163 gene locus_tag LOCUS_15010 7345 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100707.1 protein_id gnl|my_center|LOCUS_15010 8237 9154 gene locus_tag LOCUS_15020 8237 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9689 9249 gene locus_tag LOCUS_15030 9689 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10177 9875 gene locus_tag LOCUS_15040 10177 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 10657 10319 gene locus_tag LOCUS_15050 10657 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 11294 10719 gene locus_tag LOCUS_15060 11294 10719 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096557.1 protein_id gnl|my_center|LOCUS_15060 11405 11626 gene locus_tag LOCUS_15070 11405 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 11853 12572 gene locus_tag LOCUS_15080 11853 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 12654 14633 gene locus_tag LOCUS_15090 12654 14633 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_15090 15959 14715 gene locus_tag LOCUS_15100 gene nqrF 15959 14715 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_15100 16742 16131 gene locus_tag LOCUS_15110 gene nqrE 16742 16131 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHJ7 protein_id gnl|my_center|LOCUS_15110 17497 16787 gene locus_tag LOCUS_15120 gene nqrD 17497 16787 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_15120 >Feature sequence075 145 2796 gene locus_tag LOCUS_15130 145 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3640 2804 gene locus_tag LOCUS_15140 3640 2804 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_15140 3821 4927 gene locus_tag LOCUS_15150 3821 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4961 5764 gene locus_tag LOCUS_15160 4961 5764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088988.1 protein_id gnl|my_center|LOCUS_15160 6681 5761 gene locus_tag LOCUS_15170 6681 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6982 8622 gene locus_tag LOCUS_15180 6982 8622 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_15180 8914 8684 gene locus_tag LOCUS_15190 8914 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 9989 8934 gene locus_tag LOCUS_15200 gene speB 9989 8934 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_15200 10069 11274 gene locus_tag LOCUS_15210 10069 11274 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_15210 11284 12426 gene locus_tag LOCUS_15220 11284 12426 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_15220 12423 13271 gene locus_tag LOCUS_15230 gene prmC 12423 13271 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_15230 13971 13273 gene locus_tag LOCUS_15240 13971 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 14555 13968 gene locus_tag LOCUS_15250 14555 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 15448 14633 gene locus_tag LOCUS_15260 15448 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 16610 15432 gene locus_tag LOCUS_15270 16610 15432 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_15270 17810 16749 gene locus_tag LOCUS_15280 17810 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence076 1265 183 gene locus_tag LOCUS_15290 1265 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_15290 1548 1276 gene locus_tag LOCUS_15300 1548 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2298 3332 gene locus_tag LOCUS_15310 2298 3332 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_15310 3626 4084 gene locus_tag LOCUS_15320 3626 4084 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_15320 6885 4120 gene locus_tag LOCUS_15330 gene sucA 6885 4120 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_15330 7874 7149 gene locus_tag LOCUS_15340 7874 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8100 8384 gene locus_tag LOCUS_15350 gene rpsT 8100 8384 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_15350 8520 9092 gene locus_tag LOCUS_15360 8520 9092 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_15360 9793 9548 gene locus_tag LOCUS_15370 9793 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15370 10054 9830 gene locus_tag LOCUS_15380 10054 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 11023 10385 gene locus_tag LOCUS_15390 gene rutB 11023 10385 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN79 protein_id gnl|my_center|LOCUS_15390 11169 12098 gene locus_tag LOCUS_15400 11169 12098 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404222.1 protein_id gnl|my_center|LOCUS_15400 12162 12779 gene locus_tag LOCUS_15410 12162 12779 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808283.1 protein_id gnl|my_center|LOCUS_15410 13126 15417 gene locus_tag LOCUS_15420 13126 15417 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785386.1 protein_id gnl|my_center|LOCUS_15420 15700 16458 gene locus_tag LOCUS_15430 gene mapB 15700 16458 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_15430 16558 16761 gene locus_tag LOCUS_15440 16558 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15440 16771 17052 gene locus_tag LOCUS_15450 16771 17052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 >Feature sequence077 3 209 gene locus_tag LOCUS_15460 3 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1389 271 gene locus_tag LOCUS_15470 gene lpxB 1389 271 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_15470 2589 1807 gene locus_tag LOCUS_15480 gene surE 2589 1807 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_15480 2900 3934 gene locus_tag LOCUS_15490 gene hemH 2900 3934 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FA4 protein_id gnl|my_center|LOCUS_15490 4410 5423 gene locus_tag LOCUS_15500 gene holA 4410 5423 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_15500 5638 9090 gene locus_tag LOCUS_15510 5638 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9343 10755 gene locus_tag LOCUS_15520 gene trpE 9343 10755 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_15520 10812 11423 gene locus_tag LOCUS_15530 10812 11423 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_15530 11434 12420 gene locus_tag LOCUS_15540 gene trpD 11434 12420 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD5 protein_id gnl|my_center|LOCUS_15540 12434 13249 gene locus_tag LOCUS_15550 gene trpC 12434 13249 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_15550 13264 13920 gene locus_tag LOCUS_15560 gene trpF 13264 13920 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX4 protein_id gnl|my_center|LOCUS_15560 13947 15131 gene locus_tag LOCUS_15570 gene trpB 13947 15131 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_15570 15143 15928 gene locus_tag LOCUS_15580 gene trpA 15143 15928 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_15580 15946 16962 gene locus_tag LOCUS_15590 gene aroF1 15946 16962 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_15590 <17795 17033 gene locus_tag LOCUS_15600 <17795 17033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A441:protein TonB >Feature sequence078 1535 3400 gene locus_tag LOCUS_15610 1535 3400 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 protein_id gnl|my_center|LOCUS_15610 3703 4407 gene locus_tag LOCUS_15620 3703 4407 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_15620 5413 4484 gene locus_tag LOCUS_15630 5413 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6180 5467 gene locus_tag LOCUS_15640 6180 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15640 6529 6173 gene locus_tag LOCUS_15650 6529 6173 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_15650 7240 6704 gene locus_tag LOCUS_15660 7240 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 8373 7402 gene locus_tag LOCUS_15670 8373 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10312 8807 gene locus_tag LOCUS_15680 10312 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 10869 10327 gene locus_tag LOCUS_15690 10869 10327 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_15690 12345 11089 gene locus_tag LOCUS_15700 12345 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 <17653 12607 gene locus_tag LOCUS_15710 <17653 12607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020394.1:cell surface protein >Feature sequence079 259 1038 gene locus_tag LOCUS_15720 259 1038 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_15720 2254 1136 gene locus_tag LOCUS_15730 2254 1136 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_15730 4502 2274 gene locus_tag LOCUS_15740 gene purL 4502 2274 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ77 protein_id gnl|my_center|LOCUS_15740 5217 4579 gene locus_tag LOCUS_15750 5217 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 5461 6300 gene locus_tag LOCUS_15760 5461 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 7410 6283 gene locus_tag LOCUS_15770 7410 6283 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_15770 7581 8978 gene locus_tag LOCUS_15780 7581 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8979 9806 gene locus_tag LOCUS_15790 8979 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 11825 9870 gene locus_tag LOCUS_15800 11825 9870 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_15800 13801 12026 gene locus_tag LOCUS_15810 13801 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 14795 13995 gene locus_tag LOCUS_15820 14795 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 15332 17593 gene locus_tag LOCUS_15830 15332 17593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence080 1769 1191 gene locus_tag LOCUS_15840 1769 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2306 3238 gene locus_tag LOCUS_15850 gene prsA 2306 3238 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_15850 3353 3943 gene locus_tag LOCUS_15860 gene rplY 3353 3943 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_15860 4154 4930 gene locus_tag LOCUS_15870 4154 4930 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_15870 5113 5709 gene locus_tag LOCUS_15880 5113 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8353 5828 gene locus_tag LOCUS_15890 8353 5828 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_15890 8778 8987 gene locus_tag LOCUS_15900 8778 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 9204 9521 gene locus_tag LOCUS_15910 9204 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 9687 9499 gene locus_tag LOCUS_15920 9687 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 10349 9807 gene locus_tag LOCUS_15930 10349 9807 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_15930 11700 10366 gene locus_tag LOCUS_15940 11700 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 11777 13579 gene locus_tag LOCUS_15950 11777 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 13700 17401 gene locus_tag LOCUS_15960 13700 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence081 4757 2163 gene locus_tag LOCUS_15970 4757 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 6065 4998 gene locus_tag LOCUS_15980 gene aroB 6065 4998 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_15980 6482 6168 gene locus_tag LOCUS_15990 gene fjo15 6482 6168 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_15990 7262 6486 gene locus_tag LOCUS_16000 7262 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404562.1 protein_id gnl|my_center|LOCUS_16000 7626 8639 gene locus_tag LOCUS_16010 7626 8639 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_16010 8648 8893 gene locus_tag LOCUS_16020 8648 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 8997 10238 gene locus_tag LOCUS_16030 gene aroA 8997 10238 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_16030 11542 10277 gene locus_tag LOCUS_16040 11542 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 11796 11939 gene locus_tag LOCUS_16050 11796 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 13152 11932 gene locus_tag LOCUS_16060 gene gcdH 13152 11932 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_16060 13668 14036 gene locus_tag LOCUS_16070 13668 14036 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PK9 protein_id gnl|my_center|LOCUS_16070 14213 14890 gene locus_tag LOCUS_16080 14213 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_16080 15038 16195 gene locus_tag LOCUS_16090 15038 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 16318 17076 gene locus_tag LOCUS_16100 gene coaX 16318 17076 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB4 protein_id gnl|my_center|LOCUS_16100 >Feature sequence082 675 601 gene locus_tag LOCUS_t00090 675 601 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1032 1397 gene locus_tag LOCUS_16110 1032 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_16110 2796 1441 gene locus_tag LOCUS_16120 2796 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4397 2865 gene locus_tag LOCUS_16130 4397 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4698 5924 gene locus_tag LOCUS_16140 4698 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6704 5943 gene locus_tag LOCUS_16150 6704 5943 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009628.1 protein_id gnl|my_center|LOCUS_16150 7430 6762 gene locus_tag LOCUS_16160 gene rsmI 7430 6762 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_16160 7697 7443 gene locus_tag LOCUS_16170 gene purS 7697 7443 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI1 protein_id gnl|my_center|LOCUS_16170 8356 7694 gene locus_tag LOCUS_16180 8356 7694 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_16180 8786 11692 gene locus_tag LOCUS_16190 8786 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 11758 11958 gene locus_tag LOCUS_16200 11758 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12198 11959 gene locus_tag LOCUS_16210 12198 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16210 12994 12572 gene locus_tag LOCUS_16220 12994 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13452 13643 gene locus_tag LOCUS_16230 13452 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 14288 17341 gene locus_tag LOCUS_16240 14288 17341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence083 146 562 gene locus_tag LOCUS_16250 146 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 958 1194 gene locus_tag LOCUS_16260 958 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4353 1303 gene locus_tag LOCUS_16270 4353 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5701 4604 gene locus_tag LOCUS_16280 5701 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_16280 5799 6920 gene locus_tag LOCUS_16290 5799 6920 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_16290 6925 7551 gene locus_tag LOCUS_16300 6925 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7671 10457 gene locus_tag LOCUS_16310 7671 10457 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_16310 11415 10531 gene locus_tag LOCUS_16320 11415 10531 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 protein_id gnl|my_center|LOCUS_16320 13781 11475 gene locus_tag LOCUS_16330 13781 11475 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_16330 15390 14308 gene locus_tag LOCUS_16340 15390 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_16340 15578 15937 gene locus_tag LOCUS_16350 15578 15937 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence084 175 2538 gene locus_tag LOCUS_16360 175 2538 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_16360 2557 3405 gene locus_tag LOCUS_16370 2557 3405 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_16370 3631 4530 gene locus_tag LOCUS_16380 3631 4530 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_16380 4531 5688 gene locus_tag LOCUS_16390 4531 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_16390 10939 5690 gene locus_tag LOCUS_16400 10939 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12011 11304 gene locus_tag LOCUS_16410 12011 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_16410 12492 13931 gene locus_tag LOCUS_16420 12492 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 14052 14834 gene locus_tag LOCUS_16430 14052 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 14846 15598 gene locus_tag LOCUS_16440 gene lptB 14846 15598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_16440 15585 15884 gene locus_tag LOCUS_16450 15585 15884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 15929 16222 gene locus_tag LOCUS_16460 15929 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 16789 16403 gene locus_tag LOCUS_16470 16789 16403 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence085 1 1536 gene locus_tag LOCUS_16480 1 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1604 2836 gene locus_tag LOCUS_16490 1604 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2895 4103 gene locus_tag LOCUS_16500 2895 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4088 5038 gene locus_tag LOCUS_16510 4088 5038 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_16510 5179 6327 gene locus_tag LOCUS_16520 5179 6327 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709647.1 protein_id gnl|my_center|LOCUS_16520 6375 9974 gene locus_tag LOCUS_16530 6375 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 12430 10088 gene locus_tag LOCUS_16540 gene pepN 12430 10088 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_16540 13537 12683 gene locus_tag LOCUS_16550 13537 12683 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_16550 14853 13669 gene locus_tag LOCUS_16560 14853 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 15211 15786 gene locus_tag LOCUS_16570 15211 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_16570 16232 16420 gene locus_tag LOCUS_16580 16232 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence086 2855 741 gene locus_tag LOCUS_16590 2855 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2949 4130 gene locus_tag LOCUS_16600 gene thrC 2949 4130 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_16600 4475 5071 gene locus_tag LOCUS_16610 4475 5071 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_16610 7668 5131 gene locus_tag LOCUS_16620 gene mrcA 7668 5131 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_16620 8012 8470 gene locus_tag LOCUS_16630 8012 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 10246 8381 gene locus_tag LOCUS_16640 gene mnmG 10246 8381 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_16640 10594 12012 gene locus_tag LOCUS_16650 10594 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_16650 12113 12916 gene locus_tag LOCUS_16660 12113 12916 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_16660 13969 12926 gene locus_tag LOCUS_16670 13969 12926 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_16670 14070 15170 gene locus_tag LOCUS_16680 gene paaE 14070 15170 CDS product phenylacetic acid degradation NADH oxidoreductase PaaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551026.1 protein_id gnl|my_center|LOCUS_16680 15552 16271 gene locus_tag LOCUS_16690 15552 16271 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence087 <1 1340 gene locus_tag LOCUS_16700 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74ED9:glycogen synthase 1 1468 4530 gene locus_tag LOCUS_16710 1468 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4871 4527 gene locus_tag LOCUS_16720 4871 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5265 5504 gene locus_tag LOCUS_16730 5265 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5655 5581 gene locus_tag LOCUS_t00100 5655 5581 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6086 7087 gene locus_tag LOCUS_16740 6086 7087 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_16740 7167 8369 gene locus_tag LOCUS_16750 gene pgk 7167 8369 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_16750 8526 10397 gene locus_tag LOCUS_16760 8526 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 10410 11498 gene locus_tag LOCUS_16770 10410 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 12220 14160 gene locus_tag LOCUS_16780 12220 14160 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_16780 <16761 14220 gene locus_tag LOCUS_16790 <16761 14220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence088 <1 1023 gene locus_tag LOCUS_16800 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 1527 1291 gene locus_tag LOCUS_16810 1527 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2396 1758 gene locus_tag LOCUS_16820 2396 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2463 3518 gene locus_tag LOCUS_16830 2463 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3943 3515 gene locus_tag LOCUS_16840 3943 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404126.1 protein_id gnl|my_center|LOCUS_16840 5810 4092 gene locus_tag LOCUS_16850 5810 4092 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_16850 6346 5990 gene locus_tag LOCUS_16860 6346 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6929 6282 gene locus_tag LOCUS_16870 6929 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 7703 7179 gene locus_tag LOCUS_16880 7703 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 9720 7714 gene locus_tag LOCUS_16890 gene hreP 9720 7714 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816615.1 protein_id gnl|my_center|LOCUS_16890 10488 9841 gene locus_tag LOCUS_16900 10488 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_16900 10518 11120 gene locus_tag LOCUS_16910 10518 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 11299 11766 gene locus_tag LOCUS_16920 11299 11766 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_16920 13101 11767 gene locus_tag LOCUS_16930 13101 11767 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJP2 protein_id gnl|my_center|LOCUS_16930 15611 13116 gene locus_tag LOCUS_16940 15611 13116 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_16940 16077 15646 gene locus_tag LOCUS_16950 16077 15646 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366341.1 protein_id gnl|my_center|LOCUS_16950 16586 16077 gene locus_tag LOCUS_16960 gene paaD 16586 16077 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence089 986 1879 gene locus_tag LOCUS_16970 gene fjo11 986 1879 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_16970 2262 1894 gene locus_tag LOCUS_16980 2262 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705335.1 protein_id gnl|my_center|LOCUS_16980 3019 2504 gene locus_tag LOCUS_16990 3019 2504 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_16990 3363 3028 gene locus_tag LOCUS_17000 3363 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4239 3763 gene locus_tag LOCUS_17010 4239 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5459 4407 gene locus_tag LOCUS_17020 5459 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 9602 5529 gene locus_tag LOCUS_17030 9602 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 11124 10201 gene locus_tag LOCUS_17040 11124 10201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_17040 12229 11174 gene locus_tag LOCUS_17050 12229 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_17050 13122 12199 gene locus_tag LOCUS_17060 13122 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 14229 13255 gene locus_tag LOCUS_17070 14229 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 16070 14235 gene locus_tag LOCUS_17080 16070 14235 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108133.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence090 145 1383 gene locus_tag LOCUS_17090 145 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1807 1532 gene locus_tag LOCUS_17100 1807 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2315 1809 gene locus_tag LOCUS_17110 2315 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3002 2370 gene locus_tag LOCUS_17120 3002 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 3222 3464 gene locus_tag LOCUS_17130 3222 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4735 3461 gene locus_tag LOCUS_17140 4735 3461 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_17140 4903 6999 gene locus_tag LOCUS_17150 4903 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7099 7662 gene locus_tag LOCUS_17160 7099 7662 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_17160 7664 8965 gene locus_tag LOCUS_17170 7664 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 8978 10162 gene locus_tag LOCUS_17180 8978 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 10354 11232 gene locus_tag LOCUS_17190 10354 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 12279 11521 gene locus_tag LOCUS_17200 gene fabG 12279 11521 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_17200 15547 14861 gene locus_tag LOCUS_17210 15547 14861 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_17210 <16495 15544 gene locus_tag LOCUS_17220 <16495 15544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107797.1:histidine kinase >Feature sequence091 3 1016 gene locus_tag LOCUS_17230 3 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1960 1013 gene locus_tag LOCUS_17240 1960 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4240 2195 gene locus_tag LOCUS_17250 4240 2195 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_17250 5604 4939 gene locus_tag LOCUS_17260 5604 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6760 8541 gene locus_tag LOCUS_17270 6760 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 11347 8582 gene locus_tag LOCUS_17280 11347 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 11690 13906 gene locus_tag LOCUS_17290 11690 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 14266 13907 gene locus_tag LOCUS_17300 14266 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 15582 14692 gene locus_tag LOCUS_17310 15582 14692 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence092 406 3471 gene locus_tag LOCUS_17320 406 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3993 3508 gene locus_tag LOCUS_17330 3993 3508 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210231.1 protein_id gnl|my_center|LOCUS_17330 4024 4722 gene locus_tag LOCUS_17340 gene cutC 4024 4722 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NS44 protein_id gnl|my_center|LOCUS_17340 5185 5550 gene locus_tag LOCUS_17350 5185 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6395 5604 gene locus_tag LOCUS_17360 6395 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6570 7415 gene locus_tag LOCUS_17370 6570 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 9746 7680 gene locus_tag LOCUS_17380 gene hutU 9746 7680 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_17380 11050 9809 gene locus_tag LOCUS_17390 11050 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 12543 11188 gene locus_tag LOCUS_17400 12543 11188 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727955.1 protein_id gnl|my_center|LOCUS_17400 12711 13139 gene locus_tag LOCUS_17410 12711 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 13437 13189 gene locus_tag LOCUS_17420 13437 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 14409 13456 gene locus_tag LOCUS_17430 14409 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 <16322 14571 gene locus_tag LOCUS_17440 <16322 14571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYP1:signal peptidase I >Feature sequence093 2915 324 gene locus_tag LOCUS_17450 2915 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 7478 3492 gene locus_tag LOCUS_17460 7478 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10975 10028 gene locus_tag LOCUS_17470 gene porP 10975 10028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_17470 <16302 11103 gene locus_tag LOCUS_17480 <16302 11103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence094 1041 220 gene locus_tag LOCUS_17490 gene gldN 1041 220 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_17490 2746 1232 gene locus_tag LOCUS_17500 gene gldM 2746 1232 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_17500 3388 4233 gene locus_tag LOCUS_17510 gene tatC 3388 4233 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_17510 4358 4804 gene locus_tag LOCUS_17520 4358 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4941 6218 gene locus_tag LOCUS_17530 4941 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 6279 7370 gene locus_tag LOCUS_17540 6279 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 7594 8022 gene locus_tag LOCUS_17550 7594 8022 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_17550 8597 9346 gene locus_tag LOCUS_17560 8597 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 10126 9431 gene locus_tag LOCUS_17570 10126 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 10867 10181 gene locus_tag LOCUS_17580 10867 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 11570 11052 gene locus_tag LOCUS_17590 11570 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 15137 12288 gene locus_tag LOCUS_17600 15137 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence095 179 1051 gene locus_tag LOCUS_17610 179 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_17610 1052 2380 gene locus_tag LOCUS_17620 1052 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2634 3248 gene locus_tag LOCUS_17630 2634 3248 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_17630 3245 3991 gene locus_tag LOCUS_17640 3245 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5247 3958 gene locus_tag LOCUS_17650 5247 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5411 6544 gene locus_tag LOCUS_17660 gene hppD 5411 6544 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_17660 6741 7856 gene locus_tag LOCUS_17670 6741 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 7993 10518 gene locus_tag LOCUS_17680 7993 10518 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106540.1 protein_id gnl|my_center|LOCUS_17680 10523 11452 gene locus_tag LOCUS_17690 10523 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 11896 12867 gene locus_tag LOCUS_17700 11896 12867 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_17700 14065 12950 gene locus_tag LOCUS_17710 14065 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_17710 15122 14190 gene locus_tag LOCUS_17720 15122 14190 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_17720 15193 15393 gene locus_tag LOCUS_17730 15193 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence096 920 1267 gene locus_tag LOCUS_17740 920 1267 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_17740 2431 1346 gene locus_tag LOCUS_17750 2431 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2652 2963 gene locus_tag LOCUS_17760 gene trxA 2652 2963 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66928 protein_id gnl|my_center|LOCUS_17760 3056 3985 gene locus_tag LOCUS_17770 3056 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_17770 4067 4807 gene locus_tag LOCUS_17780 4067 4807 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_17780 4934 5284 gene locus_tag LOCUS_17790 4934 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5392 8853 gene locus_tag LOCUS_17800 5392 8853 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_17800 10535 8994 gene locus_tag LOCUS_17810 gene pccB 10535 8994 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_17810 11351 10542 gene locus_tag LOCUS_17820 11351 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 13504 11357 gene locus_tag LOCUS_17830 13504 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 13771 14979 gene locus_tag LOCUS_17840 13771 14979 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_17840 15061 15867 gene locus_tag LOCUS_17850 15061 15867 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence097 1081 530 gene locus_tag LOCUS_17860 1081 530 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_17860 1813 1082 gene locus_tag LOCUS_17870 1813 1082 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_17870 2154 1858 gene locus_tag LOCUS_17880 gene gatC 2154 1858 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF4 protein_id gnl|my_center|LOCUS_17880 2333 2977 gene locus_tag LOCUS_17890 2333 2977 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_17890 3227 3015 gene locus_tag LOCUS_17900 3227 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3410 4066 gene locus_tag LOCUS_17910 3410 4066 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_17910 4970 4056 gene locus_tag LOCUS_17920 gene glsA 4970 4056 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MM2 protein_id gnl|my_center|LOCUS_17920 5634 4981 gene locus_tag LOCUS_17930 5634 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_17930 5915 6436 gene locus_tag LOCUS_17940 5915 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_17940 6433 7911 gene locus_tag LOCUS_17950 6433 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_17950 8249 9151 gene locus_tag LOCUS_17960 8249 9151 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_17960 9393 10820 gene locus_tag LOCUS_17970 9393 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 10863 12404 gene locus_tag LOCUS_17980 gene guaA 10863 12404 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_17980 12532 13836 gene locus_tag LOCUS_17990 12532 13836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 13910 14185 gene locus_tag LOCUS_18000 13910 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 14222 14467 gene locus_tag LOCUS_18010 14222 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 14464 15390 gene locus_tag LOCUS_18020 14464 15390 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence098 517 149 gene locus_tag LOCUS_18030 517 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1904 693 gene locus_tag LOCUS_18040 1904 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3098 2142 gene locus_tag LOCUS_18050 3098 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3414 4625 gene locus_tag LOCUS_18060 gene trzA 3414 4625 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_18060 6170 4740 gene locus_tag LOCUS_18070 6170 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7177 6182 gene locus_tag LOCUS_18080 7177 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_18080 7316 8650 gene locus_tag LOCUS_18090 7316 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 8855 9661 gene locus_tag LOCUS_18100 8855 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 9696 10472 gene locus_tag LOCUS_18110 gene paaG 9696 10472 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_18110 10558 11577 gene locus_tag LOCUS_18120 10558 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_18120 14164 11582 gene locus_tag LOCUS_18130 14164 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 14487 14825 gene locus_tag LOCUS_18140 14487 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 15255 14878 gene locus_tag LOCUS_18150 15255 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence099 <1 598 gene locus_tag LOCUS_18160 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288769.1:lipase 700 1755 gene locus_tag LOCUS_18170 700 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3951 1897 gene locus_tag LOCUS_18180 3951 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6000 4045 gene locus_tag LOCUS_18190 6000 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 7443 6559 gene locus_tag LOCUS_18200 7443 6559 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_18200 7666 8211 gene locus_tag LOCUS_18210 gene resA 7666 8211 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL81 protein_id gnl|my_center|LOCUS_18210 8296 8892 gene locus_tag LOCUS_18220 gene grpE 8296 8892 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_18220 8901 10067 gene locus_tag LOCUS_18230 gene dnaJ 8901 10067 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_18230 10202 10669 gene locus_tag LOCUS_18240 10202 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 10745 12682 gene locus_tag LOCUS_18250 10745 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 14550 12916 gene locus_tag LOCUS_18260 14550 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence100 <1 6232 gene locus_tag LOCUS_18270 <1 6232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 6560 6216 gene locus_tag LOCUS_18280 6560 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18280 6800 7978 gene locus_tag LOCUS_18290 6800 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 9131 10000 gene locus_tag LOCUS_18300 9131 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 10368 10057 gene locus_tag LOCUS_18310 10368 10057 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882942.1 protein_id gnl|my_center|LOCUS_18310 11354 10788 gene locus_tag LOCUS_18320 11354 10788 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_18320 11443 12606 gene locus_tag LOCUS_18330 gene celE 11443 12606 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_18330 12952 13461 gene locus_tag LOCUS_18340 12952 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 13511 14137 gene locus_tag LOCUS_18350 13511 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 <15782 14210 gene locus_tag LOCUS_18360 <15782 14210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence101 77 877 gene locus_tag LOCUS_18370 77 877 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_18370 1009 1908 gene locus_tag LOCUS_18380 1009 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_18380 2809 1898 gene locus_tag LOCUS_18390 2809 1898 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_18390 6180 2908 gene locus_tag LOCUS_18400 6180 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_18400 6506 8257 gene locus_tag LOCUS_18410 6506 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 8339 9130 gene locus_tag LOCUS_18420 8339 9130 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 protein_id gnl|my_center|LOCUS_18420 9587 9093 gene locus_tag LOCUS_18430 gene pyrR 9587 9093 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1T4 protein_id gnl|my_center|LOCUS_18430 9721 11088 gene locus_tag LOCUS_18440 9721 11088 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_18440 11111 11896 gene locus_tag LOCUS_18450 11111 11896 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_18450 11937 12407 gene locus_tag LOCUS_18460 11937 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_18460 14875 12530 gene locus_tag LOCUS_18470 14875 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 15401 14919 gene locus_tag LOCUS_18480 15401 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence102 1268 162 gene locus_tag LOCUS_18490 gene capI 1268 162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_18490 3174 1258 gene locus_tag LOCUS_18500 3174 1258 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_18500 3481 5226 gene locus_tag LOCUS_18510 3481 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 5365 6387 gene locus_tag LOCUS_18520 5365 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6842 6471 gene locus_tag LOCUS_18530 6842 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 9740 7023 gene locus_tag LOCUS_18540 9740 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 10176 9865 gene locus_tag LOCUS_18550 10176 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 11941 10400 gene locus_tag LOCUS_18560 11941 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_18560 12031 13740 gene locus_tag LOCUS_18570 12031 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 13743 15233 gene locus_tag LOCUS_18580 13743 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence103 1137 592 gene locus_tag LOCUS_18590 1137 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1667 1299 gene locus_tag LOCUS_18600 1667 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2404 1775 gene locus_tag LOCUS_18610 gene rsmG 2404 1775 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_18610 3092 2406 gene locus_tag LOCUS_18620 3092 2406 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_18620 3260 3093 gene locus_tag LOCUS_18630 3260 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3625 6696 gene locus_tag LOCUS_18640 3625 6696 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_18640 6727 7167 gene locus_tag LOCUS_18650 gene rpiB 6727 7167 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_18650 7381 8985 gene locus_tag LOCUS_18660 7381 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 10323 10595 gene locus_tag LOCUS_18670 10323 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18670 10925 12793 gene locus_tag LOCUS_18680 gene htpG 10925 12793 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_18680 13555 12854 gene locus_tag LOCUS_18690 13555 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 14205 13552 gene locus_tag LOCUS_18700 14205 13552 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_18700 15161 14217 gene locus_tag LOCUS_18710 15161 14217 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence104 1496 1948 gene locus_tag LOCUS_18720 gene spoIIAB 1496 1948 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189W4 protein_id gnl|my_center|LOCUS_18720 1971 2441 gene locus_tag LOCUS_18730 gene ybeY 1971 2441 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_18730 2707 5163 gene locus_tag LOCUS_18740 gene thrA 2707 5163 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_18740 5175 6107 gene locus_tag LOCUS_18750 gene thrB 5175 6107 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_18750 6120 7415 gene locus_tag LOCUS_18760 6120 7415 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_18760 7498 8580 gene locus_tag LOCUS_18770 gene mvaD 7498 8580 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_18770 8640 9167 gene locus_tag LOCUS_18780 8640 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 10509 9196 gene locus_tag LOCUS_18790 gene mntH 10509 9196 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_18790 11491 10523 gene locus_tag LOCUS_18800 11491 10523 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_18800 12104 11502 gene locus_tag LOCUS_18810 12104 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 13390 14100 gene locus_tag LOCUS_18820 13390 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 14220 15191 gene locus_tag LOCUS_18830 14220 15191 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence105 397 1344 gene locus_tag LOCUS_18840 397 1344 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_18840 1466 3883 gene locus_tag LOCUS_18850 1466 3883 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_18850 4544 3927 gene locus_tag LOCUS_18860 4544 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6517 4625 gene locus_tag LOCUS_18870 6517 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 10336 6569 gene locus_tag LOCUS_18880 10336 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 10533 12131 gene locus_tag LOCUS_18890 10533 12131 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_18890 12128 12826 gene locus_tag LOCUS_18900 gene npdA 12128 12826 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_18900 14633 12912 gene locus_tag LOCUS_18910 14633 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence106 4667 5797 gene locus_tag LOCUS_18920 4667 5797 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_18920 6922 5921 gene locus_tag LOCUS_18930 6922 5921 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_18930 6916 7494 gene locus_tag LOCUS_18940 6916 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8424 7531 gene locus_tag LOCUS_18950 gene hemF 8424 7531 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_18950 8770 8414 gene locus_tag LOCUS_18960 8770 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 8881 9768 gene locus_tag LOCUS_18970 gene udp 8881 9768 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_18970 9781 11826 gene locus_tag LOCUS_18980 9781 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 12450 11872 gene locus_tag LOCUS_18990 12450 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 13097 12585 gene locus_tag LOCUS_19000 13097 12585 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_19000 13205 14008 gene locus_tag LOCUS_19010 gene proC 13205 14008 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_19010 >Feature sequence107 2460 1048 gene locus_tag LOCUS_19020 2460 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2993 2457 gene locus_tag LOCUS_19030 2993 2457 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19030 3253 3804 gene locus_tag LOCUS_19040 3253 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3888 7775 gene locus_tag LOCUS_19050 3888 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 7982 8599 gene locus_tag LOCUS_19060 7982 8599 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384970.1 protein_id gnl|my_center|LOCUS_19060 10155 8656 gene locus_tag LOCUS_19070 10155 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 10694 10822 gene locus_tag LOCUS_19080 10694 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 11211 11345 gene locus_tag LOCUS_19090 11211 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 11845 12225 gene locus_tag LOCUS_19100 11845 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 12606 13037 gene locus_tag LOCUS_19110 12606 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 13738 13211 gene locus_tag LOCUS_19120 gene mutX 13738 13211 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904550.1 protein_id gnl|my_center|LOCUS_19120 13835 14098 gene locus_tag LOCUS_19130 gene rpmE2 13835 14098 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_19130 >Feature sequence108 1186 758 gene locus_tag LOCUS_19140 1186 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_19140 1860 1273 gene locus_tag LOCUS_19150 1860 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_19150 3134 2040 gene locus_tag LOCUS_19160 3134 2040 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_19160 4390 4560 gene locus_tag LOCUS_19170 4390 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4665 5075 gene locus_tag LOCUS_19180 4665 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 6599 5160 gene locus_tag LOCUS_19190 6599 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 7801 7415 gene locus_tag LOCUS_19200 7801 7415 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_19200 8728 8006 gene locus_tag LOCUS_19210 8728 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 9277 8924 gene locus_tag LOCUS_19220 9277 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 9643 9338 gene locus_tag LOCUS_19230 9643 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 9740 10120 gene locus_tag LOCUS_19240 9740 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11905 10175 gene locus_tag LOCUS_19250 gene lysS 11905 10175 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_19250 13295 12246 gene locus_tag LOCUS_19260 13295 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence109 796 2124 gene locus_tag LOCUS_19270 796 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2126 3406 gene locus_tag LOCUS_19280 2126 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4707 3475 gene locus_tag LOCUS_19290 4707 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 6526 4985 gene locus_tag LOCUS_19300 6526 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7608 6550 gene locus_tag LOCUS_19310 7608 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 10888 8351 gene locus_tag LOCUS_19320 10888 8351 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_19320 11686 11009 gene locus_tag LOCUS_19330 gene rpe 11686 11009 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_19330 12743 14206 gene locus_tag LOCUS_19340 12743 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence110 2002 1211 gene locus_tag LOCUS_19350 2002 1211 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_19350 2617 2003 gene locus_tag LOCUS_19360 2617 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3869 2619 gene locus_tag LOCUS_19370 3869 2619 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_19370 9050 4116 gene locus_tag LOCUS_19380 9050 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 9680 10663 gene locus_tag LOCUS_19390 9680 10663 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_19390 11094 11351 gene locus_tag LOCUS_19400 11094 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 11509 11748 gene locus_tag LOCUS_19410 11509 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 12616 12407 gene locus_tag LOCUS_19420 12616 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence111 670 365 gene locus_tag LOCUS_19430 670 365 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_19430 919 3162 gene locus_tag LOCUS_19440 919 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3246 4064 gene locus_tag LOCUS_19450 gene scpA 3246 4064 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_19450 4074 4253 gene locus_tag LOCUS_19460 4074 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 6652 4424 gene locus_tag LOCUS_19470 6652 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_19470 7730 6657 gene locus_tag LOCUS_19480 7730 6657 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_19480 9356 7848 gene locus_tag LOCUS_19490 9356 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 9863 9360 gene locus_tag LOCUS_19500 9863 9360 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497611.1 protein_id gnl|my_center|LOCUS_19500 9975 10553 gene locus_tag LOCUS_19510 9975 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 11254 10580 gene locus_tag LOCUS_19520 11254 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 11646 11299 gene locus_tag LOCUS_19530 11646 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 <14569 11782 gene locus_tag LOCUS_19540 <14569 11782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 >Feature sequence112 <1 1338 gene locus_tag LOCUS_19550 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 1761 9392 gene locus_tag LOCUS_19560 1761 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 12018 9946 gene locus_tag LOCUS_19570 12018 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 12245 12694 gene locus_tag LOCUS_19580 12245 12694 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 protein_id gnl|my_center|LOCUS_19580 <14517 12699 gene locus_tag LOCUS_19590 <14517 12699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963131.1:transcriptional regulator >Feature sequence113 4262 3582 gene locus_tag LOCUS_19600 4262 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 6065 4281 gene locus_tag LOCUS_19610 6065 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6503 7012 gene locus_tag LOCUS_19620 6503 7012 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_19620 7002 7637 gene locus_tag LOCUS_19630 7002 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796794.1 protein_id gnl|my_center|LOCUS_19630 7720 8232 gene locus_tag LOCUS_19640 7720 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 8586 9116 gene locus_tag LOCUS_19650 8586 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 9232 9729 gene locus_tag LOCUS_19660 9232 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 9895 12789 gene locus_tag LOCUS_19670 9895 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 13398 12844 gene locus_tag LOCUS_19680 13398 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 <14347 13592 gene locus_tag LOCUS_19690 <14347 13592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975804.1:DNA-binding response regulator >Feature sequence114 <1 940 gene locus_tag LOCUS_19700 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit ClpC 1914 1087 gene locus_tag LOCUS_19710 1914 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3611 2691 gene locus_tag LOCUS_19720 3611 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3785 4399 gene locus_tag LOCUS_19730 3785 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4712 4509 gene locus_tag LOCUS_19740 4712 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5825 5073 gene locus_tag LOCUS_19750 5825 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6380 10060 gene locus_tag LOCUS_19760 6380 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 12150 10300 gene locus_tag LOCUS_19770 gene gaa 12150 10300 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_19770 12315 13553 gene locus_tag LOCUS_19780 gene xseA 12315 13553 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_19780 13550 13726 gene locus_tag LOCUS_19790 13550 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 14143 13712 gene locus_tag LOCUS_19800 14143 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence115 1904 1059 gene locus_tag LOCUS_19810 1904 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3533 2295 gene locus_tag LOCUS_19820 3533 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4824 3538 gene locus_tag LOCUS_19830 4824 3538 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_19830 7168 4943 gene locus_tag LOCUS_19840 7168 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 7538 9448 gene locus_tag LOCUS_19850 7538 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 10565 9744 gene locus_tag LOCUS_19860 10565 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 11948 10629 gene locus_tag LOCUS_19870 11948 10629 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_19870 12803 12063 gene locus_tag LOCUS_19880 12803 12063 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_19880 13957 12806 gene locus_tag LOCUS_19890 13957 12806 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence116 725 6 gene locus_tag LOCUS_19900 725 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1939 794 gene locus_tag LOCUS_19910 1939 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 4494 2959 gene locus_tag LOCUS_19920 4494 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 5273 4524 gene locus_tag LOCUS_19930 5273 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6940 5984 gene locus_tag LOCUS_19940 gene ftsY 6940 5984 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_19940 7219 7046 gene locus_tag LOCUS_19950 7219 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7489 7301 gene locus_tag LOCUS_19960 gene rpmG 7489 7301 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_19960 7779 7528 gene locus_tag LOCUS_19970 gene rpmB 7779 7528 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EM4 protein_id gnl|my_center|LOCUS_19970 7925 7851 gene locus_tag LOCUS_t00110 7925 7851 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8457 9617 gene locus_tag LOCUS_19980 8457 9617 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_19980 9990 10727 gene locus_tag LOCUS_19990 9990 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 10760 11611 gene locus_tag LOCUS_20000 10760 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_20000 11625 12785 gene locus_tag LOCUS_20010 11625 12785 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_20010 13906 12854 gene locus_tag LOCUS_20020 13906 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence117 2849 1521 gene locus_tag LOCUS_20030 2849 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 6110 2853 gene locus_tag LOCUS_20040 6110 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9449 6141 gene locus_tag LOCUS_20050 9449 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10047 9463 gene locus_tag LOCUS_20060 10047 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 13687 10424 gene locus_tag LOCUS_20070 13687 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence118 362 15 gene locus_tag LOCUS_20080 362 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2712 391 gene locus_tag LOCUS_20090 2712 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3045 4886 gene locus_tag LOCUS_20100 3045 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 5529 4888 gene locus_tag LOCUS_20110 gene narP 5529 4888 CDS product nitrate/nitrite response regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44845 protein_id gnl|my_center|LOCUS_20110 8256 5542 gene locus_tag LOCUS_20120 8256 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 9152 8724 gene locus_tag LOCUS_20130 9152 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 9835 9182 gene locus_tag LOCUS_20140 9835 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 10732 9836 gene locus_tag LOCUS_20150 gene hemC 10732 9836 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_20150 11174 12718 gene locus_tag LOCUS_20160 gene fadD 11174 12718 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence119 3028 1766 gene locus_tag LOCUS_20170 gene erg3 3028 1766 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_20170 4979 3426 gene locus_tag LOCUS_20180 4979 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5757 5260 gene locus_tag LOCUS_20190 5757 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 6562 5795 gene locus_tag LOCUS_20200 6562 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_20200 6667 7407 gene locus_tag LOCUS_20210 6667 7407 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_20210 11386 7496 gene locus_tag LOCUS_20220 11386 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 11649 12989 gene locus_tag LOCUS_20230 11649 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence120 2602 1148 gene locus_tag LOCUS_20240 gene murE 2602 1148 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_20240 4840 2681 gene locus_tag LOCUS_20250 gene ftsI 4840 2681 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_20250 5364 5053 gene locus_tag LOCUS_20260 5364 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 6317 5394 gene locus_tag LOCUS_20270 gene rsmH 6317 5394 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_20270 6778 6317 gene locus_tag LOCUS_20280 gene mraZ 6778 6317 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_20280 7405 7707 gene locus_tag LOCUS_20290 7405 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7761 8417 gene locus_tag LOCUS_20300 7761 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9506 8760 gene locus_tag LOCUS_20310 9506 8760 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_20310 9936 10745 gene locus_tag LOCUS_20320 9936 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 11128 10742 gene locus_tag LOCUS_20330 11128 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 11552 11193 gene locus_tag LOCUS_20340 11552 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 11995 11645 gene locus_tag LOCUS_20350 11995 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 13916 11997 gene locus_tag LOCUS_20360 13916 11997 CDS product penicillin G acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877994.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence121 163 2070 gene locus_tag LOCUS_20370 163 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2258 3187 gene locus_tag LOCUS_20380 2258 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4528 3182 gene locus_tag LOCUS_20390 4528 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 4964 4521 gene locus_tag LOCUS_20400 4964 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5144 6736 gene locus_tag LOCUS_20410 gene dagA 5144 6736 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_20410 7194 6844 gene locus_tag LOCUS_20420 7194 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 7490 7233 gene locus_tag LOCUS_20430 7490 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 8511 7597 gene locus_tag LOCUS_20440 8511 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9234 8515 gene locus_tag LOCUS_20450 9234 8515 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_20450 10901 9330 gene locus_tag LOCUS_20460 gene zwf 10901 9330 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL52 protein_id gnl|my_center|LOCUS_20460 11257 11394 gene locus_tag LOCUS_20470 11257 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 11485 12882 gene locus_tag LOCUS_20480 gene gndA 11485 12882 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_20480 12985 13791 gene locus_tag LOCUS_20490 12985 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence122 672 1088 gene locus_tag LOCUS_20500 672 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2077 1616 gene locus_tag LOCUS_20510 2077 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_20510 2411 4816 gene locus_tag LOCUS_20520 2411 4816 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_20520 5425 8340 gene locus_tag LOCUS_20530 5425 8340 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_20530 8364 9665 gene locus_tag LOCUS_20540 8364 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 9733 10707 gene locus_tag LOCUS_20550 9733 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 10801 11289 gene locus_tag LOCUS_20560 10801 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 13804 11381 gene locus_tag LOCUS_20570 13804 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence123 2600 198 gene locus_tag LOCUS_20580 2600 198 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_20580 2779 4413 gene locus_tag LOCUS_20590 2779 4413 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EE6 protein_id gnl|my_center|LOCUS_20590 5066 4575 gene locus_tag LOCUS_20600 5066 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20600 8086 5339 gene locus_tag LOCUS_20610 8086 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 8500 8210 gene locus_tag LOCUS_20620 8500 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 9733 8624 gene locus_tag LOCUS_20630 gene recF 9733 8624 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_20630 10323 9736 gene locus_tag LOCUS_20640 gene coaE 10323 9736 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_20640 10702 11610 gene locus_tag LOCUS_20650 10702 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 11716 13629 gene locus_tag LOCUS_20660 11716 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence124 2722 2291 gene locus_tag LOCUS_20670 2722 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4306 3128 gene locus_tag LOCUS_20680 4306 3128 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_20680 5062 6963 gene locus_tag LOCUS_20690 gene pop 5062 6963 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538184.1 protein_id gnl|my_center|LOCUS_20690 8492 7101 gene locus_tag LOCUS_20700 8492 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 10873 8498 gene locus_tag LOCUS_20710 10873 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 11259 13571 gene locus_tag LOCUS_20720 11259 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 13654 13727 gene locus_tag LOCUS_t00120 13654 13727 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 673 254 gene locus_tag LOCUS_20730 673 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1550 708 gene locus_tag LOCUS_20740 1550 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2191 1607 gene locus_tag LOCUS_20750 gene ctaE 2191 1607 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_20750 2979 2197 gene locus_tag LOCUS_20760 gene ctaB 2979 2197 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_20760 5134 3278 gene locus_tag LOCUS_20770 gene ctaD 5134 3278 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_20770 6716 5196 gene locus_tag LOCUS_20780 6716 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 8223 6835 gene locus_tag LOCUS_20790 8223 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 9223 8273 gene locus_tag LOCUS_20800 gene actE 9223 8273 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_20800 9784 9254 gene locus_tag LOCUS_20810 gene actD 9784 9254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_20810 11245 9839 gene locus_tag LOCUS_20820 gene actC 11245 9839 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_20820 <13703 11307 gene locus_tag LOCUS_20830 <13703 11307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:Fe-S-cluster-containing hydrogenase >Feature sequence126 84 572 gene locus_tag LOCUS_20840 84 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 798 724 gene locus_tag LOCUS_t00130 798 724 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1135 2109 gene locus_tag LOCUS_20850 gene accA 1135 2109 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_20850 2119 2670 gene locus_tag LOCUS_20860 2119 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2657 3565 gene locus_tag LOCUS_20870 gene dapA 2657 3565 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_20870 4764 3562 gene locus_tag LOCUS_20880 4764 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 6241 4787 gene locus_tag LOCUS_20890 6241 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 6413 6925 gene locus_tag LOCUS_20900 6413 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 6861 7223 gene locus_tag LOCUS_20910 6861 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 8865 7387 gene locus_tag LOCUS_20920 8865 7387 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_20920 10224 9064 gene locus_tag LOCUS_20930 10224 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 10495 11964 gene locus_tag LOCUS_20940 gene proS 10495 11964 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_20940 12797 12099 gene locus_tag LOCUS_20950 12797 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 13106 13648 gene locus_tag LOCUS_20960 13106 13648 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJK9 protein_id gnl|my_center|LOCUS_20960 >Feature sequence127 522 740 gene locus_tag LOCUS_20970 gene infA 522 740 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_20970 927 1304 gene locus_tag LOCUS_20980 gene rpsM 927 1304 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_20980 1434 1820 gene locus_tag LOCUS_20990 gene rpsK 1434 1820 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN3 protein_id gnl|my_center|LOCUS_20990 1866 2477 gene locus_tag LOCUS_21000 gene rpsD 1866 2477 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_21000 2620 3618 gene locus_tag LOCUS_21010 gene rpoA 2620 3618 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_21010 3733 4281 gene locus_tag LOCUS_21020 gene rplQ 3733 4281 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A3 protein_id gnl|my_center|LOCUS_21020 4480 5583 gene locus_tag LOCUS_21030 gene carA 4480 5583 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_21030 5700 6986 gene locus_tag LOCUS_21040 gene eno 5700 6986 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64074 protein_id gnl|my_center|LOCUS_21040 7129 7461 gene locus_tag LOCUS_21050 7129 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 7541 8413 gene locus_tag LOCUS_21060 gene sucD 7541 8413 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_21060 8486 8806 gene locus_tag LOCUS_21070 8486 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9333 8803 gene locus_tag LOCUS_21080 9333 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 11423 9525 gene locus_tag LOCUS_21090 11423 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 13350 11539 gene locus_tag LOCUS_21100 13350 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence128 962 333 gene locus_tag LOCUS_21110 962 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1553 2605 gene locus_tag LOCUS_21120 1553 2605 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_21120 5872 2636 gene locus_tag LOCUS_21130 5872 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 7163 6285 gene locus_tag LOCUS_21140 7163 6285 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_21140 7300 7115 gene locus_tag LOCUS_21150 7300 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 8336 7767 gene locus_tag LOCUS_21160 8336 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8480 9325 gene locus_tag LOCUS_21170 8480 9325 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_21170 9330 9728 gene locus_tag LOCUS_21180 9330 9728 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_21180 9729 10805 gene locus_tag LOCUS_21190 9729 10805 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z17 protein_id gnl|my_center|LOCUS_21190 10814 11641 gene locus_tag LOCUS_21200 10814 11641 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_21200 11664 12494 gene locus_tag LOCUS_21210 11664 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 12648 13421 gene locus_tag LOCUS_21220 12648 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence129 <1 713 gene locus_tag LOCUS_21230 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403040.1:osteoblast specific factor 2-related protein 2256 1168 gene locus_tag LOCUS_21240 2256 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3090 2281 gene locus_tag LOCUS_21250 3090 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4665 3187 gene locus_tag LOCUS_21260 4665 3187 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_21260 4887 4805 gene locus_tag LOCUS_t00140 4887 4805 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5649 7880 gene locus_tag LOCUS_21270 gene relA 5649 7880 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_21270 7982 8461 gene locus_tag LOCUS_21280 7982 8461 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_21280 8480 8833 gene locus_tag LOCUS_21290 8480 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 9011 10297 gene locus_tag LOCUS_21300 gene purA 9011 10297 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_21300 11203 10463 gene locus_tag LOCUS_21310 11203 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 12644 11274 gene locus_tag LOCUS_21320 gene dacB 12644 11274 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_21320 <13380 12817 gene locus_tag LOCUS_21330 <13380 12817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962840.1:fumarylacetoacetase >Feature sequence130 1882 845 gene locus_tag LOCUS_21340 gene guaC 1882 845 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFP5 protein_id gnl|my_center|LOCUS_21340 2149 4740 gene locus_tag LOCUS_21350 2149 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4746 5237 gene locus_tag LOCUS_21360 4746 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5372 5686 gene locus_tag LOCUS_21370 5372 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 5683 7815 gene locus_tag LOCUS_21380 gene feoB 5683 7815 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_21380 8160 8582 gene locus_tag LOCUS_21390 8160 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 9101 11560 gene locus_tag LOCUS_21400 9101 11560 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_21400 11562 12200 gene locus_tag LOCUS_21410 11562 12200 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_21410 13087 12242 gene locus_tag LOCUS_21420 13087 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence131 1201 1863 gene locus_tag LOCUS_21430 1201 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1965 2966 gene locus_tag LOCUS_21440 1965 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 5761 3074 gene locus_tag LOCUS_21450 5761 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 6426 12839 gene locus_tag LOCUS_21460 6426 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 13226 13065 gene locus_tag LOCUS_21470 13226 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence132 56 853 gene locus_tag LOCUS_21480 56 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 859 1077 gene locus_tag LOCUS_21490 859 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1074 1523 gene locus_tag LOCUS_21500 1074 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1697 4489 gene locus_tag LOCUS_21510 1697 4489 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_21510 6174 5191 gene locus_tag LOCUS_21520 gene pdhB 6174 5191 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_21520 6490 6654 gene locus_tag LOCUS_21530 6490 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 6767 7435 gene locus_tag LOCUS_21540 6767 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_21540 8003 7443 gene locus_tag LOCUS_21550 8003 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 8334 9299 gene locus_tag LOCUS_21560 gene ribD 8334 9299 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_21560 9552 10013 gene locus_tag LOCUS_21570 9552 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 11678 10116 gene locus_tag LOCUS_21580 11678 10116 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_21580 12636 11734 gene locus_tag LOCUS_21590 gene nucA 12636 11734 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence133 <1 507 gene locus_tag LOCUS_21600 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039182.1:gluconolactonase 2640 589 gene locus_tag LOCUS_21610 2640 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5906 2919 gene locus_tag LOCUS_21620 5906 2919 CDS product 4-aminobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 protein_id gnl|my_center|LOCUS_21620 6940 6062 gene locus_tag LOCUS_21630 6940 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 7705 6944 gene locus_tag LOCUS_21640 gene crtB 7705 6944 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_21640 9402 7933 gene locus_tag LOCUS_21650 gene crtI 9402 7933 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_21650 10151 9570 gene locus_tag LOCUS_21660 10151 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11364 10219 gene locus_tag LOCUS_21670 11364 10219 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_21670 12016 12648 gene locus_tag LOCUS_21680 12016 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence134 170 319 gene locus_tag LOCUS_21690 170 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1379 873 gene locus_tag LOCUS_21700 1379 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1842 1537 gene locus_tag LOCUS_21710 1842 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3110 2091 gene locus_tag LOCUS_21720 gene ansA 3110 2091 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_21720 3254 3772 gene locus_tag LOCUS_21730 3254 3772 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_21730 4321 3854 gene locus_tag LOCUS_21740 4321 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5891 4413 gene locus_tag LOCUS_21750 5891 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 8359 5936 gene locus_tag LOCUS_21760 8359 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 10028 8478 gene locus_tag LOCUS_21770 10028 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 10334 11260 gene locus_tag LOCUS_21780 gene mdh 10334 11260 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_21780 11693 12235 gene locus_tag LOCUS_21790 11693 12235 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence135 3626 339 gene locus_tag LOCUS_21800 3626 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4799 3936 gene locus_tag LOCUS_21810 gene ubiA 4799 3936 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156605.1 protein_id gnl|my_center|LOCUS_21810 5439 4909 gene locus_tag LOCUS_21820 5439 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_21820 5739 6725 gene locus_tag LOCUS_21830 5739 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 6715 7002 gene locus_tag LOCUS_21840 6715 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7673 8023 gene locus_tag LOCUS_21850 7673 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21850 8718 8281 gene locus_tag LOCUS_21860 8718 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 10679 8940 gene locus_tag LOCUS_21870 gene atsA 10679 8940 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206777.1 protein_id gnl|my_center|LOCUS_21870 11452 10685 gene locus_tag LOCUS_21880 11452 10685 CDS product thiazole biosynthesis protein ThiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021037.1 protein_id gnl|my_center|LOCUS_21880 11915 11565 gene locus_tag LOCUS_21890 11915 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 12584 12012 gene locus_tag LOCUS_21900 12584 12012 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660207.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence136 4128 595 gene locus_tag LOCUS_21910 gene dnaE 4128 595 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_21910 4639 6210 gene locus_tag LOCUS_21920 4639 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 6616 6999 gene locus_tag LOCUS_21930 6616 6999 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_21930 7135 7944 gene locus_tag LOCUS_21940 7135 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 7991 8872 gene locus_tag LOCUS_21950 gene cysM 7991 8872 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_21950 10492 9380 gene locus_tag LOCUS_21960 10492 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 12262 10520 gene locus_tag LOCUS_21970 gene aceK 12262 10520 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_21970 >Feature sequence137 501 1835 gene locus_tag LOCUS_21980 gene der 501 1835 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_21980 1840 2382 gene locus_tag LOCUS_21990 gene rmlC 1840 2382 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_21990 2401 2883 gene locus_tag LOCUS_22000 2401 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2952 3824 gene locus_tag LOCUS_22010 2952 3824 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_22010 4037 6799 gene locus_tag LOCUS_22020 4037 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 6894 7487 gene locus_tag LOCUS_22030 gene ribE 6894 7487 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_22030 7636 10416 gene locus_tag LOCUS_22040 7636 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 <12625 10491 gene locus_tag LOCUS_22050 <12625 10491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A470:DNA-directed RNA polymerase subunit beta' >Feature sequence138 248 1126 gene locus_tag LOCUS_22060 248 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_22060 1138 1683 gene locus_tag LOCUS_22070 1138 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1683 4580 gene locus_tag LOCUS_22080 1683 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 4561 5310 gene locus_tag LOCUS_22090 4561 5310 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence139 497 1090 gene locus_tag LOCUS_22100 497 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22100 3771 1087 gene locus_tag LOCUS_22110 3771 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4322 4456 gene locus_tag LOCUS_22120 4322 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 5238 6290 gene locus_tag LOCUS_22130 5238 6290 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067003.1 protein_id gnl|my_center|LOCUS_22130 6476 7528 gene locus_tag LOCUS_22140 6476 7528 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_22140 8523 7525 gene locus_tag LOCUS_22150 8523 7525 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_22150 9084 9437 gene locus_tag LOCUS_22160 9084 9437 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_22160 9438 11717 gene locus_tag LOCUS_22170 9438 11717 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_22170 >Feature sequence140 2428 986 gene locus_tag LOCUS_22180 2428 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 4108 2561 gene locus_tag LOCUS_22190 4108 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 5082 4105 gene locus_tag LOCUS_22200 5082 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5612 8257 gene locus_tag LOCUS_22210 5612 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 8373 9224 gene locus_tag LOCUS_22220 8373 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_22220 9401 10687 gene locus_tag LOCUS_22230 9401 10687 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_22230 11159 11602 gene locus_tag LOCUS_22240 gene rplM 11159 11602 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I8 protein_id gnl|my_center|LOCUS_22240 11658 12044 gene locus_tag LOCUS_22250 gene rpsI 11658 12044 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_22250 >Feature sequence141 <1 967 gene locus_tag LOCUS_22260 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EZP1:polyamine aminopropyltransferase 1 1648 12168 gene locus_tag LOCUS_22270 1648 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence142 689 961 gene locus_tag LOCUS_22280 gene groS 689 961 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF03 protein_id gnl|my_center|LOCUS_22280 1028 2665 gene locus_tag LOCUS_22290 gene groL 1028 2665 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_22290 3311 2763 gene locus_tag LOCUS_22300 3311 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701028.1 protein_id gnl|my_center|LOCUS_22300 4081 3311 gene locus_tag LOCUS_22310 4081 3311 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_22310 4557 4081 gene locus_tag LOCUS_22320 4557 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_22320 5516 4662 gene locus_tag LOCUS_22330 gene mvaB 5516 4662 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_22330 5777 5980 gene locus_tag LOCUS_22340 5777 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6519 7202 gene locus_tag LOCUS_22350 gene phoP 6519 7202 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_22350 7202 8257 gene locus_tag LOCUS_22360 gene phoR 7202 8257 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_22360 8339 10252 gene locus_tag LOCUS_22370 8339 10252 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_22370 11956 10328 gene locus_tag LOCUS_22380 gene pruA 11956 10328 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence143 230 541 gene locus_tag LOCUS_22390 230 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 879 1043 gene locus_tag LOCUS_22400 879 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2618 1086 gene locus_tag LOCUS_22410 2618 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3657 2674 gene locus_tag LOCUS_22420 3657 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3863 3657 gene locus_tag LOCUS_22430 3863 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 8712 4276 gene locus_tag LOCUS_22440 8712 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 9399 8953 gene locus_tag LOCUS_22450 9399 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 10520 9528 gene locus_tag LOCUS_22460 10520 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 <12238 10517 gene locus_tag LOCUS_22470 <12238 10517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705083.1:putative monooxygenase >Feature sequence144 1910 3043 gene locus_tag LOCUS_22480 1910 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 3241 4329 gene locus_tag LOCUS_22490 3241 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 5655 4324 gene locus_tag LOCUS_22500 5655 4324 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764618.1 protein_id gnl|my_center|LOCUS_22500 6395 5805 gene locus_tag LOCUS_22510 6395 5805 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_22510 6564 8657 gene locus_tag LOCUS_22520 6564 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 8667 9116 gene locus_tag LOCUS_22530 8667 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 9762 9394 gene locus_tag LOCUS_22540 9762 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 10275 9862 gene locus_tag LOCUS_22550 gene yqiW 10275 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_22550 10796 11188 gene locus_tag LOCUS_22560 10796 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence145 1673 654 gene locus_tag LOCUS_22570 gene oruR 1673 654 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_22570 1775 2209 gene locus_tag LOCUS_22580 1775 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3477 2272 gene locus_tag LOCUS_22590 3477 2272 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_22590 5363 3495 gene locus_tag LOCUS_22600 5363 3495 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_22600 5672 5391 gene locus_tag LOCUS_22610 5672 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5979 7295 gene locus_tag LOCUS_22620 gene lysC 5979 7295 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_22620 >Feature sequence146 712 185 gene locus_tag LOCUS_22630 712 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1247 1960 gene locus_tag LOCUS_22640 gene pdxJ 1247 1960 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_22640 2733 5921 gene locus_tag LOCUS_22650 2733 5921 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_22650 5994 7688 gene locus_tag LOCUS_22660 5994 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7795 8685 gene locus_tag LOCUS_22670 7795 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence147 533 2233 gene locus_tag LOCUS_22680 533 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2318 2791 gene locus_tag LOCUS_22690 gene rlmH 2318 2791 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_22690 2859 3500 gene locus_tag LOCUS_22700 2859 3500 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_22700 3500 4270 gene locus_tag LOCUS_22710 3500 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_22710 4267 4827 gene locus_tag LOCUS_22720 4267 4827 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_22720 6044 4956 gene locus_tag LOCUS_22730 6044 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_22730 6702 6175 gene locus_tag LOCUS_22740 6702 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 9367 6878 gene locus_tag LOCUS_22750 9367 6878 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_22750 11157 9598 gene locus_tag LOCUS_22760 11157 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence148 1189 1995 gene locus_tag LOCUS_22770 1189 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2432 2157 gene locus_tag LOCUS_22780 2432 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22780 3003 3377 gene locus_tag LOCUS_22790 gene rpsL 3003 3377 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_22790 3413 3880 gene locus_tag LOCUS_22800 gene rpsG 3413 3880 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_22800 3924 6053 gene locus_tag LOCUS_22810 gene fusA 3924 6053 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A474 protein_id gnl|my_center|LOCUS_22810 6163 6471 gene locus_tag LOCUS_22820 gene rpsJ 6163 6471 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_22820 6653 7276 gene locus_tag LOCUS_22830 gene rplC 6653 7276 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A476 protein_id gnl|my_center|LOCUS_22830 7323 7949 gene locus_tag LOCUS_22840 gene rplD 7323 7949 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_22840 7984 8280 gene locus_tag LOCUS_22850 gene rplW 7984 8280 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_22850 8341 9168 gene locus_tag LOCUS_22860 gene rplB 8341 9168 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_22860 9200 9466 gene locus_tag LOCUS_22870 gene rpsS 9200 9466 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_22870 9508 9927 gene locus_tag LOCUS_22880 gene rplV 9508 9927 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL3 protein_id gnl|my_center|LOCUS_22880 9959 10711 gene locus_tag LOCUS_22890 gene rpsC 9959 10711 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL4 protein_id gnl|my_center|LOCUS_22890 10805 11224 gene locus_tag LOCUS_22900 gene rplP 10805 11224 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_22900 11259 11522 gene locus_tag LOCUS_22910 11259 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11579 11842 gene locus_tag LOCUS_22920 gene rpsQ 11579 11842 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_22920 >Feature sequence149 345 1070 gene locus_tag LOCUS_22930 gene recO 345 1070 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A275 protein_id gnl|my_center|LOCUS_22930 1535 1155 gene locus_tag LOCUS_22940 1535 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2228 2455 gene locus_tag LOCUS_22950 2228 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4088 2604 gene locus_tag LOCUS_22960 4088 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5589 4108 gene locus_tag LOCUS_22970 5589 4108 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583648.1 protein_id gnl|my_center|LOCUS_22970 6156 5644 gene locus_tag LOCUS_22980 6156 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6827 9547 gene locus_tag LOCUS_22990 gene valS 6827 9547 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZM4 protein_id gnl|my_center|LOCUS_22990 11311 9614 gene locus_tag LOCUS_23000 11311 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence150 <1 1280 gene locus_tag LOCUS_23010 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E5N3:nuclease SbcCD subunit C 1410 1961 gene locus_tag LOCUS_23020 1410 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2021 3040 gene locus_tag LOCUS_23030 2021 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4672 3152 gene locus_tag LOCUS_23040 4672 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5652 7091 gene locus_tag LOCUS_23050 5652 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 7689 7198 gene locus_tag LOCUS_23060 gene purE 7689 7198 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_23060 8837 7731 gene locus_tag LOCUS_23070 8837 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 9631 8915 gene locus_tag LOCUS_23080 9631 8915 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_23080 11086 9632 gene locus_tag LOCUS_23090 11086 9632 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_23090 11276 11848 gene locus_tag LOCUS_23100 11276 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence151 <1 1523 gene locus_tag LOCUS_23110 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2517 2957 gene locus_tag LOCUS_23120 2517 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_23120 3666 8147 gene locus_tag LOCUS_23130 3666 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 8214 9155 gene locus_tag LOCUS_23140 8214 9155 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_23140 9812 9144 gene locus_tag LOCUS_23150 gene dhlB 9812 9144 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090289.1 protein_id gnl|my_center|LOCUS_23150 10370 9813 gene locus_tag LOCUS_23160 10370 9813 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 protein_id gnl|my_center|LOCUS_23160 11125 10379 gene locus_tag LOCUS_23170 11125 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 11744 11163 gene locus_tag LOCUS_23180 11744 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence152 2425 131 gene locus_tag LOCUS_23190 2425 131 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_23190 2797 3435 gene locus_tag LOCUS_23200 2797 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3435 4556 gene locus_tag LOCUS_23210 gene garK 3435 4556 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181434.1 protein_id gnl|my_center|LOCUS_23210 4919 6529 gene locus_tag LOCUS_23220 gene treF 4919 6529 CDS product cytoplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PS8 protein_id gnl|my_center|LOCUS_23220 6492 7463 gene locus_tag LOCUS_23230 gene yihR 6492 7463 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602494.1 protein_id gnl|my_center|LOCUS_23230 7671 8666 gene locus_tag LOCUS_23240 7671 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 8910 9518 gene locus_tag LOCUS_23250 gene arsC 8910 9518 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_23250 9605 10537 gene locus_tag LOCUS_23260 9605 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 10637 11425 gene locus_tag LOCUS_23270 10637 11425 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302068.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence153 942 292 gene locus_tag LOCUS_23280 942 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 8692 1517 gene locus_tag LOCUS_23290 8692 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 8987 10441 gene locus_tag LOCUS_23300 8987 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 10530 11303 gene locus_tag LOCUS_23310 10530 11303 CDS product RlpA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679809.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence154 189 908 gene locus_tag LOCUS_23320 189 908 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_23320 1576 956 gene locus_tag LOCUS_23330 1576 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1737 2162 gene locus_tag LOCUS_23340 1737 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2691 2215 gene locus_tag LOCUS_23350 gene smpB 2691 2215 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 protein_id gnl|my_center|LOCUS_23350 3118 2804 gene locus_tag LOCUS_23360 3118 2804 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_23360 5485 3236 gene locus_tag LOCUS_23370 gene pepX1 5485 3236 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_23370 7114 5627 gene locus_tag LOCUS_23380 7114 5627 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969867.1 protein_id gnl|my_center|LOCUS_23380 7463 7873 gene locus_tag LOCUS_23390 7463 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 7876 8556 gene locus_tag LOCUS_23400 7876 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 11597 10980 gene locus_tag LOCUS_23410 11597 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence155 224 3 gene locus_tag LOCUS_23420 224 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 383 240 gene locus_tag LOCUS_23430 383 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1408 575 gene locus_tag LOCUS_23440 gene cysQ 1408 575 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_23440 2366 1410 gene locus_tag LOCUS_23450 2366 1410 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_23450 2857 2378 gene locus_tag LOCUS_23460 2857 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3692 2868 gene locus_tag LOCUS_23470 3692 2868 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_23470 4394 3843 gene locus_tag LOCUS_23480 4394 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 4411 7443 gene locus_tag LOCUS_23490 4411 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 8460 7546 gene locus_tag LOCUS_23500 8460 7546 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_23500 11302 8678 gene locus_tag LOCUS_23510 gene parC 11302 8678 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence156 201 1184 gene locus_tag LOCUS_23520 201 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1513 1875 gene locus_tag LOCUS_23530 1513 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2215 2703 gene locus_tag LOCUS_23540 2215 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3009 4094 gene locus_tag LOCUS_23550 3009 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4995 4198 gene locus_tag LOCUS_23560 4995 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 7081 5219 gene locus_tag LOCUS_23570 7081 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 7713 7186 gene locus_tag LOCUS_23580 7713 7186 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_23580 7962 8465 gene locus_tag LOCUS_23590 7962 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 8848 9777 gene locus_tag LOCUS_23600 8848 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 10059 9916 gene locus_tag LOCUS_23610 10059 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 10131 11366 gene locus_tag LOCUS_23620 gene hutI 10131 11366 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_23620 >Feature sequence157 1163 1486 gene locus_tag LOCUS_23630 1163 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1513 2523 gene locus_tag LOCUS_23640 1513 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2771 3733 gene locus_tag LOCUS_23650 2771 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5579 3840 gene locus_tag LOCUS_23660 5579 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6245 5619 gene locus_tag LOCUS_23670 6245 5619 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_23670 6543 7919 gene locus_tag LOCUS_23680 6543 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7936 9684 gene locus_tag LOCUS_23690 7936 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701431.1 protein_id gnl|my_center|LOCUS_23690 11005 9749 gene locus_tag LOCUS_23700 gene amaA 11005 9749 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence158 111 2015 gene locus_tag LOCUS_23710 111 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 5714 3447 gene locus_tag LOCUS_23720 5714 3447 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_23720 5933 6604 gene locus_tag LOCUS_23730 5933 6604 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_23730 6732 9584 gene locus_tag LOCUS_23740 6732 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 10053 10436 gene locus_tag LOCUS_23750 10053 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 10977 11174 gene locus_tag LOCUS_23760 10977 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence159 538 323 gene locus_tag LOCUS_23770 538 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2727 1558 gene locus_tag LOCUS_23780 2727 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3696 2842 gene locus_tag LOCUS_23790 3696 2842 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258363.1 protein_id gnl|my_center|LOCUS_23790 5619 3700 gene locus_tag LOCUS_23800 5619 3700 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_23800 10318 5765 gene locus_tag LOCUS_23810 10318 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 11306 10476 gene locus_tag LOCUS_23820 gene prmA 11306 10476 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence160 54 2246 gene locus_tag LOCUS_23830 gene glnA 54 2246 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_23830 2452 3699 gene locus_tag LOCUS_23840 gene pepT 2452 3699 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_23840 8191 3749 gene locus_tag LOCUS_23850 8191 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9077 10279 gene locus_tag LOCUS_23860 9077 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence161 4264 935 gene locus_tag LOCUS_23870 4264 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 5162 4284 gene locus_tag LOCUS_23880 5162 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 9206 5442 gene locus_tag LOCUS_23890 9206 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 <11303 9529 gene locus_tag LOCUS_23900 <11303 9529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202542.1:beta-mannosidase >Feature sequence162 761 1480 gene locus_tag LOCUS_23910 761 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1750 2343 gene locus_tag LOCUS_23920 1750 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_23920 4024 2600 gene locus_tag LOCUS_23930 gene sdaA 4024 2600 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_23930 4648 4091 gene locus_tag LOCUS_23940 4648 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 5102 4815 gene locus_tag LOCUS_23950 5102 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 5985 5383 gene locus_tag LOCUS_23960 5985 5383 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_23960 6727 6164 gene locus_tag LOCUS_23970 6727 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 7008 8156 gene locus_tag LOCUS_23980 gene degP/Q 7008 8156 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_23980 8456 9040 gene locus_tag LOCUS_23990 8456 9040 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_23990 9755 9042 gene locus_tag LOCUS_24000 gene pyrH 9755 9042 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_24000 10756 9923 gene locus_tag LOCUS_24010 gene tsf 10756 9923 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence163 <1 1581 gene locus_tag LOCUS_24020 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:formate dehydrogenase 1774 2679 gene locus_tag LOCUS_24030 1774 2679 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_24030 2694 3179 gene locus_tag LOCUS_24040 gene moaC 2694 3179 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_24040 3172 4341 gene locus_tag LOCUS_24050 3172 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 4385 5092 gene locus_tag LOCUS_24060 4385 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5560 5144 gene locus_tag LOCUS_24070 gene moaE 5560 5144 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31705 protein_id gnl|my_center|LOCUS_24070 5812 5570 gene locus_tag LOCUS_24080 5812 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24080 6448 7548 gene locus_tag LOCUS_24090 6448 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 7723 10659 gene locus_tag LOCUS_24100 7723 10659 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence164 2064 700 gene locus_tag LOCUS_24110 2064 700 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_24110 3499 2054 gene locus_tag LOCUS_24120 3499 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_24120 6663 3523 gene locus_tag LOCUS_24130 6663 3523 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_24130 7537 6857 gene locus_tag LOCUS_24140 7537 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 8572 7715 gene locus_tag LOCUS_24150 8572 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 10919 8577 gene locus_tag LOCUS_24160 10919 8577 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence165 3 167 gene locus_tag LOCUS_24170 3 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 227 496 gene locus_tag LOCUS_24180 227 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 535 1536 gene locus_tag LOCUS_24190 535 1536 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_24190 1732 2388 gene locus_tag LOCUS_24200 1732 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2679 2975 gene locus_tag LOCUS_24210 2679 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 3224 3577 gene locus_tag LOCUS_24220 3224 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3970 4305 gene locus_tag LOCUS_24230 3970 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4605 4832 gene locus_tag LOCUS_24240 4605 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 5268 4879 gene locus_tag LOCUS_24250 5268 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 8077 5246 gene locus_tag LOCUS_24260 8077 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 8260 9078 gene locus_tag LOCUS_24270 8260 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 9433 9071 gene locus_tag LOCUS_24280 9433 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 9635 10468 gene locus_tag LOCUS_24290 9635 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence166 <1 2585 gene locus_tag LOCUS_24300 <1 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120738.1:cytochrome c 2595 4031 gene locus_tag LOCUS_24310 2595 4031 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120737.1 protein_id gnl|my_center|LOCUS_24310 4092 5408 gene locus_tag LOCUS_24320 4092 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 5616 6434 gene locus_tag LOCUS_24330 5616 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 6502 6978 gene locus_tag LOCUS_24340 6502 6978 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_24340 7186 8142 gene locus_tag LOCUS_24350 gene ltd 7186 8142 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_24350 8201 9298 gene locus_tag LOCUS_24360 8201 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 9303 10493 gene locus_tag LOCUS_24370 gene kbl 9303 10493 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_24370 >Feature sequence167 <1 765 gene locus_tag LOCUS_24380 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009931069.1:ABC transporter permease 835 1221 gene locus_tag LOCUS_24390 835 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1188 1394 gene locus_tag LOCUS_24400 1188 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1664 2074 gene locus_tag LOCUS_24410 1664 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2237 3160 gene locus_tag LOCUS_24420 2237 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24420 3466 3735 gene locus_tag LOCUS_24430 3466 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4995 3880 gene locus_tag LOCUS_24440 4995 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 7997 5322 gene locus_tag LOCUS_24450 7997 5322 CDS product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_24450 9189 8074 gene locus_tag LOCUS_24460 9189 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 protein_id gnl|my_center|LOCUS_24460 10323 9202 gene locus_tag LOCUS_24470 10323 9202 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_24470 >Feature sequence168 822 1277 gene locus_tag LOCUS_24480 822 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1414 2040 gene locus_tag LOCUS_24490 1414 2040 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_24490 3463 2066 gene locus_tag LOCUS_24500 3463 2066 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_24500 4447 3494 gene locus_tag LOCUS_24510 4447 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4753 4538 gene locus_tag LOCUS_24520 4753 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6626 5004 gene locus_tag LOCUS_24530 6626 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_24530 9588 6769 gene locus_tag LOCUS_24540 9588 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence169 329 1441 gene locus_tag LOCUS_24550 329 1441 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_24550 3888 1519 gene locus_tag LOCUS_24560 3888 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4364 6952 gene locus_tag LOCUS_24570 gene mutS 4364 6952 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_24570 7114 7830 gene locus_tag LOCUS_24580 gene dapB 7114 7830 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_24580 8135 9175 gene locus_tag LOCUS_24590 8135 9175 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_24590 10460 9216 gene locus_tag LOCUS_24600 gene rocD 10460 9216 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence170 <1 2130 gene locus_tag LOCUS_24610 <1 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2L2:beta-galactosidase 3291 2146 gene locus_tag LOCUS_24620 3291 2146 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_24620 3818 3291 gene locus_tag LOCUS_24630 3818 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4372 5736 gene locus_tag LOCUS_24640 4372 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 7049 5769 gene locus_tag LOCUS_24650 7049 5769 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_24650 7483 8214 gene locus_tag LOCUS_24660 7483 8214 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_24660 >Feature sequence171 771 73 gene locus_tag LOCUS_24670 771 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1279 1830 gene locus_tag LOCUS_24680 1279 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2589 1867 gene locus_tag LOCUS_24690 2589 1867 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_24690 3996 2710 gene locus_tag LOCUS_24700 gene dctD 3996 2710 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_24700 5374 4178 gene locus_tag LOCUS_24710 5374 4178 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_24710 6140 5430 gene locus_tag LOCUS_24720 6140 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 7280 6171 gene locus_tag LOCUS_24730 7280 6171 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_24730 8908 7457 gene locus_tag LOCUS_24740 8908 7457 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_24740 9936 8983 gene locus_tag LOCUS_24750 gene rocF 9936 8983 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_24750 >Feature sequence172 222 1259 gene locus_tag LOCUS_24760 222 1259 CDS product plasmid replication initiator protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 protein_id gnl|my_center|LOCUS_24760 1531 1262 gene locus_tag LOCUS_24770 1531 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1812 1531 gene locus_tag LOCUS_24780 1812 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2144 2072 gene locus_tag LOCUS_t00150 2144 2072 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3058 2240 gene locus_tag LOCUS_24790 3058 2240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_24790 3532 5769 gene locus_tag LOCUS_24800 3532 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 6759 5872 gene locus_tag LOCUS_24810 6759 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 6899 7495 gene locus_tag LOCUS_24820 gene caiE 6899 7495 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHD9 protein_id gnl|my_center|LOCUS_24820 7522 8487 gene locus_tag LOCUS_24830 gene pqqB 7522 8487 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP45 protein_id gnl|my_center|LOCUS_24830 10016 8727 gene locus_tag LOCUS_24840 gene glgC 10016 8727 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence173 269 27 gene locus_tag LOCUS_24850 269 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1682 303 gene locus_tag LOCUS_24860 1682 303 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_24860 2637 1747 gene locus_tag LOCUS_24870 2637 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3249 4748 gene locus_tag LOCUS_24880 3249 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 5186 7336 gene locus_tag LOCUS_24890 5186 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 8489 7458 gene locus_tag LOCUS_24900 gene ykfA 8489 7458 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_24900 8625 9497 gene locus_tag LOCUS_24910 8625 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 9570 10172 gene locus_tag LOCUS_24920 9570 10172 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723074.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence174 2598 154 gene locus_tag LOCUS_24930 2598 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3128 2703 gene locus_tag LOCUS_24940 3128 2703 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_24940 4409 3141 gene locus_tag LOCUS_24950 4409 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 5707 4406 gene locus_tag LOCUS_24960 5707 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 5783 6196 gene locus_tag LOCUS_24970 5783 6196 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 protein_id gnl|my_center|LOCUS_24970 8946 6226 gene locus_tag LOCUS_24980 8946 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 9844 9155 gene locus_tag LOCUS_24990 9844 9155 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence175 <1 6519 gene locus_tag LOCUS_25000 <1 6519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 8250 6631 gene locus_tag LOCUS_25010 gene arsA 8250 6631 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121660.1 protein_id gnl|my_center|LOCUS_25010 9017 8496 gene locus_tag LOCUS_25020 gene apt 9017 8496 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9H4 protein_id gnl|my_center|LOCUS_25020 9322 9014 gene locus_tag LOCUS_25030 9322 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 10236 9442 gene locus_tag LOCUS_25040 10236 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence176 <1 1290 gene locus_tag LOCUS_25050 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797236.1:membrane protein 1534 1902 gene locus_tag LOCUS_25060 1534 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_25060 1974 2630 gene locus_tag LOCUS_25070 1974 2630 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 protein_id gnl|my_center|LOCUS_25070 2642 3526 gene locus_tag LOCUS_25080 2642 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3533 4288 gene locus_tag LOCUS_25090 3533 4288 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_25090 6070 4682 gene locus_tag LOCUS_25100 6070 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 7301 6357 gene locus_tag LOCUS_25110 7301 6357 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_25110 7982 7509 gene locus_tag LOCUS_25120 7982 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8555 8037 gene locus_tag LOCUS_25130 8555 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 9068 8640 gene locus_tag LOCUS_25140 9068 8640 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_25140 <10239 9455 gene locus_tag LOCUS_25150 <10239 9455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964090.1:inward rectifier potassium channel Irk >Feature sequence177 1092 463 gene locus_tag LOCUS_25160 1092 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747124.1 protein_id gnl|my_center|LOCUS_25160 1946 1326 gene locus_tag LOCUS_25170 1946 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2946 2089 gene locus_tag LOCUS_25180 2946 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3967 2927 gene locus_tag LOCUS_25190 3967 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 4048 4617 gene locus_tag LOCUS_25200 gene ruvC 4048 4617 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_25200 5069 4674 gene locus_tag LOCUS_25210 5069 4674 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_25210 5560 5087 gene locus_tag LOCUS_25220 gene greA 5560 5087 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_25220 7008 5947 gene locus_tag LOCUS_25230 7008 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence178 1600 530 gene locus_tag LOCUS_25240 1600 530 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_25240 2866 1601 gene locus_tag LOCUS_25250 2866 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3543 2866 gene locus_tag LOCUS_25260 3543 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 5519 3630 gene locus_tag LOCUS_25270 5519 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 5827 6573 gene locus_tag LOCUS_25280 5827 6573 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_25280 6774 8144 gene locus_tag LOCUS_25290 6774 8144 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_25290 8148 8501 gene locus_tag LOCUS_25300 8148 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence179 1210 1836 gene locus_tag LOCUS_25310 1210 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1918 2862 gene locus_tag LOCUS_25320 1918 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2866 3828 gene locus_tag LOCUS_25330 2866 3828 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_25330 3889 4263 gene locus_tag LOCUS_25340 gene ptpS 3889 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_25340 4263 5216 gene locus_tag LOCUS_25350 4263 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6035 5187 gene locus_tag LOCUS_25360 6035 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 6159 6890 gene locus_tag LOCUS_25370 6159 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 6890 7822 gene locus_tag LOCUS_25380 6890 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 7893 8324 gene locus_tag LOCUS_25390 7893 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 8334 9317 gene locus_tag LOCUS_25400 8334 9317 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_25400 9398 9892 gene locus_tag LOCUS_25410 9398 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence180 782 417 gene locus_tag LOCUS_25420 782 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1365 796 gene locus_tag LOCUS_25430 1365 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963179.1 protein_id gnl|my_center|LOCUS_25430 2115 1366 gene locus_tag LOCUS_25440 2115 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4591 2252 gene locus_tag LOCUS_25450 4591 2252 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_25450 5506 4823 gene locus_tag LOCUS_25460 5506 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 5775 5467 gene locus_tag LOCUS_25470 5775 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25470 6363 5785 gene locus_tag LOCUS_25480 6363 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 6745 7761 gene locus_tag LOCUS_25490 6745 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 8381 9574 gene locus_tag LOCUS_25500 gene mauG 8381 9574 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence181 467 2947 gene locus_tag LOCUS_25510 gene priA 467 2947 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_25510 3419 2982 gene locus_tag LOCUS_25520 3419 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3888 4805 gene locus_tag LOCUS_25530 3888 4805 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_25530 4910 5539 gene locus_tag LOCUS_25540 4910 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 6222 5935 gene locus_tag LOCUS_25550 6222 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 8318 6660 gene locus_tag LOCUS_25560 8318 6660 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_25560 9748 8420 gene locus_tag LOCUS_25570 9748 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence182 515 1516 gene locus_tag LOCUS_25580 515 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1649 2098 gene locus_tag LOCUS_25590 1649 2098 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_25590 2091 2480 gene locus_tag LOCUS_25600 2091 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_25600 2717 3553 gene locus_tag LOCUS_25610 2717 3553 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_25610 4129 3605 gene locus_tag LOCUS_25620 4129 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 4539 4057 gene locus_tag LOCUS_25630 4539 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 7420 5006 gene locus_tag LOCUS_25640 7420 5006 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_25640 7912 7622 gene locus_tag LOCUS_25650 7912 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 8630 9715 gene locus_tag LOCUS_25660 8630 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence183 9859 6230 gene locus_tag LOCUS_25670 9859 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence184 1462 1037 gene locus_tag LOCUS_25680 1462 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1731 3302 gene locus_tag LOCUS_25690 1731 3302 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_25690 3416 4078 gene locus_tag LOCUS_25700 3416 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4155 5129 gene locus_tag LOCUS_25710 4155 5129 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764986.1 protein_id gnl|my_center|LOCUS_25710 5202 7880 gene locus_tag LOCUS_25720 5202 7880 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_25720 7884 8777 gene locus_tag LOCUS_25730 7884 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence185 1326 2480 gene locus_tag LOCUS_25740 gene dinB 1326 2480 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 protein_id gnl|my_center|LOCUS_25740 2489 5425 gene locus_tag LOCUS_25750 2489 5425 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 protein_id gnl|my_center|LOCUS_25750 5550 6251 gene locus_tag LOCUS_25760 5550 6251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_25760 6257 7669 gene locus_tag LOCUS_25770 6257 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_25770 7666 8991 gene locus_tag LOCUS_25780 7666 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 9406 9972 gene locus_tag LOCUS_25790 9406 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence186 1669 68 gene locus_tag LOCUS_25800 1669 68 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_25800 2102 1776 gene locus_tag LOCUS_25810 2102 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2273 3130 gene locus_tag LOCUS_25820 2273 3130 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_25820 3166 3522 gene locus_tag LOCUS_25830 3166 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3968 5077 gene locus_tag LOCUS_25840 3968 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 6932 5211 gene locus_tag LOCUS_25850 6932 5211 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_25850 7567 6929 gene locus_tag LOCUS_25860 7567 6929 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_25860 7808 7635 gene locus_tag LOCUS_25870 7808 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 8123 7812 gene locus_tag LOCUS_25880 8123 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 8688 8371 gene locus_tag LOCUS_25890 8688 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 9103 8795 gene locus_tag LOCUS_25900 9103 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence187 2295 1858 gene locus_tag LOCUS_25910 2295 1858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056732.1 protein_id gnl|my_center|LOCUS_25910 4233 2308 gene locus_tag LOCUS_25920 gene glgB 4233 2308 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_25920 4436 5479 gene locus_tag LOCUS_25930 4436 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 6387 5476 gene locus_tag LOCUS_25940 6387 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6625 7284 gene locus_tag LOCUS_25950 6625 7284 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_25950 8275 7859 gene locus_tag LOCUS_25960 8275 7859 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence188 718 1584 gene locus_tag LOCUS_25970 gene rpoD 718 1584 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_25970 1658 2773 gene locus_tag LOCUS_25980 1658 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2900 3577 gene locus_tag LOCUS_25990 2900 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3704 4171 gene locus_tag LOCUS_26000 3704 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4275 4691 gene locus_tag LOCUS_26010 4275 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 6529 4751 gene locus_tag LOCUS_26020 6529 4751 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_26020 7200 6526 gene locus_tag LOCUS_26030 gene cmk 7200 6526 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_26030 8817 7309 gene locus_tag LOCUS_26040 8817 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 9348 9127 gene locus_tag LOCUS_26050 9348 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence189 1991 1083 gene locus_tag LOCUS_26060 gene porP 1991 1083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_26060 4364 3093 gene locus_tag LOCUS_26070 gene ilvA 4364 3093 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGL1 protein_id gnl|my_center|LOCUS_26070 5529 4483 gene locus_tag LOCUS_26080 5529 4483 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_26080 6526 5873 gene locus_tag LOCUS_26090 6526 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 7760 6600 gene locus_tag LOCUS_26100 7760 6600 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_26100 <9781 7858 gene locus_tag LOCUS_26110 <9781 7858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87S51:polyphosphate kinase >Feature sequence190 980 102 gene locus_tag LOCUS_26120 980 102 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_26120 1142 1636 gene locus_tag LOCUS_26130 1142 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083642.1 protein_id gnl|my_center|LOCUS_26130 2928 1843 gene locus_tag LOCUS_26140 gene aroC 2928 1843 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_26140 3267 5657 gene locus_tag LOCUS_26150 gene mutS2 3267 5657 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_26150 6288 5869 gene locus_tag LOCUS_26160 gene ndk 6288 5869 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_26160 6468 7472 gene locus_tag LOCUS_26170 gene fjo19 6468 7472 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_26170 7567 8457 gene locus_tag LOCUS_26180 7567 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8880 9500 gene locus_tag LOCUS_26190 8880 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence191 1374 2066 gene locus_tag LOCUS_26200 1374 2066 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_26200 2168 2566 gene locus_tag LOCUS_26210 2168 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2680 3081 gene locus_tag LOCUS_26220 2680 3081 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_26220 3245 4156 gene locus_tag LOCUS_26230 3245 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4230 5513 gene locus_tag LOCUS_26240 4230 5513 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_26240 5614 6810 gene locus_tag LOCUS_26250 5614 6810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_26250 7490 7257 gene locus_tag LOCUS_26260 7490 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 8392 8117 gene locus_tag LOCUS_26270 8392 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 8986 8408 gene locus_tag LOCUS_26280 gene yozB 8986 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_26280 9643 8993 gene locus_tag LOCUS_26290 9643 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence192 <1 1647 gene locus_tag LOCUS_26300 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405361.1:peptidase S9 2377 5541 gene locus_tag LOCUS_26310 2377 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6599 5658 gene locus_tag LOCUS_26320 6599 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 7630 6728 gene locus_tag LOCUS_26330 7630 6728 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 protein_id gnl|my_center|LOCUS_26330 8333 7623 gene locus_tag LOCUS_26340 gene pxpB 8333 7623 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383180.1 protein_id gnl|my_center|LOCUS_26340 9083 8343 gene locus_tag LOCUS_26350 9083 8343 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UC7 protein_id gnl|my_center|LOCUS_26350 <9670 9105 gene locus_tag LOCUS_26360 <9670 9105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964380.1:glycerol acyltransferase >Feature sequence193 1979 777 gene locus_tag LOCUS_26370 1979 777 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_26370 2420 2082 gene locus_tag LOCUS_26380 2420 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_26380 3227 2442 gene locus_tag LOCUS_26390 gene bamD 3227 2442 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_26390 3415 4341 gene locus_tag LOCUS_26400 3415 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4507 5373 gene locus_tag LOCUS_26410 4507 5373 CDS product GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 protein_id gnl|my_center|LOCUS_26410 5553 6350 gene locus_tag LOCUS_26420 gene uspA 5553 6350 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_26420 6760 6981 gene locus_tag LOCUS_26430 6760 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 7863 8498 gene locus_tag LOCUS_26440 7863 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence194 1962 1015 gene locus_tag LOCUS_26450 1962 1015 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_26450 2904 2122 gene locus_tag LOCUS_26460 2904 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 4280 2985 gene locus_tag LOCUS_26470 4280 2985 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_26470 4623 5897 gene locus_tag LOCUS_26480 gene tyrS 4623 5897 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_26480 6065 8098 gene locus_tag LOCUS_26490 6065 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 8394 9473 gene locus_tag LOCUS_26500 8394 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence195 2429 981 gene locus_tag LOCUS_26510 2429 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2501 3055 gene locus_tag LOCUS_26520 2501 3055 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_26520 3299 3733 gene locus_tag LOCUS_26530 3299 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3850 5715 gene locus_tag LOCUS_26540 gene argS 3850 5715 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_26540 5755 7440 gene locus_tag LOCUS_26550 gene glnS 5755 7440 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_26550 7878 7504 gene locus_tag LOCUS_26560 7878 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 8638 7919 gene locus_tag LOCUS_26570 8638 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 9254 8781 gene locus_tag LOCUS_26580 gene lrp 9254 8781 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45265 protein_id gnl|my_center|LOCUS_26580 >Feature sequence196 <1 1158 gene locus_tag LOCUS_26590 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0E1:tricorn protease 1414 1650 gene locus_tag LOCUS_26600 1414 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2548 1814 gene locus_tag LOCUS_26610 2548 1814 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_26610 2715 3437 gene locus_tag LOCUS_26620 2715 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3474 4025 gene locus_tag LOCUS_26630 3474 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26630 4018 5580 gene locus_tag LOCUS_26640 4018 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 6260 5577 gene locus_tag LOCUS_26650 gene trmD 6260 5577 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM8 protein_id gnl|my_center|LOCUS_26650 6450 6755 gene locus_tag LOCUS_26660 6450 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 7423 6794 gene locus_tag LOCUS_26670 7423 6794 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_26670 8136 7579 gene locus_tag LOCUS_26680 gene ubiX 8136 7579 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ8 protein_id gnl|my_center|LOCUS_26680 8431 8934 gene locus_tag LOCUS_26690 8431 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence197 106 555 gene locus_tag LOCUS_26700 106 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26700 904 1782 gene locus_tag LOCUS_26710 904 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1782 2444 gene locus_tag LOCUS_26720 1782 2444 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_26720 3302 2682 gene locus_tag LOCUS_26730 gene miaE 3302 2682 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_26730 4498 3314 gene locus_tag LOCUS_26740 4498 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4751 6934 gene locus_tag LOCUS_26750 4751 6934 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_26750 6943 7749 gene locus_tag LOCUS_26760 6943 7749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202009.1 protein_id gnl|my_center|LOCUS_26760 7808 8347 gene locus_tag LOCUS_26770 7808 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence198 27 2876 gene locus_tag LOCUS_26780 gene uvrA2 27 2876 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_26780 3267 4694 gene locus_tag LOCUS_26790 3267 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_26790 5931 4687 gene locus_tag LOCUS_26800 5931 4687 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_26800 6202 8001 gene locus_tag LOCUS_26810 6202 8001 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence199 754 344 gene locus_tag LOCUS_26820 754 344 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_26820 1251 2315 gene locus_tag LOCUS_26830 1251 2315 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_26830 2359 3093 gene locus_tag LOCUS_26840 2359 3093 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_26840 6270 3757 gene locus_tag LOCUS_26850 6270 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 6661 8085 gene locus_tag LOCUS_26860 6661 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence200 3906 4658 gene locus_tag LOCUS_26870 3906 4658 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_26870 5713 4976 gene locus_tag LOCUS_26880 5713 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 7031 5841 gene locus_tag LOCUS_26890 7031 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 7078 7992 gene locus_tag LOCUS_26900 7078 7992 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_26900 8489 8238 gene locus_tag LOCUS_26910 gene ykoF 8489 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_26910 9420 8566 gene locus_tag LOCUS_26920 9420 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence201 2388 556 gene locus_tag LOCUS_26930 2388 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3124 2495 gene locus_tag LOCUS_26940 3124 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 4129 3206 gene locus_tag LOCUS_26950 gene parB 4129 3206 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_26950 5058 4249 gene locus_tag LOCUS_26960 5058 4249 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_26960 5801 5121 gene locus_tag LOCUS_26970 5801 5121 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_26970 7055 5889 gene locus_tag LOCUS_26980 7055 5889 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_26980 7716 7063 gene locus_tag LOCUS_26990 7716 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 8529 7741 gene locus_tag LOCUS_27000 8529 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946941.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence202 4208 1275 gene locus_tag LOCUS_27010 4208 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4969 5868 gene locus_tag LOCUS_27020 4969 5868 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_27020 5917 6339 gene locus_tag LOCUS_27030 5917 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_27030 7391 6480 gene locus_tag LOCUS_27040 7391 6480 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028189.1 protein_id gnl|my_center|LOCUS_27040 7716 9506 gene locus_tag LOCUS_27050 7716 9506 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence203 <1 957 gene locus_tag LOCUS_27060 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791384.1:mannose-1-phosphate guanylyltransferase 1162 2400 gene locus_tag LOCUS_27070 1162 2400 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186419.1 protein_id gnl|my_center|LOCUS_27070 3736 2630 gene locus_tag LOCUS_27080 gene mnmA 3736 2630 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_27080 4470 3823 gene locus_tag LOCUS_27090 4470 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 5025 4720 gene locus_tag LOCUS_27100 5025 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5686 6549 gene locus_tag LOCUS_27110 5686 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 7237 6611 gene locus_tag LOCUS_27120 7237 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 7675 8634 gene locus_tag LOCUS_27130 7675 8634 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence204 6030 2209 gene locus_tag LOCUS_27140 gene rpoB 6030 2209 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_27140 6719 6336 gene locus_tag LOCUS_27150 gene rplL 6719 6336 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_27150 7357 6809 gene locus_tag LOCUS_27160 7357 6809 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_27160 8070 7378 gene locus_tag LOCUS_27170 gene rplA 8070 7378 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_27170 8601 8140 gene locus_tag LOCUS_27180 gene rplK 8601 8140 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_27180 9262 8714 gene locus_tag LOCUS_27190 gene nusG 9262 8714 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_27190 >Feature sequence205 <1 928 gene locus_tag LOCUS_27200 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962298.1:8-amino-7-oxononanoate synthase 921 1553 gene locus_tag LOCUS_27210 gene bioD 921 1553 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_27210 1489 2868 gene locus_tag LOCUS_27220 gene bioA 1489 2868 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_27220 2849 4024 gene locus_tag LOCUS_27230 2849 4024 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_27230 4183 4770 gene locus_tag LOCUS_27240 4183 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4763 5905 gene locus_tag LOCUS_27250 gene bioB 4763 5905 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_27250 5905 6543 gene locus_tag LOCUS_27260 5905 6543 CDS product SanA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462605.1 protein_id gnl|my_center|LOCUS_27260 6634 7389 gene locus_tag LOCUS_27270 gene tpiA 6634 7389 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_27270 8174 7386 gene locus_tag LOCUS_27280 8174 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 9331 8252 gene locus_tag LOCUS_27290 9331 8252 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence206 575 1366 gene locus_tag LOCUS_27300 gene lpxH 575 1366 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_27300 1374 2114 gene locus_tag LOCUS_27310 1374 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3449 2115 gene locus_tag LOCUS_27320 3449 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3926 5458 gene locus_tag LOCUS_27330 3926 5458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_27330 5538 7283 gene locus_tag LOCUS_27340 5538 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 7381 7839 gene locus_tag LOCUS_27350 7381 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 9206 7911 gene locus_tag LOCUS_27360 9206 7911 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946567.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence207 832 518 gene locus_tag LOCUS_27370 832 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1009 2445 gene locus_tag LOCUS_27380 1009 2445 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_27380 2579 4213 gene locus_tag LOCUS_27390 2579 4213 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_27390 6116 4275 gene locus_tag LOCUS_27400 6116 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 6494 7420 gene locus_tag LOCUS_27410 6494 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 8408 7533 gene locus_tag LOCUS_27420 8408 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_27420 8589 8960 gene locus_tag LOCUS_27430 8589 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence208 5833 3812 gene locus_tag LOCUS_27440 5833 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7526 5913 gene locus_tag LOCUS_27450 7526 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 protein_id gnl|my_center|LOCUS_27450 8823 7834 gene locus_tag LOCUS_27460 8823 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence209 967 1530 gene locus_tag LOCUS_27470 967 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1533 2678 gene locus_tag LOCUS_27480 1533 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2689 3591 gene locus_tag LOCUS_27490 2689 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3678 5000 gene locus_tag LOCUS_27500 gene rmuC 3678 5000 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_27500 5570 4986 gene locus_tag LOCUS_27510 5570 4986 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_27510 6541 5570 gene locus_tag LOCUS_27520 6541 5570 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_27520 7637 6612 gene locus_tag LOCUS_27530 7637 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 8643 8095 gene locus_tag LOCUS_27540 8643 8095 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_27540 9217 8651 gene locus_tag LOCUS_27550 9217 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence210 <1 1626 gene locus_tag LOCUS_27560 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase 2692 5748 gene locus_tag LOCUS_27570 2692 5748 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_27570 5787 7133 gene locus_tag LOCUS_27580 5787 7133 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_27580 7252 9129 gene locus_tag LOCUS_27590 7252 9129 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence211 525 2507 gene locus_tag LOCUS_27600 525 2507 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405118.1 protein_id gnl|my_center|LOCUS_27600 3403 2645 gene locus_tag LOCUS_27610 3403 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3427 3921 gene locus_tag LOCUS_27620 3427 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4129 4599 gene locus_tag LOCUS_27630 4129 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 4745 6094 gene locus_tag LOCUS_27640 4745 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6383 7660 gene locus_tag LOCUS_27650 6383 7660 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_27650 8397 7942 gene locus_tag LOCUS_27660 8397 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence212 653 276 gene locus_tag LOCUS_27670 653 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1215 2135 gene locus_tag LOCUS_27680 1215 2135 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404222.1 protein_id gnl|my_center|LOCUS_27680 4149 2155 gene locus_tag LOCUS_27690 4149 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 4214 4489 gene locus_tag LOCUS_27700 4214 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 6815 4851 gene locus_tag LOCUS_27710 6815 4851 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_27710 <9222 6983 gene locus_tag LOCUS_27720 <9222 6983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence213 7411 56 gene locus_tag LOCUS_27730 7411 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 7777 8958 gene locus_tag LOCUS_27740 7777 8958 CDS product beta-carotene 15,15'-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence214 210 1571 gene locus_tag LOCUS_27750 210 1571 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873462.1 protein_id gnl|my_center|LOCUS_27750 1651 2052 gene locus_tag LOCUS_27760 1651 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2973 4679 gene locus_tag LOCUS_27770 gene ggt 2973 4679 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_27770 4794 5384 gene locus_tag LOCUS_27780 4794 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 5884 5381 gene locus_tag LOCUS_27790 5884 5381 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_27790 6849 5881 gene locus_tag LOCUS_27800 6849 5881 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644512.1 protein_id gnl|my_center|LOCUS_27800 7542 6874 gene locus_tag LOCUS_27810 7542 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8645 7755 gene locus_tag LOCUS_27820 8645 7755 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence215 239 1003 gene locus_tag LOCUS_27830 239 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 protein_id gnl|my_center|LOCUS_27830 1006 1935 gene locus_tag LOCUS_27840 1006 1935 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_27840 2093 2494 gene locus_tag LOCUS_27850 2093 2494 CDS product cytochrome C biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_27850 2589 5465 gene locus_tag LOCUS_27860 2589 5465 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_27860 5465 6250 gene locus_tag LOCUS_27870 5465 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_27870 6264 6545 gene locus_tag LOCUS_27880 6264 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 6594 6770 gene locus_tag LOCUS_27890 6594 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 7472 6789 gene locus_tag LOCUS_27900 gene udk 7472 6789 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0A8 protein_id gnl|my_center|LOCUS_27900 7698 9035 gene locus_tag LOCUS_27910 7698 9035 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence216 429 1007 gene locus_tag LOCUS_27920 429 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_27920 1148 1795 gene locus_tag LOCUS_27930 1148 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_27930 1802 3532 gene locus_tag LOCUS_27940 1802 3532 CDS product dynamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_27940 3537 3758 gene locus_tag LOCUS_27950 3537 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 4331 3765 gene locus_tag LOCUS_27960 4331 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27960 5207 4407 gene locus_tag LOCUS_27970 5207 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27970 5370 5777 gene locus_tag LOCUS_27980 5370 5777 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_27980 6156 5875 gene locus_tag LOCUS_27990 6156 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 6197 6730 gene locus_tag LOCUS_28000 6197 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 7136 6798 gene locus_tag LOCUS_28010 7136 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 8205 7588 gene locus_tag LOCUS_28020 8205 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 8241 8882 gene locus_tag LOCUS_28030 gene pyrE 8241 8882 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYF1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence217 3 176 gene locus_tag LOCUS_28040 3 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 564 3887 gene locus_tag LOCUS_28050 564 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 4743 4276 gene locus_tag LOCUS_28060 4743 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 4922 5107 gene locus_tag LOCUS_28070 4922 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 5857 5399 gene locus_tag LOCUS_28080 5857 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 6472 5924 gene locus_tag LOCUS_28090 6472 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 7217 6669 gene locus_tag LOCUS_28100 7217 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 <9097 7286 gene locus_tag LOCUS_28110 <9097 7286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203288.1:membrane protein >Feature sequence218 2332 3138 gene locus_tag LOCUS_28120 2332 3138 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_28120 6471 3109 gene locus_tag LOCUS_28130 6471 3109 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_28130 6569 6796 gene locus_tag LOCUS_28140 6569 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 6850 7074 gene locus_tag LOCUS_28150 6850 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 7093 7962 gene locus_tag LOCUS_28160 7093 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 8181 7963 gene locus_tag LOCUS_28170 8181 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 8696 8199 gene locus_tag LOCUS_28180 8696 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence219 226 2184 gene locus_tag LOCUS_28190 226 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2502 2347 gene locus_tag LOCUS_28200 2502 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2788 4863 gene locus_tag LOCUS_28210 2788 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 4907 6646 gene locus_tag LOCUS_28220 4907 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 7087 7872 gene locus_tag LOCUS_28230 7087 7872 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645452.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence220 1425 3017 gene locus_tag LOCUS_28240 gene bshC 1425 3017 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_28240 3071 4537 gene locus_tag LOCUS_28250 gene accC 3071 4537 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_28250 4813 4583 gene locus_tag LOCUS_28260 4813 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 5680 4835 gene locus_tag LOCUS_28270 5680 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 5871 7217 gene locus_tag LOCUS_28280 gene tilS 5871 7217 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_28280 7382 8371 gene locus_tag LOCUS_28290 7382 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence221 2040 1057 gene locus_tag LOCUS_28300 2040 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2360 2040 gene locus_tag LOCUS_28310 2360 2040 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_28310 3027 2536 gene locus_tag LOCUS_28320 3027 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3203 3724 gene locus_tag LOCUS_28330 gene aroK 3203 3724 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_28330 3721 4323 gene locus_tag LOCUS_28340 3721 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 5350 4703 gene locus_tag LOCUS_28350 5350 4703 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence222 1596 4205 gene locus_tag LOCUS_28360 1596 4205 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_28360 4236 5177 gene locus_tag LOCUS_28370 4236 5177 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_28370 5726 7276 gene locus_tag LOCUS_28380 5726 7276 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107274.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence223 223 615 gene locus_tag LOCUS_28390 223 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 962 2716 gene locus_tag LOCUS_28400 962 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3558 2764 gene locus_tag LOCUS_28410 3558 2764 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_28410 3621 4115 gene locus_tag LOCUS_28420 gene sixA 3621 4115 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_28420 4187 4450 gene locus_tag LOCUS_28430 4187 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 5593 4451 gene locus_tag LOCUS_28440 5593 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 6889 5663 gene locus_tag LOCUS_28450 6889 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence224 1367 612 gene locus_tag LOCUS_28460 1367 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402809.1 protein_id gnl|my_center|LOCUS_28460 2210 1566 gene locus_tag LOCUS_28470 2210 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3088 2237 gene locus_tag LOCUS_28480 3088 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3663 5018 gene locus_tag LOCUS_28490 gene ffh 3663 5018 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_28490 6765 5062 gene locus_tag LOCUS_28500 6765 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 <8715 6926 gene locus_tag LOCUS_28510 <8715 6926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence225 <1 1096 gene locus_tag LOCUS_28520 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510954.1:aryl sulfotransferase 1474 3615 gene locus_tag LOCUS_28530 1474 3615 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203284.1 protein_id gnl|my_center|LOCUS_28530 3954 3739 gene locus_tag LOCUS_28540 3954 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 4996 3977 gene locus_tag LOCUS_28550 4996 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 5358 5116 gene locus_tag LOCUS_28560 5358 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28560 6343 5360 gene locus_tag LOCUS_28570 gene glpQ 6343 5360 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_28570 6653 7708 gene locus_tag LOCUS_28580 6653 7708 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078027.1 protein_id gnl|my_center|LOCUS_28580 7742 8440 gene locus_tag LOCUS_28590 7742 8440 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence226 1810 209 gene locus_tag LOCUS_28600 1810 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 5139 1876 gene locus_tag LOCUS_28610 5139 1876 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_28610 5520 6365 gene locus_tag LOCUS_28620 5520 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 6589 6458 gene locus_tag LOCUS_28630 6589 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 8214 6871 gene locus_tag LOCUS_28640 gene rhlE 8214 6871 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence227 2344 3429 gene locus_tag LOCUS_28650 2344 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3933 3670 gene locus_tag LOCUS_28660 3933 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5115 4075 gene locus_tag LOCUS_28670 5115 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 6238 5207 gene locus_tag LOCUS_28680 6238 5207 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_28680 7003 6266 gene locus_tag LOCUS_28690 7003 6266 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_28690 <8679 7006 gene locus_tag LOCUS_28700 <8679 7006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759752.1:glycosyl transferase >Feature sequence228 1525 3759 gene locus_tag LOCUS_28710 1525 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4331 4621 gene locus_tag LOCUS_28720 4331 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4815 5063 gene locus_tag LOCUS_28730 4815 5063 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_28730 5118 6818 gene locus_tag LOCUS_28740 5118 6818 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence229 <1 656 gene locus_tag LOCUS_28750 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964014.1:oxidoreductase 740 1630 gene locus_tag LOCUS_28760 740 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1774 3192 gene locus_tag LOCUS_28770 1774 3192 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_28770 3194 4894 gene locus_tag LOCUS_28780 3194 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 6452 4884 gene locus_tag LOCUS_28790 6452 4884 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_28790 7453 7938 gene locus_tag LOCUS_28800 7453 7938 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_28800 <8630 7988 gene locus_tag LOCUS_28810 <8630 7988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002561589.1:RNA polymerase sigma factor RpoD >Feature sequence230 <1 1994 gene locus_tag LOCUS_28820 <1 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:cell envelope biogenesis protein OmpA 1987 2469 gene locus_tag LOCUS_28830 1987 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 4206 2545 gene locus_tag LOCUS_28840 gene fadD 4206 2545 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 protein_id gnl|my_center|LOCUS_28840 4647 6707 gene locus_tag LOCUS_28850 4647 6707 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_28850 6922 7926 gene locus_tag LOCUS_28860 gene nadA 6922 7926 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_28860 >Feature sequence231 <1 1609 gene locus_tag LOCUS_28870 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin 2715 1567 gene locus_tag LOCUS_28880 2715 1567 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_28880 2805 3818 gene locus_tag LOCUS_28890 2805 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 5082 3784 gene locus_tag LOCUS_28900 5082 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5816 5070 gene locus_tag LOCUS_28910 5816 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 8482 6986 gene locus_tag LOCUS_28920 8482 6986 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765891.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence232 <1 857 gene locus_tag LOCUS_28930 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963149.1:peptidase M1 1602 916 gene locus_tag LOCUS_28940 1602 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1902 2129 gene locus_tag LOCUS_28950 1902 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2451 3758 gene locus_tag LOCUS_28960 gene hemL 2451 3758 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC8 protein_id gnl|my_center|LOCUS_28960 3830 4906 gene locus_tag LOCUS_28970 3830 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 4973 5656 gene locus_tag LOCUS_28980 4973 5656 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_28980 5982 5764 gene locus_tag LOCUS_28990 5982 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence233 2134 794 gene locus_tag LOCUS_29000 gene actA 2134 794 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_29000 3268 2474 gene locus_tag LOCUS_29010 gene thyA 3268 2474 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_29010 3327 3758 gene locus_tag LOCUS_29020 3327 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29020 3803 5281 gene locus_tag LOCUS_29030 3803 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29030 5703 6773 gene locus_tag LOCUS_29040 5703 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 6981 8375 gene locus_tag LOCUS_29050 6981 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence234 552 1517 gene locus_tag LOCUS_29060 gene hldD 552 1517 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_29060 7230 1651 gene locus_tag LOCUS_29070 7230 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence235 30 740 gene locus_tag LOCUS_29080 30 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1337 987 gene locus_tag LOCUS_29090 1337 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963140.1 protein_id gnl|my_center|LOCUS_29090 2958 1516 gene locus_tag LOCUS_29100 2958 1516 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_29100 4206 2971 gene locus_tag LOCUS_29110 4206 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5208 4210 gene locus_tag LOCUS_29120 5208 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 6291 5212 gene locus_tag LOCUS_29130 gene ykfB 6291 5212 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_29130 6322 7161 gene locus_tag LOCUS_29140 6322 7161 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181558.1 protein_id gnl|my_center|LOCUS_29140 7296 7907 gene locus_tag LOCUS_29150 7296 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence236 375 166 gene locus_tag LOCUS_29160 375 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1120 263 gene locus_tag LOCUS_29170 1120 263 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393714.1 protein_id gnl|my_center|LOCUS_29170 1398 1120 gene locus_tag LOCUS_29180 1398 1120 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084358.1 protein_id gnl|my_center|LOCUS_29180 2517 1747 gene locus_tag LOCUS_29190 2517 1747 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_29190 4085 4360 gene locus_tag LOCUS_29200 4085 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 4896 5660 gene locus_tag LOCUS_29210 4896 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 5906 6346 gene locus_tag LOCUS_29220 5906 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 6410 7018 gene locus_tag LOCUS_29230 gene scpB 6410 7018 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF54 protein_id gnl|my_center|LOCUS_29230 7029 7553 gene locus_tag LOCUS_29240 7029 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence237 <1 1885 gene locus_tag LOCUS_29250 <1 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 2143 3228 gene locus_tag LOCUS_29260 2143 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 6464 3351 gene locus_tag LOCUS_29270 6464 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 7291 6959 gene locus_tag LOCUS_29280 7291 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 7517 8257 gene locus_tag LOCUS_29290 gene etfB 7517 8257 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence238 1694 2629 gene locus_tag LOCUS_29300 1694 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3485 4090 gene locus_tag LOCUS_29310 3485 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 5496 4201 gene locus_tag LOCUS_29320 5496 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 6043 5486 gene locus_tag LOCUS_29330 6043 5486 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_29330 7379 6120 gene locus_tag LOCUS_29340 7379 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 7524 8027 gene locus_tag LOCUS_29350 7524 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 8273 8133 gene locus_tag LOCUS_29360 8273 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence239 735 1790 gene locus_tag LOCUS_29370 735 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_29370 2883 1792 gene locus_tag LOCUS_29380 gene gfo 2883 1792 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_29380 4500 3016 gene locus_tag LOCUS_29390 gene gatA 4500 3016 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_29390 4642 6060 gene locus_tag LOCUS_29400 4642 6060 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_29400 6840 6373 gene locus_tag LOCUS_29410 6840 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 <8259 6932 gene locus_tag LOCUS_29420 <8259 6932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WDD3:4-alpha-glucanotransferase >Feature sequence240 8 535 gene locus_tag LOCUS_29430 8 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3263 594 gene locus_tag LOCUS_29440 3263 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 4970 3507 gene locus_tag LOCUS_29450 4970 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 5328 4954 gene locus_tag LOCUS_29460 5328 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 6262 5684 gene locus_tag LOCUS_29470 6262 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 6568 6269 gene locus_tag LOCUS_29480 6568 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 7243 6581 gene locus_tag LOCUS_29490 7243 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence241 <1 809 gene locus_tag LOCUS_29500 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036949.1:sodium transporter 1936 806 gene locus_tag LOCUS_29510 1936 806 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_29510 3556 2177 gene locus_tag LOCUS_29520 3556 2177 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_29520 3775 4500 gene locus_tag LOCUS_29530 3775 4500 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_29530 4500 5081 gene locus_tag LOCUS_29540 4500 5081 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_29540 5083 5817 gene locus_tag LOCUS_29550 5083 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence242 89 724 gene locus_tag LOCUS_29560 89 724 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_29560 1578 760 gene locus_tag LOCUS_29570 1578 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2433 1630 gene locus_tag LOCUS_29580 2433 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2888 2562 gene locus_tag LOCUS_29590 2888 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 5330 3597 gene locus_tag LOCUS_29600 5330 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6176 5424 gene locus_tag LOCUS_29610 6176 5424 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_29610 6968 6186 gene locus_tag LOCUS_29620 gene cysQ 6968 6186 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence243 734 315 gene locus_tag LOCUS_29630 734 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1114 755 gene locus_tag LOCUS_29640 1114 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 1838 1125 gene locus_tag LOCUS_29650 1838 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3163 1991 gene locus_tag LOCUS_29660 3163 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 6602 3258 gene locus_tag LOCUS_29670 6602 3258 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence244 1330 1124 gene locus_tag LOCUS_29680 1330 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3032 1419 gene locus_tag LOCUS_29690 3032 1419 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_29690 3139 3888 gene locus_tag LOCUS_29700 3139 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_29700 5146 3968 gene locus_tag LOCUS_29710 gene rnd 5146 3968 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9G5 protein_id gnl|my_center|LOCUS_29710 >Feature sequence245 1738 419 gene locus_tag LOCUS_29720 1738 419 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_29720 2269 1751 gene locus_tag LOCUS_29730 2269 1751 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_29730 3211 2375 gene locus_tag LOCUS_29740 3211 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3492 4337 gene locus_tag LOCUS_29750 3492 4337 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_29750 4378 5361 gene locus_tag LOCUS_29760 gene pfkA 4378 5361 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_29760 5533 5354 gene locus_tag LOCUS_29770 5533 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 6355 7545 gene locus_tag LOCUS_29780 6355 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence246 1845 805 gene locus_tag LOCUS_29790 gene gpsA 1845 805 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV7 protein_id gnl|my_center|LOCUS_29790 1980 2975 gene locus_tag LOCUS_29800 1980 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113944.1 protein_id gnl|my_center|LOCUS_29800 5584 3035 gene locus_tag LOCUS_29810 5584 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5823 6539 gene locus_tag LOCUS_29820 5823 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence247 <1 979 gene locus_tag LOCUS_29830 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964486.1:peptidase M1 980 1360 gene locus_tag LOCUS_29840 980 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_29840 1570 2781 gene locus_tag LOCUS_29850 1570 2781 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021090.1 protein_id gnl|my_center|LOCUS_29850 2806 4002 gene locus_tag LOCUS_29860 2806 4002 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_29860 4006 4644 gene locus_tag LOCUS_29870 4006 4644 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_29870 5657 4641 gene locus_tag LOCUS_29880 5657 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 6240 7088 gene locus_tag LOCUS_29890 6240 7088 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_29890 <7993 7170 gene locus_tag LOCUS_29900 <7993 7170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963328.1:cystathionine beta-synthase >Feature sequence248 651 49 gene locus_tag LOCUS_29910 651 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1256 2737 gene locus_tag LOCUS_29920 1256 2737 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_29920 2964 4559 gene locus_tag LOCUS_29930 2964 4559 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123682.1 protein_id gnl|my_center|LOCUS_29930 4624 6201 gene locus_tag LOCUS_29940 4624 6201 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_29940 6510 7298 gene locus_tag LOCUS_29950 6510 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107829.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence249 1506 229 gene locus_tag LOCUS_29960 gene kynU 1506 229 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_29960 2569 1487 gene locus_tag LOCUS_29970 2569 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3090 2578 gene locus_tag LOCUS_29980 gene nbaC 3090 2578 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_29980 4275 3166 gene locus_tag LOCUS_29990 4275 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 5051 4275 gene locus_tag LOCUS_30000 5051 4275 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262189.1 protein_id gnl|my_center|LOCUS_30000 5892 5347 gene locus_tag LOCUS_30010 5892 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 7855 6017 gene locus_tag LOCUS_30020 7855 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence250 1355 180 gene locus_tag LOCUS_30030 1355 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1635 2681 gene locus_tag LOCUS_30040 1635 2681 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_30040 3069 4571 gene locus_tag LOCUS_30050 gene gldJ 3069 4571 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_30050 4666 5970 gene locus_tag LOCUS_30060 gene murF 4666 5970 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_30060 7021 5963 gene locus_tag LOCUS_30070 gene fjo29 7021 5963 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence251 <1 1961 gene locus_tag LOCUS_30080 <1 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence252 2668 1832 gene locus_tag LOCUS_30090 2668 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 7313 2673 gene locus_tag LOCUS_30100 7313 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence253 1377 2354 gene locus_tag LOCUS_30110 1377 2354 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_30110 3424 2351 gene locus_tag LOCUS_30120 3424 2351 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_30120 4390 3464 gene locus_tag LOCUS_30130 gene mvaK 4390 3464 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_30130 5026 4508 gene locus_tag LOCUS_30140 5026 4508 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_30140 5919 5023 gene locus_tag LOCUS_30150 gene dhmA 5919 5023 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_30150 6639 5926 gene locus_tag LOCUS_30160 6639 5926 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_30160 7443 6676 gene locus_tag LOCUS_30170 7443 6676 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence254 223 1518 gene locus_tag LOCUS_30180 223 1518 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_30180 1600 2097 gene locus_tag LOCUS_30190 1600 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933430.1 protein_id gnl|my_center|LOCUS_30190 2912 2211 gene locus_tag LOCUS_30200 2912 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3370 4710 gene locus_tag LOCUS_30210 gene phrB1 3370 4710 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_30210 5344 7632 gene locus_tag LOCUS_30220 5344 7632 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760881.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence255 1014 766 gene locus_tag LOCUS_30230 1014 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2090 1230 gene locus_tag LOCUS_30240 2090 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2794 2174 gene locus_tag LOCUS_30250 2794 2174 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_30250 4020 2884 gene locus_tag LOCUS_30260 4020 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 5335 4082 gene locus_tag LOCUS_30270 5335 4082 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_30270 7580 5778 gene locus_tag LOCUS_30280 7580 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence256 573 3725 gene locus_tag LOCUS_30290 573 3725 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_30290 4834 3911 gene locus_tag LOCUS_30300 4834 3911 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_30300 <7667 4845 gene locus_tag LOCUS_30310 <7667 4845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence257 342 671 gene locus_tag LOCUS_30320 342 671 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_30320 1707 1573 gene locus_tag LOCUS_30330 1707 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2073 1858 gene locus_tag LOCUS_30340 2073 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2468 3874 gene locus_tag LOCUS_30350 2468 3874 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_30350 3906 5576 gene locus_tag LOCUS_30360 3906 5576 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence258 1347 172 gene locus_tag LOCUS_30370 1347 172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067341.1 protein_id gnl|my_center|LOCUS_30370 2247 1474 gene locus_tag LOCUS_30380 2247 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 2724 3587 gene locus_tag LOCUS_30390 2724 3587 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_30390 3815 4165 gene locus_tag LOCUS_30400 3815 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 6305 4554 gene locus_tag LOCUS_30410 6305 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 7558 6806 gene locus_tag LOCUS_30420 7558 6806 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence259 41 1414 gene locus_tag LOCUS_30430 41 1414 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_30430 2539 1862 gene locus_tag LOCUS_30440 2539 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3735 2812 gene locus_tag LOCUS_30450 gene hchA 3735 2812 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207522.1 protein_id gnl|my_center|LOCUS_30450 4368 3739 gene locus_tag LOCUS_30460 4368 3739 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_30460 5009 4434 gene locus_tag LOCUS_30470 5009 4434 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_30470 5614 5075 gene locus_tag LOCUS_30480 5614 5075 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932924.1 protein_id gnl|my_center|LOCUS_30480 5627 6172 gene locus_tag LOCUS_30490 5627 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057789.1 protein_id gnl|my_center|LOCUS_30490 6172 6876 gene locus_tag LOCUS_30500 6172 6876 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence260 1064 159 gene locus_tag LOCUS_30510 1064 159 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_30510 1094 1825 gene locus_tag LOCUS_30520 1094 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1900 3099 gene locus_tag LOCUS_30530 gene mqnE 1900 3099 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_30530 3168 3791 gene locus_tag LOCUS_30540 gene gpm 3168 3791 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_30540 3859 4647 gene locus_tag LOCUS_30550 gene mqnA 3859 4647 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_30550 4690 5247 gene locus_tag LOCUS_30560 gene msrA 4690 5247 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_30560 5533 6423 gene locus_tag LOCUS_30570 5533 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 6476 7174 gene locus_tag LOCUS_30580 6476 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence261 849 1517 gene locus_tag LOCUS_30590 849 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1722 3374 gene locus_tag LOCUS_30600 gene pgi 1722 3374 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPV4 protein_id gnl|my_center|LOCUS_30600 4887 3427 gene locus_tag LOCUS_30610 4887 3427 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_30610 6227 4887 gene locus_tag LOCUS_30620 6227 4887 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence262 254 1693 gene locus_tag LOCUS_30630 254 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2616 1741 gene locus_tag LOCUS_30640 gene purU 2616 1741 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_30640 2821 4602 gene locus_tag LOCUS_30650 2821 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_30650 4753 6165 gene locus_tag LOCUS_30660 4753 6165 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_30660 6210 7262 gene locus_tag LOCUS_30670 6210 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence263 1308 388 gene locus_tag LOCUS_30680 1308 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_30680 1671 3317 gene locus_tag LOCUS_30690 1671 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 4166 3453 gene locus_tag LOCUS_30700 4166 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 <7450 4207 gene locus_tag LOCUS_30710 <7450 4207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence264 2377 2015 gene locus_tag LOCUS_30720 2377 2015 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_30720 3025 5553 gene locus_tag LOCUS_30730 3025 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6441 5755 gene locus_tag LOCUS_30740 6441 5755 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_30740 6565 7407 gene locus_tag LOCUS_30750 gene mqnD 6565 7407 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_30750 >Feature sequence265 523 807 gene locus_tag LOCUS_30760 523 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 1645 788 gene locus_tag LOCUS_30770 1645 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2916 1699 gene locus_tag LOCUS_30780 2916 1699 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_30780 4717 2930 gene locus_tag LOCUS_30790 gene lepA 4717 2930 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_30790 5684 4950 gene locus_tag LOCUS_30800 5684 4950 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence266 <1 668 gene locus_tag LOCUS_30810 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258650.1:GTP-binding protein 1099 1437 gene locus_tag LOCUS_30820 1099 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2899 1445 gene locus_tag LOCUS_30830 2899 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4040 2937 gene locus_tag LOCUS_30840 4040 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 5282 4110 gene locus_tag LOCUS_30850 5282 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 6260 5442 gene locus_tag LOCUS_30860 6260 5442 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700996.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence267 2031 409 gene locus_tag LOCUS_30870 2031 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3597 2035 gene locus_tag LOCUS_30880 3597 2035 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202758.1 protein_id gnl|my_center|LOCUS_30880 4268 3618 gene locus_tag LOCUS_30890 4268 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 4970 4293 gene locus_tag LOCUS_30900 gene lolA 4970 4293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_30900 5168 7129 gene locus_tag LOCUS_30910 5168 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence268 1457 624 gene locus_tag LOCUS_30920 1457 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1564 2316 gene locus_tag LOCUS_30930 gene kdsB 1564 2316 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_30930 2611 2865 gene locus_tag LOCUS_30940 2611 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2852 3394 gene locus_tag LOCUS_30950 2852 3394 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_30950 3879 3391 gene locus_tag LOCUS_30960 gene cdd 3879 3391 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_30960 4152 5483 gene locus_tag LOCUS_30970 4152 5483 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence269 3551 1911 gene locus_tag LOCUS_30980 3551 1911 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_30980 4945 3563 gene locus_tag LOCUS_30990 gene arsA 4945 3563 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_30990 6705 5092 gene locus_tag LOCUS_31000 6705 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence270 2504 3808 gene locus_tag LOCUS_31010 2504 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3997 4212 gene locus_tag LOCUS_31020 3997 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 4575 4228 gene locus_tag LOCUS_31030 4575 4228 CDS product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 protein_id gnl|my_center|LOCUS_31030 7068 4579 gene locus_tag LOCUS_31040 gene ftsK 7068 4579 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence271 881 3991 gene locus_tag LOCUS_31050 881 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 5003 4155 gene locus_tag LOCUS_31060 gene chbG 5003 4155 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261938.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence272 1124 771 gene locus_tag LOCUS_31070 gene gldC 1124 771 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_31070 2121 1201 gene locus_tag LOCUS_31080 2121 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2394 2245 gene locus_tag LOCUS_31090 2394 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4804 2693 gene locus_tag LOCUS_31100 gene copA 4804 2693 CDS product copper-exporting P-type ATPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN02 protein_id gnl|my_center|LOCUS_31100 5003 5815 gene locus_tag LOCUS_31110 5003 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 5973 6527 gene locus_tag LOCUS_31120 5973 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 7018 6524 gene locus_tag LOCUS_31130 7018 6524 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110170.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence273 1937 516 gene locus_tag LOCUS_31140 gene gltP 1937 516 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_31140 2177 3223 gene locus_tag LOCUS_31150 gene hemE 2177 3223 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_31150 3523 4371 gene locus_tag LOCUS_31160 gene accD 3523 4371 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_31160 4486 5055 gene locus_tag LOCUS_31170 4486 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 5642 5058 gene locus_tag LOCUS_31180 gene rluE 5642 5058 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1GRK1 protein_id gnl|my_center|LOCUS_31180 6745 5648 gene locus_tag LOCUS_31190 gene ychF 6745 5648 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_31190 >Feature sequence274 155 622 gene locus_tag LOCUS_31200 155 622 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_31200 694 1935 gene locus_tag LOCUS_31210 694 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2557 2117 gene locus_tag LOCUS_31220 2557 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_31220 2575 3750 gene locus_tag LOCUS_31230 2575 3750 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_31230 3859 5790 gene locus_tag LOCUS_31240 3859 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_31240 5787 6545 gene locus_tag LOCUS_31250 5787 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence275 687 1781 gene locus_tag LOCUS_31260 687 1781 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_31260 1778 3355 gene locus_tag LOCUS_31270 gene lig2 1778 3355 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_31270 3629 3444 gene locus_tag LOCUS_31280 3629 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 6692 3669 gene locus_tag LOCUS_31290 gene lacZ 6692 3669 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_31290 >Feature sequence276 2156 5566 gene locus_tag LOCUS_31300 2156 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence277 4560 1210 gene locus_tag LOCUS_31310 4560 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 5062 6267 gene locus_tag LOCUS_31320 5062 6267 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206886.1 protein_id gnl|my_center|LOCUS_31320 6754 6948 gene locus_tag LOCUS_31330 6754 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence278 315 154 gene locus_tag LOCUS_31340 315 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1073 2338 gene locus_tag LOCUS_31350 1073 2338 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_31350 2411 3376 gene locus_tag LOCUS_31360 2411 3376 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_31360 4707 3460 gene locus_tag LOCUS_31370 gene deaD-2 4707 3460 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_31370 5256 4765 gene locus_tag LOCUS_31380 5256 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 5910 6368 gene locus_tag LOCUS_31390 5910 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 6385 7008 gene locus_tag LOCUS_31400 6385 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence279 890 4261 gene locus_tag LOCUS_31410 890 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 5471 4443 gene locus_tag LOCUS_31420 5471 4443 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_31420 6590 5484 gene locus_tag LOCUS_31430 6590 5484 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence280 2546 144 gene locus_tag LOCUS_31440 2546 144 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_31440 3278 2889 gene locus_tag LOCUS_31450 3278 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_31450 3360 4355 gene locus_tag LOCUS_31460 3360 4355 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_31460 4440 6116 gene locus_tag LOCUS_31470 4440 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_31470 6116 6964 gene locus_tag LOCUS_31480 6116 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence281 3833 2676 gene locus_tag LOCUS_31490 3833 2676 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_31490 5340 3940 gene locus_tag LOCUS_31500 gene ycgA 5340 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55908 protein_id gnl|my_center|LOCUS_31500 >Feature sequence282 338 2461 gene locus_tag LOCUS_31510 338 2461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_31510 2458 3762 gene locus_tag LOCUS_31520 2458 3762 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_31520 5202 3805 gene locus_tag LOCUS_31530 gene lpdA2 5202 3805 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_31530 6354 5836 gene locus_tag LOCUS_31540 6354 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence283 3238 2561 gene locus_tag LOCUS_31550 3238 2561 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_31550 5414 3393 gene locus_tag LOCUS_31560 gene fadH 5414 3393 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence284 343 2979 gene locus_tag LOCUS_31570 343 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3913 3611 gene locus_tag LOCUS_31580 3913 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 4039 3965 gene locus_tag LOCUS_t00160 4039 3965 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4146 5066 gene locus_tag LOCUS_31590 4146 5066 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_31590 6211 5159 gene locus_tag LOCUS_31600 gene rlmN 6211 5159 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_31600 >Feature sequence285 5176 4229 gene locus_tag LOCUS_31610 5176 4229 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_31610 6272 5190 gene locus_tag LOCUS_31620 6272 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence286 1609 731 gene locus_tag LOCUS_31630 gene fdhD 1609 731 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_31630 3402 1711 gene locus_tag LOCUS_31640 3402 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3957 6104 gene locus_tag LOCUS_31650 3957 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 6691 6272 gene locus_tag LOCUS_31660 6691 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence287 4409 1842 gene locus_tag LOCUS_31670 4409 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 4654 4953 gene locus_tag LOCUS_31680 4654 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 5544 5014 gene locus_tag LOCUS_31690 5544 5014 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_31690 5959 5555 gene locus_tag LOCUS_31700 5959 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 6682 5969 gene locus_tag LOCUS_31710 gene lipB 6682 5969 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_31710 >Feature sequence288 338 1168 gene locus_tag LOCUS_31720 338 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 1428 3083 gene locus_tag LOCUS_31730 1428 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3073 3759 gene locus_tag LOCUS_31740 3073 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4126 3902 gene locus_tag LOCUS_31750 4126 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4305 5063 gene locus_tag LOCUS_31760 4305 5063 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_31760 5178 5789 gene locus_tag LOCUS_31770 5178 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_31770 5805 6332 gene locus_tag LOCUS_31780 5805 6332 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93J09 protein_id gnl|my_center|LOCUS_31780 >Feature sequence289 431 2632 gene locus_tag LOCUS_31790 gene dpp11 431 2632 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_31790 3059 2904 gene locus_tag LOCUS_31800 3059 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 5143 3209 gene locus_tag LOCUS_31810 gene dnaK 5143 3209 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YW6 protein_id gnl|my_center|LOCUS_31810 6370 5372 gene locus_tag LOCUS_31820 6370 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence290 3374 2286 gene locus_tag LOCUS_31830 gene ctaA 3374 2286 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_31830 4096 4776 gene locus_tag LOCUS_31840 gene yoqW 4096 4776 CDS product putative SOS response-associated peptidase YoqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31916 protein_id gnl|my_center|LOCUS_31840 5800 4994 gene locus_tag LOCUS_31850 gene lgt 5800 4994 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_31850 6605 5967 gene locus_tag LOCUS_31860 6605 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence291 1471 1256 gene locus_tag LOCUS_31870 1471 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2653 1589 gene locus_tag LOCUS_31880 2653 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 3320 2664 gene locus_tag LOCUS_31890 3320 2664 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_31890 3935 3441 gene locus_tag LOCUS_31900 3935 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 4174 4262 gene locus_tag LOCUS_t00170 4174 4262 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4776 5303 gene locus_tag LOCUS_31910 4776 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence292 144 1022 gene locus_tag LOCUS_31920 144 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_31920 2269 1046 gene locus_tag LOCUS_31930 2269 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_31930 2340 3737 gene locus_tag LOCUS_31940 2340 3737 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_31940 5933 3789 gene locus_tag LOCUS_31950 5933 3789 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_31950 6449 5991 gene locus_tag LOCUS_31960 6449 5991 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_31960 >Feature sequence293 1122 436 gene locus_tag LOCUS_31970 1122 436 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_31970 2541 1264 gene locus_tag LOCUS_31980 2541 1264 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_31980 2801 3727 gene locus_tag LOCUS_31990 2801 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3770 4549 gene locus_tag LOCUS_32000 3770 4549 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_32000 4649 5275 gene locus_tag LOCUS_32010 4649 5275 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence294 318 740 gene locus_tag LOCUS_32020 318 740 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107328.1 protein_id gnl|my_center|LOCUS_32020 1027 3645 gene locus_tag LOCUS_32030 gene clpB 1027 3645 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X21 protein_id gnl|my_center|LOCUS_32030 3878 4339 gene locus_tag LOCUS_32040 3878 4339 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623961.1 protein_id gnl|my_center|LOCUS_32040 4755 4399 gene locus_tag LOCUS_32050 4755 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence295 2398 2048 gene locus_tag LOCUS_32060 2398 2048 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_32060 2611 3147 gene locus_tag LOCUS_32070 2611 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_32070 3216 4502 gene locus_tag LOCUS_32080 3216 4502 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_32080 4504 5427 gene locus_tag LOCUS_32090 4504 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 6186 5620 gene locus_tag LOCUS_32100 6186 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence296 1005 646 gene locus_tag LOCUS_32110 1005 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 1242 1009 gene locus_tag LOCUS_32120 1242 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 2987 1626 gene locus_tag LOCUS_32130 2987 1626 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_32130 4680 3283 gene locus_tag LOCUS_32140 gene rtcB 4680 3283 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7R9 protein_id gnl|my_center|LOCUS_32140 5751 5227 gene locus_tag LOCUS_32150 5751 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 <6549 5930 gene locus_tag LOCUS_32160 <6549 5930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965973.1:maltose phosphorylase >Feature sequence297 720 112 gene locus_tag LOCUS_32170 720 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2174 921 gene locus_tag LOCUS_32180 gene metK 2174 921 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_32180 2916 2296 gene locus_tag LOCUS_32190 2916 2296 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_32190 3597 2953 gene locus_tag LOCUS_32200 gene pdxH 3597 2953 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_32200 6540 5020 gene locus_tag LOCUS_32210 6540 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence298 1135 2250 gene locus_tag LOCUS_32220 1135 2250 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_32220 3012 2299 gene locus_tag LOCUS_32230 3012 2299 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_32230 3041 4000 gene locus_tag LOCUS_32240 3041 4000 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 protein_id gnl|my_center|LOCUS_32240 4002 4271 gene locus_tag LOCUS_32250 4002 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 <6513 4275 gene locus_tag LOCUS_32260 <6513 4275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404275.1:translocation/assembly module TamB >Feature sequence299 2369 204 gene locus_tag LOCUS_32270 gene rnr 2369 204 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 protein_id gnl|my_center|LOCUS_32270 2946 2440 gene locus_tag LOCUS_32280 2946 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3231 3872 gene locus_tag LOCUS_32290 3231 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3897 5903 gene locus_tag LOCUS_32300 gene sdhA 3897 5903 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence300 3049 1346 gene locus_tag LOCUS_32310 3049 1346 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_32310 4334 3183 gene locus_tag LOCUS_32320 gene ribBA 4334 3183 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_32320 4984 4391 gene locus_tag LOCUS_32330 4984 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence301 889 317 gene locus_tag LOCUS_32340 889 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1989 892 gene locus_tag LOCUS_32350 1989 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2280 3539 gene locus_tag LOCUS_32360 2280 3539 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120079.1 protein_id gnl|my_center|LOCUS_32360 3552 4595 gene locus_tag LOCUS_32370 3552 4595 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_32370 5347 4649 gene locus_tag LOCUS_32380 5347 4649 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_32380 >Feature sequence302 1077 1286 gene locus_tag LOCUS_32390 1077 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1344 3026 gene locus_tag LOCUS_32400 1344 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 5365 3071 gene locus_tag LOCUS_32410 5365 3071 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_32410 <6432 5548 gene locus_tag LOCUS_32420 <6432 5548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O84147:serine/threonine-protein kinase pkn1 >Feature sequence303 195 2405 gene locus_tag LOCUS_32430 195 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 2475 3482 gene locus_tag LOCUS_32440 2475 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3589 5358 gene locus_tag LOCUS_32450 3589 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 5864 5415 gene locus_tag LOCUS_32460 5864 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence304 1886 732 gene locus_tag LOCUS_32470 1886 732 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_32470 2816 1971 gene locus_tag LOCUS_32480 2816 1971 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_32480 4926 2872 gene locus_tag LOCUS_32490 gene ptrB 4926 2872 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_32490 5312 5698 gene locus_tag LOCUS_32500 5312 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32500 >Feature sequence305 5614 4262 gene locus_tag LOCUS_32510 5614 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 6054 5647 gene locus_tag LOCUS_32520 6054 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence306 <1 1012 gene locus_tag LOCUS_32530 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788537.1:two-component sensor histidine kinase 1361 3820 gene locus_tag LOCUS_32540 1361 3820 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_32540 4566 3964 gene locus_tag LOCUS_32550 4566 3964 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_32550 5102 4689 gene locus_tag LOCUS_32560 5102 4689 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812348.1 protein_id gnl|my_center|LOCUS_32560 <6358 5152 gene locus_tag LOCUS_32570 <6358 5152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZX41:kynurenine 3-monooxygenase >Feature sequence307 275 685 gene locus_tag LOCUS_32580 275 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 818 2884 gene locus_tag LOCUS_32590 gene glgX-1 818 2884 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV9 protein_id gnl|my_center|LOCUS_32590 3724 3047 gene locus_tag LOCUS_32600 3724 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 5620 3953 gene locus_tag LOCUS_32610 5620 3953 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_32610 6344 5781 gene locus_tag LOCUS_32620 6344 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence308 246 7 gene locus_tag LOCUS_32630 246 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 894 442 gene locus_tag LOCUS_32640 894 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1314 2099 gene locus_tag LOCUS_32650 1314 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 2404 2192 gene locus_tag LOCUS_32660 2404 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2477 2917 gene locus_tag LOCUS_32670 2477 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 4200 3016 gene locus_tag LOCUS_32680 4200 3016 CDS product glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_32680 4845 4294 gene locus_tag LOCUS_32690 4845 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 5019 5228 gene locus_tag LOCUS_32700 5019 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence309 3127 1952 gene locus_tag LOCUS_32710 3127 1952 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_32710 4589 3156 gene locus_tag LOCUS_32720 4589 3156 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_32720 5230 4610 gene locus_tag LOCUS_32730 5230 4610 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_32730 6052 5483 gene locus_tag LOCUS_32740 6052 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence310 161 454 gene locus_tag LOCUS_32750 161 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 451 669 gene locus_tag LOCUS_32760 451 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 1228 2145 gene locus_tag LOCUS_32770 1228 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2135 2572 gene locus_tag LOCUS_32780 2135 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 3048 3563 gene locus_tag LOCUS_32790 3048 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 4796 3624 gene locus_tag LOCUS_32800 4796 3624 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_32800 <6273 4945 gene locus_tag LOCUS_32810 <6273 4945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963833.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence311 1941 433 gene locus_tag LOCUS_32820 1941 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3169 2156 gene locus_tag LOCUS_32830 gene adhP 3169 2156 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_32830 3328 4635 gene locus_tag LOCUS_32840 3328 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 5486 4668 gene locus_tag LOCUS_32850 5486 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 <6268 5502 gene locus_tag LOCUS_32860 <6268 5502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257170.1:peptidase S10 >Feature sequence312 3 2654 gene locus_tag LOCUS_32870 3 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32870 5078 2745 gene locus_tag LOCUS_32880 5078 2745 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_32880 5847 5230 gene locus_tag LOCUS_32890 5847 5230 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_32890 6178 5978 gene locus_tag LOCUS_32900 6178 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence313 1964 717 gene locus_tag LOCUS_32910 1964 717 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_32910 2725 1967 gene locus_tag LOCUS_32920 2725 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3103 4047 gene locus_tag LOCUS_32930 3103 4047 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_32930 4077 5132 gene locus_tag LOCUS_32940 gene rmlB 4077 5132 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_32940 >Feature sequence314 1701 727 gene locus_tag LOCUS_32950 1701 727 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206300.1 protein_id gnl|my_center|LOCUS_32950 1783 2229 gene locus_tag LOCUS_32960 1783 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 2308 2841 gene locus_tag LOCUS_32970 gene mogA 2308 2841 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_32970 3291 4820 gene locus_tag LOCUS_32980 3291 4820 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_32980 5922 4894 gene locus_tag LOCUS_32990 5922 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence315 1561 2166 gene locus_tag LOCUS_33000 1561 2166 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_33000 2177 2608 gene locus_tag LOCUS_33010 2177 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 2838 5666 gene locus_tag LOCUS_33020 2838 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 6149 5670 gene locus_tag LOCUS_33030 6149 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence316 <1 2448 gene locus_tag LOCUS_33040 <1 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A329:leucine--tRNA ligase >Feature sequence317 1700 402 gene locus_tag LOCUS_33050 gene pdhC 1700 402 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_33050 2005 2619 gene locus_tag LOCUS_33060 gene recR 2005 2619 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_33060 2642 4651 gene locus_tag LOCUS_33070 2642 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 5766 4951 gene locus_tag LOCUS_33080 5766 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence318 580 1245 gene locus_tag LOCUS_33090 580 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1635 3314 gene locus_tag LOCUS_33100 gene ilvD 1635 3314 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_33100 3332 5086 gene locus_tag LOCUS_33110 gene ilvB 3332 5086 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_33110 5098 5640 gene locus_tag LOCUS_33120 gene ilvH 5098 5640 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence319 1 195 gene locus_tag LOCUS_33130 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 422 886 gene locus_tag LOCUS_33140 422 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402907.1 protein_id gnl|my_center|LOCUS_33140 2556 1165 gene locus_tag LOCUS_33150 2556 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3000 2928 gene locus_tag LOCUS_t00180 3000 2928 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3325 4938 gene locus_tag LOCUS_33160 3325 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 5738 4977 gene locus_tag LOCUS_33170 5738 4977 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence320 151 681 gene locus_tag LOCUS_33180 151 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 701 1678 gene locus_tag LOCUS_33190 701 1678 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882917.1 protein_id gnl|my_center|LOCUS_33190 1798 2979 gene locus_tag LOCUS_33200 1798 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3569 5668 gene locus_tag LOCUS_33210 3569 5668 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence321 1026 544 gene locus_tag LOCUS_33220 gene crtZ 1026 544 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_33220 1818 1120 gene locus_tag LOCUS_33230 1818 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 3398 1935 gene locus_tag LOCUS_33240 3398 1935 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_33240 <6097 3580 gene locus_tag LOCUS_33250 <6097 3580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403426.1:histidine kinase >Feature sequence322 3313 812 gene locus_tag LOCUS_33260 3313 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4023 4715 gene locus_tag LOCUS_33270 4023 4715 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855408.1 protein_id gnl|my_center|LOCUS_33270 4764 5807 gene locus_tag LOCUS_33280 4764 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence323 811 1707 gene locus_tag LOCUS_33290 811 1707 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 protein_id gnl|my_center|LOCUS_33290 1967 2761 gene locus_tag LOCUS_33300 1967 2761 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_33300 3989 2877 gene locus_tag LOCUS_33310 3989 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 4540 4037 gene locus_tag LOCUS_33320 4540 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 5775 4528 gene locus_tag LOCUS_33330 5775 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence324 1336 1034 gene locus_tag LOCUS_33340 1336 1034 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_33340 2295 1399 gene locus_tag LOCUS_33350 gene xerC 2295 1399 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_33350 2705 3148 gene locus_tag LOCUS_33360 2705 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence325 <1 947 gene locus_tag LOCUS_33370 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261387.1:deacylase 958 1863 gene locus_tag LOCUS_33380 958 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2534 2118 gene locus_tag LOCUS_33390 2534 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 3244 2606 gene locus_tag LOCUS_33400 3244 2606 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_33400 5267 3294 gene locus_tag LOCUS_33410 5267 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence326 1802 429 gene locus_tag LOCUS_33420 gene secY 1802 429 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_33420 2258 1812 gene locus_tag LOCUS_33430 gene rplO 2258 1812 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM7 protein_id gnl|my_center|LOCUS_33430 2523 2344 gene locus_tag LOCUS_33440 gene rpmD 2523 2344 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP02 protein_id gnl|my_center|LOCUS_33440 3078 2557 gene locus_tag LOCUS_33450 gene rpsE 3078 2557 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_33450 3452 3099 gene locus_tag LOCUS_33460 gene rplR 3452 3099 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_33460 4082 3534 gene locus_tag LOCUS_33470 gene rplF 4082 3534 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_33470 4511 4101 gene locus_tag LOCUS_33480 gene rpsH 4511 4101 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_33480 4843 4574 gene locus_tag LOCUS_33490 gene rpsN 4843 4574 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q1 protein_id gnl|my_center|LOCUS_33490 5421 4864 gene locus_tag LOCUS_33500 gene rplE 5421 4864 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ0 protein_id gnl|my_center|LOCUS_33500 5771 5421 gene locus_tag LOCUS_33510 gene rplX 5771 5421 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP7 protein_id gnl|my_center|LOCUS_33510 >Feature sequence327 <1 591 gene locus_tag LOCUS_33520 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW30:geranylgeranylglyceryl phosphate synthase 766 1710 gene locus_tag LOCUS_33530 gene rsgA 766 1710 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_33530 2371 3066 gene locus_tag LOCUS_33540 2371 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3434 4156 gene locus_tag LOCUS_33550 3434 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4969 4172 gene locus_tag LOCUS_33560 4969 4172 CDS product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 protein_id gnl|my_center|LOCUS_33560 <6008 5007 gene locus_tag LOCUS_33570 <6008 5007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267697.1:aminoglycoside phosphotransferase >Feature sequence328 1136 462 gene locus_tag LOCUS_33580 gene nth 1136 462 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_33580 2321 1146 gene locus_tag LOCUS_33590 gene purM 2321 1146 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_33590 2750 4111 gene locus_tag LOCUS_33600 2750 4111 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_33600 4706 4149 gene locus_tag LOCUS_33610 4706 4149 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_33610 5736 4858 gene locus_tag LOCUS_33620 5736 4858 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_33620 >Feature sequence329 229 50 gene locus_tag LOCUS_33630 229 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 1101 232 gene locus_tag LOCUS_33640 1101 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1721 1161 gene locus_tag LOCUS_33650 1721 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3393 2089 gene locus_tag LOCUS_33660 3393 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence330 853 92 gene locus_tag LOCUS_33670 853 92 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_33670 3942 1021 gene locus_tag LOCUS_33680 3942 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 4604 5440 gene locus_tag LOCUS_33690 4604 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence331 <1 1981 gene locus_tag LOCUS_33700 <1 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031536.1:serine hydrolase 2178 3419 gene locus_tag LOCUS_33710 gene arsA 2178 3419 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence332 1742 108 gene locus_tag LOCUS_33720 1742 108 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_33720 3486 1786 gene locus_tag LOCUS_33730 gene xylB 3486 1786 CDS product xylosidase/arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639444.2 protein_id gnl|my_center|LOCUS_33730 4869 3556 gene locus_tag LOCUS_33740 4869 3556 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence333 561 1721 gene locus_tag LOCUS_33750 gene purK 561 1721 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_33750 1848 2033 gene locus_tag LOCUS_33760 1848 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 2454 2074 gene locus_tag LOCUS_33770 2454 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3727 2603 gene locus_tag LOCUS_33780 3727 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 3932 4714 gene locus_tag LOCUS_33790 3932 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4990 5538 gene locus_tag LOCUS_33800 4990 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence334 <1 2630 gene locus_tag LOCUS_33810 <1 2630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MI38:DNA helicase <5900 2691 gene locus_tag LOCUS_33820 <5900 2691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024196.1:cell surface protein >Feature sequence335 873 2405 gene locus_tag LOCUS_33830 873 2405 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_33830 2539 3429 gene locus_tag LOCUS_33840 2539 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3441 3923 gene locus_tag LOCUS_33850 gene defA 3441 3923 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I068 protein_id gnl|my_center|LOCUS_33850 4006 4425 gene locus_tag LOCUS_33860 4006 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 4680 5561 gene locus_tag LOCUS_33870 4680 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence336 2646 625 gene locus_tag LOCUS_33880 2646 625 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_33880 5227 2801 gene locus_tag LOCUS_33890 5227 2801 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence337 324 1757 gene locus_tag LOCUS_33900 324 1757 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_33900 2421 1867 gene locus_tag LOCUS_33910 2421 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_33910 2813 2652 gene locus_tag LOCUS_33920 2813 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3009 4805 gene locus_tag LOCUS_33930 3009 4805 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142862.1 protein_id gnl|my_center|LOCUS_33930 4977 5639 gene locus_tag LOCUS_33940 4977 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence338 2471 825 gene locus_tag LOCUS_33950 gene pyrG 2471 825 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_33950 2806 3723 gene locus_tag LOCUS_33960 2806 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 <5786 3785 gene locus_tag LOCUS_33970 <5786 3785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403216.1:outer membrane protein >Feature sequence339 1 888 gene locus_tag LOCUS_33980 1 888 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_33980 914 2359 gene locus_tag LOCUS_33990 914 2359 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_33990 3010 2360 gene locus_tag LOCUS_34000 3010 2360 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_34000 4351 3149 gene locus_tag LOCUS_34010 4351 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 4493 5335 gene locus_tag LOCUS_34020 gene folP 4493 5335 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_34020 >Feature sequence340 2776 3162 gene locus_tag LOCUS_34030 gene ytxJ 2776 3162 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence341 <1 2666 gene locus_tag LOCUS_34040 <1 2666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 2889 4040 gene locus_tag LOCUS_34050 gene porV 2889 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence342 484 1089 gene locus_tag LOCUS_34060 484 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 1194 2432 gene locus_tag LOCUS_34070 1194 2432 CDS product geranylgeranyl hydrogenase BchP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_34070 3375 2977 gene locus_tag LOCUS_34080 3375 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence343 828 139 gene locus_tag LOCUS_34090 828 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 1918 1502 gene locus_tag LOCUS_34100 gene speH 1918 1502 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZC3 protein_id gnl|my_center|LOCUS_34100 2302 2024 gene locus_tag LOCUS_34110 2302 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34110 2710 2357 gene locus_tag LOCUS_34120 2710 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34120 2816 3277 gene locus_tag LOCUS_34130 2816 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_34130 4094 3339 gene locus_tag LOCUS_34140 gene hisF 4094 3339 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT2 protein_id gnl|my_center|LOCUS_34140 4811 4095 gene locus_tag LOCUS_34150 gene hisA 4811 4095 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_34150 5401 4814 gene locus_tag LOCUS_34160 gene hisH 5401 4814 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_34160 >Feature sequence344 136 1245 gene locus_tag LOCUS_34170 gene gcvT 136 1245 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_34170 1346 1846 gene locus_tag LOCUS_34180 1346 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 2847 1882 gene locus_tag LOCUS_34190 gene serA 2847 1882 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_34190 3460 2972 gene locus_tag LOCUS_34200 3460 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 3768 4355 gene locus_tag LOCUS_34210 3768 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 5510 5040 gene locus_tag LOCUS_34220 5510 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence345 4358 3234 gene locus_tag LOCUS_34230 4358 3234 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence346 67 2196 gene locus_tag LOCUS_34240 67 2196 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_34240 2299 3339 gene locus_tag LOCUS_34250 2299 3339 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_34250 4371 3457 gene locus_tag LOCUS_34260 4371 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 4985 4389 gene locus_tag LOCUS_34270 4985 4389 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_34270 5343 5086 gene locus_tag LOCUS_34280 5343 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence347 2505 931 gene locus_tag LOCUS_34290 2505 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 3256 2669 gene locus_tag LOCUS_34300 3256 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 3669 3442 gene locus_tag LOCUS_34310 3669 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 4473 4003 gene locus_tag LOCUS_34320 4473 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence348 <1 1465 gene locus_tag LOCUS_34330 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P92:DNA primase 1591 4746 gene locus_tag LOCUS_34340 1591 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 5253 4825 gene locus_tag LOCUS_34350 5253 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence349 410 571 gene locus_tag LOCUS_34360 410 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 1838 594 gene locus_tag LOCUS_34370 1838 594 CDS product tripeptidyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108298.1 protein_id gnl|my_center|LOCUS_34370 2929 1865 gene locus_tag LOCUS_34380 2929 1865 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_34380 3840 2938 gene locus_tag LOCUS_34390 3840 2938 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_34390 <5495 3927 gene locus_tag LOCUS_34400 <5495 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECL7:alpha-N-acetylgalactosaminidase >Feature sequence350 362 889 gene locus_tag LOCUS_34410 362 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 886 2148 gene locus_tag LOCUS_34420 886 2148 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_34420 <5437 3047 gene locus_tag LOCUS_34430 <5437 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405100.1:peptidase S9 >Feature sequence351 3018 454 gene locus_tag LOCUS_34440 3018 454 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_34440 3290 4453 gene locus_tag LOCUS_34450 3290 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4507 5052 gene locus_tag LOCUS_34460 4507 5052 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_34460 >Feature sequence352 1313 147 gene locus_tag LOCUS_34470 1313 147 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108616.1 protein_id gnl|my_center|LOCUS_34470 2600 1431 gene locus_tag LOCUS_34480 2600 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3170 2646 gene locus_tag LOCUS_34490 3170 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3320 4675 gene locus_tag LOCUS_34500 3320 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence353 652 2091 gene locus_tag LOCUS_34510 652 2091 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_34510 2088 3248 gene locus_tag LOCUS_34520 2088 3248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529200.1 protein_id gnl|my_center|LOCUS_34520 4908 3502 gene locus_tag LOCUS_34530 4908 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence354 1008 562 gene locus_tag LOCUS_34540 1008 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 1439 1020 gene locus_tag LOCUS_34550 1439 1020 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_34550 1561 1962 gene locus_tag LOCUS_34560 1561 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 2438 2004 gene locus_tag LOCUS_34570 2438 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2782 3744 gene locus_tag LOCUS_34580 2782 3744 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025668.1 protein_id gnl|my_center|LOCUS_34580 4800 4090 gene locus_tag LOCUS_34590 4800 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence355 329 1030 gene locus_tag LOCUS_34600 329 1030 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_34600 1204 2769 gene locus_tag LOCUS_34610 1204 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2993 3460 gene locus_tag LOCUS_34620 gene coaD 2993 3460 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_34620 3463 4155 gene locus_tag LOCUS_34630 3463 4155 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948701.1 protein_id gnl|my_center|LOCUS_34630 5100 4147 gene locus_tag LOCUS_34640 5100 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence356 2796 1048 gene locus_tag LOCUS_34650 2796 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence357 497 4201 gene locus_tag LOCUS_34660 497 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence358 98 301 gene locus_tag LOCUS_34670 98 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 1074 556 gene locus_tag LOCUS_34680 1074 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 1619 2005 gene locus_tag LOCUS_34690 1619 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34690 3148 2246 gene locus_tag LOCUS_34700 3148 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 4190 3141 gene locus_tag LOCUS_34710 4190 3141 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_34710 5272 4196 gene locus_tag LOCUS_34720 5272 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence359 <1 1782 gene locus_tag LOCUS_34730 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein >Feature sequence360 1405 659 gene locus_tag LOCUS_34740 1405 659 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935570.1 protein_id gnl|my_center|LOCUS_34740 2889 1771 gene locus_tag LOCUS_34750 gene leuB 2889 1771 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_34750 3514 2960 gene locus_tag LOCUS_34760 3514 2960 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_34760 4946 3558 gene locus_tag LOCUS_34770 gene leuC 4946 3558 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_34770 >Feature sequence361 1282 311 gene locus_tag LOCUS_34780 1282 311 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_34780 1651 2187 gene locus_tag LOCUS_34790 1651 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 2207 2854 gene locus_tag LOCUS_34800 2207 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 4102 2906 gene locus_tag LOCUS_34810 gene moeA 4102 2906 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence362 166 1254 gene locus_tag LOCUS_34820 166 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 1361 2416 gene locus_tag LOCUS_34830 1361 2416 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence363 52 1638 gene locus_tag LOCUS_34840 52 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1631 2041 gene locus_tag LOCUS_34850 1631 2041 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_34850 2197 3792 gene locus_tag LOCUS_34860 2197 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 4085 4798 gene locus_tag LOCUS_34870 4085 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence364 1845 2450 gene locus_tag LOCUS_34880 1845 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 2578 3681 gene locus_tag LOCUS_34890 2578 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4858 4109 gene locus_tag LOCUS_34900 4858 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence365 94 540 gene locus_tag LOCUS_34910 94 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 858 2855 gene locus_tag LOCUS_34920 858 2855 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109382.1 protein_id gnl|my_center|LOCUS_34920 2892 4184 gene locus_tag LOCUS_34930 2892 4184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867388.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence366 813 256 gene locus_tag LOCUS_34940 813 256 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_34940 1008 1292 gene locus_tag LOCUS_34950 1008 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 2945 1587 gene locus_tag LOCUS_34960 2945 1587 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_34960 3280 3756 gene locus_tag LOCUS_34970 3280 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence367 126 1589 gene locus_tag LOCUS_34980 126 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 2790 1951 gene locus_tag LOCUS_34990 2790 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3056 3454 gene locus_tag LOCUS_35000 3056 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4131 3559 gene locus_tag LOCUS_35010 4131 3559 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887F6 protein_id gnl|my_center|LOCUS_35010 <5058 4221 gene locus_tag LOCUS_35020 <5058 4221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase >Feature sequence368 2 1198 gene locus_tag LOCUS_35030 2 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 1388 1696 gene locus_tag LOCUS_35040 1388 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2175 2453 gene locus_tag LOCUS_35050 2175 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35050 2466 3473 gene locus_tag LOCUS_35060 2466 3473 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_35060 4697 3495 gene locus_tag LOCUS_35070 4697 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence369 2032 1064 gene locus_tag LOCUS_35080 gene hprA 2032 1064 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_35080 2135 2308 gene locus_tag LOCUS_35090 2135 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 2406 3725 gene locus_tag LOCUS_35100 2406 3725 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_35100 3859 4221 gene locus_tag LOCUS_35110 3859 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence370 157 4866 gene locus_tag LOCUS_35120 157 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence371 1192 296 gene locus_tag LOCUS_35130 1192 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 2231 1185 gene locus_tag LOCUS_35140 gene pam 2231 1185 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_35140 3716 2241 gene locus_tag LOCUS_35150 3716 2241 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_35150 <5007 3798 gene locus_tag LOCUS_35160 <5007 3798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122595.1:cytochrome c >Feature sequence372 952 356 gene locus_tag LOCUS_35170 952 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 1058 1462 gene locus_tag LOCUS_35180 1058 1462 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_35180 1465 2241 gene locus_tag LOCUS_35190 1465 2241 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_35190 2243 2824 gene locus_tag LOCUS_35200 2243 2824 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_35200 3343 4677 gene locus_tag LOCUS_35210 3343 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence373 1426 260 gene locus_tag LOCUS_35220 1426 260 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_35220 2480 1524 gene locus_tag LOCUS_35230 gene tktC 2480 1524 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_35230 3376 2513 gene locus_tag LOCUS_35240 gene tktA 3376 2513 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_35240 4048 3776 gene locus_tag LOCUS_35250 4048 3776 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_35250 4234 4434 gene locus_tag LOCUS_35260 4234 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence374 232 423 gene locus_tag LOCUS_35270 232 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 420 761 gene locus_tag LOCUS_35280 420 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 896 1339 gene locus_tag LOCUS_35290 896 1339 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_35290 2490 1510 gene locus_tag LOCUS_35300 2490 1510 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence375 <1 1184 gene locus_tag LOCUS_35310 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963765.1:TonB-dependent receptor 1225 1902 gene locus_tag LOCUS_35320 1225 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_35320 1895 3019 gene locus_tag LOCUS_35330 1895 3019 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_35330 3016 3786 gene locus_tag LOCUS_35340 3016 3786 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_35340 <4948 3791 gene locus_tag LOCUS_35350 <4948 3791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202554.1:alkaline phosphatase >Feature sequence376 >Feature sequence377 119 1363 gene locus_tag LOCUS_35360 119 1363 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_35360 1726 1641 gene locus_tag LOCUS_t00190 1726 1641 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3202 1865 gene locus_tag LOCUS_35370 3202 1865 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_35370 3430 4131 gene locus_tag LOCUS_35380 3430 4131 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_35380 4145 4801 gene locus_tag LOCUS_35390 4145 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence378 <1 531 gene locus_tag LOCUS_35400 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918774.1:peptidase M28 813 1361 gene locus_tag LOCUS_35410 813 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1354 1692 gene locus_tag LOCUS_35420 1354 1692 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_35420 4884 1693 gene locus_tag LOCUS_35430 gene smc 4884 1693 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_35430 >Feature sequence379 216 1175 gene locus_tag LOCUS_35440 216 1175 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_35440 1321 2538 gene locus_tag LOCUS_35450 gene sbcD 1321 2538 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_35450 >Feature sequence380 120 3350 gene locus_tag LOCUS_35460 120 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 4681 3380 gene locus_tag LOCUS_35470 4681 3380 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_35470 >Feature sequence381 2 127 gene locus_tag LOCUS_35480 2 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 115 1080 gene locus_tag LOCUS_35490 gene argC 115 1080 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_35490 1292 2434 gene locus_tag LOCUS_35500 gene argD 1292 2434 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_35500 2431 3372 gene locus_tag LOCUS_35510 gene argF' 2431 3372 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_35510 3374 4147 gene locus_tag LOCUS_35520 gene argB 3374 4147 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_35520 >Feature sequence382 <1 1052 gene locus_tag LOCUS_35530 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582994.1:CRISPR-associated helicase/endonuclease Cas3 1735 1127 gene locus_tag LOCUS_35540 1735 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807752.1 protein_id gnl|my_center|LOCUS_35540 1765 2262 gene locus_tag LOCUS_35550 1765 2262 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_35550 2485 2838 gene locus_tag LOCUS_35560 2485 2838 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_35560 3070 4077 gene locus_tag LOCUS_35570 gene cas1 3070 4077 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_35570 4077 4340 gene locus_tag LOCUS_35580 gene cas2 4077 4340 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_35580 4566 >4842 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcttaatcgcaccagattggaattgaaac >Feature sequence383 1052 1468 gene locus_tag LOCUS_35590 1052 1468 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_35590 1474 2970 gene locus_tag LOCUS_35600 1474 2970 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_35600 3001 4284 gene locus_tag LOCUS_35610 3001 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence384 <1 1021 gene locus_tag LOCUS_35620 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107845.1:ABC transporter permease 1027 1692 gene locus_tag LOCUS_35630 1027 1692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_35630 1727 2971 gene locus_tag LOCUS_35640 1727 2971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764773.1 protein_id gnl|my_center|LOCUS_35640 3042 4169 gene locus_tag LOCUS_35650 gene ybjZ 3042 4169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_35650 4238 4732 gene locus_tag LOCUS_35660 4238 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence385 1053 1391 gene locus_tag LOCUS_35670 gene yegP 1053 1391 CDS product UPF0339 protein YegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7I0 protein_id gnl|my_center|LOCUS_35670 1559 3253 gene locus_tag LOCUS_35680 1559 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3401 4075 gene locus_tag LOCUS_35690 3401 4075 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence386 412 1212 gene locus_tag LOCUS_35700 412 1212 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_35700 1216 2835 gene locus_tag LOCUS_35710 1216 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 3570 2911 gene locus_tag LOCUS_35720 3570 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3687 4571 gene locus_tag LOCUS_35730 3687 4571 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963141.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence387 2050 581 gene locus_tag LOCUS_35740 gene ggt 2050 581 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_35740 3333 2056 gene locus_tag LOCUS_35750 3333 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence388 >Feature sequence389 513 1034 gene locus_tag LOCUS_35760 513 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_35760 1036 1479 gene locus_tag LOCUS_35770 1036 1479 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_35770 1552 2301 gene locus_tag LOCUS_35780 1552 2301 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106129.1 protein_id gnl|my_center|LOCUS_35780 2356 3669 gene locus_tag LOCUS_35790 2356 3669 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969977.1 protein_id gnl|my_center|LOCUS_35790 4227 3739 gene locus_tag LOCUS_35800 gene yjgM 4227 3739 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence390 283 963 gene locus_tag LOCUS_35810 283 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 1139 3955 gene locus_tag LOCUS_35820 gene carB 1139 3955 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_35820 >Feature sequence391 332 2050 gene locus_tag LOCUS_35830 332 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 2938 2090 gene locus_tag LOCUS_35840 2938 2090 CDS product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_35840 3420 2935 gene locus_tag LOCUS_35850 3420 2935 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_35850 3844 3614 gene locus_tag LOCUS_35860 3844 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 4457 3915 gene locus_tag LOCUS_35870 4457 3915 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_35870 >Feature sequence392 282 3011 gene locus_tag LOCUS_35880 282 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_35880 3034 3492 gene locus_tag LOCUS_35890 3034 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 3677 3958 gene locus_tag LOCUS_35900 3677 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_35900 >Feature sequence393 <1 901 gene locus_tag LOCUS_35910 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765630.1:protease 1275 2234 gene locus_tag LOCUS_35920 1275 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2678 3148 gene locus_tag LOCUS_35930 2678 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3138 3374 gene locus_tag LOCUS_35940 3138 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 4478 3393 gene locus_tag LOCUS_35950 4478 3393 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence394 321 76 gene locus_tag LOCUS_35960 321 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 528 2765 gene locus_tag LOCUS_35970 528 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 3045 4427 gene locus_tag LOCUS_35980 3045 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence395 1371 529 gene locus_tag LOCUS_35990 1371 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2270 3307 gene locus_tag LOCUS_36000 2270 3307 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_36000 <4622 3656 gene locus_tag LOCUS_36010 <4622 3656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403126.1:oxidoreductase >Feature sequence396 1581 505 gene locus_tag LOCUS_36020 1581 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 3483 1594 gene locus_tag LOCUS_36030 3483 1594 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881100.1 protein_id gnl|my_center|LOCUS_36030 <4608 3611 gene locus_tag LOCUS_36040 <4608 3611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963090.1:acetyl-coenzyme A synthetase >Feature sequence397 4212 1237 gene locus_tag LOCUS_36050 4212 1237 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence398 265 798 gene locus_tag LOCUS_36060 265 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 816 1013 gene locus_tag LOCUS_36070 gene rpmF 816 1013 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_36070 1098 1481 gene locus_tag LOCUS_36080 gene yjgF 1098 1481 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_36080 1541 2551 gene locus_tag LOCUS_36090 gene trpS 1541 2551 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX76 protein_id gnl|my_center|LOCUS_36090 2780 2541 gene locus_tag LOCUS_36100 2780 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence399 181 402 gene locus_tag LOCUS_36110 181 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 1688 294 gene locus_tag LOCUS_36120 gene pntB 1688 294 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_36120 2020 1694 gene locus_tag LOCUS_36130 2020 1694 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_36130 3095 2010 gene locus_tag LOCUS_36140 gene pntA 3095 2010 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_36140 3486 4172 gene locus_tag LOCUS_36150 gene ftsE 3486 4172 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence400 1099 158 gene locus_tag LOCUS_36160 gene rlmF 1099 158 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYC3 protein_id gnl|my_center|LOCUS_36160 2308 1190 gene locus_tag LOCUS_36170 gene hisC 2308 1190 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_36170 3163 2507 gene locus_tag LOCUS_36180 gene tal 3163 2507 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R94 protein_id gnl|my_center|LOCUS_36180 3360 3884 gene locus_tag LOCUS_36190 3360 3884 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVR1 protein_id gnl|my_center|LOCUS_36190 >Feature sequence401 139 1338 gene locus_tag LOCUS_36200 139 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 1433 1834 gene locus_tag LOCUS_36210 1433 1834 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_36210 1879 2439 gene locus_tag LOCUS_36220 gene def 1879 2439 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_36220 3072 2443 gene locus_tag LOCUS_36230 3072 2443 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_36230 3352 4155 gene locus_tag LOCUS_36240 3352 4155 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567380.1 protein_id gnl|my_center|LOCUS_36240 4394 4482 gene locus_tag LOCUS_t00200 4394 4482 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence402 278 994 gene locus_tag LOCUS_36250 278 994 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140119.1 protein_id gnl|my_center|LOCUS_36250 4296 1054 gene locus_tag LOCUS_36260 4296 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 >Feature sequence403 3061 1178 gene locus_tag LOCUS_36270 3061 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 4473 3499 gene locus_tag LOCUS_36280 4473 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence404 4192 2813 gene locus_tag LOCUS_36290 gene galA 4192 2813 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 protein_id gnl|my_center|LOCUS_36290 >Feature sequence405 171 518 gene locus_tag LOCUS_36300 171 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 556 1269 gene locus_tag LOCUS_36310 556 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 1498 2694 gene locus_tag LOCUS_36320 1498 2694 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_36320 4091 2736 gene locus_tag LOCUS_36330 4091 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence406 1003 308 gene locus_tag LOCUS_36340 1003 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_36340 2067 1126 gene locus_tag LOCUS_36350 gene pdhA 2067 1126 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_36350 2382 3521 gene locus_tag LOCUS_36360 2382 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030365.1 protein_id gnl|my_center|LOCUS_36360 3784 3560 gene locus_tag LOCUS_36370 3784 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 4067 3768 gene locus_tag LOCUS_36380 4067 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence407 419 571 gene locus_tag LOCUS_36390 419 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36390 667 2109 gene locus_tag LOCUS_36400 667 2109 CDS product gluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 protein_id gnl|my_center|LOCUS_36400 2369 2989 gene locus_tag LOCUS_36410 2369 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence408 2106 1174 gene locus_tag LOCUS_36420 gene pyrB 2106 1174 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_36420 2869 2291 gene locus_tag LOCUS_36430 gene pyrR1 2869 2291 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_36430 >Feature sequence409 <1 1125 gene locus_tag LOCUS_36440 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057223.1:ABC transporter permease 1182 2660 gene locus_tag LOCUS_36450 1182 2660 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_36450 4063 2657 gene locus_tag LOCUS_36460 4063 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence410 1431 172 gene locus_tag LOCUS_36470 1431 172 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_36470 4263 1873 gene locus_tag LOCUS_36480 4263 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109335.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence411 281 1063 gene locus_tag LOCUS_36490 gene crt 281 1063 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_36490 2050 3330 gene locus_tag LOCUS_36500 2050 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 <4319 3372 gene locus_tag LOCUS_36510 <4319 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403438.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence412 3203 237 gene locus_tag LOCUS_36520 3203 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 3628 4233 gene locus_tag LOCUS_36530 3628 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence413 310 1392 gene locus_tag LOCUS_36540 gene ilvK 310 1392 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_36540 3079 2450 gene locus_tag LOCUS_36550 3079 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3830 3231 gene locus_tag LOCUS_36560 3830 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence414 >Feature sequence415 1035 1652 gene locus_tag LOCUS_36570 1035 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1639 2073 gene locus_tag LOCUS_36580 1639 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence416 >Feature sequence417 3075 1555 gene locus_tag LOCUS_36590 3075 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 3284 3622 gene locus_tag LOCUS_36600 3284 3622 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340730.1 protein_id gnl|my_center|LOCUS_36600 >Feature sequence418 759 1184 gene locus_tag LOCUS_36610 759 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 1242 3254 gene locus_tag LOCUS_36620 1242 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence419 117 593 gene locus_tag LOCUS_36630 117 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 657 1178 gene locus_tag LOCUS_36640 gene ribH 657 1178 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_36640 1336 1731 gene locus_tag LOCUS_36650 1336 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 <4234 2011 gene locus_tag LOCUS_36660 <4234 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:membrane protein >Feature sequence420 808 287 gene locus_tag LOCUS_36670 808 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 1640 1140 gene locus_tag LOCUS_36680 1640 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 2356 1841 gene locus_tag LOCUS_36690 2356 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 protein_id gnl|my_center|LOCUS_36690 3690 2419 gene locus_tag LOCUS_36700 3690 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence421 1467 829 gene locus_tag LOCUS_36710 1467 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 1708 1496 gene locus_tag LOCUS_36720 1708 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 1908 1705 gene locus_tag LOCUS_36730 1908 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 2183 2698 gene locus_tag LOCUS_36740 2183 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2813 3001 gene locus_tag LOCUS_36750 2813 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence422 95 2218 gene locus_tag LOCUS_36760 gene ppk 95 2218 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A667 protein_id gnl|my_center|LOCUS_36760 2297 3859 gene locus_tag LOCUS_36770 2297 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 4080 4153 gene locus_tag LOCUS_t00210 4080 4153 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence423 1364 2653 gene locus_tag LOCUS_36780 1364 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 2697 3530 gene locus_tag LOCUS_36790 2697 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 >Feature sequence424 >Feature sequence425 133 579 gene locus_tag LOCUS_36800 133 579 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_36800 636 1082 gene locus_tag LOCUS_36810 636 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 1434 1120 gene locus_tag LOCUS_36820 1434 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_36820 4007 1437 gene locus_tag LOCUS_36830 gene topA 4007 1437 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_36830 >Feature sequence426 1597 1148 gene locus_tag LOCUS_36840 1597 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 1999 1670 gene locus_tag LOCUS_36850 1999 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 2277 1993 gene locus_tag LOCUS_36860 2277 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 2921 2352 gene locus_tag LOCUS_36870 2921 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3878 3180 gene locus_tag LOCUS_36880 3878 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence427 839 1306 gene locus_tag LOCUS_36890 839 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 1614 2576 gene locus_tag LOCUS_36900 1614 2576 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8Y4 protein_id gnl|my_center|LOCUS_36900 >Feature sequence428 562 248 gene locus_tag LOCUS_36910 562 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 3240 1033 gene locus_tag LOCUS_36920 3240 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3789 3947 gene locus_tag LOCUS_36930 3789 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence429 <1 2811 gene locus_tag LOCUS_36940 <1 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 3912 2887 gene locus_tag LOCUS_36950 3912 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence430 <1 777 gene locus_tag LOCUS_36960 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021764.1:surface antigen gene 1405 3597 gene locus_tag LOCUS_36970 1405 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence431 993 73 gene locus_tag LOCUS_36980 gene fmt 993 73 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_36980 1165 1761 gene locus_tag LOCUS_36990 1165 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2085 2903 gene locus_tag LOCUS_37000 2085 2903 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_37000 <3927 2900 gene locus_tag LOCUS_37010 <3927 2900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022258.1:bactoprenol glucosyl transferase >Feature sequence432 1517 306 gene locus_tag LOCUS_37020 1517 306 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_37020 2308 1532 gene locus_tag LOCUS_37030 2308 1532 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_37030 <3924 2392 gene locus_tag LOCUS_37040 <3924 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114561.1:acyl-CoA dehydrogenase >Feature sequence433 51 1706 gene locus_tag LOCUS_37050 51 1706 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_37050 3050 1830 gene locus_tag LOCUS_37060 3050 1830 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_37060 >Feature sequence434 <1 1396 gene locus_tag LOCUS_37070 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 2852 1614 gene locus_tag LOCUS_37080 2852 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 <3920 3030 gene locus_tag LOCUS_37090 <3920 3030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein >Feature sequence435 1161 3107 gene locus_tag LOCUS_37100 1161 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3116 3595 gene locus_tag LOCUS_37110 3116 3595 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_37110 >Feature sequence436 >Feature sequence437 <3851 1584 gene locus_tag LOCUS_37120 <3851 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963209.1:bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase >Feature sequence438 <1 716 gene locus_tag LOCUS_37130 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G3:Holliday junction ATP-dependent DNA helicase RuvB 2812 821 gene locus_tag LOCUS_37140 2812 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence439 35 655 gene locus_tag LOCUS_37150 35 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 710 1150 gene locus_tag LOCUS_37160 710 1150 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_37160 1161 3275 gene locus_tag LOCUS_37170 gene yyaL 1161 3275 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_37170 >Feature sequence440 242 985 gene locus_tag LOCUS_37180 242 985 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_37180 1393 2076 gene locus_tag LOCUS_37190 1393 2076 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_37190 2076 2537 gene locus_tag LOCUS_37200 2076 2537 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_37200 2798 2670 gene locus_tag LOCUS_37210 2798 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 3182 3727 gene locus_tag LOCUS_37220 3182 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence441 233 688 gene locus_tag LOCUS_37230 233 688 CDS product putative enoyl-CoA hydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP3 protein_id gnl|my_center|LOCUS_37230 700 2721 gene locus_tag LOCUS_37240 gene fadH 700 2721 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 protein_id gnl|my_center|LOCUS_37240 3517 2840 gene locus_tag LOCUS_37250 3517 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence442 773 1480 gene locus_tag LOCUS_37260 773 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 1783 1574 gene locus_tag LOCUS_37270 1783 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 2061 1783 gene locus_tag LOCUS_37280 2061 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 2126 3613 gene locus_tag LOCUS_37290 2126 3613 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_37290 >Feature sequence443 2197 1055 gene locus_tag LOCUS_37300 gene ftsW 2197 1055 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_37300 3517 2207 gene locus_tag LOCUS_37310 gene murD 3517 2207 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_37310 >Feature sequence444 2820 1894 gene locus_tag LOCUS_37320 2820 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3438 2896 gene locus_tag LOCUS_37330 3438 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence445 <1 954 gene locus_tag LOCUS_37340 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase 1237 2607 gene locus_tag LOCUS_37350 gene cydA 1237 2607 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_37350 2613 3647 gene locus_tag LOCUS_37360 gene cydB 2613 3647 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_37360 >Feature sequence446 >Feature sequence447 >Feature sequence448 2619 3368 gene locus_tag LOCUS_37370 2619 3368 CDS product steroid 5-alpha reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732640.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence449 379 1080 gene locus_tag LOCUS_37380 379 1080 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_37380 1293 1982 gene locus_tag LOCUS_37390 1293 1982 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_37390 1998 2732 gene locus_tag LOCUS_37400 1998 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence450 690 277 gene locus_tag LOCUS_37410 690 277 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_37410 1317 760 gene locus_tag LOCUS_37420 1317 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_37420 2043 1399 gene locus_tag LOCUS_37430 2043 1399 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_37430 3585 2185 gene locus_tag LOCUS_37440 3585 2185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_37440 >Feature sequence451 <1 1308 gene locus_tag LOCUS_37450 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143675.1:peptidase M16 1369 3459 gene locus_tag LOCUS_37460 gene ymxG 1369 3459 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403997.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence452 1 1545 gene locus_tag LOCUS_37470 1 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 2208 1534 gene locus_tag LOCUS_37480 gene ung 2208 1534 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_37480 3031 2201 gene locus_tag LOCUS_37490 3031 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3348 3422 gene locus_tag LOCUS_t00220 3348 3422 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence453 1204 65 gene locus_tag LOCUS_37500 1204 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 1483 1274 gene locus_tag LOCUS_37510 1483 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 >Feature sequence454 752 93 gene locus_tag LOCUS_37520 752 93 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768973.1 protein_id gnl|my_center|LOCUS_37520 1755 829 gene locus_tag LOCUS_37530 1755 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence455 2266 1376 gene locus_tag LOCUS_37540 2266 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 2566 2273 gene locus_tag LOCUS_37550 2566 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 3271 2669 gene locus_tag LOCUS_37560 3271 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence456 2489 1206 gene locus_tag LOCUS_37570 2489 1206 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_37570 <3521 2506 gene locus_tag LOCUS_37580 <3521 2506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027370.1:short-chain dehydrogenase >Feature sequence457 <1 572 gene locus_tag LOCUS_37590 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962476.1:alpha-amylase 2969 1305 gene locus_tag LOCUS_37600 2969 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence458 627 400 gene locus_tag LOCUS_37610 627 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 997 656 gene locus_tag LOCUS_37620 997 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 1449 2714 gene locus_tag LOCUS_37630 gene citC 1449 2714 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCT9 protein_id gnl|my_center|LOCUS_37630 >Feature sequence459 176 1381 gene locus_tag LOCUS_37640 176 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 1800 1441 gene locus_tag LOCUS_37650 1800 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 2177 1989 gene locus_tag LOCUS_37660 2177 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 2481 2320 gene locus_tag LOCUS_37670 2481 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence460 1245 2075 gene locus_tag LOCUS_37680 1245 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 2223 2753 gene locus_tag LOCUS_37690 2223 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence461 638 42 gene locus_tag LOCUS_37700 638 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 848 1168 gene locus_tag LOCUS_37710 848 1168 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_37710 1248 1706 gene locus_tag LOCUS_37720 1248 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888245.1 protein_id gnl|my_center|LOCUS_37720 1824 1982 gene locus_tag LOCUS_37730 1824 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2778 2128 gene locus_tag LOCUS_37740 gene psd 2778 2128 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_37740 <3475 2856 gene locus_tag LOCUS_37750 <3475 2856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0L5:phosphatidate cytidylyltransferase >Feature sequence462 2382 2107 gene locus_tag LOCUS_37760 gene rpsO 2382 2107 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHN4 protein_id gnl|my_center|LOCUS_37760 <3475 2600 gene locus_tag LOCUS_37770 <3475 2600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962506.1:electron transfer flavoprotein subunit alpha >Feature sequence463 1295 606 gene locus_tag LOCUS_37780 1295 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 1756 1295 gene locus_tag LOCUS_37790 1756 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3354 1801 gene locus_tag LOCUS_37800 3354 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 >Feature sequence464 >Feature sequence465 1838 2848 gene locus_tag LOCUS_37810 1838 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 >Feature sequence466 845 1909 gene locus_tag LOCUS_37820 gene queA 845 1909 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_37820 2026 3195 gene locus_tag LOCUS_37830 2026 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence467 <1 1123 gene locus_tag LOCUS_37840 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404400.1:amidase 1334 3079 gene locus_tag LOCUS_37850 1334 3079 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_37850 >Feature sequence468 716 147 gene locus_tag LOCUS_37860 716 147 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_37860 1187 1429 gene locus_tag LOCUS_37870 1187 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 1924 2124 gene locus_tag LOCUS_37880 1924 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 3302 2811 gene locus_tag LOCUS_37890 3302 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence469 1917 898 gene locus_tag LOCUS_37900 1917 898 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_37900 2462 1914 gene locus_tag LOCUS_37910 2462 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_37910 <3294 2467 gene locus_tag LOCUS_37920 <3294 2467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXD3:pseudouridine synthase >Feature sequence470 1873 830 gene locus_tag LOCUS_37930 1873 830 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706926.1 protein_id gnl|my_center|LOCUS_37930 2365 2910 gene locus_tag LOCUS_37940 2365 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_37940 >Feature sequence471 961 1902 gene locus_tag LOCUS_37950 gene ydjE 961 1902 CDS product putative sugar kinase YdjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34768 protein_id gnl|my_center|LOCUS_37950 3024 1909 gene locus_tag LOCUS_37960 3024 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence472 2166 1249 gene locus_tag LOCUS_37970 2166 1249 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778163.1 protein_id gnl|my_center|LOCUS_37970 >Feature sequence473 <1 1016 gene locus_tag LOCUS_37980 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109044.1:histidine kinase 1021 1779 gene locus_tag LOCUS_37990 1021 1779 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_37990 2037 2933 gene locus_tag LOCUS_38000 2037 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 protein_id gnl|my_center|LOCUS_38000 3238 2936 gene locus_tag LOCUS_38010 3238 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence474 766 134 gene locus_tag LOCUS_38020 766 134 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_38020 1155 2222 gene locus_tag LOCUS_38030 gene fabH2 1155 2222 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_38030 >Feature sequence475 2564 1395 gene locus_tag LOCUS_38040 2564 1395 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_38040 <3224 2631 gene locus_tag LOCUS_38050 <3224 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence476 2412 511 gene locus_tag LOCUS_38060 2412 511 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_38060 >Feature sequence477 909 85 gene locus_tag LOCUS_38070 909 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2497 1064 gene locus_tag LOCUS_38080 2497 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence478 >Feature sequence479 <1 1490 gene locus_tag LOCUS_38090 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117742.1:cysteine proteinase 1598 2404 gene locus_tag LOCUS_38100 1598 2404 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence480 <1 632 gene locus_tag LOCUS_38110 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H090:aminotransferase 1115 690 gene locus_tag LOCUS_38120 1115 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 1220 3139 gene locus_tag LOCUS_38130 gene yidC 1220 3139 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_38130 >Feature sequence481 2470 86 gene locus_tag LOCUS_38140 gene nrdA 2470 86 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_38140 <3143 2539 gene locus_tag LOCUS_38150 <3143 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962627.1:ribonucleoside-diphosphate reductase >Feature sequence482 1012 212 gene locus_tag LOCUS_38160 1012 212 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 protein_id gnl|my_center|LOCUS_38160 <3133 1368 gene locus_tag LOCUS_38170 <3133 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T09:UvrABC system protein B >Feature sequence483 >Feature sequence484 1850 2497 gene locus_tag LOCUS_38180 1850 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence485 1329 961 gene locus_tag LOCUS_38190 1329 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1601 1344 gene locus_tag LOCUS_38200 1601 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 2385 2059 gene locus_tag LOCUS_38210 2385 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 2672 2379 gene locus_tag LOCUS_38220 2672 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence486 179 1297 gene locus_tag LOCUS_38230 179 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 1322 2992 gene locus_tag LOCUS_38240 1322 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence487 1335 598 gene locus_tag LOCUS_38250 1335 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 <3055 1420 gene locus_tag LOCUS_38260 <3055 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase >Feature sequence488 545 1924 gene locus_tag LOCUS_38270 545 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 2129 1848 gene locus_tag LOCUS_38280 2129 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 2732 2406 gene locus_tag LOCUS_38290 2732 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence489 1055 630 gene locus_tag LOCUS_38300 1055 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1177 2658 gene locus_tag LOCUS_38310 1177 2658 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence490 2587 1031 gene locus_tag LOCUS_38320 2587 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence491 2291 1725 gene locus_tag LOCUS_38330 2291 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_38330 >Feature sequence492 1498 104 gene locus_tag LOCUS_38340 1498 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1979 2704 gene locus_tag LOCUS_38350 1979 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_38350 >Feature sequence493 <1 887 gene locus_tag LOCUS_38360 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114948.1:oxidoreductase >Feature sequence494 285 85 gene locus_tag LOCUS_38370 285 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 1190 363 gene locus_tag LOCUS_38380 1190 363 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_38380 2104 2679 gene locus_tag LOCUS_38390 2104 2679 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence495 419 1999 gene locus_tag LOCUS_38400 419 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 2519 2394 gene locus_tag LOCUS_38410 2519 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 >Feature sequence496 2464 2111 gene locus_tag LOCUS_38420 2464 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence497 821 150 gene locus_tag LOCUS_38430 821 150 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_38430 1838 831 gene locus_tag LOCUS_38440 1838 831 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_38440 >Feature sequence498 837 2051 gene locus_tag LOCUS_38450 837 2051 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_38450 2249 2827 gene locus_tag LOCUS_38460 gene bplG 2249 2827 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 protein_id gnl|my_center|LOCUS_38460 >Feature sequence499 1093 455 gene locus_tag LOCUS_38470 1093 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence500 910 2496 gene locus_tag LOCUS_38480 910 2496 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence501 <2779 2233 gene locus_tag LOCUS_38490 <2779 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387456.1:lipoprotein >Feature sequence502 <1 1724 gene locus_tag LOCUS_38500 <1 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:membrane protein <2747 1779 gene locus_tag LOCUS_38510 <2747 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963904.1:glycosyl transferase family 1 >Feature sequence503 1532 333 gene locus_tag LOCUS_38520 1532 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_38520 2548 1553 gene locus_tag LOCUS_38530 2548 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 >Feature sequence504 2170 779 gene locus_tag LOCUS_38540 2170 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence505 915 1979 gene locus_tag LOCUS_38550 915 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 2068 2442 gene locus_tag LOCUS_38560 2068 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence506 >Feature sequence507 1024 1839 gene locus_tag LOCUS_38570 gene panB 1024 1839 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_38570 >Feature sequence508 321 1967 gene locus_tag LOCUS_38580 321 1967 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763451.1 protein_id gnl|my_center|LOCUS_38580 <2692 2149 gene locus_tag LOCUS_38590 <2692 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNZ8:glutamine synthetase >Feature sequence509 <1 929 gene locus_tag LOCUS_38600 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56307:beta-galactosidase 2073 907 gene locus_tag LOCUS_38610 2073 907 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence510 780 340 gene locus_tag LOCUS_38620 780 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 1180 2169 gene locus_tag LOCUS_38630 1180 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence511 >Feature sequence512 >Feature sequence513 861 175 gene locus_tag LOCUS_38640 861 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence514 422 2401 gene locus_tag LOCUS_38650 422 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 >Feature sequence515 2488 38 gene locus_tag LOCUS_38660 2488 38 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_38660 >Feature sequence516 972 103 gene locus_tag LOCUS_38670 972 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_38670 >Feature sequence517 1430 1305 gene locus_tag LOCUS_38680 1430 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 <2571 1434 gene locus_tag LOCUS_38690 <2571 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108693.1:beta-hexosaminidase >Feature sequence518 942 181 gene locus_tag LOCUS_38700 942 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 1377 2153 gene locus_tag LOCUS_38710 gene pcbD 1377 2153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_38710 >Feature sequence519 665 1069 gene locus_tag LOCUS_38720 665 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence520 1949 183 gene locus_tag LOCUS_38730 gene fhs 1949 183 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJE1 protein_id gnl|my_center|LOCUS_38730 >Feature sequence521 899 447 gene locus_tag LOCUS_38740 gene vapC 899 447 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_38740 1180 899 gene locus_tag LOCUS_38750 1180 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 1864 1400 gene locus_tag LOCUS_38760 gene vapC 1864 1400 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHV3 protein_id gnl|my_center|LOCUS_38760 2151 1870 gene locus_tag LOCUS_38770 2151 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence522 694 1077 gene locus_tag LOCUS_38780 694 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 1108 1866 gene locus_tag LOCUS_38790 1108 1866 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_38790 <2509 1850 gene locus_tag LOCUS_38800 <2509 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I109:pseudouridine-5'-phosphate glycosidase >Feature sequence523 >Feature sequence524 488 1324 gene locus_tag LOCUS_38810 488 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 >Feature sequence525 1711 272 gene locus_tag LOCUS_38820 1711 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 >Feature sequence526 <1 1221 gene locus_tag LOCUS_38830 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599478.1:di- and tricarboxylate transporter 1231 1398 gene locus_tag LOCUS_38840 1231 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence527 480 2237 gene locus_tag LOCUS_38850 480 2237 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence528 995 402 gene locus_tag LOCUS_38860 995 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 1284 1976 gene locus_tag LOCUS_38870 1284 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence529 >Feature sequence530 400 2031 gene locus_tag LOCUS_38880 400 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 protein_id gnl|my_center|LOCUS_38880 >Feature sequence531 500 1075 gene locus_tag LOCUS_38890 500 1075 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_38890 1245 2210 gene locus_tag LOCUS_38900 1245 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence532 692 1195 gene locus_tag LOCUS_38910 692 1195 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_38910 1205 2332 gene locus_tag LOCUS_38920 gene porR 1205 2332 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_38920 >Feature sequence533 67 1266 gene locus_tag LOCUS_38930 67 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 1398 2078 gene locus_tag LOCUS_38940 1398 2078 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence534 2152 947 gene locus_tag LOCUS_38950 2152 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 >Feature sequence535 <1 956 gene locus_tag LOCUS_38960 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963986.1:TonB-dependent receptor 1777 1031 gene locus_tag LOCUS_38970 1777 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 <2320 1723 gene locus_tag LOCUS_38980 <2320 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XV8:demethylmenaquinone methyltransferase >Feature sequence536 592 1290 gene locus_tag LOCUS_38990 gene atoD 592 1290 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_38990 1382 2035 gene locus_tag LOCUS_39000 gene atoA 1382 2035 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence537 217 870 gene locus_tag LOCUS_39010 gene trpF 217 870 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z4 protein_id gnl|my_center|LOCUS_39010 1075 2049 gene locus_tag LOCUS_39020 1075 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence538 1228 170 gene locus_tag LOCUS_39030 1228 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 <2294 1241 gene locus_tag LOCUS_39040 <2294 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000030106.1:molecular chaperone DnaK >Feature sequence539 >Feature sequence540 3 926 gene locus_tag LOCUS_39050 3 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 1449 952 gene locus_tag LOCUS_39060 1449 952 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_39060 >Feature sequence541 <1 999 gene locus_tag LOCUS_39070 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF6:ribosomal protein S12 methylthiotransferase RimO >Feature sequence542 <1 705 gene locus_tag LOCUS_39080 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964029.1:amino acid dehydrogenase >Feature sequence543 475 233 gene locus_tag LOCUS_39090 475 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2033 1218 gene locus_tag LOCUS_39100 2033 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_39100 >Feature sequence544 <2242 312 gene locus_tag LOCUS_39110 <2242 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94388:cephalosporin-C deacetylase >Feature sequence545 405 1568 gene locus_tag LOCUS_39120 405 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence546 2003 330 gene locus_tag LOCUS_39130 2003 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence547 320 63 gene locus_tag LOCUS_39140 320 63 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_39140 712 263 gene locus_tag LOCUS_39150 712 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence548 1293 688 gene locus_tag LOCUS_39160 1293 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence549 >Feature sequence550 1648 1343 gene locus_tag LOCUS_39170 1648 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence551 1648 773 gene locus_tag LOCUS_39180 1648 773 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082850.1 protein_id gnl|my_center|LOCUS_39180 1920 1645 gene locus_tag LOCUS_39190 1920 1645 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_39190 >Feature sequence552 <1 1108 gene locus_tag LOCUS_39200 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870127.1:RND transporter >Feature sequence553 >Feature sequence554 >Feature sequence555 1897 1172 gene locus_tag LOCUS_39210 1897 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence556 1622 117 gene locus_tag LOCUS_39220 1622 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 >Feature sequence557 >Feature sequence558 <1937 816 gene locus_tag LOCUS_39230 <1937 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889560.1:methylamine utilization protein >Feature sequence559 613 1098 gene locus_tag LOCUS_39240 613 1098 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267269.1 protein_id gnl|my_center|LOCUS_39240 >Feature sequence560 >Feature sequence561 <1 1558 gene locus_tag LOCUS_39250 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038421.1:gamma-glutamyltranspeptidase >Feature sequence562 711 1172 gene locus_tag LOCUS_39260 711 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1788 1201 gene locus_tag LOCUS_39270 1788 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence563 472 11 gene locus_tag LOCUS_39280 472 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 1341 586 gene locus_tag LOCUS_39290 1341 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 >Feature sequence564 1601 171 gene locus_tag LOCUS_39300 1601 171 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_39300 >Feature sequence565 217 1500 gene locus_tag LOCUS_39310 217 1500 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence566 >Feature sequence567 <1 1151 gene locus_tag LOCUS_39320 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039289.1:dipeptidase 1151 1684 gene locus_tag LOCUS_39330 1151 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence568 <1 761 gene locus_tag LOCUS_39340 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766463.1:flagellar motor protein MotA 826 1314 gene locus_tag LOCUS_39350 826 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence569 >Feature sequence570 >Feature sequence571 >Feature sequence572 1674 835 gene locus_tag LOCUS_39360 1674 835 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence573 1339 395 gene locus_tag LOCUS_39370 gene trxB1 1339 395 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence574 197 1546 gene locus_tag LOCUS_39380 197 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence575 >Feature sequence576 252 1022 gene locus_tag LOCUS_39390 252 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 <1667 1075 gene locus_tag LOCUS_39400 <1667 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962348.1:T9SS C-terminal target domain-containing protein >Feature sequence577 >Feature sequence578 1639 476 gene locus_tag LOCUS_39410 gene mauG 1639 476 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_39410 >Feature sequence579 480 1283 gene locus_tag LOCUS_39420 480 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence580 1448 903 gene locus_tag LOCUS_39430 1448 903 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_39430 >Feature sequence581 <1 1312 gene locus_tag LOCUS_39440 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964459.1:TonB-dependent receptor >Feature sequence582 >Feature sequence583 >Feature sequence584 889 77 gene locus_tag LOCUS_39450 gene pyrF 889 77 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_39450 1158 895 gene locus_tag LOCUS_39460 1158 895 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence585 279 863 gene locus_tag LOCUS_39470 279 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 1301 858 gene locus_tag LOCUS_39480 1301 858 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_39480 >Feature sequence586 >Feature sequence587 >Feature sequence588 <1 774 gene locus_tag LOCUS_39490 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7U2:mannonate dehydratase >Feature sequence589 >Feature sequence590 <1 809 gene locus_tag LOCUS_39500 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940434.1:UDP-N-acetyl-D-galactosamine dehydrogenase 821 1360 gene locus_tag LOCUS_39510 821 1360 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202523.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence591 569 1333 gene locus_tag LOCUS_39520 gene algR 569 1333 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_39520 >Feature sequence592 >Feature sequence593 515 799 gene locus_tag LOCUS_39530 515 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence594 305 1453 gene locus_tag LOCUS_39540 gene lldD 305 1453 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_39540 >Feature sequence595 >Feature sequence596 <1 1370 gene locus_tag LOCUS_39550 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016159.1:ATPase >Feature sequence597 >Feature sequence598 <1 1096 gene locus_tag LOCUS_39560 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964503.1:ABC transporter permease >Feature sequence599 878 114 gene locus_tag LOCUS_39570 878 114 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_39570 <1448 882 gene locus_tag LOCUS_39580 <1448 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963506.1:ABC transporter permease >Feature sequence600 607 374 gene locus_tag LOCUS_39590 607 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 <1423 755 gene locus_tag LOCUS_39600 <1423 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TY9:uronate isomerase >Feature sequence601 >Feature sequence602 >Feature sequence603 1110 517 gene locus_tag LOCUS_39610 1110 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence604 >Feature sequence605 897 676 gene locus_tag LOCUS_39620 897 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 >Feature sequence606 1088 429 gene locus_tag LOCUS_39630 1088 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence607 672 52 gene locus_tag LOCUS_39640 672 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 1221 673 gene locus_tag LOCUS_39650 1221 673 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence608 480 941 gene locus_tag LOCUS_39660 480 941 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence609 >Feature sequence610 163 540 gene locus_tag LOCUS_39670 163 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence611 >Feature sequence612 >Feature sequence613 <1 925 gene locus_tag LOCUS_39680 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence614 >Feature sequence615 >Feature sequence616 994 245 gene locus_tag LOCUS_39690 994 245 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_39690 >Feature sequence617 >Feature sequence618 >Feature sequence619 >Feature sequence620 502 245 gene locus_tag LOCUS_39700 502 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39700 1057 503 gene locus_tag LOCUS_39710 1057 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39710 >Feature sequence621 >Feature sequence622 >Feature sequence623 <1 909 gene locus_tag LOCUS_39720 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108517.1:hybrid sensor histidine kinase/response regulator >Feature sequence624 205 77 gene locus_tag LOCUS_39730 205 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730